Ijrpb Vol 1 Issue 6

Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)
Editor
B.Pragati Kumar, M.Pharm, Assistant Professor, Nimra College of Pharmacy
Consulting editor
Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy
Associate Editors
Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy
Editorial Advisory Board

Dr.Y.Narasimaha Reddy, M. Pharm., Ph D. Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal. Dr.V.Gopal, M. Pharm., Ph D.
Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6
Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy), Kerala Dr. M.Umadevi, M.Sc. (Agri), Phd
Research Associate, Tamil Nadu Agricultural University, Coimbatore
Dr. J.Balasubramanium, M. Pharm., Ph D.

General Manager, FR&D R A Chem Pharma Ltd., Hyderabad
Dr. V.Prabhakar Reddy, M. Pharm., Ph D.

Principal, Chaitanya College of Pharmacy Education & Research, Warangal
Dr.P.Ram Reddy, M. Pharm., Ph D.

General Manager, Formulation, Dr.Reddys Laboratory, Hyderabad
Dr. S.D.Rajendran, M. Pharm., Ph D. Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad
IJRPB 1(6)
www.ijrpb.com
November-December 2013
INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY Instructions to Authors

Manuscripts will be subjected to peer review process to determine their suitability for publication provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the review, manuscripts will be returned for revision along with reviewers and/or editors comments. Dont copy and paste the article content from internet or other sources like e-books etc. Authors are the sole responsible persons for the article, article content; results of the research conducted and copy right issues if any. The editor and the editorial board are not entitled to change the article content, results and diagrammatic representations which are given by authors. The article will be published only after getting the approved galley proof from the authors. Kindly follow the below guidelines for preparing the manuscript: 1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any decorative borders anywhere in the text including the title page. 2. Dont leave any space between the paragraphs. 3. Divide the research article into a. Abstract Visit us at b. Introduction www.ijrpb.com c. Materials and Methods Contact us/ send your articles to: d. Results Email: ijrpb@yahoo.com e. Discussion Phone no: 9490717845; 9704660406 f. conclusion g. References 4. References should include the following in the same order given below a) Author name followed by initials b) Title of the book/ if the reference is an article then title of the article c) Edition of the book/ if the reference is an article then Journal name d) Volume followed by issue of the journal e) Year of publication followed by page numbers 5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post or scanned attachment to ijrpb@yahoo.com. 6. Keep in touch with the editor through mail or through phone for further clarifications as well as for timely publication of your article. Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna District, Andhra Pradesh, India-521456
Printed at: F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456
IJRPB 1(6)
www.ijrpb.com
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) S.No. 1 2 Contents Authentication of traditional crop Kalongi ( Nigella sativa L.) by LAMP marker Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release tablets in QbD environment V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja Development and validation of a stability indicating HPLC method for analysis of Altretamine in bulk drug and pharmaceutical formulations M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao A review of various analytical methods on Atrovastatin N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular cancer Praveen D, Ranadheer Chowdary P Method development and validation for the simultaneous estimation of Ofloxacin and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method Y.Bhargav, K Haritha Pavani, S Amareswari Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S Method development and validation for the simultaneous estimation of Atazanavir and Ritonavir in tablet dosage form by RP-HPLC Nuli Vasavi, Afroz Patan Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats Marri Praveen, M.Janarthan Some H.R. methodology/ techniques for costs reduction in companies to improve profit M. Sarkar, B. K. Sarkar, M. D. Gora, S. C. Verma Analytical method development and validation of Artesunate and Amodiaquine hydrochloride in tablet dosage form by RP-HPLC P RajaRao, Nanda Kishore Agarwal Analytical method development and validation for the simultaneous estimation of Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by RP-HPLC Syed Shaheda, Nanda Kishore Agarwal Formulation and evaluation of herbal anti-dandruff shampoo Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel Analytical method development and validation for the simultaneous estimation of Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and Gentamycin induced nephrotoxicity in Albino rats Radha.B, Janarthan M, Durraivel S Analytical method development and validation for the simultaneous estimation of Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid chromatography M. Sumalatha, K.Haritha Pavani A new development and validated RP-HPLC method for the assay and related substances of Itraconazole in capsule dosage form Sarvani Paruchuri, Haritha Pavani K Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats Thirumala K, Janarthan M, Firasat Ali M Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride Hardeep Singh Dhaliwal, Dhruba Sankar Goswami Page No. 765-771 772-777
778-785
4 5
786-792 793-796
797-802
803-807
808-814
9 10 11
815-818 819-821 822-827
12
828-834
13 14
835-839 840-845
15
846-849
16
850-856
17
857-865
18
866-868
19
869-874
Volume 1 Issue 6
www.ijrpb.com
20
21
22
23 24 25
Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment of osteoarthritis of the knee: a randomized controlled trial Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy Analytical method development and validation for the estimation of Olmesartan medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M Modern hygienic industrial canteen amenity: A change factor for healthy physical work environment of the work force in Indian industrial units TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash Design and development of Metformin hydrochloride Trilayered sustained release tablets Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K Amlodipine: the upcoming threat to Periodontist Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets of Diltiazem hydrochloride Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3 Development and optimization of Diltiazem hydrochloride loaded microspheres by using different Eudragit polymers V. Kamalakkannan, K.S.G.Arul Kumaran Formulation, characterization and optimization of Methotrexate loaded sodium alginate chitosan Nanoparticles using 32 factorial design S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar Strategies in Dendritic architecture for drug delivery An over review Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan
875-880
881-885
886-892
893-897 898-900 901-907
26
