International Buffalo Information Center BUFFALO BULLETIN

ISSN : 0125-6726
(IBIC)

Aims Buffalo Bulletin is published quarterly in March,

IBIC is a specialized information center on
water buffalo. Established in 1981 by Kasetsart
University (Thailand) with an initial financial
support from the International Development
Research Center (IDRC) of Canada. IBIC aims at
being the buffalo information center of buffalo
research community through out the world.
June, September and December. Contributions on
any aspect of research or development, progress
reports of projects and news on buffalo will be
considered for publication in the bulletin. Manu-
scripts must be written in English and follow the
instruction for authors which describe at inside of
the back cover.

Main Objectives Editor

1. To be world source on buffalo
information
2. To provide literature search and
photocopy services
3. To disseminate information in
newsletter
4. To publish occasional publications
such as an inventory of ongoing
research projects
S. Sophon
Publisher
International Buffalo Information Centre,
Main Library, Kasetsart University
Online availible:
http://ibic.lib.ku.ac.th/e-Bulletin

BUFFALO BULLEITN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688

INDUCTION OF ESTRUS IN TRUE ANESTRUS BUFFALOES USING CRESTAR IMPLANTS
ALONE AND IN COMBINATION WITH PMSG
Vivek Nayak, R.G. Agrawal, O.P. Srivastav and M.S. Thakur
ABSTRACT
This study was conducted on 32 true
anestrus buffaloes to see the efficacy of Crestar
implants alone and in combination with PMSG to
induce estrus and fertility. The animals were
randomly divided into four groups with eight animals
in each. Group 1 was implanted with Crestar for 9
days whereas Groups 2 and 3 for 7 days with 2 ml
injection of Crestar solution on the day of
implantation. PMSG 500 IU was also injected in
Group 3 on the day of implant removal. Group 4
served as an untreated control. On removal of
implant, all the buffaloes of Group 3 exhibited estrus
with the mean duration of 2.75 ± 0.24 days with
highest (75 %) conception rate followed by 87.50
and 75 % estrus response within 2.62 ± 0.46 and
2.50 ± 0.73 days, with the conception rate of 71.42
and 66.67 % in Groups 1 and 2, respectively. None
of the animals of Group 4 showed estrus. Most of
the buffaloes of Groups 1, 2 and 3 expressed intense
and intermediate estrus (50 vs. 33.33, 57.10 vs. 28.60
and 37.50 vs. 37.50 %) with conception rates of
100 vs. 50, 75 vs. 50 and 100 vs. 66.66 %,
respectively. Most of the animals of Groups 1, 2
and 3 showed good and satisfactory arborization
patterns (50 vs. 33.33, 42.86 vs. 42.86, and 50 vs.
37.50 %) with conception rates of 100 vs. 50, 100
vs. 66.67 and 75 vs. 100 %, respectively. None of
the animals missing arborization pattern conceived.
It was concluded that better conception rates can
be obtained when animals are bred during intense
(standing) estrus with good to satisfactory
arborization patterns of cervico- vaginal mucus.
Department of Animal Reproduction, Gynaecology and Obstetrics, College of Veterinary Science & A.H.,
J.N.K.V.V. Jabalpur, India
51
Buffalo Bulletin (June 2009) Vol.28 No.2
Keywords: crestar implant, PMSG, estrus induction,
fertility, arborization
INTRODUCTION
Anoestrus due to ovarian inactivity is
considered to be the most important, frustrating, and
challenging problem associated with buffalo
reproduction in India. It is the main cause of lowered
fertility in buffaloes and is responsible for
tremendous economic losses to the farmers by
decreasing milk yield and the number of calves
produced in a cow’s lifetime. True anestrus is the
condition in which both the ovaries are small, smooth,
inactive with the absence of Graffian follicle or
corpus luteum and characterized by cessation of
sexual cycle and psychic manifestation of estrus.
Higher incidence of anestrus due to inactive ovaries
in buffalo than in cow has been reported by Tanwar
et al. (2003). Various hormonal treatments like
GnRH, estrogen and progesterone either alone or in
combination have been tried with variable success
(Rao and Rao, 1984 and Singh et al., 2004). Keeping
all this in view, the present study was undertaken on
true anestrus buffaloes to see the efficacy of Crestar
implants alone and in combination with PMSG in
relation to estrus response and fertility.
MATERIALS AND METHODS
The present study was conducted on 32 true
anestrus buffaloes aged between 5 and 10 years
belonging to the Livestock Farm Adhartal and to
private dairies in Jabalpur, November 2005 to April
2006. The animals which did not express estrus for
Buffalo Bulletin (June 2009) Vol.28 No.2
4 to 8 months were examined gynaeco-clinically, and
those having inactive ovaries with no cyclic activity
were considered as “true anestrus”. These animals
were randomly distributed into four groups of eight
animals and the treatments given were as in Table1.
Estrus was detected by parading a breeding
bull followed by observing behavior symptoms and
confirmed by rectal examination of genitalia. Animal
showing estrus were allowed natural service. Estrus
intensity was recorded as intense (standing),
intermediate and weak. The arborization patterns
of cervico-vaginal mucus (CVM) were observed
under low power (10x) and classified as good,
satisfactory and unsatisfactory (missing) as per
Hafez (2000). The buffaloes of all the groups were
examined gynaeco-clinically on the 12th day post
service for the presence of corpus luteum.
Pregnancy was confirmed per-rectally 50 days after
breeding. The fertility response to the different
treatment regimens was evaluated in relation to the
intensity of estrus and the arborization pattern.
RESULTS AND DISSCUSSION
On removal of implants, all the buffaloes of
Group 3 exhibited estrus with the mean duration of
2.75 ± 0.24 days with highest (75 %) conception
rate; in Groups 1 and 2, there were 87.50 and 75 %
estrus responses within 2.62 ± 0.46 and 2.50 ± 0.73
days, and conception rates of 71.42 and 66.67 %,
respectively, wheras, none of the animals of Group
4 showed estrus. The present findings are in close
agreement with the findings of Agrawal et al. (1999),
who reported 71.42 percent estrus response in true
anestrus cows. Similarly, Chhatry (1998) observed
an 80 % estrus response within 62.8 ± 8.70 h with
70 % conception in buffaloes during the breeding
season and 60 % estrus induction with 30 %
conception during the non-breeding season by using
Norgestomet ear implants. The better estrus
induction and fertility in Group 2 than in Group 1
can be attributed to the inclusion of Crestar solution
(Norgestomet and Estradiol valerate) which initiates
better follicular growth and behavioral estrus
symptoms. The best estrus induction (100 %) with
highest (75 %) conception rate accord with the
reports of Rao et al. (1985); Kathiresan (1995);
Kundu (1998) and Patel et al. (2003) in buffaloes.
52
The better estrus response (100 %) and conception
rate (75 %) of Group 3 in comparison to the animals
of Groups 1 and 2 might be due to the combining
effect of implant removal with an intramuscular
injection of PMSG which stimulated the follicular
development and ovulation.
Most of the buffaloes of Groups 1, 2 and 3
expressed intense and intermediate estrus (50 vs.
33.33, 57.10 vs. 28.60 and 37.50 vs. 37.50 %) with
the conception rate of 100 vs. 50, 75.00 vs 50 and
100 vs. 66.66 % respectively. Weak symptoms of
estrus were observed in 16.67, 14.30 and 25 %
buffaloes of Groups 1, 2 and 3 respectively. Only
50 % animals each from Groups 2 and 3 with weak
estrus sign became pregnant and none from
Group 1.
The present findings are in agreement with
the findings of Chede (1990) who observed 38.70
and 32.25 % buffaloes in intense and intermediate
estrus, respectively by implanting norgestomet ear
implant for 9 days. As observed in the present study
37.50 vs. 37.50 % buffaloes exhibited intense and
intermediate symptoms of estrus by injecting
500 IU of PMSG on the day of implant removal
substantiate the findings of Kathiresan et al. (1995)
who also reported 28.50 and 43 % buffaloes
exhibited intense and intermediate estrus,
respectively by implanting Norgestomet ear implant
for 9 days and an injection of 500 IU of PMSG at
the time of implant removal. On the contrary to our
findings Markendeya and Bharkad (2004) observed
intermediate type of estrus in all the Deoni cow
within 3.9 days of treatment with 70 % conception
on implantation of Crestar.
Most of the animals of Groups 1, 2 and 3
showed good and satisfactory arborization patterns
(50 vs. 33.33, 42.86 vs. 42.86, and 50 vs. 37.50 %)
with conception rates of 100 vs. 50, 100 vs. 66.67
and 75 vs. 100 %, respectively. None of the animal
missing arborization patterns conceived. As observed
in the present study, other workers also observed
that the conception rate was highest with good to
satisfactory arborization pattern and nil when it was
missing (Kumar, 1989; Chhatry, 1998 and Nzar,
2004). Our findings are in accord with the reports
of Sahasrabudhe (1995), who also reported 92.31
and 75 % conception rates with good and satisfactory
arborization patterns, respectively. Similarly, Rathore
(2004) also reported 80 and 71.43 % conception with
 Buffalo Bulletin (June 2009) Vol.28 No.2

the best and average arborization patterns in
buffaloes. They further reported that when the
arborization pattern was missing, none of the animal
conceived after artificial insemination or even natural
service.
It was concluded that better conception
rates can be obtained when animals are bred during
intense (standing) estrus with good to satisfactory
arborization patterns of cervico-vaginal mucus. An
injection of 500 IU PMSG on the day of implant
removal has a positive effect on estrus induction
and fertility.

Table 1. Distribution of animals and treatment regimens.

Group 0th Day 7th PID 9th PID
1 Crestar ear implant alone - Implant removed
Crestar ear implant +
2 Implant removed -
2 ml Crestar solution I/M
Crestar ear implant + Implant removed and
3 -
2 ml Crestar solution I/M Inj. 500 IU PMSG I/M
4 Control - -

PID = Post Implant Day

1. Crestar implant (3 mg of 17 α acetoxy, 11 β methyl, 19-norpreg-4-en-2, 20 dione) Intervet International
B.V. Boxmeer, Holland.
2. Crestar solution (3 mg Norgestomet and 5 mg Oestradiol valerate) Intervet International B.V. Boxmeer,
Holland.
3. PMSG (1000 IU serum gonadotrophins) Intervet International, Holland.

Table 2. Efficacy of Crestar alone and in combination with PMSG for estrus induction and fertility.

No. of Animals Duration of Induced

No. of No. of Animals
Group responded to estrus (days)
Animals conceived (%)
treatment (%) (MEAN ± SE)
1 8 6 (75.00) 2.500 ± 0.732 4 (66.67)
2 8 7 (87.50) 2.625 ± 0.460 5 (71.42)
3 8 8 (100.00) 2.750 ± 0.249 6 (75.00)

Table 3. Estrus intensity in relation to fertility with Crestar alone and in combination with PMSG.

Animals
Animals showed Animals showed
Grou Showed CR
Intermediate CR (%) Weak estrus CR (%)
p Intense estrus (%)
estrus (%) (%)
(%)
3/3 1/2 0/1
1 3/6 (50.0) 2/6 (33.3) 1/6 (16.67)
(100.0) (50.0) (0.0)
3/4 1/2 1/1
2 4/7 (57.1) 2/7 (28.5) 1/7 (14.2)
(75.0) (50.0) (100.0)
3/3 2/3 1/2
3 3/8 (37.5) 3/8 (37.5) 2/8 (25.0)
(100.0) (66.67) (50.0)

CR- Conception rate.

53
Buffalo Bulletin (June 2009) Vol.28 No.2
Table 4. Quality of arborization pattern of Cervico-Vaginal Mucus in relation to fertility at induced estrus.
Quality of Group1
arborization
pattern Buffalo (%) CR (%)
Good 50.00 100.00
Satisfactory 33.33 38.10
Missing 16.67 0.0
REFERENCES
Agrawal, S.K., U. Shankar, U. Kumar and G.
Mohan. 1999. Studies on induction of
ovarian cyclicity and progesterone profile
in anoestrus cattle using a systemic
progesterone regimen-Crestar. XVth ISSAR
Convention Com-pendium, 21-22.
Chede, S.A. 1990. Pattern of estrus, estrus
behavior and synchronization in buffaloes.
Ph. D. Thesis, Punjabrao Krishi Vidyapeeth,
Akola.
Chhatry, U. 1998. Efficacy of synchronization of
estrus in true anestrus buffalo during
breeding and low breeding season using
norgestomet implant. M.V. Sc. Thesis,
JNKVV, Jabalpur.
Hafez, E.S.E. 2000. Reproduction in Farm
Animals, 7 th ed. Lippincott Williams and
Wilking Co., Philadelphia.
Kathiresan, D., D. Ezekial Napolean, J. Antonie, L.
Dowson and S.R. Pattabiraman. 1995.
Influence of ovarian status and lactational
stress on the effect of norgestomet, treatment
of buffaloes. The Blue Cross Book, 4: 25.
Kumar, S. 1989. Conception rate in relation to estrus
cervical mucus crystallization fern pattern in
buffaloes. Livestock Advisor., 14(12): 25-27.
Kundu, A.S. 1998. Management of summer
anestrus in postpartum buffaloes with
norgestomet-estradiol-eCG combination
clinical and endocrine studies. M.V. Sc.
Thesis, CCS Hariyana Agri. Uni. Hissar.
Markandeya, N.M. and G.P. Bharkad. 2004.
Controlled breeding with norgestomet ear
implant for induction of postpartum estrus in
Group2 Group3
Buffalo (%) CR (%) Buffalo (%) CR (%)
42.86 100.00 50.00 75.00
42.86 66.67 37.50 100.00
14.28 0.00 12.50 0.00
Deoni Cows. Indian J. Anim. Reprod., 25(1):
53-54.
Nzar 2004. Studies on induction of estrus in sub
estrus crossbred cows using Sodium Di-
hydrogen phosphate and PGF2 alpha. M.V.
Sc. Thesis, JNKVV, Jabalpur.
Patel, D.M., N.P. Sarvaiya, A.V. Patel and A.P.
Parmar. 2003. Induction of estrus and
hormonal profile in buffalo treated with
norgestromet ear implant. Indian J. Anim.
Reprod., 24(1): 67-68
Rao, A.R. and V.S. Rao. 1984. Improved conception
rate in buffaloes after administration of
receptal. Indian Vet. J., 61: 813.
Rao, A.V.N., O. Srimanarayana and K.P. Rao. 1985.
Estrus response and fertility in post partum
anoestrus buffaloes treated with progesterone,
pregnant mare serum gonadatrophin and
prostaglandin during the low breeding season.
Anim. Reprod. Sci., 8: 129-135.
Rathore, K.K. 2004. Studies on treatment of
anestrus in Murrah buffaloes. M.V. Sc.
Thesis, JNKVV, Jabalpur.
Sahasrabudhe, S.A. 1995. Fertility respone in sub
estrus buffaloes treated with prostaglandin
F2 alpha through different routes during
summer. M.V. Sc Thesis, JNKVV, Jabalpur.
Singh, A., M.S. Saxena and S. Prasad. 2004.
Efficacy of Crestar and its combination with
folligon on postpartum anestrus buffaloes.
IJAR., 25(1): 43-49.
Tanwar, P.S., N.K. Rakha and J.B. Phogat. 2003.
Challenges in buffalo infertility. Intas Polivet.,
4(11): 121-127.
54
 Buffalo Bulletin (June 2009) Vol.28 No.2

RE-UTILIZATION OF CRESTAR IMPLANTS FOR INDUCTION OF FERTILE ESTRUS IN

TRUE ANESTRUS BUFFALOES

Vivek Nayak , R.G. Agrawal, O.P. Srivastav and I.J. Sharma

ABSTRACT Keywords: crestar re-utilization, estrus induction,

fertility, arborization, buffalo
The efficacy and economy of re-utilization
of Crestar implant alone and in combination with
PMSG for induction of fertile estrus in 24 true
INTRODUCTION
anoestrus buffaloes was investigated. The animals
were randomly divided equally in three groups. The
Anoestrus due to ovarian inactivity is the
animals of Groups 1 and 2 were injected with
most important, frustrating, and challenging problem
500 mg progesterone intramuscularly followed by
associated with buffalo reproduction. Higher
implantation of used Crestar (already implanted in
incidences of anestrus due to inactive ovaries in
the other animals for 7 days) on day 4 and removed
buffalo than in cow have been reported by Tanwar
on day 9 of treatment and Group 2 was injected
et al. (2003). In non-cycling true anoestrus animals,
with 500 IU PMSG on the day of implant removal.
the primary effect of Norgestomet is enhanced by
Group 3 served as untreated control. On removal of
combining the effect of the implant removal and an
the implant, 62.50 % buffaloes each from Groups 1
injection of small dose of PMSG to stimulate follicular
and 2 expressed estrus within the mean distribution
development. Several reports are available regarding
of 2.50 + 0.80 and 2.37 + 0.73 days, respectively.
estrus induction using different combinations of
Sixty percent animals each from Groups 1 and 2
hormones and norgestomet ear implant. Crestar is
conceived. No extra beneficial effect of PMSG was
a white silicon polymer containing 3 mg norgestomet
observed either on estrus response or conception
and 5 mg estradiol valerate. Kundu (1998) utilized
rate. None of the animals from Group 3 (control)
1 1/2 and 2 implants for induction of estrus. However,
showed estrus. Only 20 and 40 percent animals of
no report is available on reutilization of Crestar
Group 1 and 40 and 20 percent of Group 2 expressed
implants for estrus induction. Keeping this in view,
intense and intermediate estrus, with 100 percent
the effort was made to induce fertile estrus in true
conception. From these groups, 40 percent of the
anoestrus buffaloes by re-utilization of Crestar
animals expressed weak symptoms of estrus and
implants alone and in combination with PMSG.
failed to conceive. Sixty percent of the animals from
both the groups had satisfactory arborization patterns
with 66.67 percent conception. However, only 20
percent of the animals in both the groups showed
MATERIALS AND METHODS
good arborization patterns of cervico- vaginal mucus
with 100 percent conception. None of the animals The experimental study was undertaken in
conceived expressing weak symptoms of estrus and 24 anestrus buffalo, aged 9 years, maintained under
missing arborization pattern. It was concluded that iso-managerial conditions. True anoestrus was
utilized Crestar implant (for 7 days) can also be re- diagnosed in the animals on the basis of anamnesis
utilized to reduce the cost of treatment for induction twice in gynaeco-clinically examinations at 10 days
of fertile estrus even with out PMSG. intervals finding smooth inactive ovaries, flaccid

Department of Animal Reproduction, Gynaecology and Obstetrics, College of Veterinary Science & A.H.,
J.N.K.V.V., Jabalpur, India

55
Buffalo Bulletin (June 2009) Vol.28 No.2
uterine horns, and non-relaxed (closed) cervix. The
animals were randomly distributed into three groups
of eight animals and were subjected to the treatment
regimens given in Table 1.
The estrus was detected by parading a
breeding bull followed by observing behavioral
symptoms and confirmed by rectal examination of
genitalia. Buffalo exhibited in estrus were allowed
for natural service. The estrus intensity was recorded
after on spot observation as intense (standing),
intermediate and weak. The arborization pattern
was seen under low power (10x) and classified as
good, satisfactory and unsatisfactory (missing) after
Hafez (2000). All the buffaloes of the treatment
groups were examined gynaeco-clinically on the 12th
day post service for presence of the corpus luteum.
Pregnancy was confirmed per-rectally 50 days after
breeding. The fertility response of different treatment
regimen was evaluated in relation to intensity of
estrus and arborization pattern. An application for
an ear implant was also developed (costing approx.
Rs.35) which is equally effective as that supplied
by Intervet, International B.V. Boxmeer, Holland
(costing approx. Rs. 2500).
RESULTS AND DISCUSSION
The results of re-utilized Crestar implant
alone and in combination with PMSG for induction
of estrus and fertility in relation to estrus intensity
and arborization pattern are presented in Tables 2, 3
and 4. On removal of implant, 62.50 % buffaloes
each from Group 1 and 2 expressed estrus with in
the mean distribution of 2.50 + 0.80 and 2.37 + 0.73
days, respectively. Sixty percent of the animals each
from Groups 1 and 2 conceived. No extra beneficial
effect of PMSG was observed either on estrus
response or conception rate. None of the animal
from Group 3 (control) showed estrus. The present
observations support the findings of Macmillan et
al. (1989), who also reported that the occurrence
of estrus was more frequent when the device was
inserted only for four days irrespective of PMSG
treatment. However, Rao (1984) observed better
estrus response (96.67 percent) by injecting 25 mg
progesterone daily for 7 days followed by 1000 IU
56
of PMSG on the last day of progesterone treatment
in buffaloes. Whereas, Kumar et al. (2000) induced
pronounced estrus only in 25 % of crossbred cows
within 2.5 ± 0.5 days with 100 % conception by
injecting 50 mg of progesterone daily for 5 days
followed by an intramuscular injection of Estradiol
valerate 5 mg on the 7th day of treatment.
Only 20 and 40 % animals of Group 1 and
40 and 20 % of Group 2 expressed intense and
intermediate estrus, respectively, with 100 %
conception. From the above groups, 40 % of the
animals expressed weak symptoms and failed to
conceive. The poor response for intense and
intermediate estrus of the animals of both the group
can be attributed to the intramuscular injection of
progesterone, which causes its slow decline because
rapid decline of progesterone and increase in the
estrogen level is required for the manifestation of
behavioral symptoms of estrus (Hafez,1993). Higher
percentages of weak symptoms of estrus in the
animals of both the group in the present study also
supports the above views. However, the fact that a
larger proportion (40 %) of animals of Group 2
expressed intense estrus (40 %) in comparison to
animals of Group 1 (20 %) can be attributed to the
effect of PMSG.
Sixty percent of the animals from both groups
had satisfactory arborization patterns with 66.67
percent conception. However, only 20 % of the
animals from both groups showed good arborization
pattern of cervico-vaginal mucus with 100 %
conception. None of the animals expressing weak
symptoms of estrus and missing arborization pattern
conceived. As observed in the present study, various
other workers also observed that the conception rate
was highest with good to satisfactory arborization
pattern and nil when it was missing (Kumar, 1989;
Chhatry, 1998 and Nzar, 2004).
Our findings are supported by the reports of
Sahasrabudhe (1995), who also reported 92.31 and
75 % conception rate with good and satisfactory
arborization patterns, respectively. Similarly, Rathore
(2004) also reported 80 and 71.43 % conception with
the best and average the arborization pattern in
buffaloes. They further reported that when the
arborization pattern was missing, none of the animals
conceived after artificial insemination or even natural
service.
 Buffalo Bulletin (June 2009) Vol.28 No.2

An applicator for ear implant was also It was concluded that utilized Crestar implants (for
developed (costing approx. Rs. 35) which is equally 7 days) can also be re-utilized to reduce the cost of
effective as that supplied by Intervet, International treatment for induction of fertile estrus even without
B.V. Boxmeer, Holland (costing approx Rs.2500). PMSG in true anoestrus buffaloes.

Table 1. Experimental plan and Treatment schedule.

Animals
Group 0th Day 4th Day 9th Day
used
Utilized Crestar
1 8 Progesterone 500mg I/M Implant removed
implanted
Utilized Crestar Implant removed and
2 8 Progesterone 500mg I/M
implanted PMSG 500 IU I/M
3 8 Controls - -

Table 2. Post treatment response of anoestrus buffaloes.

No. of Animals Mean induction of

No. of No. of Animals
Group respond to estrus in days
Animals conceived (%)
treatment (%) (MEAN ± SE)
1 8 5 (62.50) 2.50 ± 0.80 3(60.00)
2 8 5 (62.50) 2.37 ± 0.73 3(60.00)

Table 3. Post treatment response of estrus intensity in relation to fertility.

Intense Weak
Group CR (%) Intermediate (%) CR (%) CR (%)
(%) (%)
1 1 2 2 2 0
1
(20.0) (100.0) (40.0) (100.0) (40.0) (0.0)
2 2 1 1 2 0
2
(40.0) (100.0) (20.0) (100.0) (40.0) (0.0)

Table 4. Group wise conception rate according to the quality of arborization pattern of cervico-vaginal
mucus.

Quality of Group 1 Group 2

Arborization
Pattern
Buffalo (%) CR (%) Buffalo (%) CR (%)
Good 20.00 100.00 20.00 100.00
Satisfactory 60.00 66.67 60.00 66.67
Missing 20.00 0.00 20.00 0.00

57
Buffalo Bulletin (June 2009) Vol.28 No.2
REFERENCES
Chhatry, U. 1998. Efficacy of synchronization of
estrus in true anoestrus buffalo during
breeding and low breeding season using
norgestomet implant. M.V. Sc. Thesis,
JNKVV, Jabalpur.
Hafez, E.S.E. 1993. Reproduction in Farm
Animals, 6th ed. Lea and Febiger, Philadelphia.
Hafez, E.S.E. 2000. Reproduction in Farm
Animals, 7th ed. Publ., Lippincott Williams and
Wilking Co., Philadelphia.
Kumar, N., S. Mahmood, L.P. Singh and L.N.
Purbey. 2000. Induction of estrus and ovulation
in post partum anesturs crossbred cows with
short term treatment. Indian J. Anim.
Reprod., 21: 53-54.
Kumar, S. 1989. Conception rate in relation to estrus
cervical mucus crystallization fern pattern in
buffaloes. Livestock Advisor., 14(12): 25-27.
Kundu, A.S. 1998. Management of summer
anestrus in postpartum buffaloes with
norgestomet-estradiol-eCG combination
58
clincial and endocrine studies. M.V. Sc.
Thesis, CCS Hariyana Agri. Uni. Hissar.
Macmillan, K.L., A.M. Day and V.K. Toufa. 1989.
Problem of non cycling cows. Proc. Prakura
Farmers. Conf., 41: 15-18.
Nzar. 2004. Studies on induction of estrus in
suboestrus crossbred cows using sodium di-
hydrogen phosphate and PGF2 alpha. M.V.
Sc. Thesis, JNKVV, Jabalpur.
Rao, S.K. 1984. A study on treatment of anoestrus
in buffaloes with certain hormones. M.V.
Sc. Thesis, Andhra Pradesh Agriculture
University, Tirupati.
Rathore, K.K. 2004. Studies on treatment of
anoestrus in Murrah Buffaloes. M.V. Sc.
Thesis, JNKVV, Jabalpur.
Sahasrabudhe, S.A. 1995. Fertility respone in
suboestrus buffaloes treated with
prostaglandin F 2 alpha through different
routes during summer. M.V. Sc. Thesis,
JNKVV, Jabalpur.
Tanwar, P.S., N.K. Rakha and J.B. Phogat. 2003.
Challenges in buffalo infertility. Intas Polivet.,
4(11): 121-127.

DYSTOCIA DUE TO FETAL MALDISPOSITION IN A BUFFALO
G.K. Das, Ravi Dutt, Ravinder Kumar, S. Deori and Uma Shanker
ABSTRACT
This communication reports a case of
dystocia in a pluriparous buffalo due to fetal
maldisposition. The maldisposition was caused by
severe left lateral deviation of head and neck of the
fetus. It was successfully handled without any post
operative complications.
Keywords: fetal maldisposition, dystocia, buffalo
INTRODUCTION
Deviations of the head and neck are
common type of abnormal posture in anterior
presentation causing dystocia in all species (Roberts,
1971). The deviation may be in any direction. Lateral
deviation of the head is seen most often in unipara
and the prognosis is serious when the fetus is dead
and the deviations are due to muscle contractures
(Sane et al., 1994). In a study, Srinivas et al. (2007)
reported that 40.84 percent of dystocia in graded
Murrah buffalo is due to fetal cause, among which
head deviations were of 42.22 percent. Present
communication reports a case of dystocia in a buffalo
due to severe lateral deviation of the head and neck
and its successful management.
HISTORY AND OBSERVATIONS
A pluriparous buffalo was presented in the
Veterinary Polyclinic of the institute with a history
of labour pain for about the previous 17 h. It was
reported that the animal had completed the normal
gestation period and was attended by a local
Animal Reproduction Division, Indian Veterinary Research Institute, Izatnagar, Bareilly-243122, India
59
Buffalo Bulletin (June 2009) Vol.28 No.2
veterinarian. The buffalo had calved twice earlier
without any complications. On general examination,
the animal appeared alert and active with normal
rectal temperature, pulse and respiration. The fore
limbs of the calf were presented in the birth canal
and the hooves were slightly protruding from the
vulva. Per-vaginal examination revealed a fetus was
presented in normal anterior presentation with dorso-
sacral position and a convex mass which appeared
to be bent neck was presented in the pelvic inlet.
The head was totally unapproachable per-vaginum.
A slight repulsion revealed a severely deviated head
and neck in the left lateral side. The fetus was
diagnosed to be dead. The case was diagnosed as
fetal dystocia due to severe left lateral deviation of
head and neck on the basis of the per vaginal
examination.
RESULTS AND DISCUSSION
Under epidural anesthesia using 2 percent
lignocaine hydrochloride, both the forelimbs were
repelled back into the uterus. After properly
lubricating the birth canal with obstetrical gel, the
muzzle of the calf was firmly grasped and brought
round through an arc until the nose came in line with
the birth canal. Then both the forelimbs were
extended towards the vulva. With traction on the
fetal head and the limbs simultaneously in a ventral
direction, a dead male fetus was delivered (Figure).
Following delivery the animal was treated with
enrofloxacin inj (15 ml IM x 5 days), normal saline
(2 liters, IV), calcium borogluconate (450 ml, IV),
and meloxicam inj (15 ml, IM) and uterotone (a herbal
uterotonic) was prescribed (150 ml for 3 days orally).
The animal was discharged from the polyclinic one
hour after the treatment.
Buffalo Bulletin (June 2009) Vol.28 No.2
REFERENCES
Roberts, S.J. 1971. Veterinary Obstetrics and
Genital Diseases. 2nd ed. CBS Publishers and
Distributors.
Sane, C.R., B.R. Despande, A.S. Kaikini,
D.P.Velhankar, S.B. Kodagali, S.N. Luktuke,
V.B. Hukeri and V.L. Deopurkar. 1994. In: A
Figure. Dead fetus delivered after correction of dystocia.
60
Textbook of Reproduction in Farm Animals.
2nd ed. Varghese Publishing House
Srinivas, M., M. Sreenu, N, Laskshmi Rani, K.
Subramanyam Naidu, and V. Devi Prasad.
2007. Studies on dystocia in graded Murrah
buffaloes: a retrospective study. Buffalo
Bulletin, 26(2): 40-45.

EFFECT OF PIROXICAM ON THE CELLULAR RESPONSE
IN BUFFALO CALF SKIN
Neelu Gupta1, A.K. Katiyar2 and Madhu Swamy2
ABSTRACT
The present work was conducted in
apparently healthy buffalo calves 3-6 months in age.
Calves were pretreated with piroxicam
intramuscularly 30 minutes prior to intradermal
injection of Steph. epidermidis suspension and
turpentine. Lesions of different time intervals were
obtained for the sequential study of cellular
responses. Maximal suppression of leukocytes
occurred at 3 h in both types of inflammation. In all
the cases, neutrophils were more extensively
suppressed as compared to other cells.
Keywords: Staphylococcus epidermidis,
turpentine, piroxicam, neutrophils, monocytes,
lymphocytes, basophils
INTRODUCTION
Specific antagonistic drugs have been used
earlier in buffalo calves (Gupta et.al., 2007, 2008a,
2008b) to study the chemical mediation of acute
inflammation in this species. Piroxicam is a cyclo-
oxygenase inhibitor and specifically blocks the
synthesis of prostaglandins. However, to our
knowledge, no such studies have been conducted in
buffaloes. Thus, in the present study, the possible
suppression of the cellular response in the
inflammation induced by turpentine and Staph.
epidermidis was studied in the buffalo calves
pretreated with piroxicam.
1
Department of Veterinary Public Health, College of Veterinary Science & A.H. Anjora, Durg, (Chhattisgarh)
India, E-mail: gupta.neelu8@gmail.com
2
Department of Pathology, College of Veterinary Science and A.H. JABALPUR (M.P.) India
61
Buffalo Bulletin (June 2009) Vol.28 No.2
MATERIALS AND METHODS
Twelve healthy male buffalo calves, aged 3
to 6 months, were divided into two groups: control
and experimental, for the study of cellular response
in the buffalo calf skin. The calves were maintained
under hygienic conditions and fed standard feed.
Substances-Normal saline: (Wockhardt
Ltd. Aurangabad ) 0.9 % w/v, sterile pyrogen free,
isotonic solution was used for the preparation of the
bacterial suspension.
Staphylococcus epidermidis: (MTCC-35)
the culture was obtained from the Institute of
Microbial Technology, Chandigarh. A bacterial
suspension was prepared, and 0.1 ml was injected
intradermaley at each site. The concentration of the
bacteria per ml of the suspension was determines
as 2.3 x 103 million.
Turpentine- (SAM KAM, INDORE) the
commercially available turpentine was used
intradermally for the induction of inflammation. At
each site 0.05 ml turpentine was injected.
Piroxicam- (Pfizer Limited Batch No.020-
04065 Mumbai) of 20 mg /ml strength was used as
a prostaglandin antagonist.
Preparation of skin- The site of the
cutaneous reaction was prepared according to the
method described in horses (Zarrilli and Calhoun,
1970) with suitable modifications. Briefly, one day
before induction of the inflammation, hair from the
lateral thoraco-abdominal region of the buffalo
calves was removed by close shaving. The skin was
cleaned with a soft cloth moistened with the sterile
distilled water. On the following day, cleaning of the
skin was repeated.
Buffalo Bulletin (June 2009) Vol.28 No.2
Induction of inflammation- Inflammation
was induced in the buffalo calf skin as described in
the following groups.
Control Group I- Six calves of the control
group were again divided into two subgroups, i.e.,
Subgroup I A and Subgroup I B. Each subgroup had
three calves.
Subgroup IA- Each calf received two
intradermal injections of the Steph. epidermidis
(MTCC-35) suspension (0.1 ml) in the normal saline
(Wockhardt Ltd. Aurangabad) for each time interval
(0-2 minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and
48 h) at both sides of the thoraco-abdominal region.
At the appropriate time (immediately after the 0-2
time interval. The calves were euthanized with a
saturated solution of magnesium sulphate given
intravenously. The skin specimens were collected
and fixed in the Cornoy’s fluid for the histo-
pathological studies as described for the chicken by
Shrivastava et al., 1997. Sections were cut to 4-5
μm thickness.
Skin sections were stained with the
haematoxylin and eosin and with 0.05 percent
solution of the toluidine blue in acetate buffer (pH
3.8) for basophils as described for the chickens by
Dhodapkar et al. (1987).
Subgroup IB- Each calf received two i/d
injection of the turpentine (SAM KAM, INDORE)
@ dose rate of 0.05ml for each time interval (0-2
minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and
48 h). The rest of the procedure was the same as
that for Subgroup IA.
Experimental Group II- Six calves of the
experimental group were again divided into two
subgroups i.e., Subgroup II A and Subgroup II B.
Each subgroup had three calves.
Subgroup II A- Each calf was pretreated
with piroxicam (Pfizer Limited Batch No. 020-
04065, Mumbai) i/m, at the dose rate of 0.3 mg/kg
body weight 30 minutes prior to the i/d Steph.
epidermidis and this treatment was repeated every
12 h. The rest of the procedure was the same as
that for control group IA.
Subgroup II B- Each calf was pretreated
with piroxicam i/m, at the dose rate of 0.3 mg/kg
body weight 30 minutes prior to i/d injection of the
turpentine (0.05 ml), and this treatment was repeated
every 12 h. The rest of the procedure was the same
as that for control group IA.
62
RESULT AND DISCUSSION
Control Group I
Subgroup IA- The inflammatory reaction
in the calf was induced by giving intradermal
injections of Steph. epidermidis, and lesions of 0-2
minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and 48
h were collected for the histopathology. The vascular
and cellular changes were not noticeable at the initial
intervals (0-2 minutes and 30 minutes). However, a
few neutrophils were found at 0-2minutes and 30
minutes. At 6 h, hyperaemia of the blood vessels
and oedema of the dermis were well marked. From
30 minutes onwards, leukocytes infiltration had
significantly increased, and the maximal number of
leukocytes were observed at 12 h. The maximum
numbers of neutrophils, monocytes, lymphocytes and
basophils were recorded at 6, 12, 24 and 1 h,
respectively. Infiltration of eosionophils was not
noticed at any time interval (Table 1)
Subgroup IB- The inflammatory reaction
in the calf was induced by giving intradermal
inoculations of turpentine (0.5 ml), and lesions of
different time intervals were collected for
histopathology. The vascular and cellular changes
were noticed from 30 minutes onward to 48 h. A
few leukocytes were seen adhering to endothelium.
From 30 minutes onwards cellular infiltration had
significantly increased, and the maximal number of
leukocytes was observed at 12 h. The number of
neutrophils increased gradually up to 6 h, after which
the number gradually decreased, but there were
more than in the initial stages. The maximal number
of neutrophils was observed at 6 h. The number of
monocytes increased gradually up to 12 h, after
which it decreased. Marked infiltration of monocytes
were observed at 12 h. From 1 h onwards infiltration
of lymphocytes increased, and the maximal number
of lymphocytes was recorded at 48 h. Toluidine blue
sections showed infiltration of basophils. Infiltration
of basophils were observed from 30 minutes and
gradually increased up to 3 h. Infiltration of
eosionophils was not noticed at any time interval
(Table 2).
Experimental group II-
Subgroup II A- Calves were pretreated
with Piroxicam intramuscularly 30 minutes prior to
intradermal injection of the Steph. epidermidis
suspension, and lesions of different ages were
 Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 1. Figure 2. Figure 3.

Figure 4. Figure 5. Figure 6.

Figure 7. Figure 8. Figure 9.

Figure 1. Section of buffalo calf skin 30 minutes after intradermal injection of Staph. epidermidis suspension.
Note - emigration of leukocytes. H &E x 400.
Figure 2. Section of buffalo calf skin 30 minutes after intradermal injection of turpentine. Note - emigration
of leukocytes. H &E x 400.
Figure 3. Section of buffalo calf skin 12 h after intradermal injection of Staph. epidermidis suspension.
Note- intense infiltration of leukocytes. H&E x 400.
Figure 4. Section of buffalo calf skin 12 h after intradermal injection of turpentine. Note- maximal number of
leukocytes. H&E x 400.
Figure 5. Section of piroxicam preatreated buffalo calf skin 3 h after intradermal injection of Satph. epidermidis
suspension. Note-maximal suppression of leukocytes. H&E x 400.
Figure 6. Section of piroxicam preatreated buffalo calf skin 3 h after intradermal injection of turpentine.
Note-maximal suppression of leukocytes. H&E x 400.
Figure 7. Section of buffalo calf skin 48 h after intradermal injection turpentine. Note- completely disintegrated
neutrophils. H&E x 400.
Figure 8. Section of buffalo calf skin 12 h after intradermal injection turpentine. Note- the presence of giant
cells in the interstitium. H&E x 400.
Figure 9. Section of piroxicam preatreated buffalo calf skin 12 h after intradermal injection of Turpentine.
Note- the presence of giant cells in the interstitium. H&E x 400.

63
 Table 1. Tissue leukocytosis in response to Staphylococcus epidermidis in control and piroxicam pretreated buffalo calves.

Number of leukocytes ( Means ±S.E) / High power (x 400) microscopic field

N e utro phil s Monocytes Lymphocytes Basophils Total
Time
Percent Staph. Staph. Percent Staph. Percent Staph. Percent
Interval Staph. Percent
Piroxicam Su p p re s si e p i d er- Piroxicam epider- Piroxicam Suppres epider- Piroxicam S uppres si epider- Piroxicam S u p pr e s si
e pid erm id is S uppr es s io n
on midis midis sion midis on midis on
0-2 min 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
30 min 0.433 0.433 00 00 00 00 00 00 00 1.166 1.00 14.236 1.6 1.433 10.437
Buffalo Bulletin (June 2009) Vol.28 No.2

±0.221 ±0.125 ±0.125 ±0.149 ±0.278 ±0.221

1 hr 10.600 9.00 15.09 1.533 1.466 4.370 1.100 0.800 27.272 2.633 2.166 17.736 15.966 13.300 12.689
±0.992 ±0.649 ±0.564 ±0.227 ±0.174 ±0.163 ±2.245 ±0.287 ±1.368 ±0.603

64
3 hr 30.166 20.900 33.037 3.033 2.600 14.276 1.933 1.366 29.332 2.033 1.833 9.837 37.233 26.066 29.992
±1.996 ±1.668 ±0.784 ±1.031 ±0.554 ±0.194 ±0.531 ±0.357 ±2.592 ±3.697

6 hr 59.466 52.00 12,555 15.766 10.766 16.660 10.00 8.200 18.00 1.566 1.433 8.141 85.966 73.066 14.502
±4.676 ±3.192 ±1.579 ±1.543 ±0.527 ±0.171 ±0.194 ±0.194 ±3.250 ±3.905

12 hr 50.266 45.166 10.146 27.366 25.766 5.846 14.33 12.433 13.237 0.8 0.766 4.250 92.833 83.300 10.268
±1.206 ±3.164 ±1.883 ±1.784 ±1.763 ±1.648 ±0.149 ±0.163 ±2.969 ±2.726

24 hr 10.066 9.300 7.690 5.066 4.933 2.509 18.366 18.00 1.992 00 00 00 32.400 31.600 2.469
±3.023 ±0.630 ±1.530 ±0.523 ±1.747 ±0.627 ±3.508 ±0.881

48 hr 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
 Table 2. Tissue leukocytosis in response to turpentine in control and piroxicam pretreated buffalo calves.