908-914
27
915-921
28
922-934
Volume 1 Issue 6
www.ijrpb.com
Mohd Asif et.al
Indian Journal of Research in Pharmacy and Biotechnology
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)
Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker

Showkat Hussain Ganie1, Deepak Yadav1, Altaf Ahmad2, Anis Chadhry1, Mohd Asif1* 1. Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India 2. Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062 *Corresponding author: Email: profasif2012@gmail.com, Phone: 8860142069
ABSTRACT Nigella sativa, commonly known as kalongi is an important drug of traditional system of medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice. Because of increased demand and high price, there are chances that the herb could be adulterated in the trade by other related species. Therefore, a reliable authentication method is needed to facilitate identification of this genuine material from its adulterants. To carry out the work, the market samples were procured from the crude-drug markets of different geographical regions of India. The RAPD derived LAMP technique was employed for the characterization of different accessions of Kalongi. 19 primers were used of which one unique band, common in all accessions were eluted, cloned and sequenced. LAMP primers were designed and LAMP product formation was detected at 60C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands. One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was developed into LAMP marker for identification of N. Sativa. The primers successfully amplified the genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification. The LAMP markers developed in this study may provide guidance for the authentication of plant materials traded as Kalongi. Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP); Molecular markers; kalongi; RAPD. 1. INTRODUCTION The traditional knowledge of herbal medicine is widespread- ranging from tribal folklore use to age-old practices and closely guarded recipes handed down from generation to generation, to highly evolved systems of medicine like Ayurveda, Unani and Siddha. These systems have served the humanity through the centuries and it is certain that they will continue to be in use for times to come. However, in the process of urbanization the contact with nature was cut off and, consequently, the knowledge about the identification of medicinal plants deteriorated to a great extent. Additionally, the crude drugs sold in the market are adulterated, sophisticated or substituted by quite unrelated plant materials. The adulteration of market samples is one of the greatest drawbacks in promotion of herbal products (Dubey, 2004). Plant samples in the market are stored under undesirable conditions over the years and often contain a mixture of other plant species (Khatoon, 1993), thus, adversely affecting their bio efficacy. The efficacy of many of the drugs has become suspect because of the adulterated, dried raw materials profusely available in the indigenous market (Anonymous, 1996). Very often the identity of market drugs is taken for granted without subjecting the plant material to stringent methods of botanical identification. This result in the loss of therapeutic potential of the preparations if the plant used is adulterated or substituted. It results in the production of misleading or overlapping data on phytochemical, pharmacological, pharmacognostical and clinical aspects. Nigella sativa (Family: Ranunculaceae) is considered one of the most important medicinal herb used in various Indigenous System of Medicine. The plant cultivated almost all over India, is an annual herb with linear- lance late leaves. Pale blue flowers are solitary, fruit is capsule; seeds are black, flattened, angular and funnel shaped. Seeds of the herb are mostly used in medicine. Many formulations containing Kalongi as a single drug or in combination with other drugs are available in Indian market. The important Unani formulations using the drug are Anquriya Kabir, Habe-e-Halteet, Roghan Kalan, Qairuti Arad Karsana, Mujun Nankhaw. Traditionally the drug is used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice (Paarakh, 2010). Seed oil is used as a local anaesthetic (Paarakh, 2010). As far as its pharmacological activities are concerned, the drug is hypoglycaemic, hypocholestermic (Bamosaet, 2002) and antioxidant (Kanter, 2003). Thymoquinone (constituent of seed oil extract) is antitumor, found to kill the pancreatic cancer cells and its derivatives are used in blood, skin and breast cancers (Paarakh, 2010). The aqueous decoction of kalonji revealed significant antibacterial potential against Staphylococcus aureus, Micrococcus roseus, Streptococcus mutans, Streptococcus morbillorium, Streptococcus sanguis, Streptococcus intermedius,
IJRPB 1(6)
www.ijrpb.com
November December 2013
Page 765
Mohd Asif et.al
Klebsiella ozaenae, Aeromonas hydrophila, and Streptococcus salivarius (Chaudhry and Tariq, 2008). Considering the medicinal importance of Kalongi, the authentication of this herb is highly mandatory. DNA fingerprinting techniques are very useful for correct identification of taxa. Among various DNA markers, loop-mediated isothermal amplification (LAMP) is convenient because the reaction could be conducted under isothermal conditions, thereby facilitating amplification and the results could be achieved in less than 1 hr. To the best of our knowledge, no attempt has been made to characterize this herb using molecular biology. To fill this gap, we employed LAMP markers to authenticate the said drug. For this, samples were collected from the crude drug dealers of North and West India. 2. MATERIALS ANDMETHODS 2.1. Plant material: The samples of N. Sativa were collected from crude drug dealers of Delhi, Kolkatta, Uttarakhand and Uttar Pradesh. Voucher specimens of these samples were prepared and kept in the Herbarium, Department of Botany, Hamdard University, New Delhi, 110062. The seeds are stored in seed bank, Department of Botany, Hamdard University, New Delhi, 110062. The identified specimens were compared with authenticated voucher specimens preserved in the herbarium of National Institute of Science and Information Resources (NISCAIR). The seeds were used for DNA isolation. 2.2. DNA Isolation: The modified CTAB protocol of Doyle and Doyle (1990) and purification kit (HiPurA, India) were used to extract DNA from the overnight soaked seeds. 2.2.1. Reagents and Solutions: CTAB extraction buffer (2M Sodium Chloride, 100mM TrisHCl (pH 8), 20 mM EDTA) 0.2% -mercaptoethanol, Chloroform:Isoamylalcohol (24:1), absolute alcohol, 3M Potassium acetate, Isoamyl alcohol. All the chemicals chemical were of analytic grade. Enzymes (Taq polymerase, Bst polymerase and RNAase A), Taq buffer, MgCl2 and dNTPs were purchased from Bangalore Genei (Bangalore, India). 2.2.2. Protocol: In order to avoid surface contamination, the seeds were washed with 0.2% Cetrimide for 3 min, followed by treatment with 0.5% streptomycin sulphate and 0.5% bavistine for 5 min each. After these treatments the seeds were rinsed with 70% alcohol for 1 min andfinally washed with sterile double distilled water and kept overnight. 1g seeds were pulverized to fine powder by liquid nitrogen in a chilled mortar and pestle followed by the addition of 100 mg of poly vinyl pyrollidone (PVP, insoluble) and 10 ml pre-heated