Number of leukocytes ( Means ±S.E) / High power (x 400) microscopic field

Time Ne u tro p hil s Mon ocy t es Lymphocytes Ba sophils To ta l
Inter- Percent Percent Percent Percent Percent
T u rp e- T u rp e - Tu r p e n t T ur pe nt - T urpe n t -
val Piroxicam supper- Piroxicam su p p r e s Piroxicam s u p p e r- Piroxicam su p p r es- Piroxicam s u p p r es -
ntine ntine -ine i ne i ne
ssion - s io n ssion sion sion
00
10.200 00 00 00 00 00 00 00
0-2 min 00 00 00 00 00 00 00
±1.206 9.20 0.433 0.400 00 00 12.5 10.1
30 min 9.088 7.621 00 1.733 1.700 1.904 19.200
24.500 ±0.194 0.149
±1.336 ±0.105 ±0.905 ±0.252
±0.360 ±0.229
1 hr 21.433 2.300 2.033 1.800 1.500 32.433 27.533
137.96 12.518 11.608 16.660 3.033 2.833 6.594 16.033
±1.066 ±0.204 ±0.323 ±0.502 ±0.912 ±1.904 ±1.903
6 ±0.618 ±0.452
±6.762 98.200 18.300 15.766 7.400 5.333 169.333 124.133
3 hr

65
28.823 13.846 27.932 5.666 4.833 14.701 26.692
±1.410 ±1.027 ±0.789 ±0.958 ±0.467 ±5.120 ±1.821
244.83 ±0.750 ±0.323
3 185.466 71.530 56.500 44.766 39.666 365.066 282.173
6 hr 25.206 11.392 4.133 3.833 7.258 22.717
±5.002 ±5.754 24.247 ±2.837 ±3.151 ±4.769 ±1.790 ±6.947 ±3.630
±0.360 ±0.581
196.86 159.433 95.833 82.760 64.466 60.760 358.900 305.233
12 hr 13.635 5.748 2.600 1.933 2.565 14.953
6 ±1.701 19.014 ±4.980 ±2.457 ±2.484 ±2.719 ±6.841 ±4.085
±3.32 ±0.520 ±0.201

24 hr 118.560 72.566 69.366 131.166 125.700±1. 341.333 314.233

134.60 11.916 4.409 4.379 1.466 1.433 2.251 7.939
±0.284 ±3.089 ±4.498 ±3.210 391 ±5.455 ±6.828
0 ±0.172 ±0.194
±2.995 85.433 48.633 48.166 142.266 140.200 285.833 273.800
48 hr 0.960 1.452 00 00 00 4.209
±3.541 10.007 ±2.466 ±2.383 ±3.803 ±2.275 ±4.372 ±3.964
94.933
±4.086
Buffalo Bulletin (June 2009) Vol.28 No.2
Buffalo Bulletin (June 2009) Vol.28 No.2
obtained and processed for histopathlogical
examination. The vascular and cellular changes were
noticed from 30 minutes onward to 48 h. The
maximal number of leukocytes was observed at 12
h, but there were fewer than in the control group.
However, maximal suppression of leukocytes was
observed at 3 h. Infiltration of neutrophils was more
marked at 6 h. While maximal suppression of
neutrophils was recorded at 3 h. The maximal
number of the monocytes was recorded at 12 h,
while maximal suppression of monocytes at 6 h.
Marked infiltration of lymphocytes was observed at
24 h. However, maximal suppression of lymphocytes
was seen at 3 h. Maximal basophil suppression was
observed at 1 h. Infiltration of eosionophils was not
noticed at any time interval (Table 1).
Subgropup II B- Thirty minutes before
intradermal injection of turpentine, the calves were
pretreated with the piroxicam intramuscularly, and
the lesions as per the non-pretreated group were
obtained and processed for histopathological
examination. The vascular and cellular changes were
noticed from 30 minutes onward to 48 h. The
maximal number of leukocytes were observed at
24 h. However, maximal suppression of leukocytes
was observed at 3 h. Neutrophils were more marked
at 6 h. While maximal suppression of neutrophils
was recorded at 3 h. Monocytes were noted from
30 minutes onwards up to 24 h. The maximal number
of monocytes was recorded at 48 h while maximal
suppression of monocytes was at 6 h. Multinucleated
giant cells were observed at 12 and 24 h.
Lymphocytes were noted at 1 h to 48 h. Marked
infiltration of lymphocytes was observed at 48 h.
However, maximal suppression of lymphocytes was
seen at 3 h. Few basophils were noted at 30 minutes
onward to 24 h. The maximal number of the
basophils was observed at 3 h, and suppression of
the basophils was noted at 3 h. Infiltration of
eosionophils was not noticed at any time interval
(Table 2).
Pretreatment with the prostaglandin
antagonist piroxicam caused suppression of the total
leukocyte infiltration in both turpentine and Staph.
Epidermidis-induced buffalo inflammation. At 3 h,
maximal suppression of leukocytes occurred in both
types of injury. However, in the turpentine induced
reaction, piroxicam caused maximal suppression of
the neutrophils, lymphocytes and basophils at 3 h,
66
and of monocytes at 6 h. Whereas, in the Staph.
Epidermidis-injury it resulted in maximal
suppression of neutrophils and lymphocytes at 3 h,
monocytes at 6 h, and basophils at 1 h. Issekutz and
Movat (1982) studied the effect of prostaglandin on
polymorphonuclear leukocyte infiltration. They
concluded that prostaglandins enhance chemotactic-
factor-mediated poly-morphonuclear infiltration.
Since, piroxicam is a cyclooxygenase pathway
inhibitor through which the prostaglandins are
formed, pretreatment with the drug may also cause
suppression of neutrophil infiltration. Gupta et al.
(2008) reported that intradermal injection of S.
epidermidids suspension and turpentine resulted in
an inflammatory reaction in buffalo calf skin. The
inflammation-induced vascular permeability was
significantly suppressed by injection of the
prostaglandin antagonist drug piroxicam, indicating
that the prostaglandins might be responsible for
increased vascular permeability in inflammation. In
the present study, the greater suppression of
neutrophils indirectly indicates the suppression of
prostaglandin synthesis due to piroxicam
pretreatment. Taken together our results indicate that
the prostaglandins may play a role in the mediation
in the cellular response in buffalo inflammation.
REFERENCES
Dhodapkar, B.S., J.L. Vegad, R.G. Dhawedkar and
G.N. Kolte. 1984. Pathology of reversed
passive arthus reaction in the chicken. Avian
Pathol., 13: 93-108.
Gupta, N., A.K. Katiyar and M. Swamy. 2007. Role
of histamine in turpentine induced cellular
inflammatory response of buffalo calves.
Indian Vet. J., 4: 363-364.
Gupta, N., A.K. Katiyar and M. Swamy. 2008a.
Effect of promethazine hydrochloride on the
vascular permeability and cellular response of
buffalo calves. Indian Vet. J., 11: 1152-1154.
Gupta, N., A.K. Katiyar and M. Swamy. 2008b.
Effect of piroxicam on the vascular
permeability in buffalo calf . Indian Vet. J.,
11: 1354-1355.
*Continued on page 72
 Buffalo Bulletin (June 2009) Vol.28 No.2

ULTRASONOGRAPHIC BIOMETRY OF THE OVARY AND ITS RESPONSES DURING

SUPEROVULATION IN TODA BUFFALOES

D.V. Patel2, R. Anil Kumar1*, M.Iyue1 and R. Kasiraj2

ABSTRACT Keywords: Toda buffalo, ultrasonography,

Eight superovulated Toda buffaloes were
studied ultrasonographically to record the biometry
of the ovarian structures and superovulatory
response during superovulation and flushing
programme, conducted in this breed as a breed
conservation measure. Ovarian size (10 buffaloes)
and structural changes (eight superovulated
buffaloes) were monitored on a) the 10th day post
heat (before initiation of FSH) b) Post SOV heat
(the 3rd day of superovulatory heat) and c) on the
day of flushing. The animals were subjected to
superovulation with either 400 or 600 mg FSH
(Folltropin V). The superovulation was initiated from
the 10th day of the estrous cycle, and embryos were
collected on the 5.5 to 6 day of post superovulatory
(SOV) heat. Before SOV programming, the average
size of the left ovary was found to be 24.67 + 2.35
mm while the right ovary measured 26.11 + 1.71
mm and the average size of CL was 14.50 + 3.28
mm. There was significant increase in the length
and width of ovaries post superovulation and on the
day of flushing. A greater number of ovarian
structures (CL/follicles) were found at the time of
flushing than during post SOV heat indicating late/
an-ovulations (post heat). The average size of the
follicle showed increase on the day of flushing, due
to cystic ovarian condition in a few buffaloes. Late
ovulation and a lower number of recruited follicles
during superovulation may be the reason for lower
response in Toda buffaloes than in other breeds of
buffaloes.
superovulation, ovary
INTRODUCTION
Buffaloes (Bubalus bubalis) in general are
known to be very poor responders to superovulation
protocols in comparison to white cattle. The total
population of follicles is comparatively lower in
buffaloes than in cattle (Madan, 1990).
The main problem encountered during
superovulation with different hormones based on
earlier reports on superovulation was the availability
of anovulatory follicle, leading to few and poor quality
embryos (Madan et al., 1996 and Misra, 1997). In
addition the quality of CL and presence of un-
ovulated follicle is also known to influence the
recruitment of new follicles.
Several reports suggest a lower follicular
population in the buffalo ovaries (Madan, 1990 and
Totey et al., 1991). It is essential to know the number
of follicles recruited and CL available in buffaloes
before and during superovulation and embryo
collection programme. Hence an attempt has been
made to study ovarian size and structures using
ultrasound scanner in the semi wild Toda buffaloes
of Nilgiris district of Tamil Nadu, during
superovulation. The study was carried out at the
Sheep Breeding Research Station, Sandynallah,
Nilgiris, in collaboration with Sabarmati Ashram
Gaushala, Bidaj Farm, Gujarat, under the
conservation project funded by the Department of
Biotechnology, Government of India and the National
Dairy Development Board.

1
Sheep Breeding Research Station, Tamilnadu Veterinary and Animal Sciences University, Sandynallah, Ooty,
Nilgiris -643 237, Tamilnadu, India, *E-mail: ootyanil@yahoo.com
2
Sabarmati Ashram Gaushala, Bidaj Farm, PO- Lali, Dist, Kheda, Gujarat-387 120, India

67
Buffalo Bulletin (June 2009) Vol.28 No.2
MATERIALS AND METHODS
Ten female Toda buffaloes were purchased
from Toda hamlets (Toda munds) and were managed
under a semi-intensive system of management at
the Sheep Breeding Research Station, Sandynallah,
The Nilgiris. During the day time, the animals were
allowed to graze on natural pastures of the farm
land. The animals were fed with 2 kg of concentrate
ration per day per animal.
The work was undertaken during December
2006. The estrum in Toda buffaloes were
synchronized with two injections of prostaglandin,
(inj. Iliren- 5 ml i/m; Hoechst, India) 11 day apart.
Post second PG, animals were checked per-rectally
at 72 h for the presence of follicle on ovary, uterine
tone and discharge. The animals reporting for estrum
were selected for superovulation. Eight buffaloes
were superovulated using either 400 mg or 600 mg
of NIH-FSH-P1 (Folltorpin-V, Vetrepharm, Ontario,
Canada). FSH was given from the 10th day of the
estrous cycle for 5 days in a tapering dose rate.
Luteolysis was induced with prostaglandin injection
along with a 7th and 8th FSH dose. All the animals
reporting to oestrum (48-72 h post PG) were allowed
to be bred by the Toda bull. The superovulated
animals were flushed on the 5.5 or 6th day after
breeding. The number of corpora lutea was counted
per-rectally before flushing. Flushing was carried
out as per the standard procedures (Misra et al.,
1980) using 18 gauge Rusch catheter (Minitub,
Germany) and DPBS media (IMV, France) with
0.1 % Bovine Serum Albumin (Sigma) added.
An ultrasound scanner was used to record
the ovarian structures and superovulatory response
in these animals during the superovulation and
flushing programme. Ovarian size (10 buffaloes) and
structural changes (8 superovulated buffaloes) were
monitored on a) the 10th day post heat (before
initiation of FSH) b) post SOV heat (3rd day) and c)
on the day of flushing.
A real time B-mode ultrasound scanner
(Medison SA600V, BCF Technology Ltd., Scotland)
equipped with a 5.0 MHz linear-array rectal
transducer and a video graphic printer (Sony, Japan)
was used for this study. The total follicle population
was recorded as appreciated by anechoic black
68
structures, while CL with granular structures and
more echogenicity were recorded and measured.
For comparison, two pairs of ovaries were collected
from Toda buffaloes from a slaughter house. The
ovarian size and structure were recorded.
The means and standard errors for all
variables were calculated and presented.
Differences between the ovarian size and the
number of follicles and corpus luteum before and
after superovulation were tested by Student “t” test.
RESULTS AND DISCUSSION
Buffaloes are regarded to have a lower
reproductive efficiency and several reports suggest
lower follicular population in the buffalo ovaries
(Madan, 1990 and Totey et al., 1991). The mean
length, width and height of ovaries in slaughter
specimens were 31.00 + 5.00, 13.50 + 0.50 and
14.00 + 1.00 mm (Lt. Ovary) and 27.50 + 1.50, 25.00
+ 2.00 and 14.50 + 4.50 mm (Rt. Ovary), respectively
(Table 1). The mean length, width and height of
ovaries of Toda buffaloes were greater than those
observed in non-descript buffaloes by Chandrahasan
and Rajasekaran (2004) and in Murrah buffaloes
by Kumar et al. (2004). Both left ovaries in slaughter
specimens had mature projecting CL of 15 mm and
10 mm in size. One of the right ovaries had a graffian
follicle of 15 mm in size.
Significant superovulatory changes in the
length and width of ovaries prior to and post
superovulation were observed. The smallest normal
ovary was found to be 13 x10 mm (length x width),
while the biggest ovary measured 37 x 29 mm. On
the day of flushing, they measured 17 x 17 mm and
42 x 36 mm, respectively. The length and width of
ovary as observed with ultrasonography in this study
was higher than that found by Chandrahasan and
Rajsekaran (2004) in non-descript buffaloes and
Kumar et al. (2004) in Murrah buffaloes. Use of
FSH increased the size of ovary significantly at post
SOV heat. Also significant increase (P<0.05) in the
size of the ovary on the day of flushing was
observed. The changes in ovary size and structures
during superovulation are shown in Figure 1.

Corpus luteum was present in all the animals
studied on the day of SOV, and there was an increase
(1.67 + 0.24) in the number on the day of flushing
(Table 3). Similarly, there was an increase in the
availability of number of follicles in response to
superovulation. The average size of follicle on the
day of flushing (10.25 + 1.28) was greater as
compared to the 10th day (9.00 + 0.82).
On the 10th day post heat, six buffaloes were
shown to have a distinct CL, while in two buffaloes,
CL was not found in any of the ovaries. However,
both the buffaloes had follicles in their ovaries. There
was an increase in number of CL on the day of
flushing (1.67 + 0.24) compared to the number found
on the 10th day (1.00 + 0.00). However, there was
no difference in the number of CL on post SOV
heat (1.00 + 0.00) and the 10th day. Similarly, there
was no difference in the availability of follicles on
post SOV heat (4.00 + 0.44) and on the day of
flushing (3.64 + 0.61). Both these findings indicate
that the buffaloes in this study had late ovulations
(post heat), and that the number of recruited follicles
even during superovulation was low.
Overall, there was no significant response
in the presence of ovarian structures on the 10th
day or post SOV heat or on flushing day. The
presence of a lower number of primordial follicles
and poor recruitment of follicles on the 10th day of
cycle may be the reason for the lower response.
The current results are in agreement with the findings
69
Buffalo Bulletin (June 2009) Vol.28 No.2
of Madan (1990), who showed that buffaloes have
a low number of primordial follicles at the 10th day
of the estrous cycle. However, Chandrahasan and
Rajsekaran (2004) found a greater number (3.41 +
0.11) of follicles than Toda buffaloes (2.80 + 0.63).
Rohilla et al. (2005) also found 7.7 + 0.3 follicles in
anoestrus Murrah buffaloes by ultrasonography.
The size of the follicle observed in this study
was comparable to the ultrasonographic studies by
Honparkhe et al. (2003) and Rohilla et al. (2005).
The average size of the follicle on the flushing day
(10.25 + 1.28 mm) was greater as compared to the
10th day (9.00 + 0.82 mm). This increase in size of
the follicle may be due to the presence of cysts (16-
22 mm) found on the day of flushing in three
buffaloes. The size of CL was larger than those
studied by Honparkhe et al. (2003) and
Chandrahasan and Rajsekaran (2004).
In conclusion, Toda buffaloes were found to
have large-sized ovaries compared to Murrah
buffaloes, but their response to superovulation was
very poor, which might be due to a lower number of
primordial follicles than in other buffaloes. More
study with the use of different hormone regimens
along with ultrasonography are required to fully
exploit the germplasm of these buffaloes. It was
observed that ultrasound can be a very good tool
for more detailed, reliable and accurate study of
ovarian responses to superovulation in buffaloes.
Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 1. Ovary and structural changes during superovulation.

70
 Buffalo Bulletin (June 2009) Vol.28 No.2

Table 1. Ovarian biometry of two pairs of ovaries obtained from a slaughter house.

Sl. Length Width in Height Corpus luteum

Side Remarks
No. in mm mm in mm (CL) /Follicle (F)
Left 36 14 15 1.0 1CL, 3F
1
Right 29 23 19 1.0 1CL
Left 26 13 13 1.0 1LF, 1SCL
2
Right 26 17 10 0.0 1SCL

Table 2. Mean (+ SE) of superovulatory changes in ovarian size (mm).

Length Width
Particulars
Lt. Ovary Rt. Ovary Lt. Ovary Rt. Ovary
10th day
24.67 ± 2.35a 26.11 ± 1.71 18.00 ± 2.03a 19.11 ± 1.72a
(prior to SOV)
Post SOV Heat 30.63 ± 1.77b 29.50 ± 2.19 23.50 ± 2.37b 23.75 ± 2.39b

Flushing day 33.71 ± 1.69b 31.00 ± 3.42 25.57 ± 2.02b 25.86 ± 2.41b

Means in the same column within categories with different superscript differ significantly (p<0.05).

Table 3. Mean (+ SE) of number of ovarian structures and their size (mm) during superovulation.

Number available Average Size (mm)

Particulars
CL Follicle CL Follicle
10th day
1.00 ± 0.00 2.80 ± 0.63 14.50 ± 3.28 9.00 ± 0.82
(prior to SOV)

Post SOV Heat 1.00 ± 0.00 4.00 ± 0.44 12.88 ± 2.19 9.42 ± 1.07

Flushing day 1.67 ± 0.24 3.64 ± 0.61 12.21 ± 0.79 10.25 ± 1.28

71
Buffalo Bulletin (June 2009) Vol.28 No.2
ACKNOWLEDGEMENTS
Authors are grateful to the Professor and
Head, Department of Animal Reproduction,
Gynaecology and Obstetrics, Veterinary College and
Research Institute, Namakkal, Tamilnadu, for
providing ultrasonography instrument for this study.
We also thank Dr. K. Krishnakumar, Associate
Professor, VCRI, Namakkal, for his help in the initial
demonstration of ultrasonography.
REFERENCES
Chandrahasan, C. and J. Rajasekaran. 2004.
Biometry of buffalo (Bubalus bubalis)
ovaries in relation to different stages of the
oestrous cycle. Indian J. Anim. Reprod.,
25(2): 87-90.
Kumar, S., F.A.Ahmed and M.S. Bhadwal. 2004.
Biometry of female genitalia of Murrah buffalo
(Bubalus bubalis). Indian J. Anim. Reprod.,
25(2): 143-145.
Madan, M.L. 1990. Factors limiting super-ovulation
response in embryo transfer programme
among buffaloes. Theriogenology, 33: 280.
*Continued from page 66
Issekutz, A.A. and H.Z.C. Movat. 1982. The effect
of vasodilator prostaglndins on
polymorphonuclear leukocyte infiltration and
vascular injury. Am. J. Path., 107: 300-309.
Shrivastava, A.B., J.L. Vegad and A.K. Katiyar.
1997. Inflammatory response of skin
autograftin in the chicken. Ind. J. Anim. Sci.,
67: 387-391.
Spector, T.S. 1989. An Introduction to General
Pathology, 3 rd ed. Churchill Livingstone,
Edinburg.
72
Madan, M.L., S.K. Das and P. Palta. 1996.
Application of reproductive technology to
buffalo. Anim. Reprod. Sci., 42: 299-306.
Misra, A.K., M.C. Yadav, and K.T. Motwani. 1988.
Successful embryo transfer in a buffalo
(Bubalus bubalis).In Proc. of the Second
World Buffalo Congress, New Delhi, India,
I: 56.
Honparkhe, M., V.K. Gandotra, A.S. Nanda and S.
Prabhakar. 2003. A comparison of rectal
palpation and ultrasonography for the detection
of follicle(s) and corpus luteum in pluriparous
buffaloes. Indian J. Anim. Reprod., 24(2):
149-151.
Rohilla, N., U. Singh, R.K. Sharma and I. Singh.
2005. Ultrasonic ovarian status in summer
anestrus postpartum Murrah buffaloes. Indian
J. Anim. Reprod.Indian J. Anim. Reprod.,
26(2): 95-98.
Totey, S.M., G. Singh, M. Taneja and G.P. Talwar.
1991. In vitro maturation and fertilization of
follicular oocytes from buffalo.
Theriogenology, 35: 284.
Vegad J.L. 1979 . The acute inflammatory response
in the sheep skin. Vety. Bull. Weybridge., 49:
555-561.
Vegad, J.L. and A.K. Katiyar. 1995. The acute
inflammatory response in the chicken. Vet.
Bull., 65: 399-409.
Zarrilli, L.W. and M.L. Calhoun. 1970. Cellular
response to equine encephalomyelitis vaccine
in skin window of horses. Amer. J. Vet. Res.,
31: 97-102.

SEROPREVALENCE OF BRUCELLA SPP. IN BUFFALOES IN THE CENTRAL GUJARAT
REGION OF INDIA
M.N. Brahmabhatt, R.N. Varasada, C.D. Bhong and J.B. Nayak
ABSTRACT
Brucellosis remains a major threat from the
zoonotic as well as the economic point of view. The
prevalence of brucellosis in the central Gujarat was
studied using the rose bengal presipitation test
(RBPT), standard tube agglutination test (STAT) and
indirect enzyme-linked immunosorbent assay (i-
ELISA). The seroprevalence was found to be 12.75
percent, 11.16 percent and 19.12 percent by RBPT,
STAT and i-ELISA, respectively.
Keywords: buffalo, brucellosis, seroprevalence
INTRODUCTION
Brucellosis has long been a major threat to
livestock. It is mainly a disease of domestic animals
caused by various strains of Brucella spp. Bovine
brucellosis is found worldwide, but it has been
eradicated from many countries. The rate of infection
varies greatly from one country to another and
between regions within a country. The disease
causes heavy economic losses due to abortion,
premature births, decreased milk yield and repeat
breeding leading to temporary or permanent infertility
in infected livestock (Yagupsky, 1999).
The diagnosis of the disease can be
challenging and is frequently delayed or missed
because the clinical picture may mimic other
infectious and noninfectious conditions (Araj, 1999;
Yagupsky, 1999). Diagnosis can be established by
laboratory methods such as serology and blood
cultures. Prolonged incubation periods, special
growth media, and subcultures are required for the
isolation of these fastidious, slow growing bacteria.
Department of Veterinary Public Health, College of Veterinary Science & Animal Husbandry, Anand
Agricultural University, Anand Gujarat - 388 001, India
73
Buffalo Bulletin (June 2009) Vol.28 No.2
However, cultures are not always positive when
other tests are positive (Romero et al., 1995).
Automated systems have been reported to detect
more than 95 % of Brucella melitensis-positive
cultures within seven days of incubation (Yagupsky,
1999). The technology is lacking in developing
countries or rural areas where the disease is
prevalent and diagnoses rely mainly on serology.
Many serological tests have been used for the
diagnosis of human brucellosis, such as agglutination
tests, indirect immunofluorescence, rose bengal plate
test (RBPT), standard tube agglutination Test
(STAT), and ELISA specially Dot-ELISA &
Indirect-ELISA. The most commonly used tests are
the serum agglutination test, Coombs anti-Brucella
test, rose bengal test, and complement fixation
(Orduna,∼ 2000).
Buffalo milk and milk products are an
appreciable source of income of farmers of India,
that is why buffaloes are integral part of the
economy of rural people. Hence, this study was
carried out to find out the seroprevalence of
Brucella spp. in central Gujarat, Anand, Kaira,
Ahmedabad and Vadodara districts of Gujarat
(India). These districts are one of the biggest pockets
of milk production in India and also the location of a
world famous dairy co-operative-AMUL.
MATERIALS AND METHODS
A total of 251 (230 female and 21 male) sera
samples from buffaloes were collected from various
places of four districts in Central Gujarat, viz., Anand
(78), Kaira (60), Ahmedabad (86) and Vadodara
(27). Collected sera samples were subjected to rose
bengal plate test. (RBPT), standard tube
Buffalo Bulletin (June 2009) Vol.28 No.2
agglutination Test (STAT) and indirect-enzyme linked
immunosorbant assay (i-ELISA). The RBPT antigen
and Brucella abortus agglutinating antigen for STAT
was procured from the Division of Biological
Products, Indian Veterinary Research Institute
(I.V.R.I.); Izatnagar, Uttar Pradesh (India). The tests
were conducted as per manufacturer’s instructions.
For i-ELISA, smooth lipopolysaccharide (S-LPS)
based (A-B-ELISA) kits supplied by the All India
Coordinated Research Project (AICRP) on Animal
Disease Monitoring and Surveillance (ADMAS),
Bangalore, was used. The test was performed as
per the manufacture’s instructions.
i-ELISA was compared with RBPT and
STAT, considering i-ELISA as the gold standard test
as per Hobbs (1985) and Nielsen et al. (1996), to
determine the relative sensitivity and specificity of
RBPT and STAT.
RESULTS AND DISCUSSION
Out of 251 sera tested during present study
with RBPT, 32 (12.75 %) were found positive. With
STAT, 28 (11.16 %) gave positive while 48
(19.12 %) reacted as positive when tested with i-
ELISA. The highest (23.26 %) prevalence was found
in Ahemdabad district, while prevalences were
20.51 %, 7.40 % and 16.67 % in Anand, Vadodara
and Kaira districts, respectively (Table 1).
Out of 230 females and 21 males tested, 43
(18.70 %), 29 (12.61 %) and 25 (10.87 %) were
Table 1. Geographical distribution of brucellosis antibodies.
i-ELISA
Numer of
District No. of samples
samples tested
+ve (%)
Anand 78 16 (20.51)
Vadodara 27 2 (7.40)
Ahemdabad 86 20 (23.26)
Kaira 60 10 (16.67)
TOTAL 251 48 (19.12)
74
found positive by the i-ELISA, RBPT, and STAT
tests, respectively, in females while 5 (23.81 %), 3
(14.29 %), and 3 (14.29 %) were found positive in
bulls by the respective tests.
The prevalence of brucellosis was 19.12 %.
These findings were comparable to the results of
Sharma and Saini (1995), who found 14.61 %
prevalence in Punjab, India. This finding also
supported Chatterjee et al. (1984) who found 19.6
percent prevalence.
Lower seroprevalences were reported by
Isloor et al. (1998), 1.8 %; Mishra et al. (2005),
4.18 percent; Bhattacharya et al. (2005), 11.94 %;
and Agarwal et al. (2007), 4.6 %, while the
prevalence found in the present study was lower
than that observed by Chauhan et al. (2000),
38.9 % in North Gujarat region of India,
Chandramohan et al. (1992) 21.74 %.
The seroprevalences determined by various
tests differed from one another. This could be due
to variation in the numbers of false positives and
false negatives detected by various tests. Similar
findings were reported by Rao et al. (1999) and
Singh et al. (2004).
In the present study, RBPT shows 64.58 %
sensitivity and 99.50 % specificity when compared
with i-ELISA. This is in agreement with Uzal et al.
(1995) and Saravi et al. (1995), who reported 98.9
% and 99.7 % specificity, respectively. Prahlad
Kumar et al. (1999) showed 33.33 % sensitivity;
this was lower than the present findings.
RBPT STAT
No. of samples No. of samples
+ve (%) +ve (%)
11 (14.10) 9 (11.53)
2 (7.40) 2 (7.40)
13 (15.11) 12 (13.95)
6 (10.00) 5 (8.34)
32 (12.74) 28 (11.16)

STAT showed 56.25 % sensitivity and
99.50 % specificity when compared with i-ELISA.
Higher sensitivity (81.81 %) was observed by
Agrawal and Batra (1999). Prahlad Kumar et al.
(1999) reported more than 90 % specificity. The
relative sensitivity of RBPT was 64.58 % and that
of STAT was 56.25 %. The relative specificity
observed was more than 99.00 % in the above case.
Thus, i-ELISA test in conjunction with other
serological tests can give more reliable diagnosis.
REFERENCES
Agarwal, R., M. Kumar and J.L. Singh. 2007.
Seroprevalence of brucellosis in Uttranchal.
Indian Vet. J., 84: 204-205.
Agrawal, G.S. and H.V. Batra. 1999. Comparision
of an inhibition enzyme linked immunosorbent
assay with other serological tests for detection
of antibodies to Brucella. Indian Vet. J., 76:
10-12.
Araj, G.F. 1999. Human brucellosis: a classical
infectious disease with persistent diagnostic
challenges. Clin Lab Sci., 12: 207-212.
Bhattacharya, D.K., K. Ahmed and H. Rahman.
2005. Studies on seroprevalence of bovine
brucellosis by different tests. J. Vet. Pub.
Hlth., 3: 131-133.
Chandramohan, C.P., P. Ramdass and N. Raghavan.
1992. Studies on bovine brucellosis in an
endemic area. Indian Vet. J., 69: 581-583.
Chatterjee, B.N., J. Bidyanata, M. Chakraborty, P.
Mondal and G.P. Sen. 1984. Sero-
epidemiological studies on bovine brucellosis
in organized herds in West Bengal. Indian J.
Anim. Sci., 55: 249-252.
Chauhan, H.C., B.S. Chandel and N.M. Shah. 2000.
Seroprevalence of brucellosis in buffaloes of
Gujarat. Indian Vet. J., 77: 1105-1106.
Hobbs, I.F. 1985. Comparision of indirect enzyme
linked immunosorbent assay (ELISA) with the
complement fixation test (CFT) for
serodiagnosis of bovine brucellosis. N.Z. Vet.
J., 33: 112-116.
75
Buffalo Bulletin (June 2009) Vol.28 No.2
Isloor, S., G.J. Renukaradhya and M. Rajshekhar.
1998. A serological survey of bovine
brucellosis in India. Rev. Sci. Tech., 17: 781-
785.
Nielsen, K., P. Smith, D. Gall, Perez, C. Cosma, P.
Mueller, J. Trottier and J. Bosse. 1996.
Development and validation of an indirect
enzyme linked immunosorbent assay for
detection for detection of antibody to Brucella
abortus in milk. Vet. Microbiol., 52: 165-173.
∼
Orduna, A., A. Almaraz and A. Prado. 2000.
Evaluation of an immunocapture-agglutination
test (Brucellacapt) for serodiagnosis of human
brucellosis. J. Clin. Microbiol., 38: 4000-
4005.
Prahlad Kumar, D.K. Singh and S.B. Barbuddhe.
1999. Seroprevalence of brucellosis and
comparision of serological test to diagnosis it
in buffaloes. Buff. J., 15: 361-370.
Rao, S.T., V. Rama Devi, R. Madhu Babu And
A.V.C. Narsinha Rao. 1999. Comparision of
rapid plate agglutination, standard tube
agglutination and dot-ELISA tests for
detection of antibodies to Brucella in bovines.
Indian Vet. J., 76: 255-256.
Romero, C., C. Gamazo, M. Pardo and I. Lo’pez-
gon. 1995. Specific detection of Brucella
DNA by PCR. J. Clin. Microbiol., 33: 615-
617.
Saravi, M.A., P.P. Wright, R.J. Gregort and D.E.
Gall. 1995. Comparative performance of the
enzyme linked immunosorbent assay (ELISA)
and conventional assays in the diagnosis of
bovine brucellosis in Argentina. Vet. Immunol.
Immunopathol., 47: 93-99.
Sharma, J.K. and S.S. Saini. 1995. Seroprevalence
of brucellosis among farm animals of Punjab.
Indian Vet. J., 72: 881-882.
Singh, G., D.R. Sharma and N.K. Dhand. 2004.
Seroprevalence of bovine brucellosis in
Punjab. Indian Vet. J., 81: 620-623.
Uzal, F.A., A.E. Carrasco, S. Echaide, K. Nielsen
and C.A. Robles. 1995. Evaluation of indirect
ELISA for the diagnosis of bovine brucellosis.
J. Vet. Digan. Invest., 7: 473-475.
Yagupsky, P. 1999. Detection of Brucella in blood
cultures. J. Clin. Microbiol., 31: 1927-1931.
Buffalo Bulletin (June 2009) Vol.28 No.2

DETECTION OF BOVINE HERPESVIRUS 1 (BHV-1) INFECTION IN SEMEN OF INDIAN

BREEDING BULLS BY POLYMERASE CHAIN REACTION AND ITS CHARACTERIZATION
BY DNA SEQUENCING
Jain Lata1, A.N. Kanani2, J.H. Purohit2, C.G. Joshi2, D.N. Rank2,
Vinay Kumar3 and V.K. Jain2

ABSTRACT must be taken at the State level for controlling BHV-

Bovine herpesvirus 1 (BHV-1), the
causative agent of infectious bovine rhinotracheitis
(IBR), is considered to be the most common viral
pathogen found in bovine semen. BHV-1 is
associated with several clinical conditions, including
infectious bovine rhinotracheitis, infectious pustular
vulvovaginitis, balanoposthitis, conjunctivitis and
generalized disease in newborn calves, causing great
economic loss to the livestock industry. A total of
101 semen samples from breeding bulls of different
Artificial Insemination Centres were screened for
the presence of viral genome by employing PCR
using two sets of primers viz., gB1/gB2 and gC1/
gC2 from gB and gC genes coding for viral envelope.
Viral DNA was extracted from semen using
QIAamp DNA Mini Kit and was then subjected to
PCR. In gB gene based PCR, 47 (46.53 %) semen
samples were found to be positive, producing an
amplified PCR product of size 478 bp. While in gC
gene based PCR, 43 (42.57 %) were found to be
positive for presence of viral genome, producing an
amplified PCR product of size 173 bp. In comparison
of the efficacy of the primers, the results of these
two primers were in agreement for 95 samples out
of the 101 tested samples. Thus, both the primers
can be applied effectively in detection of BHV-1
DNA in semen. In sequencing of gB-gene based
PCR products, a consensus sequence of 459 bp was
obtained. The sequences of field isolates matched
completely with the sequence of BHV-1.1. Finally,
the study revealed the presence of BHV-1 in the
semen of breeding bulls of Gujarat. Thus, under the
Sexual Health Control Programme proper measures
1
Division of Biological Standardization, IVRI, Izatnagar, UP, India
2
Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Anand, Gujarat
State, India
3
Directorate on medicinal and Aromatic Plants, Anand, Gujarat, India
1 infection. The bulls must be free from BHV-1
infection prior to use.
Keywords: BHV-1, breeding bulls, semen, gB gene,
gC gene, PCR, sequencing
INTRODUCTION
Bovine herpesvirus type 1 (BHV-1) is a
member of the Alphaherpesvirinae. BHV-1 infects
the respiratory and genital tracts of cattle and
buffaloes, causing various diseases, such as
infectious bovine rhinotracheitis, infectious pustular
vulvovaginitis, and infectious pustular balanoposthitis,
abortion, mastitis, infertility, tracheitis, conjunctivitis-
keratoconjunctivitis, encephalitis and fatal disease
in newborn calves, and thus causing great economic
losses to the livestock industry (Gibbs and
Rweyemamu, 1977).
Bovine herpesvirus-1 infection was first
reported in India by Mehrotra et al., 1976 and
various workers have since reported the widespread
seroprevalence and isolation of the virus, which they
have isolated in different parts of the country (Samal
et al., 1981; Renukaradhya et al., 1996). The
infection has serious economic implications for India,
which is emerging as the world’s biggest milk
producer and has the world’s largest cattle and
buffalo population.
Transmission of the virus is thought to occur
primarily via the respiratory route. However, the
virus can also be transmitted venereally and by
BHV-1 contaminated semen from virus-shedding