CTAB buffer (containing 0.2 % -mercaptoethanol). The slurry was transferred into autoclaved 50 ml centrifuge tube and incubated at 60oC for 1 hr. 10 ml of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1) was added to the centrifuge tubes and mixed carefully for 15 min. The content was centrifuged at 8000 rpm for 15 min. at 15oC. The upper phase was transferred into new autoclaved centrifuge tubes. 10l of RNAase was added and the tubes were incubated at 37oC for 30 min. 10 ml of CHCl3: IAA (24:1) was added carefully and the tubes were centrifuged at 8000 rpm for 15min at 15oC. The upper phase was transferred again into autoclaved centrifuge tube and 0.5 vol. of 3M Potassium acetate (pH 5.2) was added. For DNA precipitation equal volume of chilled isopropanol (chilled absolute ethanol was also used) was used and the tubes were kept at -20oC for 2 hrs. It was recentrifuged at 8000 rpm for 15 min at 4oC. The supernatant was discarded and the pellet was washed with 70% ethanol, air dried and dissolved in 250 l of sterile water. The DNA thus obtained was purified by DNA purification (HiPurA, India) kit according to manufacturers instructions. 2.3. Polymerase Chain Reaction (PCR) Amplification: The PCR was carried out in 20 l reaction volume containing 50ng DNA, 0.5 u/l Taq DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer primers, 200 M of each dNTPs, 2x Taq polymerase buffer with minor changes as described by Shaik et al. (2006). The final volume was made-up with sterile MilliQ water. The amplifications were carried out in DNA thermal cycler (Eppendorf, Germany). The PCR amplification conditions for RAPD consisted of initial step of denaturation at 94C for 4 min, 35 cycles of denaturation at 94C for 1 min, annealing at 35C for 1 min, extension at 72C for 2 min, followed by final extension at 72C for 10 min. The amplified DNA was loaded on 1.2% agarose gel in 0.5x TBE buffer containing 10 l of EtBr (10mg/ml) and photographed using gel documentation system (UVP, Germany). Twenty 10-mer RAPD primer series OPAA, purchased from Qiagen, USA and five (BG series) from Bangalore Genei (India) were screened. 2.4. Gel purification, Cloning and sequencing of RAPD amplified product: RAPD fragment was excised from the gel with a sharp and sterile scalpel to avoid any contamination. Elution of DNA from agarose gel was carried out using MiniElute kit from Qiagen (USA) following manufacturers instructions and the product was run on 1.2% gel along with the Gene Rular DNA ladder, to check the presence of the desired product. The eluted DNA was ligated into pGEM-T easy vector (Promega,
IJRPB 1(6)
www.ijrpb.com
Page 766
Mohd Asif et.al
USA). Ligation reaction was carried out in 10l reaction containing 10x ligase buffer (5.0 l), pGEM-T easy vector (0.5 l), T4 DNA Ligase (1.0 l) and PCR product 3.0 l) and the final volume was set up with autoclaved Milli Q water. Competent cells of E. coli DH5 were prepared by CaCl2 method (Sambrook et al. 2001) and 5l of the ligation mixture was mixed with an aliquot of 100 l competent cells. The transformed cells were plated on LB-X-gal/Amp plates and the recombinant colonies were selected through blue-white screening. The plasmid was isolated from the positive bacterial colonies using plasmid isolation kit (Qiagen, Germany). The cloned fragments were sequenced using T7 primers through the centre for Genomic Application, New Delhi, India. 2.5. Design of LAMP Oligonucleotides: A total set of four LAMP primers were designed using Primer Explorer V3 (http://primerexplorer.jp/elamp3.0.0/index.html) for the specific detection of PCR product. The primer set consisted of two outer (F3 and B3), and two inner (FIP and BIP); the inner primers cover two distinct sequences of the target (F1c/B1c and F2c/B2c). Sequences of the LAMP primers are given in table 1. 2.6. LAMP reaction: The LAMP reaction was carried out in a 25 l reaction volume containing 60pmol each of the primers FIP and BIP, 10 pmol each of the outer primers F3 and B3, 8mM MgSO4, 1.4mM dNTPs, 0.8M betaine, 10 units of the Bst DNA polymerase and 2 l of DNA template. The optimum temperature for the LAMP reaction was 60C. 1lSYBR Green- dye was added at the end of the reaction. Visual inspection for amplifications was performed through observation of colour change following addition of 1l of SYBR Green I (fluorescent dsDNA intercalating dye) to the tube.
3. RESULTS RAPD reaction was performed in order to find out unique specie specific monomorphic bands present in all the samples, meant for LAMP analysis. Twenty five 10-mer RAPD primers were used of which six did not amplify the DNA. Each RAPD reaction was repeated thrice and only reproducible bands were taken in to account. A total of 524RAPD bands (table 2) were obtained and to develop the LAMP marker, we analyzed the nucleotide sequences of 5 species-specific RAPD amplicons, consisting of 5 DNA fragments for N. saitva. From the resulting nucleotide sequences, one unique RAPD amplicon from primer OPAA-9 has been registered in the NCBI Gene Bank dbGSS, and used to develop RAPD derived LAMP marker (Fig. 1). The specific amplicon of 600bp (fig.2) RAPD fragment, specific for all the accessions of N. sativa, was used for designing primers of LAMP reaction. The reaction was carried out using genomic DNA as a template to determine the optimal temperature and reaction time and to evaluate the use of primers. LAMP product formation was detected at a temperature range of 6064C and consequently, 60C was considered to be the optimal reaction temperature for the LAMP assay. The tube containing the amplified products were visualised in the presence of fluorescent intercalating dye SYBR Green I under UV transilluminator. In case of positive amplification, the original colour of the dye was changed into green that was judged under natural light as well as under UV light (302 nm) with the help of UV transilluminator. In case of negative control (Catharanthus roseus) there was no amplification, the original orange colour of the dye was retained (Figure.3)
Figure.1. RAPD profile of Kalonji (N. sativa) representing specific band present in all accessions amplified with OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1K5 corresponds to the 5 accessions (K1Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- DehradunUttarakhand)
IJRPB 1(6)
www.ijrpb.com
Page 767
Mohd Asif et.al
gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac
Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N. sativa used for development LAMP marker
Figure.3.Analysis of LAMP under UV light (A) and natural light (B). 1-5 accessions of Nigella sativa.(1- Kolkatta, 2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, CNegative control (Catharanthus roseus) Table 1.Primer Sequences used in this study sequence (5 3) catttgccccgacggc cggctgctgtagaccga tcggccactgcactctgcgcgaggacaccctgctct tccgcctctgcctggaggaccacaggttctcgaagagc
Name F3 B3 FIP (F1c+F2) BIP (B1+B2c)
Bases 16 17 36 38