76

bulls (Kupferschmied et al., 1986 and Afshar and
Eaglesome, 1990). Bulls may shed virus in semen
during both clinical and subclinical infections (van
Oirscholt et al., 1993). After genital infection and
seroconversion, BHV-1 localizes and persists,
latently, in sacral ganglia (Ackermann and Wyler,
1984). Shedding of virus reoccurs during periodic
reactivation of viral replication. Viral reactivation
from the latent state is generally thought to be stress-
induced but can also be induced by the injection of
corticosteroids (Pastoret et al., 1980). The use of
semen from BHV-1 infected bulls necessitates the
identification of BHV-1 contaminated semen
samples to prevent transmission of virus to the
recipient cow. To prevent the transmission of
BHV-1 by artificial insemination, only semen that is
free of BHV-1 should be used. The virus is excreted
through secretions (nasal and ocular), and is present
in the placenta of aborted animals and semen. Bovine
semen is stored and handled in conditions that are
ideal for preserving the viral pathogen, so
contaminated semen presents a potential threat to
the cattle industry: BHV-1 can spread through
artificial insemination (AI), causing a variety of
genital tract disorders, such as endometritis, infertility
and abortion
van Engelenburg et al., 1993 detected most
BHV-1 DNA in seminal fluid, and virtually no BHV-
1 DNA was present in the sperm head fraction,
confirming the current view on the way that bovine
semen becomes contaminated with BHV-1.
The present methods of BHV-1 detection
in diagnostic laboratories are by virus isolation (VI),
fluorescent antibody tests (FAT) of tissues, and
screening for specific antibodies either in paired
serum samples or single serum samples. Virus
isolation is laborious, expensive, has a long turnaround
time and requires fresh materials. The fluorescent
antibody test is insensitive and requires good
immunological reagents, which are not easily
available. The test for seroconversion takes a
minimum of 14 to 21 days, and some latently infected
animals may have low antibody titer that may not
be detected using the current serological procedures.
In recent years, efforts have been made to exploit
the detection of viral genetic material in the field of
diagnostic virology. Polymerase chain reaction
(PCR) is one of the DNA manipulation techniques
77
Buffalo Bulletin (June 2009) Vol.28 No.2
that have stimulated strong interest in this area.
Various PCR assays for the recognition of BHV-1
have been described. Primers were selected to
amplify parts of the gB gene (Vilcek, 1993; Lyaku
et al., 1996 and Santurde et al., 1996), the gC gene
(Galeota et al., 1997 and van Engelenburg et al.,
1995), the gD gene (Wiedmann et al., 1993 and Gee
et al., 1996), and the thymidine kinase gene of BHV-
1 (Kibenge et al., 1994) with various sensitivities.
MATERIALS AND METHODS
Reference virus and semen samples:
IBR seed virus (7th passage) was procured from
PD-ADMAS, Bangalore. The virus was processed
for 8th and 9th passages at Disease Investigation and
Monitoring Laboratory, NDDB, Anand. This 9th
passage IBR seed virus was used as reference virus
DNA extraction and PCR. A total of 101 semen
samples were collected from cattle (49 samples)
and buffalo breeding bulls (52 samples) of five
different AI centres of Gujarat. Samples were
collected in screw-capped plastic vials and
transported on ice to the laboratory and were stored
at -80 oC for future use.
DNA extraction: DNA extraction from
seed virus as well as semen samples was carried
out as per the manufacturer’s protocol using
QIAamp DNA Mini Kit (Catalog no. 51304, Qiagen
Pvt. Ltd). The eluted DNA was stored at -20 oC for
long term use.
Polymerase Chain Reaction:
Primers: Two pairs of primers, gB1 F (52 -
TAC GAC TCG TTC GCG CTC TC-32 ), gB2 R
(52 -GGT ACG TCT CCA AGC TGC CC-32 ) and
gC1 F (5'-CTG CTG TTC GTA GCC CAC AAC
G-3') /gC2 R(5'-TGT GAC TTG GTG CCC ATG
TCG C-3') (synthesized by MWG Biotech AG,
Germany) were used for PCR amplification. gB1/
gB2 primer was selected according to the DNA
sequence published for glycoproteins gB (BHV-1.1
Cooper; accession no. M21474) by Fuchs et al.,
1999, and was predicted to produce a PCR product
of 478 base pairs (bp). gC1/gC2 primer sequences
are based on the sequence of the BHV-1
Buffalo Bulletin (June 2009) Vol.28 No.2
glycoprotein C (gpC) gene as used by Engelenburg
et al., 1993.
Conditions of PCR: PCR was carried out
in a final reaction volume of 25 μl using a 200 μl
capacity thin wall PCR tube (Axygen). PCR was
performed in a 25 μl volume containing 12.5 μl hot
start PCR master mix (Catalog no. 203443, Qiagen),
1 μl of each primer (10 pmol/μl), 3 μl of extracted
DNA and 7.5 μl of DNAse free water. The
amplification was performed in a thermal cycler
(MyCycler, Bio-Rad, USA); cycling conditions
consisted of an initial denaturation step at 95 oC for
15 minutes, followed by 35 cycles of 96 oC for
1 minute, 65 oC for 45 sec, 72 oC for 45 sec and a
final extension at 72 oC for 10 minutes for gB1/gB2
primer and a initial denaturation step at 95 oC for 15
minutes, followed by 38 cycles of 95 oC for 1 minute,
60 oC for 1 minute, 72 oC for 1 minute and a final
extension at 72 oC for 10 minutes for gC1/gC2
primer. The negative control consisted of sterile
water instead of DNA template while positive control
consist of DNA extracted from reference virus
spiked with neat semen. After amplification, 5 μl of
the reaction mixture was electrophoresed in a
2.0 % agarose gel, stained with ethidium bromide.
The amplified product was visualized as a single
compact band of expected size under UV light and
documented by a gel documentation system (Syn
Gene,Gene Genius BioImaging System, UK). A
clear, compact band of 478 and 173 bp, respectively,
for gB1/gB2 and gC1/gC2 primers was regarded
as a positive result.
Sequencing of the gB Gene Segment:
Purification of PCR products for
sequencing: PCR products amplified from the gB
gene (478bp) using gB1/gB2 primer pair were
purified in low melting point agarose -Nusieve GTG
agarose (Cat. No.50080, BioWhittakar Molecular
Applications, USA) following the method described
by Sambrook and Russel (2001). Twenty microlitres
of the PCR-amplified products of representative
field sample was electrophoresed (60 mV for two
hour) along with 100 bp DNA molecular weight
marker (GeneRuler, MBI Fermentas) on a 2 % (W/
V) low melting point agarose gel in 1X TAE (TAE
50X composition: Tris base - 242 g; Glacial acetic
acid - 57.1 ml; 0.5 M EDTA (pH 8.0) - 100 ml;
78
Deionized water up to 1000 ml) and stained with
ethidium bromide (0.5 μg/ml of 1X TAE buffer).
The DNA band of interest (478bp) was visualized
on a UV Trans-illuminator. Using a sharp razor
blade, a slice of agarose containing the bands of
interest was cut out and transferred into a clean
microfuge tube and was incubated in five volumes
of LMT elution buffer (Tris base - 0.12 g; EDTA
- 0.0075 g; Deionized water up to 50 ml) at 72 oC
for 10 minutes. Then an equal volume of equilibrated
phenol was added and then the aqueous phase was
recovered by centrifugation at 11000 rpm for 10
minutes. The aqueous phase was extracted once
with Phenol: Chloroform (1:1, v/v) and once with
chloroform. The aqueous phase was transferred to
a fresh tube, then to it was added 0.1 volume of 3 M
sodium acetate and two volumes of chilled absolute
ethanol, and then DNA was pelleted by
centrifugation at 11000 rpm for 20 minutes at 4 oC.
The DNA pellet was washed twice with 70 %
ethanol. The pellet was air dried for 30 minutes and
then dissolved in 20 μl of TE buffer [Tris base-
0.06 g; EDTA- 0.0075 g; Deionized water up to
50 ml (pH 8.0)]. The concentration of the purified
PCR product was determined and subjected to cycle
sequencing.
Cycle sequencing: Cycle sequencing was
performed following the instructions supplied along
with BigDye O R
Terminator v3.1 Cycle Sequencing
Kit. The reaction was carried out in a final reaction
volume of 20 μl in thermal cycler containing 1.00 μl
of Ready reaction premix, 3.50 μl of Big dye
sequencing buffer (5X), 2.00 μl of gB specific
primer- forward or reverse each in separate tubes
(1.6 pmol/μl), 2.00 μl of PCR product, 0.5 μl of Hot
start taq polymerase (5U/μl), 2.00 μl of Hot start
buffer (10X) and 9.00 μl of deionized water. The
cycling protocol included: initial denaturation at
95 oC for 5 minutes, denaturation at 95 oC for 30
seconds, annealing at 50 oC for 10 seconds, and
extension at 60 oC for 4 minutes and was designed
for 25 cycles with the thermal ramp rate of 1oC per
second. After the cycling, the extension products
were purified. The extension product (20 μl) was
mixed with two μl of 125 mM EDTA, two μl of 3 M
sodium acetate and 50 μl of 100 % ethanol and
incubated at room temperature for 15 minutes and
then centrifuged at 3000 g for 30 minutes at 4 oC.
 Buffalo Bulletin (June 2009) Vol.28 No.2

with 70 µl of 70 % ethanol by centrifuging at 1650 g RESULTS

for 15 minutes at 4 oC. Finally, the pellet was dried
and resuspended in 10 µl formamide (Sigma Aldrich,
USA, Cat No. F-9037) and was heated at 95 oC for
two minutes, snap chilled, vortexed and spun briefly.
The samples were stored on ice until ready to load
into the instrument. The samples were transferred
to 0.5 ml sample tube and subjected to automated
DNA sequencing on ABI PRISM OR 310 Genetic
Analyzer (Applied Biosystems, USA) for capillary
electrophoresis through the performance optimized
polymer (POP-6TM) (Part No. 402837 Applied
Biosystems, USA) and data analysis. The nucleic
acid sequences of the gB gene PCR products were
aligned with known sequences of BHV-1 available
in Genbank.
PCR: In the present study, the BHV-1
genome was detected by using the gB and gC gene
based primers. By using the gB gene based primer,
reference virus as well as 47 (46.53 %) out of 101
semen samples, produced an approximately 478 bp
amplicon (Figure 1 and Table 1). Similarly while using
the gC gene based primer, reference virus as well
as 43 (42.57 %) out of 101 semen samples produced
an approximately 173 bp amplicon (Figure 2 and
Table 1).
Comparative efficiency of two primers:
Two primer pairs viz., gB1/gB2 amplifying a region

Table 1. Detection of BHV-1 genome in semen of bulls by gB and gC gene based PCR.

Number Percent Number Percent

Numbers positive by positive by positive by positive by
Attributes
tested gB gene gB gene gC gene gC gene
PCR PCR PCR PCR
[A] Centre/Location:
I. Himmatnagar 11 0 0.00 0 0.00
II. Surat 14 4 28.57 5 35.71
III. Rajkot 21 14 66.67 11 52.38
IV. Mahesana 51 26 50.98 24 47.06
V. Anand 04 3 75.00 3 75.00
Total 101 47 46.53 43 42.57
[B] Specieswise:
Cattle 49 23 46.93 20 40.81
Buffalo 52 24 46.15 23 44.23
Total 101 47 46.53 43 42.57
[C] Breedwise (Cattle) :
Cross bred 39 15 38.46 13 33.33
Gir 10 8 80.0 7 70.0
Total 49 23 46.93 20 40.81
[D] Breedwise (Buffalo):
Mahesani 38 18 47.36 17 44.73
Jafrabadi 7 4 57.14 3 42.85
Surti 7 2 28.57 3 42.85
Total 52 24 46.15 23 44.23

79
Buffalo Bulletin (June 2009) Vol.28 No.2

Table 2. Comparison of gB-PCR and gC-PCR.

gB gene based PCR

Test Total
Positive Negative
gC gene Positive 42 01 43
based PCR Negative 05 53 58
Total 47 54 101

Table 3. Score table for alignment of 459 bp sequence of BHV-1 field isolates Meh/Guj/ibr with sequence
published in Gene bank.

SeqA Name Length(nt) SeqB Name Length(nt) Score

1 Meh/Guj/ibr 459 2 BHT1UL 459 100
1 Meh/Guj/ibr 459 3 BHV1CGEN 459 100
1 Meh/Guj/ibr 459 4 HSBGPI 459 100
1 Meh/Guj/ibr 459 5 HSB1GPB 459 99
2 BHT1UL 459 3 BHV1CGEN 459 100
2 BHT1UL 459 4 HSBGPI 459 100
2 BHT1UL 459 5 HSB1GPB 459 99
3 BHV1CGEN 459 4 HSBGPI 459 100
3 BHV1CGEN 459 5 HSB1GPB 459 99
4 HSBGPI 459 5 HSB1GPB 459 99

Figure 1. Agarose gel electrophoresis pattern of BHV-1 gB gene 478 bp specific PCR product amplified with
primer gB1/gB2.
La : DNA molecular weight ladder of 100 bp
-Ve : Negative Control
+Ve : Positive Control (Reference Virus)
01-12 : Field Samples

80
 Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 2. Agarose gel electrophoresis pattern of BHV-1 gB gene 173 bp specific PCR product amplified with
primer gC1/gC2.
La : DNA molecular weight ladder of 100 bp
-Ve : Negative Control
+Ve : Positive Control (Reference Virus)
01-09 : Field Samples

Meh/Guj/ibr
>TCGCGCTCTCGACCGGGGACATTATCTACATGTCGCCCTTTTACGGGCTGCGCGA
GGGCGCGCACCGCGAGCACACCAGCTACTCGCCGGAGCGCTTCCAGCAGATCGA
GGGCTACTACAAGCGCGACATGGCCACGGGCCGGCGCCTCAAGGAGCCGGTCTC
GCGGAACTTTTTGCGTACACAGCACGTGACGGTAGCCTGGGACTGGGTGCCCAAG
CGCAAAAACGTGTGCTCGCTGGCCAAGTGGCGCGAGGCGGACGAAATGCTGCGA
GACGAGAGCCGCGGGAACTTCCGCTTCACGGCCCGCTCGCTCTCGGCGACCTTTG
TGAGCGACAGCCACACCTTCGCGTTGCAGAATGTGCCGCTGAGCGACTGCGTGAT
CGAAGAGGCCGAGGCCGCGGTCGAGCGCGTCTACCGCGAGCGCTACAACGGCAC
GCACGTGCTGTCGGGCAGCTTGG<

Figure 3. Consensus sequence of 459 bp submitted in NCBI genbank under Accession no. EF175730.

of the gB gene and gC1/gC2 amplifying a region of
the gC gene were compared for their efficiency in
detection of the BHV-1 genome from the field
samples. A total of 101 semen samples were tested
with both the primers. Primer set gB1/gB2 produced
the desired amplicons of 478 bp in 47 samples while
primer set gC1/gC2 produced the desired amplicons
of 173 bp in 43 samples. A total of 42 and 53 samples,
respectively, were found positive and negative with
both the primers. While five samples found positive
by primer set gB1/gB2 were found negative by
primer set gC1/gC2 and only one sample found
positive by primer set gC1/gC2 was found negative
by primer set gB1/gB2. Thus, the results of these
two primers were in agreement for 95 samples out
of the 101 tested samples (Table 2).
Sequencing of the gB gene PCR
amplified product: In the present study, a sequence
of 462 bp was obtained by using forward primer
while a sequence of 445 bp was obtained by using

81
Buffalo Bulletin (June 2009) Vol.28 No.2
reverse primer. The reverse sequence was
converted to reverse complement sequence. The
currated sequence obtained by using forward and
reverse primers were assembled using SeqScape
v2.5 software programme and a consensus sequence
of 459 bp was obtained (Figure 3).
DISCUSSION
PCR: In the present study, the BHV-1 viral
genome was detected in 47 and 43 samples out of
100 semen samples by using gB gene and gC gene
based primers, respectively. This gB gene based
primer was developed by Fuchs et al. (1999), and
they obtained product of 478 bp with this primer
from different strains of BHV-1 and used this primer
sucessfully for detection of BHV-1 DNA in
peripheral blood of naturally infected cattle.
This gC gene based primer was developed
by van Engelenburg et al. (1993) using the computer
programme of Lowe et al. (1990). They examined
the coding region of the BHV-1 gC gene and selected
a primer pair with an expected product length of
173 bp. They tested 18 different BHV-1 isolates by
PCR using the selected primer to test whether the
PCR target was conserved among BHV-1 strains.
A specific product of 173 bp was obtained from each
of the above 18 isolates tested. On the basis of the
results of both the primers, BHV-1 was more or
less equally distributed both in cattle and buffalo
bulls.
Gee et al. (1996) detected BHV-1 in a
limited number of semen samples only using PCR;
however, they detected BHV-1 in 23 out of 100 nasal
swabs using PCR. Wagter et al. (1996) developed
and evaluated a PCR assay using a primer of the
gD gene and compared it with virus isolation from
non extended semen of experimentally infected bulls.
Of a total 162 ejaculates, 51 were found positive by
virus isolation and 73 by PCR, thus proving PCR
more sensitive as compared to virus isolation. Rola
(2002) detected the presence of BHV-1 in 7.4 %
and 10.7 % semen samples, respectively, for gC and
gD primers using PCR technique thus observed
82
minor difference between two primers. Deka et
al. (2005) found 14 positive out of 24 semen samples
by using a primer of the gI gene amplifying a product
of 468 bp. Similarly other workers viz., van
Engelenburg et al. (1993), Wiedmann et al. (1993),
van Engelenburg et al. (1995), Masri et al. (1996)
and Gupta et al. (2006) developed PCR using primers
of different regions for detection of BHV-1 in
semen.
Sequencing of gB gene PCR amplified
product: To prove the specificity and authenticity
of the PCR products, products (478 bp) of BHV-1
genome amplified by gB1/gB2 primers from
representative sample were subjected using forward
and reverse primer of gB gene in seperate PCR
tubes for sequencing by ABI PRISM OR 310 Genetic
Analyzer. In the present study, a consensus sequence
of 459 bp was obtained (Figure 3). This consensus
sequence was then further used for alignment with
the published sequence of BHV-1 in Genbank using
NCBI Blast and CLUSTAL W (1.82) software and
SeqScape v2.5 software.
Sequence analysis: The consensus
sequence of 459 bp (named as Meh/Guj/ibr) obtained
from forward and reverse primer cycle sequencing
was aligned with known sequences BHT1UL
(Accession no. Z78205.1), BHV1CGEN (Accession
no. AJ004801.1), HSBGPI (Accession no.
M21474.1) and HSB1GPB (Accession no.
M23257.1) of BHV-1 published in GenBank. The
sequence and alignment homology scores for field
sample are presented in Table 3. The consensus
sequence of 459 bp was submitted in NCBI genbank
under Accession no. EF175730.
The amplified parts of the gB gene were
found to be 100 % identical to the published
sequences of BHT1UL (Accession no. Z78205.1),
BHV1CGEN (Accession no. AJ004801.1), HSBGPI
(Accession no. M21474). Compared to HSB1GPB
(Accession no. M23257) the sequence of the
amplified gB region of field isolate differed at one
nucleotide (99 % identity), which also led to one
different amino acid (the amino acid at position 114;
S to T). The sequences of field isolate matched
completely with the sequence of BHV-1.1. A similar

result was also reported by Fuchs et al. (1999) for
the same PCR fragment of 478 bp.
CONCLUSION
Finally, the study revealed the presence of
BHV-1 in the semen of breeding bulls of Gujarat.
Thus, under the Sexual Health Control Programme,
proper measures must be taken at the State level
for controlling BHV-1 infection. The 46.72 %
positivity for IBR virus in semen by PCR in this
study was not surprising and directs our attention
towards the alarming situation in the state.
Considering the fact than BHV-1 is capable of
transmission through artificial insemination, this is
an alarming condition for the Gujarat State.
Therefore, the results of this study should be taken
as an indicator of infection foci and warrant carrying
out large-scale state-wide surveys using appropriate
sampling techniques for a meaningful assessment
of the disease situation in the bovine population that
will be helpful in planning the state level control
programmes. Thus under the Sexual Health Control
Programme, proper measures must be taken at the
State level for controlling BHV-1 infection. All
breeding bulls must be tested periodically for
detection of the presence of BHV-1 in semen. The
bulls must be free from BHV-1 infection prior to
use.
ACKNOWLEDGEMENTS
The authors are thankful to the Incharges
of different AI Centres of Gujarat State for providing
semen samples for this study.
REFERENCES
Ackermann, M. and R. Wyler. 1984. The DNA of
an IPV strain of bovid herpesvirus 1 in sacral
ganglia during latency after intravaginal
infection. Vet. Microbiol., 9: 53-63.
Afshar, A. and M.D. Eaglesome, 1990. Viruses
associated with bovine semen. Vet. Bull., 60:
93-109.
83
Buffalo Bulletin (June 2009) Vol.28 No.2
Deka, D., Ramneek, N.K. Maiti and M.S. Oberoi.
2005. Detection of bovine herpesvirus-1
infection in breeding bull semen by vius
isolation and polymerase chain reaction. Rev.
Sci. Tech. Off. Int. Epiz., 24: 1085-1094.
Fuchs, M., H. Peter, Jan Detterer and R. Hanns
Joachim. 1999. Detection of bovine
herpesvirus type 1 in blood from naturally
infected cattle by using a sensitive PCR that
discriminates between wild-type virus and
virus lacking glycoprotein E. J. Clin.
Microbiol., 37: 2498-2507.
Galeota, J.A., E.F. Flores, S. Kit, M. Kit and F.A.
Osorio, 1997. A quantitative study of the
efficacy of a deletion mutant bovine
herpesvirus-1 differential vaccine in reducing
the establishment of latency by wildtype virus.
Vaccine, 15: 123-128.
Gee, De A.L.W., L.H.A. Wagter and J.J. Hage.
1996. The use of polymerase chain reaction
assay for the detection of bovine herpesvirus
1 in semen during a natural outbreak of
infectious bovine rhinotracheitis. Vet.
Microbiol., 53: 163-168.
Gibbs, E.P.J. and M.M. Rweyemamu. 1977. Bovine
herpesviruses. Part I. Bovine herpesvirus 1.
Vet. Bull., 47: 317-343.
Gupta, P.K., M. Saini and A. Rai. 2006. Rapid and
sensitive PCR- based test for detection of
bovine herpesvirus-1 in semen. Indian J.
Virol., 17: 23-27.
Kibenge, F.S., L.M. Harris, P.K. Mckenna, D.
Wadowska and C.V. Yason. 1994.
Amplification of strains of bovine herpesvirus
1 by use of polymerase chain reaction with
primers in the thymidine kinase region. Amer.
J. Vet. Res., 55: 1206-1212.
Kupferschmied, H.U., U. Kihm, P. Bachmann, K.H.
Muller and M. Ackermann. 1986.
Transmission of IBR/IPV virus in bovine
semen: a case report. Theriogenology, 25:
439-443.
Lowe, T., J. Sharefkin, S.Q. Yang and C.W.
Dieffenbach. 1990. A computer program for
selection of oligonucleotide primers for
polymerase chain reactions. Nucl. Acid. Res.,
18: 1757-1761.
Buffalo Bulletin (June 2009) Vol.28 No.2
Lyaku, J.R.S., S. Vilcek, P.F. Nettleton and H.S.
Marsden. 1996. The distinction of serologically
related ruminant alphaherpesviruses by the
polymerase chain reaction (PCR) and
restriction endonuclease analysis. Vet.
Microbiol., 48: 135-142.
Masri, S.A., W. Olson, P.T. Nguyen, S. Prins and
D. Deregt. 1996. Rapid detection of bovine
herpes 1 in the semen of infected bulls by a
nested polymerase chain reaction assay. Can.
J. Vet. Res., 60: 100-107.
Mehrotra, M.L., B.S. Rajya and S. Kumar. 1976.
Infectious bovine rhinotracheitis (IBR)-
keratoconjunctivitis in calves. Indian J. Vet.
Pathol., 1: 70-73.
Pastoret, P.P., L.A. Babiuk, V. Misra and P. Griebel.
1980. Reactivation of temperature sensitive
and non-temperature sensitive infectious
bovine rhinotracheitis vaccine virus with
dexamethasone. Infec. Immunity, 29: 483-
488.
Renukaradhya, G.J., M. Rajasekhar and R.
Raghavan. 1996. Prevalence of infectious
bovine rhinotracheitis in Southern India. Rev.
Sci. Tech. Off. Int. Epiz., 15: 1021-1028.
Rola, J. 2002. Application of PCR assay for detection
of BHV-1 virus with bull semen. Postep.
Mikrobiol., 41: 45-49.
Samal, S.K., B.B. Mallick and S.K. Das. 1981. Note
on the incidence of infectious bovine
rhinotracheitis virus infection among cattle in
India. Indian J. Anim. Sci., 51: 895-897.
Sambrook, J. and D.W. Russel. 2001. Molecular
Cloning: A Laboratory Manual, 3rd ed. Cold
84
Spring Harbor Laborartory, Cold Spring
Harbor, New York.
Santurde, G., N. Da Silva, R. Villares, E. Tabares,
A. Solana, J.M. Bautista anf J.M. Castro.
1996. Rapid and high sensitivity test for direct
detection of bovine herpesvirus-1 genome in
clinical samples. Vet. Microbiol., 49: 81-92.
van Engelenburg, F.A.C., R.K. Maes, J.T. van
Oirschot, F.A.M. Rijsewijk. 1993.
Development of a rapid and sensitive
polymerase chain reaction assay for detection
of bovine herpesvirus type 1 in bovine semen.
J. Clin. Microbiol., 31: 3129-3135.
van Engelenburg, F.A.C., F.W.V. Schie, F.A.M.
Rijsewijk and J.T. van Oirschot. 1995.
Excretion of bovine herpesvirus 1 in semen is
detected much longer by PCR than by virus
isolation. J. Clin. Microbiol., 33: 308-312.
van Oirscholt, J.T., P.J. Straver, A.H. van Lieshout,
J. Quak, F. Westenbrink and A.C.A. van
Exsel. 1993. A subclinical infection of bulls
with bovine herpesvirus type I at an artificial
insemination centre. Vet. Rec., 132: 32-35.
Vilcek, S. 1993. Detection of bovine herpesvirus-1
(BHV-1) genome by PCR. J. Virol. Meth.,
41: 245-248.
Wagter, L.H.A., R.D. Glas, N. Bleumink Pluym,
F.A.C. van Engelenburg, F.A.M. Rijsewijk and
D.J. Houwers. 1996. A polymerase chain
reaction (PCR) assay for detection of bovine
herpesvirus-1 (BHV-1) in selectively digested
whole bovine semen. Vet. Res. Commun., 20:
401- 408.
Wiedmann, M., R. Brandon, P. Wagner, E.J. Dubovi
and C.A. Batt. 1993. Detection of bovine
herpesvirus-1 in bovine semen by a nested
PCR assay. J. Virol. Meth., 44: 129-139.
 Buffalo Bulletin (June 2009) Vol.28 No.2