Table 2.Number of amplified products generated by 20 arbitrary primers in 5 accessions of Kalonji (Nigella sativa) Primer code sequence (5 3) No. of amplification products Fragment size (kb) OPAA -01 AGACGGCTCC 37 0.45-1.20 OPAA -02 GAGACCAGAC 31 0.3-1.15 OPAA -03 TTAGCGCCCC 29 0.3-1.20 OPAA -04 AGGACTGCTC 0 0 OPAA -05 GGCTTTAGCC 20 0.3-1.00 OPAA -06 TCAAGCTAAC 11 0.5-1.10 OPAA -07 CTACGCTCAC 24 0.2-1.20 OPAA -08 TCCGCAGTAG 29 0.4-1.40 OPAA -09 AGATGGGCAG 35 0.5-1.20 OPAA -10 TGGTCGGGTG 34 0.3-1.15 OPAA -11 ACCCGACCTG 32 0.35-1.10 OPAA -12 GGACCTCTTG 40 0.35-1.20 OPAA -13 GAGCGTCGCT 26 0.35-1.10 OPAA -14 AACGGGCCAA 14 0.5-1.00 OPAA -15 ACGGAAGCCC 14 0.3-1.20 OPAA -16 GGAACCCACA 33 0.3-1.20 OPAA -17 GAGCCCGACT 23 0.3-1.10 OPAA -18 TGGTCCAGCC 39 0.4-1.15 OPAA -19 TGAGGCGTGT 28 0.3-1.20 OPAA-20 TTGCCTTCGG 32 0.4-1.20 Total 524
IJRPB 1(6)
www.ijrpb.com
Page 768
Mohd Asif et.al
4. DISCUSSION Correct identification of plants forming the drug is a prerequisite and fundamental to whole realm of medicine and science. Most of the regularity guidelines and pharmacopoeia recommend macro- and microscopic evaluation and chemical analysis of botanical material for quality and quantity control and standardization (Anonymous, 1996). Morphological or macroscopic identification of plant materials is based on parameters like shape, size, texture, colour, surface feature, odour, taste and other organoleptic characters that are compared to standard reference materials. Though this method is simple and direct, its accuracy and authenticity which are sometimes subjective, depends on examiners. Histological or microscopic examinations are done to study comparative microscopic inspection of broken as well as powdered, crude, botanical materials to reveal the characteristics of tissue structure and arrangement of cells in different organs and tissues. Chemical authentication establishes a chemical composition of plant, which is used for differentiation. The variation of chemical composition may hinder the authentication, and in some cases, may be misleading if the samples are adulterated. Moreover, it is difficult to distinguish closely related species due to similar chemical compounds. Molecular or DNA-based markers are now becoming a popular means for the identification of medicinal plants (Yip, 2007). Molecular markers have the advantage over chemical markers as the genetic composition is unique for each individual and is least affected by age (Kumble, 2003), environmental factors and physiological conditions (Macbeath and Schreiber, 2000), harvest, storage and processing of the samples (Schweitzer, 2003). Molecular markers are not stage and tissue specific and thus can be detected at any stage of development. Ours is the first attempt to characterize Kalongi using LAMP markers. Although in earlier reports RAPDs were used for the authentication purpose (Rivera-Arce, 2007; Shinde, 2007; Hammad and Qari 2010; Ganie, 2012), however, these markers are very sensitive and the big blow to these markers are IJRPB 1(6) www.ijrpb.com
reproducibility problem. Therefore, in the present study RAPDs were converted into LAMP markers. These markers are very specific and highly reproducible because these markers could amplify a specific gene from the whole genome discriminating a single nucleotide difference (Parida, 2008). As the reaction is carried out under optimal and isothermal conditions, therefore, there are negligible chances of inhibition reaction at the later stage of amplification compared with the PCR. The results can be easily monitored by checking the turbidity obtained from the precipitate and most importantly the detection of the desired gene could be completed in a single step by incubating mixture of gene sample, primers, DNA polymerase with strand displacement activity and substrates at constant temperature (Parida, 2008). In our study, the amplification was not detected when the concentration of the template was 0.3 ng, however when the template concentration was in the range of 0.8-1.5 ng, amplifications occurred; therefore, it was thought that DNA concentration of 0.8 ng is the detection limit in N. sativa. Such type of results was also observed in the studies of P. Ginseng (Sasaki, 2008) in which 0.5 ng of template was the detection limit. The optimized reaction parameters that showed positive results were 10 ng template DNA, 10pmol of outer primers (F3 and B3), 60pmol of each of forward internal and backward outer primers (FIP and BIP), 20 mM reaction buffer, 10 mmMgSO4, 0.8 M betaine and 10 units of Bst DNA polymerase. The optimum temperature for the reaction was set at 60C, which is considered optimum for the activity of Bst DNA polymerase. The use of LAMP markers for the authentication of medicinal plants, although is rare; however, there are some recent reports in which the technique has been successfully applied for the identification purposes and some of which include Curcuma longa (Sasaki and Nagumo; 2007), Panex ginseng (Sasaki, 2008), Catharanthus roseus (Choudhry, 2011). We have developed LAMP, a rapid, highly sensitive, and specific method for the authentication of N. sativa. The present study November December 2013 Page 769
Mohd Asif et.al
could be applicable to identify N. Sativa to differentiate the herb from the spurious and adulterated drugs sold in the market in the name of geniuine drugs. Efforts are in progress to develop LAMP markers to medicinal plants in order to provide accurate method for authenticating the medicinal plants. 5. CONCLUSION LAMP technology could be efficiently used to characterize the medicinal plants like of N. sativa. By analysing the genetic profiling it is possible to identify the said drug; this information could be employed for identification of authenticN. sativa devising from the spurious and adulterated drugs. ACKNOWLEDGMENTS This work was financed by the CCRUM, AYUSH, Ministry of Health and Family Welfare, Government of India. REFERENCES Anonymous, The Useful Plants of India. PID, CSIR, 1996, New Delhi Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The effects of thymoquinone on blood lipids on rats, Indian. J. Physio. Pharmacol, 46, 2002, 195201. Chaudhary A.A, Hemant, Mohsin M, Ahmad A, Application of loop-mediated isothermal amplification (LAMP)-based technology for authentication of Catharanthus roseus (L.) G. Don. Protoplasma, 249, 2012, 417-422. Chaudhry N.M.A, Tariq P, In-vitro anti bacterial activities of Kalonji, Cumin and Poppy Seed. Pak. J. Bot, 40, 2008, 461-467. Doyle J.J, Doyle J.J, Isolation of plant DNA from fresh tissue, Focus, 12, 1990, 13-15. Dubey N.K, Kumar R, Tripathi P, Global promotion of herbal medicine: Indias opportunity. Curr. Sci. 86, 2004, 37-41. Ganie S.H, Srivastava P.S, Narula A, Ali Z, Sharma M.P., Authentication of shankhpushpi by RAPD markers. Eurasia. J. Biosci, 6, 2012, 39-46. Hammad I, Qari S.H, Genetic diversity among Zygophyllum (Zygophyllaceae) populations IJRPB 1(6) www.ijrpb.com
based on RAPD analysis. Genet. Mol. Res. 9, 2010, 2412-2420. Kanter, M., Meral, I.,Dede, S., Effects of Nigella sativa L. and Urticadioica L. on lipid peroxidation, antioxidant enzyme systems and some liver enzymes in CCl4-treated rats. J. Vet. Med. Physiol. Pathol. Clin. Med. 50, 2003, 264268. Khatoon, S., Mehrotra, S., Shome, U., Mehrotra, B.N., Analysis of commercial Ratanjot; by TLC fluorescence fingerprinting. Int. J. Pharmacol. 31, 1993, 269-277. Kumble, K.D., Protien microarrays, new tools for pharmaceutical development. Analyt. Bio. Chem. 377, 2003, 812-819. MacBeath, G., Schreiber, S.L., Printing proteins as microarrays for high-throughput function determination. Sci., 289, 2000, 1760-1763. Paarakh, P.M., Nigella sativa Linn.- A Comprehensive Review. Ind. J. Nat. Prod. Resour. 1, 2010, 409-429. Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 18, 2008, 407-421. Rivera-Arce, E., Gattuso, M., Alvarado, R., Zarate, E., Aguero, J., Feria, I., Lozoya, X., Pharmacognostical studies of the plant drug Mimosa tenuifloraecortex. J. Ethnopharmaco. 113, 2007, 400-408. Sasaki, Y., Komatsu, K., Nagumo, S., Rapid detection of Panax ginseng by loop-mediated isothermal amplification and its application to authentication of Ginseng. Biol. Pharm. Bull, 31, 2008, 1806-1808. Sasaki, Y., Nagumo, S., Rapid identification of Curcuma longa and C. aromatic by LAMP. Biol. Pharm. Bull, 30, 2007, 2229-2230. Schweitzer, B., Predki, P., Synder, M., Microarrays to characterize protein interactions on a whole-protoeme scale. Proteomics. 3, 2003, 190-199. Shaik Y.B, Castellani M.L, Perrella A, Conti F, Salini V, Tete S, Madhappan B, Vecchiet J, De Lutiis M.A, Caraffa A, Cerulli G, Role of quercetin (a natural herbal compound) in allergy November December 2013 Page 770
Mohd Asif et.al
and inflammation, J. Biol. Regul. Homeost. Agents, 20(3-4), 2006, 47-52. Shinde M, Dhalwal K, Mahadik K.R, Joshi, K.S, Patwardhan B.K, RAPD Analysis for Determination of Components in Herbal
Medicine, Evi. Based Complemen. Alterna. Med, 4, 2007, 21-23. Yip P.Y, Chau C.F, Mak C.Y, Kwan H.S, DNA methods for identification of Chinese medicinal materials, J. Chin. Med, 2, 2007, 1-19.
IJRPB 1(6)
www.ijrpb.com
Page 771
Malleswari et.al
Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release tablets in QbD environment
V Malleswari Bai*1, M Prasada Rao1, M Chandana1, K Naga Harini1, B Naga Deepthi1, K Thirumala Devi1, 2 P Lakashmana Rao1, Vinay U rao and J Naga raja1 1. Department o f Pharmaceuitical Analysis, Medarametla Anjamma Masthanrao College of Pharmacy, Narasarao Pet, Guntur district, Andhra Pradesh, India. 2. Institutes of Pharmaceutical Sciences, Hyderabad-500049 *Corresponding author: E.Mail:malleswari.v4@gmail.com ABSTRACT Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide the resistance of drug release in acidic environment of stomach and allow the drug to be released in alkaline environment of the intestine. A large number of enteric polymers are available which provide excellent protection to drug release in acidic environment. However, each polymer dissolves at different alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH 6.5 and above. HPMC Phthalate P5.5 dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on which enteric polymer is used to provide the delayed release. The aim of the current work was to comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that brand 1 and 5 are equivalent to each other while brands 2, 3 and 4 are equivalent to each other. Similarity factor f2 was used for comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping test. This indicates that patients may have to counsel not to concomitantly consume alcohol while on Diclofenac sodium delayed release tablets. Key words: Diclofenac sodium, Quality by design (QbD), Delayed release, Dissolution test INTRODUCTION Quality by Design (QbD) is a concept first outlined by well-known quality expert Joseph M Juran in various publications, most notably Juran on Quality by Design. Juran believed that quality could be planned, and that most quality crises and problems relate to the way in which quality was planned in the first place. While Quality by Design principles has been used to advance product and process quality in every industry, and particularly the automation industries, they have most recently been adopted by the U.S Food and Drug administration (FDA) as a vehicle for the transformation of how drugs are discovered, developed, and commercially manufactured (Juran, 1992). MATERIALS AND METHODS Development of a predictive dissolution method: The effects of dissolution medium pH, stirring speed, volume of the dissolution medium, type of apparatus used were systemically evaluated to develop the predictive dissolution method Effect of dissolution medium: An initial attempt at developing the discriminating dissolution method that would be predictive of in vivo performance was made using USP apparatus 2 .Effect of dissolution medium pHof both the innovator product and the four brands were subjected to dissolution testing using USP apparatus 2 at 50 rpm in 900 mL of various media including water, 0.1 N HCl, pH 5.5 phosphate buffer, and pH 6.8 phosphate buffer. The drug release of the marketed samples in comparison with the innovator at different time intervals was obtained in all the mediums. The similarity factor of the brands using innovator product as the reference is calculated Effect of dissolution medium volume: The drug release of innovator products and all the marked brands was evaluated using pH 1.2(0.1N HCl) dissolution medium volumes of1000ml and 500ml. The stirring speed was 50 rpm in each case. The drug release profile of the marketed samples in comparison with the innovator product at various time intervals were obtained in all two volumes. The similarity factor of the brands using innovator product as the reference is calculated Effect of stirring speed: Dissolution testing of all the marketed samples and the innovator product was conducted at25, 50, 75, and 100 rpm in 900 mL of pH 1.2(0.1NHCl) dissolution medium. The similarity
IJRPB 1(6)
www.ijrpb.com
Page 772
Malleswari et.al
factor of the brands using innovator product as the reference is calculated Effect of type of dissolution apparatus: Dissolution testing of all the marketed samples and the innovator product was conducted using both USP1 (Basket) and USP2 (Paddle) apparatus in 900ml of pH 1.2(0.1NHCl) dissolution medium. The drug release profiles of all the marketed samples in comparison with the innovator product at various time intervals were obtained. The similarity factor of the brands using innovator product as the reference is calculated QbD development process includes: Begin with the target product profile that describes the use, safety and efficacy of the product. Defining a target quality profile that will be used by formulators and process engineers as a quantitative surrogate for aspects of clinical safety and efficacy during product development. Gather relevant prior knowledge about the substance, potential excipients and process operation. Design a formulation and identify the quality attributes to the final product that must be controlled to meet the target product quality profile. Design a manufacturing process to produce a final product having this critical material attributes. Identify the critical process parameters and raw material attributes that must be controlled to achieve these critical material attributes of the final product. Establish a control strategy for the entire process that may include input material controls, process controls and monitors design space around individual or multiple unit operation and/ or final product tests. Continually monitor and update the process to assure consistent quality. Quality by Design for drug release Two primary aspects: 1. Clinical relevance of release and stability specifications 2. Correlation between process parameters and ability to achieve specifications (and therefore remain clinically relevant) Dissolution testing and drug release: Dissolution testing has been widely used as the primary tool to evaluate drug release