QUANTITATION OF SERUM IMMUNOGLOBULINS OF NEONATAL BUFFALO CALVES

AND COW CALVES THROUGH ELISA AND PAGE:
STATUS OF IMMUNE-COMPETENCE
Barmaiya, S.1, Aditi Dixit1, A. Mishra1, A.K. Jain2, A. Gupta3, A. Paul3,
M.A. Quadri3, A.K. Madan4 and I.J. Sharma1

ABSTRACT
In order to explore the features of the
immune system, sera samples of neonatal buffalo
calves (24) and cow calves (24) were processed
for ELISA of IgM, IgG and IgA. PAGE of the
immunoglobulins of the sera samples was conducted
to separate the different types of immunoglobulins.
The levels of all the types of immunoglobulins
increased with age of the calves in serum after
colostrum feeding and the degree of elevation was
higher for IgG and IgA. The overall enhancement
recorded was greater in the cow calves than in the
buffalo calves. The increment in the concentration
of immunoglobulins was significant (P< 0.05) within
6 days postcolostral feeding; thereafter, a consistency
was maintained, except for IgG, which was always
at higher levels. Overall, to begun with, five bands
were recorded in PAGE, of which the first band
was conspicuous. The other bands might have been
the fragmented forms of IgD and IgA indicative of
poor immunity at the time of birth. The sixth band
appeared in PAGE along with consolidation of other
bands in terms of density at 15 days postcolostral
feeding, indicating the building up of the immune
system. After about 60 days of age, the molecular
weight and density of the bands increased. This is
indicative of the polymerization of immunoglobulins.
The immunomodulators like neem oil and withaneloid
also enhanced the polymerization of immu-
noglobulins. Finally, it was evident from the data
developed that the amount and molecular weight of
each immunoglobulin type increased with
consolidation by the 90th day of age of the calves. It
1
Department of Physiology, College of Veterinary Science & AH, Jabalpur 482001 (M.P), India
2
Department of Physiology, College of Veterinary Science and Animal Husbandry J.N.K.V.V. Jabalpur (M.P.)
482001, India
3
Department of Biochemistry, College of Veterinary Science & AH, Jabalpur 482001 (M.P), India
4
G.B. Pant University of Agriculture & Tech., Pantnagar, Uttaranchal, India
was concluded that the buffalo calves not only had
poor immunocompetence, but also had poor response
to the immunity-boosters as compared to the cow
calves. Among the immunoregulators used, neem
oil could be recommended as an effective and cheap
immunity-booster for buffalo calves.
Keywords: immunoglobulins quantitation, neonatal
calves, immune-competence, immunomodulators
INTRODUCTION
Development of the internal defense starts
with development of the nervous system during
organogenesis. The parasympathetic nervous system
being anabolic is immunogenic whereas the
sympathetic nervous system is immunodepressant,
being catabolic in function. At the time of birth, the
development of the whole of the autonomic nervous
system is slow and so the defense system.
Expression of the genes responsible for synthesis
and secretion of immunoglobulins on rough
endoplasmic reticulum (Richard et al., 2000) is a
complex phenomenon. The neonatal buffalo calves
are almost agammaglobulinaemic at the time of birth
(Jain et al., 2007). It has been further emphasized
that the colostrum of newly calved buffaloes contain
greater amounts of immunoglobulins than cow
colostrum, and the reverse is true for the sera
samples (Jain et al., 2007). The IgG is effective
against micro-organisms present in the mouth and
gastrointestinal tract. IgM is the first antibody
produced in the body by activated B cells and is

85
Buffalo Bulletin (June 2009) Vol.28 No.2
especially effective in activating the complement
system proteins to kill micro-organisms. IgD is
related in recognition of B lymphocytes by antigens
and induces B cells to proliferate and form clones
for production of different immunoglobulins (Richard
et al., 2000 and Ganong, 2005). In newborns of the
domestic animals, the plasma gamma- globulins are
either lacking or present only as traces since the
placenta is not permeable for these immunoglobulins.
Some interesting yet incomplete information
is available with regard to the composition of the
buffalo’s vis-a-vis the cow’s colostrum and milk and
their effects on the mortality of calves. Detailed
information with regard to the levels of
immunoglobulins in the neonatatal period and their
relationship with the internal resistance of buffalo
calves as compared to cow calves may unravel the
hidden facts. Neem oil and withaneloide have very
good immuno-modulating activities (Jain et al., 2006)
and hence, their use in the calves has been explored.
MATERIALS AND METHODS
Animals
The sera samples of 24 neonatal buffalo
calves and 24 cow calves as indicated in Table 1
were separated from blood collected from the 1st
day, before colostrum feeding, through the 90th day
at regular intervals. The last sample was collected
on the 91st day of age of the animals.
Quantification of important fractions of
immuno-globulins through ELISA
The quantitative estimation of IgM, IgG and
IgA was made in the sera samples of the buffalo
calves and cow calves using ELISA kits (Bethyl
Laboratories, Inc, 25043 West FM 1097,
Montgomery, TX 77356).
ELISA of immunoglobulins
An aliquot of 0.3 ml serum was diluted with
0.6 ml of PBS and an equal volume (0.9 ml) of
saturated ammonium sulphate solution (50 %) was
added, vortexed for 30 minutes and centrifuged at
86
1000G for 15 minutes at 4 oC. The precipitate was
washed with 45 % saturated ammonium sulphate
and recentrifuged. The precipitate was then
redissolved in 0.3 ml of PBS and centrifuged to
remove any insoluble material. The protein solution
under test was taken in a cut-off filter and 0.3 ml of
PBS was added. After 3-4 washings, the filtrate was
checked for the presence of ammonium sulphate
by adding 0.5 ml of 1 % acidified barium chloride
solution. The final precipitate was decanted and kept
in eppendroff tubes.
PAGE of serum immunoglobulins
The PAGE technique was applied for
fractionation of serum immunoglobulins as per the
standard method for confirmation of the results
obtained through ELISA. Accurately measured
0.3 ml of test serum was processed for precipitation
of immunoglobulins. Sterilized Vertical Gel
Electrophoresis assembly was kept ready using
resolving gel solution (12 %) and stacking gel
(5 %). The precipitate obtained was dissolved in
0.3 ml of PBS. Twenty micro-liters of the above
sample and a standard protein marker (Bg-Pm-003-
Protein Marker, Higher Range) along with the same
amount of bromophenol blue dye was loaded in each
electrophoretic well of the gel. Electrodes were
connected and the electrophoretic run carried out
at a constant current of 30 mA until the marker dye
reached almost the end of the gel. After the
electrophoretic run, the gel was removed from in
between the glass plates and immersed in the fixing
solution for 30 minutes. After fixation, the gel was
immersed in CBB staining solution for 2 h at room
temperature on a slowly rotating platform. The
staining solution was removed and the gel was kept
in destining solution for 8-10 h. After destaining, the
gel was kept in water and the bands were examined
and documented in Gel- Doc. System.
The whole procedure was adopted as given
by “ATTO” with certain modifications. No breaking
agents like SDS and mercaptoethanol were used,
as these agents caused the breakage of the different
fragments of immunoglobulins. The samples
(immunoglobulin) were not heated to avoid their
fragmentation. The gel was stained for 4 h instead

of 2 h. 75V current and 30 mA was provided for
3- 4 h. Group significance in variation of the values
was worked out by the students ‘t’ Test (Snedecor
and Cochran, 1968).
RESULTS AND DISCUSSION
Using ELISA for quantification of IgM, IgG
and IgA in the sera samples, it was revealed that
amounts of these immunoglobulins were higher in
the cow calves than in the buffalo calves (Table 3),
which might be the important reason for
comparatively better resistance of neonatal cow
calves than buffalo calves. Of the estimated
immunoglobulins, the one in maximum quantity was
IgG and the one whose concentration was least was
IgM in calves of both the species.
Serum electrophoregram (PAGE) of buffalo
calves and cow calves
The normal reported characteristics of various
immunoglobulins have been depicted in Table 2 to
be used as a reference for identification of various
types of the normal reported immunoglobulins.
Although, the serum levels of all of the
immunoglobulins increased with age of the calves
(Tables 4-7 and Figures 1-3) after feeding of the
colostrum, the degree of elevation for IgG and IgA
was higher. Greater overall enhancement was
recorded in cow calves than the buffalo calves. The
increment in the immunoglobulin levels was
significant (P<0.05) within 6 days of postcolostral
feeding; thereafter a consistency was maintained,
except for the status of IgG, which was always kept
at higher levels. Overall, five bands were recorded
in PAGE out of which the 1st band was conspicuous.
The other bands might have been fragmented parts
of IgD and IgA. After feeding of the colostrum to
the calves, the molecular weight and density of the
87
Buffalo Bulletin (June 2009) Vol.28 No.2
bands increased, which is indicative of the
polymerization of the immunoglobulins.
The immunomodulators like neem oil and
withaneloid also enhanced the polymerization of
immunoglobulins. The mechanism of action of the
herbal immunomodulators is not clear, but these are
supposed to arrange the amino acids and possibly
activate the production of specific mRNA from
DNA. The 6th band appeared in PAGE 15 days after
postcolostral feeding along with consolidation of the
bands in terms of density, which indicated the
influence of immunomodulators. At this period of
time the IgA appears to have increased in
concentration with molecular weight around 80 KD.
Subsequently, 30 days onwards, the consolidation
of the bands was indicative of the further
polymerization of monomeric immunoglobulins, as
molecular weight as well as density of the
immunoglobulins were in increasing order. The
results of increasing concentration of IgM with age
of the neonatal calves corroborate with those
reported by Ananthnarayan and Paniker (2003). The
effect of neem oil and withaneloid on molecular
weight and density of immunoglobulins was more
pronounced as compared to Stenot. Finally, it was
evident from the results that the amount and
molecular weight of each immunoglobulin increased
with consolidation by the 90th day of age of the
calves. The effect of immunomodulators particularly,
the neem oil, was greater in cow calves than in the
buffalo calves insofar as increasing the levels of
serum immunoglobulins are concerned.
Thus, it can be surmised from the
observations made in this study that the buffalo
calves from the very beginning not only had poorer
immuno-competence than the cow calves, but also
had poor response to the immuno-boosters in
comparison to the cow calves. Neem oil could be
recommended as effective and cheap immune-
booster for buffalo calves in order to reduce the
mortality rate.
Buffalo Bulletin (June 2009) Vol.28 No.2

Table 1. Place of procurement and number of the animals used in the experiment.

Number
S. Place of Procurement of
Experimentation Animals of
No. Animals
Animals
LSF, Adhartal, COVS, Jabalpur
Cow
and Military Dairy Farm, Barela, 6
calves
Jabalpur
1 Control
LSF, Adhartal, COVS, Jabalpur
Buffalo
and Reliable Dairy, Gwarighat, 6
calves
Jabalpur
Cow
LSF, Adhartal, COVS, Jabalpur 6
Treatment with Neem oil @ calves
2
10ml/day for three months, orally Buffalo Reliable Dairy, Gwarighat,
6
calves Jabalpur
Treatment with Withanolide Cow Military Dairy Farm, Barela,
6
@10ml/day in 1st week & calves Jabalpur
3
subsequently at weekly interval Buffalo
LSF, Adhartal, COVS, Jabalpur 6
for 90days, orally calves
LSF, Adhartal, COVS, Jabalpur
Treatment with Stenot Cow
and Military Dairy Farm, Barela, 6
@300mg/day in 1st week & calves
4 Jabalpur
subsequently at weekly interval
Buffalo
for 90days, orally LSF, Adhartal, COVS, Jabalpur 6
calves

Table 2. Normal reported characteristics of various immunoglobulins.

IgM IgE , IgM

Immunoglobulin IgA, IgG,IgD IgA
(Pantomeric form) (Monomeric form)
Molecular weight 900 (KD) 190-200 (KD) 180 -150 (KD) 100-70 (KD)

88
 Buffalo Bulletin (June 2009) Vol.28 No.2

Table 3. Levels of IgM, IgG and IgA at different intervals in neonatal buffalo calves and cow calves as
determined through ELISA.

IgM IgG IgA

Time Interval Animals
(mg/ml) (mg/ml) (mg/ml)
Before Colostrums Bc 0.262± 0.05 3.9±0.3* 1.9 ±0.3
Feeding Cc 0.354±0.03 12.41±0.5 2.7±0.3
6 h post colostral Bc 0.225 ± .07 5.99± 0.4* 2.0 ± 0.4*
Feeding Cc 0.389±0.03 14.7± 0.5 5.2±0.52
Bc 0.205 ± .015 7.71± 0.3* 1.85 ± 0.1*
1st day
Cc 0.36±0.02 15.00±1.1 7.9±0.7
Bc 0.345 ± .019 8.95±0.17* 2.9 ±0.21*
2nd day
Cc 0.326±0.02 12.94±0.3 8.5±0.22
Bc 0.176 ±. 054* 8.62±0.44* 2.21 ± 0.26*
3rd day
Cc 0.32±0.02 14.26±0.4 6.3±0.4
Bc 0.155±0.01* 7.59± 0.4* 1.95 ± 0.3*
4th day
Cc 0.35±0.98 13.01±0.8 5.74±0.24
Bc 0.703±0.04* 8.30± 03* 1.43 ± 0.01*
5th day
Cc 0.4±0.02 14.39±0.7 7.05±0.3
Bc 0.213±0.015 8.75± 03* 1.05 ± 0.1*
6th day
Cc 0.37±0.014 13.53±0.5 2.03±0.3
Bc 0.216 ± 0.01 9.63± 0.4* 1.16 ± 0.1
14th day
Cc 0.35±0.03 13.92±8.2 1.72±0.2
Bc 0.613 ±0253 9.32±0.05* 1.50 ± 0.13
28th day
Cc 0.414±0.03 13.48±0.6 2.37±0.18
Bc 0.162 ± 0.06 10.28±0.13 1.31 ± 0.3
56th day
Cc 0.39±0.022 13.8±1.2 3.2±0.2
Bc 0.364±0.017 7.98± 0.2 1.7± 0.3*
90th day postnatal
Cc 0.35±0.07 8.6±0.4 6.01±0.4

*(P<0.05) Bc- Buffalo calves Cc- Cow calves

Table 4. PAGE of the sera samples of neonatal buffalo calves and cow calves before colostrum feeding.

Ani- Treat- 1st Band 2nd Band IgD, 3rd Band 4th Band 5th Band
mals ment IgM, IgE, IgG IgG IgD, IgA IgA IgA
M.W. M.W. M.W. M.W M.W.
Density Density Density Density Density
(KD) (KD) (KD) (KD) (KD)
Bc
Consolidated
Control 165±.2 162071 109±.5 607381 71±.2 467164.5 58±.5 45±.2 904912
~3rd band
Consolidated
Cc Control 188±1 151047 133±.6 238935 78±.4 826697 62±.5 45±1 2863662
~3rd band

M.W.-Molecular Weight Bc- Buffalo calves Cc- Cow calves

89
 Table 5. PAGE of the sera samples of the neonatal buffalo calves and cow calves from first day to 7th day post-colostrum feeding.

Ani Type of 1st Band IgM, IgE,

2nd Band IgD, IgG 3rd Band IgD, IgA 4th Band IgA 5th Band IgA
mals Treatment Ig G
M.W. M.W. M.W. M.W. M.W.
Density Density Density Density Density
(KD) (KD) (KD) (KD) (KD)
186±17- 720012 - Consolidated
697656- 149±2- 742600- 111±22 84±1- 72±2± 759664-
Bc Control 204±3 Consolidated ~3rd band-
91957 151±14 1779988 122±4 86±13 86 ±13 1621663
~2nd band 95034
Consolidated
211±4.2- 174116- 147±3- 1012613- 129±4- 94±5- 212258- 6 7 ±2 - 94634-
Neem oil ~2nd band-
213±5 777626 160±.1 123723 136±.5 104±2 1344121 83 ±2 854329
108798
Buffalo Bulletin (June 2009) Vol.28 No.2

210±3.5- 99951.5- 149±3- 68743.5- 116±2.5- 59898- 85±2- 157310- 77±.02- 75558-
Stenot
215±1 727694 163±.8 1108750 131±10 96638.5 107±2 1455379 91±.1 1083802
Consolidated
217±1- 106520- 144±2- 118142 131±3- 91±1- 199019- 6 5±3 - 885926-
Withanolide ~2nd band-
263±7 1236333 200±6 1309392 158±5 110±.9 1737310 78 ±2 119911

90
144726
459954-
203±5- 312455- 119±.6- 84±.3- 343111 66±6- 521234
Control 140897- 143±7- Consolidated
207±6 4769332 137±11 84±8 533880.5 76 ±3 656151.5
2811634 150±.5 ~2nd band
Consolidated
212±3- 140897- 143±7 1922238- 127±1- 84±8 343111 75±2- 429868-
Neem oil ~2nd band-
213±3 727137 148±3 4769332 137±11 96±4 729365 76 ±3 521234
Cc 63932.
202±6- 113807 150±.9- 49999 125±3- 55037 90±1- 138816.5 67±2- 70428
Stenot
222±3 650233.5 161±4 254178 137±8 170478.5 111±2 1066454 85 ±1 614047.5
Consolidated
221±2- 66577.5 149±.8- 43064 127±1- 95±4- 137544.5 70±.5- 96149
Withanolide ~2nd band-
247±19 1271859 182±10 3445281 135±13 100±2 2693535 78 ±4 1084529
97946

M.W.-Molecular Weight Bc- Buffalo calves Cc- Cow calves

 Table 6. PAGE of the sera samples of the neonatal buffalo calves and cow calves from fifteenth day to thirty days post-colostrum feeding.

Type of 1st Band 2nd Band IgD, 3rd Band 4th Band 5th Band 6th Band
Animals
Treatment IgM, IgE, IgG IgG IgD, IgA IgA IgA IgA
M.W. M.W. M.W. M.W. M.W. M.W.
Density Density Density Density Density Density
(KD) (KD) (KD) (KD) (KD) (KD)
269359- No
153±30- 230117 164±7- 317632- 123±8 273119 89±8- 68±8- 230720- No Band
Control Consolidated Band-
Bc 186±9 403748 173±1 1332887 125±9 700726 90± 9 6 7± 8 1245365 --
~3rd band 34±.1
Consolidated Consolidated 39±.5-
281±44- 43430- 161±4- 68766- 133±6- 78±2- 84018- 72±7- 1600718-
Neem oil ~2nd band- ~4th band- 5 9±2 1
295±3 918159 164±1 105283 136±4 93± 8 125366 88±29 183636
1446542 117781
Consolidated
262±3- 166436- 141±6- 120636- 130±5- 59549- 7 5 ±1 178398- 68±7- 35.2±.2- 160695-
Stenot ~4th band-
279±5 627400 177±3 518396 144±2 1313022 9 0±8 525150.5 78±24 5 8± 23 981385
133618
Consolidated
210±3- 79495- 170±.5- 142010- 143±1- 155928- 88±3- 102970- 73±4- 36±.1- 153499-
Withanolide ~4th band
256±8 315000 203±2 522006 145±.5 341323 9 8 ±5 281221 88±12 5 3 ± 12 1746035

91
2177218
Consolidated 169437 - No
227±12- 96613- 152±1- 241±1- 125±8- 68±2- 192983- 63±9-
Control ~2nd band Consolidated Band- No Band
264±3 349918 167±9 409081 131±2 96 ± 2 1964428 69±24
1094290 ~ 4th band 5 6 ± 18
302±9- 152364- 162±3- 545648- 139±.2- 105480- 89±5- 546151- 76±3- 132718- 41±.2- 1420650-
Neem oil
318±16 780208 189±6 744906 169±9 962128 104±2 56981 79±47 20452 5 7± 3 5 183629
Cc Consolidated 66±2-
228±15- 94485- 143±4- 32205- 131±9- 106012- 81±9- 94049- 41±3- 123602
Stenot ~3rd band- 74±23
280±5 445303 149±9 774690 138±2 1513097 8 7 ±2 155836 67 ± 1 7 2543252
124674
Consolidated No No
266±4- 129992- 161±2- 45514- 131±8- 170158- 87±7- 10254- 73±4-
Withanolide ~4th band- Band- Band-
285±2 504340 168±7 122578 133±6 674581 9 6± 4 91930 7 5± 8
2926417 7 0 ±1 116310

M.W.-Molecular Weight Bc- Buffalo calves Cc- Cow calves

Buffalo Bulletin (June 2009) Vol.28 No.2
 Table 7. PAGE of the sera samples of the neonatal buffalo calves and cow calves from sixty to ninety days post-colostrum feeding.

Immuno- 1st Band 3rd Band 4th Band 5th Band 6th Band
A n im a l s 2nd Band IgD, IgG
modulators IgM, IgE, IgG IgD, IgA IgA IgA IgA
M.W. M.W. M.W. M.W. M.W. M.W.
Density Density Density Density Density Density
(KD) (KD) (KD) (KD) (KD) (KD)
Consollidated No No
268±4- 75681- 175±7- 138±7- No Band 96±.6- 91222- 68±.2- 141786-
Bc Control ~2nd band- Band- Band-
278±14 110856 218±5 172±1 -57151 109±3 719129 76±.5 63112
74118 37±.58 1503289
325±.14- 129246- 177±.1- 80207- 111±11- 42695- 82±5- 93717- 53±5- 112061- 35±.01- 510020-
Neem oil
337±2 614041 177±9 482133 139±.2 174905 90±.5 791110 63±.2 124540 40±.02 1801107
Consollidated
Buffalo Bulletin (June 2009) Vol.28 No.2

228±1- 97498- 162±2- 55±5- 77441.5- 83±.06- 103224- 60±1- 113846.5- 34±.8- 549700-
Stenot ~2nd band-
294±2 291295 177±6 116±6 88707 127±1 126672 87±.8 196227 37±.3 2615860
100222
Consollidated 84671.5-
256±7- 104331- 172±.8- 142±.7- 108±6- 90507.5- 67±5- -76636.5- 42±.2- 50581-
Withanolide ~2nd band- Consollidated
290±4 106306 194±5 159±4 112±2 92513 71 ±4 104569 51±1.1 93541
164471 ~4th band

92
Consollidated No No
179±2- 77114- 170±5- 140± .3- No Band- 97±2- 130952- 69±2- 132483-
C ontr ol ~2nd band- Band- Band-
278±10 80451 181±1 155±10 9770 104±5 742540 7 8 ±2 152021
81475 39±.1 1623260
Neem oil 330±16 370151.5 163±4 57510 125±9 196715.5 96±13 281498.5 71±12 1419084 56±10 1096016
Cc Consollidated
293±2- 105802- 178±1- 131±5- 135860- 39±1- 116853- 62±2- 127176 43±.1- 542953-
Stenot ~2nd band-
259±9 120224 179±2 147±14 860446 98 ±4 146313 70±2 155414.5- 51±.2 95577
109716
135217.5-
222±13- 125026- 175±2- 44549- 143±.1- 104±4- 69893- 74±4- 86886.5- 56±.2- 52136-
Withanolide Consollidated
281±1 96490.5 187±8 94987.5- 151±6 110±4 126156.5 82±6 148255.5 67 ± 3 82573.5
~4th band

M.W.- Molecular Weight Bc- Buffalo calves Cc- Cow calves

 Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 1. Electrophoregram of neonatal buffalo calves’ and cow calves’ serum immunoglobulins (days 1 to 7).

Figure 2. Electrophoregram of neonatal buffalo calves’ and cow calves’ serum immunoglobulins (days 15 to
60).

93
Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 3. Electrophoregram of neonatal buffalo calves’ and cow calves’ serum immunoglobulins (days 60 to
90).

ACKNOWLEDGEMENTS Jain, A.K., I.J. Sharma, M.A. Quadri, R.K. Tripathi,

R.G. Agrawal and A. Mishra. 2007.
The authors gratefully acknowledge the Comparativefeature of buffalo’s and cow’s
financial help given by the ICAR, New Delhi under colostrum vis-a-vis their sera samples. Indian
ad-hoc project P-326. J. Dairy Sci., 60: 199-201.
Richard, A.G., J.K. Thomas and A.O. Barbara. 2000.
Kuby Immunology, 4th ed. W.H. Freeman and
Co., New York. 115-147.
REFERENCES
Snedecor, G.W. and W.G. Cochran. 1994. Statistical
Methods, 7th ed. Oxford & IBH Pub. Co.,
Ananthnarayan, R. and S.K.J. Paniker. 2003.
New Delhi. 312-317.
Antibodies- Immunoglobulins. In Text Book
of Microbiology. Orient Longman Pvt., Ltd.,
Hyderabad. 82-84.

94

CYTOGENETIC STUDIES ON THE CHROMOSOMES OF TODA BUFFALOES
N. Murali*, P. Devendran and S. Panneerselvam
ABSTRACT
Karyological studies and sister chromatid
exchange analysis were carried out in Toda
buffaloes stationed at the Sheep Breeding Research
Station, Sandynallah, Ooty, Tamil Nadu. Mitosis was
induced by pokeweed mitogen in short term
leucocyte cultures and bromodeoxyuridine was
incorporated in the cultures to elucidate the sister
chromatid exchanges. The modal chromosome
number was found to be 50 (2n) as in other river
type buffaloes, and the relative length of
chromosomes ranged between 7.12 + 0.01 and 2.51
+ 0.34. The mean sister chromatid exchange
frequency was 7.8 + 0.23, and the data on SCE
frequency was found to follow the Poisson
distribution.
Keywords: river buffalo, Toda buffalo,
chromosomes, relative length, sister chromatid
exchange
INTRODUCTION
The preference of buffaloes as milch
animals in India is increasing over the years as they
are considered to be a better converter of fibrous
feeds into milk, more resistant to diseases and better
adapted to local climatic conditions. Buffaloes
contribute more than 54 percent to the total milk
production in India. Buffalo cytogenetics could serve
as an essential tool in implementation of breeding
programmes, particularly in screening bulls used for
artificial insemination programmes. Systematic
cytogenetic investigation of breeding problems of
Department of Animal Genetics and Breeding, Veterinary College and Research Institute, Namakkal, Tamil
Nadu, India, *E-mail: murali_vet@rediffmail.com
95
Buffalo Bulletin (June 2009) Vol.28 No.2
buffaloes is still lacking, and hence most of the
aberrations have escaped our attention.
Toda buffaloes, named after an aboriginal
tribe the Toda of South India, are a genetically
isolated group of animals found in the Nilgiris district
of Tamil Nadu, India. This the only breed of buffalo
being reared in this high rainfall and high altitude
region has some phenotypic resemblance to the
swamp buffaloes, but based on karyological studies,
it is classified under the river buffalo (Nair et al.,
1986).
This paper presents the karyotype, relative
length of the chromosomes and sister chromatid
exchange (SCE) frequency of Toda buffaloes.
MATERIALS AND METHODS
Blood samples were collected in vacutainers
containing sodium heparin from seventeen male and
three female Toda buffaloes maintained at the Sheep
Breeding Research Station, Sandynallah, Ooty, Tamil
Nadu, India. All the animals were apparently healthy
and were above the age of 18 months. The cultures
were set up using RPMI 1640 culture medium and
buffy coat and autologous plasma from the blood
samples. Mitosis was induced by the incorporation
of pokeweed mitogen (10 μg/ml), and the cultures
were incubated at 37.5oC for 72 h. The cultures
were harvested with colchicine followed by
hypotonic treatment (0.075 M KCl) and fixed in
methanol: acetic acid (3:1). Air-dried slides were
prepared and stained in 2 percent Giemsa (Kumar
and Yadav, 1991). About 25 metaphase spreads were
screened for chromosome complement. Those
spreads with clear staining and non-overlapping
chromosomes were photographed (x 1000) for the
Buffalo Bulletin (June 2009) Vol.28 No.2
preparation of karyotypes and measuring relative
length of the chromosomes.
Simultaneously, duplicate cultures were
incubated with the incorporation of the
bromodeoxyuridine (BrdU: 10 μg/ml) at 20 h of
incubation and the samples were also harvested as
per standard protocol (Iannuzzi et al., 1988). Air-
dried slides were prepared, stained in Hoechst 33258
(10 μg/ml) for 15 minutes, incubated in 2x SSC buffer
at 60oC for 1 h, exposed to sunlight in the same
buffer and stained in 2 percent Giemsa (Perry and
Wolff, 1974). About 25 metaphase spreads with
complete chromosome complement and appreciable
sister chromatid differentiation were counted for
each animal to arrive at the mean SCE frequency.
RESULTS AND DISSCUSSION
The chromosomal complement revealed a
diploid chromosome number (2n = 50) and the
morphology resembles (first 5 pairs were
submetacentric and the remaining 19 pairs were
acrocentric) that of the river buffaloes (Nair et al.,
1986; Iannuzzi, 1994). The relative length of
chromosomes ranged between 6.74 + 0.04 and 2.02
+ 0.00 (Table 1) and the ideogram is presented in
Figure 1. The Y chromosome was one of the small
acrocentrics and not always identifiable whereas the
X chromosome was the largest acrocentric and was
easily recognised in all metaphase spreads. The
metaphase spread with complete chromosome
complement and the karyotype are presented in
Figures 2 and 3 respectively.
The comparative relative length of the
chromosomes (from the longest to shortest) of
Murrah, Surti and Mehsana were reported to range
from 6.73 + 0.28 to 2.24 + 0.19, 6.92 + 0.35 to 2.21
+ 0.24 and 6.46 + 0.23 to 2.23 + 0.16 respectively
(Kumar and Yadav, 1991). Gupta and Chaudhuri
96
(1978) reported the relative length of Indian Murrah
buffaloes to range between 7.42 + 0.08 and 1.69 +
0.08 and Joshi and Govindaiah (1997) reported in
South Kanara buffaloes of Karnataka as 6.8 + 0.17
for the longest and 1.92 + 0.7 for the shortest
chromosome and these reports are comparable to
the results obtained in the present study in Toda
buffaloes.
The mean SCE frequency was estimated
as 7.8 + 0.23. The longer submetacentric
chromosomes were observed to carry a greater
number of exchanges when compared to the
autosomal acrocentrics. The distribution of the SCEs
was found to follow Poisson distribution. The
metaphase spreads with SCEs in chromosomes of
Toda buffalo are presented in Figure 4.
The SCE test has been used to detect the
genome stability in most livestock species like cattle
(Ciotola et al., 2005), sheep (Di Meo et al., 2000)
and pigs (Peretti et al., 2006). However, studies in
buffaloes are comparatively few. The mean SCE
frequency in indigenous buffaloes was reported to
be 7.61 + 0.18 (Joshi et al., 1996) and 3.66 per cell
(Vijh et al., 1991) in Murrah buffaloes, 5.56 per cell
(Vijh et al., 1995) in Bhadawari buffaloes and 14.05
+ 0.12 (Murali et al., 1998) in Surti buffaloes. A
detailed study of SCE in chromosome of river
buffaloes reared in southern Italy revealed a mean
SCE frequency of 8.8 + 3.4 (Iannuzzi et al., 1988).
The base line SCE frequency in Beheri and Saidi
breed of Egyptian water buffaloes was reported as
8.3 + 1.1 and 7.76 + 0.8 respectively (Ahmed, 2001).
The observations made in the present study and the
data on SCE in the literature suggest that the SCEs
in the chromosomes of buffaloes have a wide range
and hence the technique has to be standardised in
each laboratory so as to utilise it for assessing the
effect of external agents.
 Buffalo Bulletin (June 2009) Vol.28 No.2

Table 1. Relative length (mean + s.e.) of chromosomes of Toda buffalo.

Chromosome Mean ± S.E.

1 6.74 ± 0.04
2 6.34 ± 0.04
3 6.17 ± 0.08
4 5.53 ± 0.02
5 4.45 ± 0.18
6 4.56 ± 0.01
7 4.35 ± 0.02
8 4.03 ± 0.05
9 3.86 ± 0.03
10 3.79 ± 0.01
11 3.74 ± 0.00
12 3.60 ± 0.02
13 3.56 ± 0.02
14 3.48 ± 0.02
15 3.30 ± 0.00
16 3.07 ± 0.01
17 2.88 ± 0.07
18 2.82 ± 0.08
19 2.78 ± 0.06
20 2.70 ± 0.02
21 2.54 ± 0.01
22 2.32 ± 0.08
23 2.18 ± 0.05
24 2.02 ± 0.00
X 6.40 ± 0.00
Y 2.79 ± 0.03

97
Buffalo Bulletin (June 2009) Vol.28 No.2

98
 Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 2. Metaphase spread (x 1000) of Toda buffalo (male).

Figure 3. Karyotype of male Toda buffalo.

99
Buffalo Bulletin (June 2009) Vol.28 No.2
Figure 4. Sister chromatid exchange (SCE) in chromosomes of Toda buffalo (x 1000).
REFERENCES
Ahmed, S. 2001. Sister chromatid exchanges in
Egyptian water buffalo. Buffalo J., 1 : 129-
136.
Ciotola, F., V. Peretti, and G.P. Di Meo. 2005. Sister
chromatid exchanges (SCEs) in the Ageroles
cattle population. Vet. Res. Commun., 29: 359-
361.
Di Meo,G.P., A. Perucatti, and D. Fornataro. 2000.
Sister chromatid exchange in chromosome of
sheep (Ovis aries). Cytobios, 101: 71-78.
Gupta, P. and S.P.R. Chaudhuri. 1978. Robertsonian
changes in the chromosomes of Indian Murrah
buffalo (Bubalus bubalis). The Nucleus, 21:
90-97.
Iannuzzi, L. 1994. Standard karyotype of the river
buffalo (Bubalus bubalis L., 2n=50). Report
of the committee for the standardisation of
banded karyotypes of the river buffalo.
Cytogenet Cell Genet., 67: 102-113.
Iannuzzi, L., A. Perucatti, G.P. Di Meo and L.
Ferrara. 1988. Sister chromatid exchange in
chromosomes of river buffalo (Bubalus
bubalis L.). Caryologia, 41: 237-244.
Joshi, S.K. and M.G. Govindaiah. 1997. Karyological
studies in South Kanara buffaloes of
Karnataka. Indian Vet. J., 74: 1037-1039.
100
Joshi, S.K., M.G. Govindaiah and M.R. Jayashankar.
1996. Sister chromatid exchanges (SCEs) in
Murrah buffaloes. Indian J. Dairy Sci., 49:
156-159.
Kumar, P. and B.R. Yadav. 1991. Comparative
cytogenetic studies in Mehasana, Murrah and
Surti buffaloes. Indian J. Dairy Sci., 44: 2.
Murali, N., V. Thiagarajan and A.M. Nainar. 1998.
Effect of industrial pollution on sister chromatid
exchanges frequency in buffaloes. Indian J.
Anim. Sci., 68: 659-661.
Nair, P.G., M. Balakrishnan and B.R. Yadav. 1986.
The Toda buffaloes of Nilgiris. Buffalo J., 2:
167-178.
Peretti, V., F. Ciotola, C. Dario, S. Albarella, G.P. Di
Meo, A. Perucatti, V. Barbieri and L. Iannuzzi.
2006. Sister chromatid exchange (SCE) for
the first time in Casertana pig breed.
Hereditas, 143: 113-116.
Perry, P. and S. Wolff. 1974. New Giemsa method
for the differential staining of sister
chromatids. Nature, Lond., 251: 156-158.
Vijh, R.K., R. Sahai and A. Sharma. 1991. Sister
chromatid exchanges in Murrah buffaloes.
Indian J. Anim. Sci., 61: 991-993.
Vijh, R.K., R.K. Pundir and R. Sahai. 1995. Base
line SCE frequency in Bhadawari buffaloes
(Bubalus bubalis). Indian J. Dairy Sci., 48:
660-663.