Dissolution is the process by which a solid solute enters a solution, and is characterized by rate (amount dissolved by time). In the pharmaceutical industry, it may be defined as the amount of drug substance that goes into solution per unit time under standardized conditions of liquid/solid interface, temperature and solvent composition. Dissolution is the quality control measure and potential to provide in sight into the in vivo performance of the drug product. In vitro release test that predicts the drug in vivo would be optimal and highly desirable. A variety of designs of apparatus for dissolution testing have been proposed and tested, varying from simple beaker with stirrer to complex systems. Different apparatus, procedures and techniques are required for different dosage forms because of significant differences in formulation design and the physicochemical properties of the drugs. Dissolution tests have been developed for various drug delivery systems including immediate release solid dosage forms, several controlled release solid dosage forms and many novel and special dosage forms.
Most of the tests with recommended apparatus and other specifications are now available as compendial standards in Pharmacopoeias and are used in pharmaceutical analysis and drug development for the various drug delivery systems. RESULTS AND DISCUSSION Five brands of Diclofenac sodium delayed release tablets 50 mg were procured from the market and subjected to assay and comparative dissolution profile testing as per USP guidelines for determining in vitro equivalence of modified release products. Assay of Diclofenac sodium delayed release tablets: Twenty tablets were weighed and crushed using mortar and pestle. Quantity of powder equivalent to 100 mg of Diclofenac sodium was weighed accurately and transferred to 100 ml volumetric flask. Approximately 70 ml of methanol AR grade was added and syndicated for 15 minutes. The volume was made up to 100 ml with methanol and filtered. From the clear filtrate and aliquot equivalent to 100 ppm was pipette out and transferred to 10 ml volumetric flask. The volume was made up to 10 ml with Methanol (10 g/ml solution). The absorbance of this
IJRPB 1(6)
www.ijrpb.com
Page 773
Malleswari et.al
solution was measured on UV spectrophotometer at 276 nm wavelength. The drug content was calculated by simultaneously measuring the absorbance of a standard 10 g/ml solution of Diclofenac sodium. The assay values for all five brands are given in Table 1. Disintegration test for Enteric coated tablets (IP): The DT test for enteric coated tablets as described in IP was performed for 6 tablets of each brand and it was observed that all brands pass this test Comparative dissolution testing in 0.1N HCl: It is mandatory for all delayed release products to show < 10% drug release in 0.1N HCl when in vitro dissolution testing is performed for 2 hours in this medium. The results for the dissolution testing of the 5 brands are given in Table 2 and shown in Figure.1. All five brands passed the criteria of <10% in two hours in pH 1.2 medium. Comparative dissolution testing in pH 5.5: pH 5.5 simulates the duodenum and upper intestinal portion. Comparative dissolution testing was conducted in pH 5.5 acetate buffer for 1 hour (Figure.2) The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by comparing with brand 1. Only brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 1 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 3 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 showed f2 > 50. Hence this may be considered as equivalent to brand 4 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5 as standard. Only brand 1 showed f2 > 50. Hence this may be considered as equivalent to brand 5 for dissolution profile testing in pH 5.5. Comparative dissolution testing in pH 6.0: pH 6.0 simulates the duodenum and upper intestinal portion. Comparative dissolution testing was conducted in pH 6.0 Phosphate buffer for 1 hour. (Figure.3) The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by
comparing with brand 1. Only brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 1 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 2 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 3 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 4 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5. Brand 1 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 5 for dissolution profile testing in pH 6.0. Comparative dissolution testing in pH 6.8: pH 6.8 simulates the middle and lower portion of the gut. Comparative dissolution testing was conducted in pH 6.0 Phosphate buffer for 1 hour. (Figure.4). The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by comparing with brand 1. Brand 2 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 1 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 1 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 3 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 4 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5. Brand 1, 2 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 5 for dissolution profile testing in pH 6.8. The multimedia dissolution study indicates that the differences in the rate and extent of dissolution between different brands are significantly more at pH 5.5 and pH 6 than at pH 6.8. This may most likely be due to the fact that each brand may have been coated with enteric materials of different chemistries having different solubility profiles in
IJRPB 1(6)
www.ijrpb.com
Page 774
Malleswari et.al
alkaline pH. For e.g. the reported solubility of Eudragit L100 is pH 6 and above while that of Eudragit L100-55 is pH 5.5 and above. Consequently, tablets coated with L-100-55 will show significantly faster and more complete dissolution at pH 5.5 as compared to Eudragit L-100. All pH dependent enteric polymers completely dissolve at pH 6.8 and above. Hence the difference between the brands is significantly reduced in case of dissolution profile testing in pH 6.8 buffer. In order to simulate the way the dosage form is exposed to pH change in vivo, dissolution profile testing for all brands was conducted by using the in situ pH change method. The in situ pH change method of dissolution testing indicates that all five brands achieve > 80% release within 30 minutes of reaching the pH 6.8. However, dissolution profiles for Brand 1 and brand 5 are significantly faster at pH 6 than those of brands 2, 3 and 4. Hence, from this study it may be predicted that Brands 1 and 5 may show therapeutic equivalence to each other while brands 2, 3 and 4 may be equivalent to each other. But brand 1 and 5 may not show therapeutic equivalence to brands 2, 3 and 4.(Figure.7).