ISOLATION, CULTURE AND CHARACTERIZATION OF ENDOMETRIAL EPITHELIAL CELLS
IN BUFFALO (BUBALUS BUBALIS)
S. Mondal*, S. Nandi, I.J. Reddy and K.P. Suresh
ABSTRACT
In the present study, the authors isolated and
developed the culture of endometrial epithelial cells
from buffalo uterus as well as evaluated functional
properties of epithelial cells. In primary culture,
epithelial cells appeared cuboidal or columnar and
showed contact inhibition at the stage of confluence.
Protein and DNA concentrations were found to
increase with the time in culture. PGF 2α
concentrations declined from 7.25±2.02 pg/μg DNA
on Day 3 of culture to 6.33±1.80 pg/μg DNA on
Day 5 of culture and thereafter to 2.98±1.09 pg/μg
DNA on Day 7 of culture in endometrial epithelial
cells. It was concluded that buffalo endometrial
epithelial cells could serve as an excellent model for
studying the specific role of PGF2α in maternal
recognition of pregnancy and implantation.
Keywords: epithelial, PGF2α, buffalo
INTRODUCTION
Early embryonic mortality is the main source
of reproductive wastages in domestic ruminants
including buffalo. The interaction between the
embryo and the maternal unit is a prerequisite to
maternal recognition of pregnancy, implantation and
parturition (Thatcher et al., 1985). During early
pregnancy, the growing embryo solely depends on
uterine microenvironment for survival and growth
as the uterine environment undergoes continual
modifications to cope the needs of the embryo. If
the embryo fails to signal its presence during this
period (days 12-18 of pregnancy), because of lack
of synchrony between uterine environment and the
National Institute of Animal Nutrition and Physiology Adugodi, Bangalore - 560 030, India, *E-mail:
sukanta781@gmail.com
101
Buffalo Bulletin (June 2009) Vol.28 No.2
embryo, premature expulsion of embryo occurs. In
ruminants, endometrial production of prostaglandins
(PGs) plays important roles in ovulation, luteolysis,
implantaion, decidualization and parturition (Poyser,
1995; Dubois et al., 1998). The endometrial epithelial
and stromal cells have specific morphological and
functional properties. Epithelial cells preferentially
produce PGF 2α whereas stromal cells produce
mainly PGE2 (Fortier et al., 1988; Asselin et al.,
1997). PGF2α acts as the luteolytic agent (Bazer et
al., 1994) to control the estrous cycle in ruminants.
In contrast, PGE2 protects the corpus luteum (CL)
from the spontaneous regression (Magness et al.,
1981) and helps in the maintenance of pregnancy. It
enhances endometrial vascular permeability at the
sites of blastocyst apposition and decidualization
(Kennedy and Lukash, 1982; Keys and Kennedy,
1990). PGE2 also plays a major role in blastocyst
hatching (Baskar et al., 1981) and implantation
(Holmes and Gordashko, 1980). Recently, in vivo
and in vitro studies have evaluated the regulation
of PG production, interactions between immune and
endocrine factors in the bovine uterus and
interactions between embryo and endometrium. In
spite of having many advantages, in vivo studies
are not suitable for examining some aspects of
autocrine and/or paracrine mechanism in uterus. A
major drawback of the in vivo situation is that local
effects at the site of interaction may be masked by
the anatomical complexity of the genital tract.
Therefore, to study the local mechanism involved in
PG synthesis, luteolysis and maternal recognition of
pregnancy, it is essential to isolate and culture
endometrial epithelial cells.
Although both kinds of endometrial cells can
produce PGF2α, they have different morphological
and physiological properties (Fortier et al., 1988;
Buffalo Bulletin (June 2009) Vol.28 No.2
Asselin et al., 1997; Skarzynski et al., 2000).
Therefore, to investigate the functions of endometrial
cells, it is essential to isolate a pure population of
epithelial cells. However, it is difficult to separate a
population of endometrial cells of one type that is
not contaminated with endometrial cells of another
type or with other cells present in buffalo uterus
such as fibroblasts or vascular endothelial cells. The
objective of the present study was to evaluate the
morphological and functional characteristics of
primary culture of epithelial cells isolated from
buffalo uterus.
MATERIALS AND METHODS
Isolation of endometrial epithelial cells
Buffalo uteri were collected from the local
abattoir immediately after slaughter and transported
to the laboratory on ice. Based on colour,
vasculature, size and consistency of corpus luteum
(Arosh et al., 2002; Verma-Kumar et al., 2004), the
stages of estrous cycle were classified. Uteri of mid
estrous cycle (Days 5-10 of the cycle) were used in
this study. The epithelial cells from the buffalo
endometrium were separated by the method of
Skarynski et al. (2000) with slight modification.
Briefly, the uterine lumen was washed three times
with sterile Ca2+and Mg2++ free Hank’s Balanced
Salt Solution (HBSS) supplemented with 100 IU/ml
gentamycin and 0.1 % BSA. The ends of the uterine
horn ipsilateral to corpus luteum were tied in order
to retain the trypsin solution for solubilizing the
epithelial cells. Fifteen to twenty milliliters of sterile
HBSS containing 0.3 % trypsin was then infused
into the uterine lumen. Epithelial cells were isolated
by incubation at 37 oC for 60 minutes. The cell
suspension obtained from the digestion was filtered
through a plastic strainer (70 μM) to remove
undissociated tissue fragments. The filtrate was
washed 3 times with HBBS supplemented with
gentamycin and 0.1 % BSA by centrifugation at
600x g for 10 minutes. The number of viable cells
that excluded Trypan blue was counted using a
haemocytometer.
102
Culture of endometrial epithelial cells
After cell counting and viability determination,
the epithelial cells were seeded at the rate of 1x105
viable cells in RPMI 1640 medium at 38.5oC in
presence of 5 % CO2 for 7 days. The viability of
epithelial cells at the time of plating was greater than
90 %. The medium was changed every 2-3 days
until the confluency was reached.
Recovery of cells, proteins and DNA
measurements
Cells were harvested on Day 3, Day 5 and
Day 7 of culture after washing three times with
DPBS and centrifugation at 500xg for 15 minutes.
Growth was estimated by measuring the levels of
protein with folin-phenol reagent (Lowry et al.,
1951) and of DNA by the diphenylamine method
(Burton et al., 1956) in the cell pellet.
Determination of PGF2αα
The concentrations of PGF 2α were
determined in 50 μl aliquots of culture medium after
10 fold dilution with extraction buffer using ELISA
kits supplied by Neogen, USA. The sensitivity of
the assay was 0.002 ng/ml. The cross reactivity of
the antisera against 6-keto prostaglandin F1α, 13, 14
dihydro-15 keto-prostaglandin F2α, prostaglandin D2
and prostaglandin E2 were 3.05 %, 0.05 %, 0.05 %
and <0.01 %, respectively. The intra- and inter-assay
coefficients of variation were less than 15 %. Data
were analyzed for descriptive statistics and
significance has been obtained by using the Repeated
Measures Analysis of Variance (SPSS 16.0).
RESULTS AND DISCUSSION
After trypsin dispersion, the epithelial cells
were released as single cells or clumps of different
sizes (Figure 1). These cells began to attach to culture
dishes within 24-48 h after seeding and reached
confluence after 6 to 7 day in culture. In primary
culture, epithelial cells exhibited cuboidal or columnar
morphologies (Figure 2) and showed contact
inhibition at the stage of confluence (Figure 3). The
patterns of cellular growth were evaluated by
proteins and DNA profiling (Table 1). Protein

concentrations have been found to increase with the
time in culture. Similarly, DNA concentrations
increased progressively from Day 3 to Day 5 and
then to Day 7 of culture. PGF 2α concentrations
decreased from 7.25±2.02 pg/μg DNA (n=6) on Day
3 of culture to 6.33±1.80 pg/μg DNA (P=0.778; n=6)
on Day 5 of culture and thereafter to 2.98±1.09 pg/
μg DNA (P=0.039; n=6) on Day 7 of culture.
To the best of our knowledge, this is the
first study to report the isolation, culture and
characterization of endometrial epithelial cells in
buffalo. Epithelial cells from uterine endometrium
have been separated and cultured for several species
including human (Liu and Tseng, 1979), rat
(McCormack and Glasser, 1980), rabbit
(Gerschenson et al., 1981, Fortier et al., 1987),
cattle (Fortier et al., 1988) but not buffalo. In this
study, we report the separation and culture of
epithelial cells from buffalo endometrium using
modifications of method previously described for
cattle (Skarynski et al., 2000). Endometrial epithelial
cells in buffalo were cuboidal or columnar
morphologies, which agrees with the earlier report
by Fortier et al. (1988) in cattle. The pattern of
protein and DNA in buffalo endometrial culture
Figure 1. Photomicrograph of endometrial epithelial cells 36 h after plating, magnification X 10.
103
Buffalo Bulletin (June 2009) Vol.28 No.2
confirms the results of Fortier et al. (1988) in terms
of increase in protein and DNA content with the
time in culture in cattle. The characterization of these
cells using immune-histochemistry, electron
microscopy or antibody labeling is not available in
this species. The function of endometrial epithelial
cells is important in order to explore the basic
information of implantation and pregnancy.
However, the tissues may act alone or in concert
and through their specific prostaglandin synthetic
capabilities on vascular permeability (Kennedy,
1980; 1985) and blood flow (Ford et al., 1979), which
are altered before implantation or at the time of
maternal recognition of pregnancy. Similarly, the
involvement of epithelial cells of the endometrium
with the luteolytic process during maternal
recognition of pregnancy needs to be characterized
in buffalo.
In conclusion, we have developed isolation
and culture of buffalo endometrial epithelial cells that
maintain their morphological characteristics and
secrete PGF2α. This system can be used for studying
the specific role of PGF2α in maternal recognition of
pregnancy and implantation.
Buffalo Bulletin (June 2009) Vol.28 No.2

Figure 2. Endometrial epithelial cells on Day 5 of culture, magnification X 40.

Figure 3. Endometrial epithelial cells at the stage of confluence on Day 7 of culture, magnification X
10.

104

Table 1. Growth pattern of endometrial epithelial cells in culture.
Protein
Day of culture
(μg/25 μl)
Day 3 6.55±1.54a
Day 5 21.30±0.89ab
Day 7 41.13±0.59bc
Significance F = 6.882; P = 0.013
Non-identical superscripts are significant at 5 % level of significance.
ACKNOWLEDGEMENTS
We thank the director, NIANP, for providing
the necessary facilities to carry out the research
work. The help rendered by S. Selvakumar is
gratefully acknowledged.
REFERENCES
Arosh, J.A., J. Parent, P. Chapdelaine, J. Sirois and
M.A. Fortier. 2002. Expression of
cyclooxygenases 1 and 2 and prostaglandin E
synthase in bovine endometrial tissue during
the estrous cycle. Biol. Reprod., 67: 161-169.
Asselin, E., P. Drolet and M.A. Fortier. 1997.
Cellular mechanisms involved during oxytocin-
induced prostaglandin F 2α production in
endometrial epithelial cells in vitro: role of
cyclooxygenase-2. Endocrinology, 138:
4798-4805.
Bazer, F.W., T.L. Ott and T.E. Spencer. 1994.
Pregnancy recognition in ruminants, pigs and
horses: signals from the trophoblast.
Theriogenology, 41: 79-94.
Baskar, J.F., D.F. Torchiana, J.D. Biggers, E.J.
Corey, N.H. Anderson and N. Subramanian.
1981. Inhibition of hatching of mouse
blastocyst in vitro by various prostaglandin
antagonists. J. Reprod. Fertil., 63: 359-363.
Burton, K. 1956. A study of the conditions and
mechanisms of diphenylamine reaction for the
colorimetric estimation of DNA. Biochem. J.,
62: 315-322.
105
Buffalo Bulletin (June 2009) Vol.28 No.2
DNA
(μg/25 μl)
10.63±1.02a
13.87±0.55b
16.28±1.46c
F = 211.819; P < 0.001
Dubois, R.N., S.B. Abramson, L. Crofford, R.A.
Gupta, L.S. Simon, L.B. Van De Putte and
P.E. Lipsky. 1998. Cyclooxygenase in biology
and disease. FASEB J., 12: 1063- 1073.
Ford, S.P., J.R. Chenault and S.E. Eckternkamp.
1979. Uterine blood flow of cows during
oestrous cycle and early pregnancy: effect of
the conceptus on the uterine blood supply. J.
Reprod. Fertil., 56: 53-62.
Fortier, M.A., M. Boulanger, A.P. Boulet and R.D.
Lambert. 1987. Cell specific localization of
prostaglandin E2 sensitive adenylate cyclase
in rabbit endometrium. Biol. Reprod., 36:
1025-1033.
Fortier, M.A., L.A. Guilbault and F. Grasso. 1988.
Specific properties of epithelial and stromal
cells from the endometrium of cows. J.
Reprod. Fertil., 83: 239-248.
Gerschenson, L.E., J.R. Depaoli and J.T. Murai.
1981. Inhibition of estrogen induced
proliferation of cultured rabbit uterine epithelial
cells by a density-dependent factor produced
by the same cells. J. Steroid Biochem., 14:
959-969.
Holmes, P.V. and B.J. Gordashko. 1980. Eviendce
of prostaglandin involvement in blastocyst
implantation. J. Embryo. Experimental
Morphol., 55: 109-122.
Kennedy, T.G. 1980. Prostaglandins and the
endometrial vascular permeability changes
preceding blastocyst implantation and
decidualization. Prog. Reprod. Biol., 2: 234-
243.
Kennedy, T.G. 1985. Evidence for the involvement
of prostaglandins throughout the decidual cell
Buffalo Bulletin (June 2009) Vol.28 No.2
reaction in the rat. Biol. Reprod., 33: 140-
146.
Kennedy, T.G. and L.A. Lukash. 1982. Induction of
decidualization in rats by the intrauterine
infusion of prostaglandins. Biol. Reprod., 27:
253-260.
Keys, J.L. and T.G. Kennedy. 1990. Effect of
indomethacin and prostaglandin-E 2 on
structural differentiation of rat endometrium
during artificially induced decidualization.
American J. Anat., 188: 148-162.
Liu, H.C. and L. Tseng. 1979. Estradiol metabolism
in isolated human endometrial epithelial glands
and stromal cells. Endocrinol., 104: 1674-
1681.
Lowry, O.H., N.J. Rosebrough, A.L. Farr and R.J.
Randall. 1951. Protein measurement with the
folin phenol reagent. J. Biol. Chem., 193: 265-
275.
Magness, R.R., J.M. Huie, G.L. Hoyer, T.P.
Huecksteadt, L.P. Reynolds, G.J. Seperich, G.
Whysong, and C.W. Weems. 1981. Effect of
chronic ipsilateral or contralateral intrauterine
infusion of prostaglandin E2 (PGE2) on luteal
function of unilaterally overiectomized ewes.
Prost. Med., 6: 389-401.
106
McCormack, S.A. and S.R. Glasser. 1980.
Differential response of individual cell types
from immature rats treated with estradiol.
Endocrinol., 106: 1634-1649.
Poyser, N.L. 1995. The control of prostaglandin
production by the endometrium in relation to
luteolysis and menstruation. Pros. Leuko.
Essen. Fatty Acids, 53: 147-195.
Skarzynski, D.J., Y. Miyamoto and K. Okuda. 2000.
Production of prostaglandin F2α by cultured
bovine endometrial cells in response to tumor
necrosis factor alpha : cell type specificity and
intracellular mechanisms. Biol Reprod., 62:
1116-1120.
Thatcher, W.W., J.J. Knickerbocker, F.F. Bartol,
F.W. Bazer, R.M. Roberts and M. Drost. 1985.
Maternal recognition of pregnancy in relation
to the survival of transferred embryos:
endocrine aspects. Theriogenol., 23: 129-
143.
Verma Kumar, S., S.V. Srinivas, P. Muraly, V.K.
Yadav and R. Medhamurthy. 2004. Cloning
of a buffalo (Bubalus bubalis) prostaglandin
F2α receptor: changes in its expression and
concentration in the buffalo corpus luteum.
Reprod., 127: 705-715.
 Instructions for Authors
Buffalo Bulletin is published by International Buffalo
Information Center under the authorization of Office of University
Library, Kasetsart University, Thailand. Contributions on any aspect
of research or development, progress report of projects and news on
buffalo will be considered for publication in the bulletin.
General editorial policies
Authorship criteria
Authorship is restricted to those who (1) have contributed
substantially to one or more of the following aspects of the work and (2)
are willing to assume public responsibility for the validity of the
work.
Copyright
Copyright to published manuscripts becomes the sole
property of International Buffalo Information Center.
Criteria for manuscript acceptance
Manuscript acceptability is based on clarity of objectives;
originality; appropriateness of the experimental design, methods and
statistical analysis; substance of the results; thoroughness with which the
results are discussed; and appropriateness of the conclusions.
Following acceptance of a paper and prior to publication, the
author will be received the acceptance letter.
Manuscript requirements
Manuscripts preparation
Manuscripts on original research in English language should
include at least the following elements.
Title
• Full title (be concise)
• Name(s) of author(s) and the first author
affiliation with complete address.
Abstract
• An abstract not exceeding 250 words; all
acronyms and abbreviations defined; no
references cited. State what, where and how it
was done, major results.
• Five key words.
Introduction. Review pertinent work, cite key references,
explain importance of the research, and state objectives of
your work.
Materials and Methods. Provide sufficient detail so work
can be repeated. Describe new methods in detail; accepted
methods briefly with references.
Use of trade names. Trade names are to be
avoided in defining products whenever possible.
Use of abbreviations and acronyms. At first text
use, define in parentheses. Do not use abbreviations and
acronyms in titles.
Results and discussion. Present results concisely using
figures and tables as needed. Do not present the same
information in figures and tables. Discuss principles and
relationship, point out exception. Show agreement with
published research work. The significances of work or
conductions should be presented in the end of discussion.
Tables. Number each table with Arabic numerals. Place a
descriptive caption at the top of each table.
Figures. (graphs, charts, line drawings, photographs)
Number each figure with Arabic numerals under the
illustration. Lettering, data lines and symbols must be
sufficiently large so as to be clearly visible when the figure
is reduced to a size commonly used in the journal.
References. List only those references cited in the text.
Required format of described below.
Reference cited format
Manuscripts should follow the name-year reference format.
Cite only necessary publications. Primary rather than secondary
references should be cited, when possible. It is acceptable to cite work
that is “in press” (i.e., accepted but not yet published) with the pertinent
year and volume number of the reference.
In text. Cite publications in text with author name and
year. Three or more authors use “et al.”. In parenthetical citations,
separate author and year with a comma. Use suffixes a, b and c to
separate publications in same year by the same author. Semi-colon
separate citations of different authors. Cite two or more publications
of different authors in chronological sequence, from earliest to latest.
For example:
….used liquid nitrogen vapour freezing technique from Verma et al.
(1975)
….liquid nitrogen vapour freezing technique (Verma et al., 1975)
…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;
Pant et al., 2002)
In reference cited. List only those literature cited in the text.
References should be listed alphabetically by the first author’s last
name. Single author precedes same author with co-authors. Type
references flush left as separate paragraphs. Do not indent manually.
Write the name of book or journal in italic letters. Use the following
format.
• Journal articles: Author(s). Year. Article title. Journal title,
volume number: inclusive pages.
Example: Citation in text: Chaudhary et al. (1981)
Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of
rumen liquor in the treatment of chronic alkaline indigestion in
cows. Indian J. Anim. Sci., 51: 356-360.
• Books: Author(s) or editor(s). Year. Title. Publishername,Place
of publication. Number of pages.
Example: Citation in text: Snedecor and Cochram. (1980)
Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7 th ed.
The Iowa State University Press, Ames, Iowa, USA. 593p.
Sattar, A. 1995. Studies on the effect of immunopotentiation of
vaccinated pregnant buffaloes and cows on neonatal antibody
titre and hematological profile. Ph. D. thesis, University of
Agriculture, Faisalabad, Pakistan. 208p.
• Chapter: Author(s) of the chapter. Year. Title of the chapter,
pages of the chapter. In author(s) or editor(s). Title of the book.
Publisher name, Place of publication.
Example: Citation in text: Sloss and Dufty. (1980)
Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy,
p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine
Obstetrics. Williams and Wilkins, Baltimore, U.S.A.
Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical
review of buffalo research and development activities in
Indonesia. Past performanceand future strategies, p. 78-89. In
Proceedings of 1 st Asian Buffalo Association Congress,
Thailand.
Submission manuscript
Submit the following items.
Cover letter. Identify the corresponding author and provide his/her
full name, address, numbers for telephone and fax, and e-mail address.
Manuscript. In 12 point Times or Times New Roman. Type on one
side of A4 paper. Use one inch margins. Number all pages. Send an
original manuscript and 1 photocopy.
Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,
containing the manuscript in Microsoft Word.
Mail manuscript to:
By post: International Buffalo Information Center
Office of University Library
Kasetsart University,
50 Pahonyothin Road, Chatuchak,
Bangkok 10900, Thailand
Tel. 66-2-942-8616
By e-mail: libibic@ku.ac.th
 Buffalo Bulletin (June 2009) Vol.28 No.2

CONTENTS
Page

Induction of estrus in true anestrus buffaloes using crestar implants alone

and in combination with PMSG.
Vivek Nayak, R.G. Agrawal, O.P.Srivastav and M.S. Thakur...........................................51

Re-utilization of crestar implants for induction of fertile estrus in true anestrus buffaloes.
Vivek Nayak , R.G. Agrawal, O.P.Srivastav and I. J. Sharma.........................................55

Dystocia due to fetal maldisposition in a buffalo.

G.K. Das, Ravi Dutt, Ravinder Kumar, S. Deori and Uma Shanker..................................59

Effect of piroxicam on the cellular response in buffalo calf skin.

Neelu Gupta, A.K. Katiyar and Madhu Swamy................................................................61

Ultrasonographic biometry of the ovary and its responses

during superovulation in Toda buffaloes.
D.V. Patel, R. Anil Kumar, M. Iyue and R. Kasiraj...........................................................67

Seroprevalence of Brucella spp. in buffaloes in the central Gujarat region of India.

M.N. Brahmabhatt, R.N. Varasada, C.D. Bhong and J.B. Nayak.....................................73

PDetection of bovine herpesvirus 1 (bhv-1) infection in semen of Indian breeding bulls

by polymerase chain reaction and its characterization by DNA sequencing.
Jain Lata, A.N. Kanani, J.H. Purohit, C.G. Joshi, D.N. Rank,
Vinay Kumar and V.K. Jain..............................................................................................76

Quantitation of serum immunoglobulins of neonatal buffalo calves and cow calves

through ELISA and page: Status of immune-competence.
Barmaiya, S., Aditi Dixit1, A. Mishra, A.K. Jain, A. Gupta, A. Paul,
M.A. Quadri, A.K. Madan and I.J. Sharma.....................................................................85

Cytogenetic studies on the chromosomes of Toda buffaloes.

N. Murali, P. Devendran and S. Panneerselvam..............................................................95

Isolation, culture and characterization of endometrial epithelial cells

in buffalo (Bubalus bubalis).
S. Mondal, S. Nandi, I.J. Reddy and K.P. Suresh..........................................................101

BUFFALO BULLETIN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688