different solubility profiles in commonly used solvents. The probability that this may affect the intended release profile in vivo is very genuine if we consider that patients may consume alcohol when under treatment with modified release products. The solubility profile of the polymer in alcohol may adversely affect the release rate of the drug from the dosage form and the actual drug release may be entirely different from the intended release. Hence, the US FDA in its latest guidelines has mandated that the alcohol dumping studies should be carried out for modified release products in order to demonstrate that the dosage form is able to perform within its specified standards even in presence e of significant levels of alcohol. For the five marketed brands of Diclofenac sodium delayed release tablets, a comparative alcohol dumping study was performed in 0.1N HCl without alcohol, and 0.1N HCl with 5%, 10% 20% and 40% v/v of alcohol respectively. The dissolution profile testing was carried out for two hours. The study indicates that only Brand 1 is able to maintain the enteric effect of < 10% release in acidic pH even in presence of 40% alcohol. All other brands fail the alcohol dumping test at 40% level of alcohol. Brand 2 fails the test even at 10% and 20% level of alcohol. (Figure.8).
Alcohol dumping study: For modified release products, different types of polymers are used to get the same kind of effect. Each of these polymers has Table.1. Assay values for all five Brands of Diclofenac sodium 50 mg delayed release tablets
BRANDS % Assay Brand 1 98.76 Time 0 30 45 60 120 Brand 2 99.27 Brand1 0 2.78 5.8 7.9 9.17 Brand2 0 1.45 3.55 5.07 6.17 Brand 3 97.54 Brand3 0 2.87 4.07 6.27 6.59 Brand4 0 2.87 3.09 4.13 5.87 Brand 4 98.04 Brand5 0 1.56 2.34 4.09 4.35
Brand 5 97.56
Table.2.Comparative dissolution profile testing in 0.1N Hcl
Figure.1. Dissolution profiles for 5 brands of Diclofenac sodium delayed release tablets in 0.1N HCl
Figure.2.Comparative dissolution profile of five brands in ph 5.5
IJRPB 1(6)
www.ijrpb.com
Page 775
Malleswari et.al
Figure.3.Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer
Figure.5. Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer
Figure.7. Dissolution profile by in situ ph change method
Figure.8.Alcohol Dumping study for Diclofenac sodium delayed release tablets market brands
SUMMARY AND CONCLUSION Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide the resistance of drug release in acidic environment of stomach and allow the drug to be released in alkaline environment of the intestine. A large number of enteric polymers are available which provide excellent protection to drug release in acidic environment. However, each polymer dissolves at different alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH 6.5 and above. HPMC Phthalate P5.5
dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on which enteric polymer is used to provide the delayed release. The aim of the current work was to comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that Brand 1 and 5 are equivalent to each other while brands 2, 3 and 4 are equivalent to
IJRPB 1(6)
www.ijrpb.com
Page776 773 Page
Malleswari et.al
each other. Similarity factor f2 was used for comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping test. This indicates that patients may have to counsel not to concomitantly consume REFFERECES 1. Juran JM, Juran on Quality by Design, The Free Press, A Division of Macmillan, Inc., New York, 1992, 407-425 2. Kearney PM, Baigent C, Godwin J, Halls H, Emberson JR, Patrono C: Do selective cyclooxygenase-2 inhibitors and traditional non-steroidal anti-inflammatory drugs increase the risk of atherothrombosis? Meta-analysis of randomised trials, BMJ, 3, 2006, 1302 3. Solomon DH, Avorn J, Sturmer T, Glynn RJ, Mogun H, Schneeweiss S: Cardiovascular outcomes in new users of coxibs and Nonsteroidal antiinflammatory drugs: high-risk subgroups and time course of risk, Arthritis Rheum, 54(5), 2006, 137889. 4. FitzGerald GA, Patrono C, The coxibs, selective inhibitors of cyclooxygenase-2, N Engl J Med, 345(6), 2001, 433-42. 5. Graham DJ: COX-2 inhibitors, other NSAIDs, and cardiovascular risk: the seduction of common sense, JAMA, 296(13), 2006, 1653-6. 6. Brater DC, Renal effects of cyclooxygyenase-2selective inhibitors, J Pain Symptom Manage, 23(4 Suppl), 2002, 15-20. 7. Sigma Aldrich Gan TJ: Diclofenac: an update on its mechanism of action and safety profile, Curr Med Res Opin, 26(7), 2010, 1715-31.
alcohol while on Diclofenac sodium delayed release tablets. ACKNOWLEDGEMENT The authors are grateful thanks to Indian Pharmaceutical Sciences, Arabindo pharma lim, EMCO industries-hyd, FMC-US, Ashaland specialty chemicals-US for providing gift samples of Diclofenac Sodium.
IJRPB 1(6)
www.ijrpb.com
Page 773 Page 777
Lakshmana Rao et.al
Development and validation of a stability indicating HPLC method for analysis of Altretamine in bulk drug and pharmaceutical formulations
M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao* V.V. Institute of Pharmaceutical Sciences, Gudlavalleru, Andhra Pradesh, India. * Corresponding author: E-mail: dralrao@gmail.com ABSTRACT A simple, sensitive and accurate stability indicating HPLC method has been developed and validated for determination of Altretamine in its bulk form and pharmaceutical formulations. Chromatographic separation was achieved on a Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 m) by a mobile phase consisted of phosphate buffer and acetonitrile (90:10, v/v) with apparent pH of 3.10.5 and a flow rate of 1.0 mL/min. The detection wave length was set at 227 nm. An excellent linearity was observed for Altretamine in the concentration range of 25-150 g/mL with a correlation coefficient of 0.999. The retention time was 2.533 min. The percentage assay of Altretamine was 99.98%. The method developed was validated for accuracy, precision, linearity, ruggedness, robustness, solution stability, selectivity and forced degradation studies like acidic, alkaline, oxidative, thermal, hydrolytic and photolytic stress conditions were performed as per ICH guidelines. The results demonstrated that the method would have a great value when applied in quality control and stability studies of Altretamine. Key Words: HPLC, Altretamine, Stability, Formulation. INTRODUCTION Altretamine (Figure 1) is a synthetic cytotoxic antineoplastic agent (Neil, 2006). Chemically it is N,N,N',N',N'',N''-hexamethyl-1,3,5-triazine-2,4,6triamine. Altretamine is indicated for use as a single agent in the palliative treatment of patients with persistent or recurrent ovarian cancer following firstline therapy with a cisplatin and/or alkylating agentbased combination (Wiernik, 1992). Altretamine is structurally related to the alkylating agents. Its precise mechanism of action is unknown but hydroxy methyl intermediates in the metabolism process are possibly the reactive species, and may act as alkylating agents (Rhoda, 1995). Altretamine interferes with the growth of cancer cells and slows their growth and spread in the body. Literature survey revealed that few HPLC methods (Ghiorghis, 1991; Barker, 1994) were reported for the determination of Altretamine. But no stability indicating HPLC method was reported. Hence the objective of this method is to develop and validate a simple, rapid and accurate stability indicating HPLC method (Snyder, 1997) in accordance with ICH guidelines (ICH Q2(R1), 2005; ICH Q1A(R2), 2003) for the determination of Altretamine in bulk sample and its pharmaceutical formulations.
formulation CANTRET capsules (Altretamine 50 mg) were procured from local market. HPLC grade acetonitrile and water were purchased from E.Merck (India) Ltd, Mumbai, India. Potassium dihydrogen phosphate, orthophosphoric acid and triethylamine of AR grade were obtained from S.D. Fine Chemicals Ltd, Mumbai, India. Instrumentation: To develop a high performance liquid chromatographic method for quantitative determination of Altretamine using Waters HPLC system on Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 m) was used. The instrument is equipped with an auto sampler and UV detector. A 10 L rheodyne injector port was used for injecting the samples. Data was analyzed by using Empower 2 software. Chromatographic conditions: A mixture of phosphate buffer pH 3.1 and acetonitrile (90:10, v/v) was found to be the most suitable mobile phase for ideal chromatographic separation of Altretamine. The solvent mixture was filtered through 0.45 membrane filter and sonicated before use. It was pumped through the column at a flow rate of 1.0 mL/min. Injection volume was 10 L and the column was maintained at a temperature of 300C. The column was equilibrated by pumping the mobile phase through the column for at least 30 minutes prior November December 2013 Page 778
MATERIALS AND METHODS Chemicals and solvents: The working standard of Altretamine was provided as gift sample from Spectrum Labs, Hyderabad, India. The market IJRPB 1(6) www.ijrpb.com
Lakshmana Rao et.al
to the injection of the drug solution. The detection of the drug was monitored at 227 nm. The run time was set at 6 minutes. Preparation of phosphate buffer pH 3.1: 2.72 grams of potassium dihydrogen phosphate was weighed and transferred into a 1000 mL beaker and dissolved. 1 mL of triethylamine solution was added to the above solution and diluted to 1000 mL with HPLC water. pH was adjusted to 3.1 with orthophosphoric acid solution. Preparation of mobile phase and diluent: 900 mL of phosphate buffer was mixed with 100 mL of acetonitrile and was used as mobile phase. The solution was degassed in an ultrasonic water bath for 5 minutes and filtered through 0.45 filter under vacuum. The mixture of 800 mL of water and 200 mL of acetonitrile was used as diluent. Preparation of standard solution: 10 mg of Altretamine was accurately weighed, transferred to 10 mL volumetric flask and is dissolved in 7 mL of the diluent. Sonicated the solution for few minutes to dissolve the drug completely. Then it is filtered through 0.45 filter and the volume is made up to 10 mL with diluent to get a concentration of 1 mg/mL stock solution. Further pipetted 1.0 mL of the above stock solution into a 10 mL volumetric flask and diluted up to the mark with diluent to obtain required concentrations. Preparation of sample solution: Twenty commercial capsules were emptied and powdered. A quantity of the powder equivalent to 10 mg of Altretamine was accurately weighed, transferred to 10 mL volumetric flask and is dissolved in 7 mL of the diluent. Sonicated the solution for few minutes to dissolve the drug completely. Then it is filtered through 0.45 filter and the volume is made up to 10 mL with diluent to get a concentration of 1 mg/mL stock solution. Further pipetted 1.0 mL of the above stock solution into a 10 mL volumetric flask and diluted up to the mark with diluent to obtain required concentrations of Altretamine in pharmaceutical dosage forms. Inject 10 L of the above solution into the HPLC system. All experiments were conducted in triplicate.
Linearity: Several aliquots of standard solution of Altretamine was taken in different 10 mL volumetric flasks and diluted up to the mark with diluent such that the final concentrations of Altretamine were in the linearity range of 25-150 g/mL. Evaluation of the drug was performed with UV detector at 227 nm, peak area was recorded for all the peaks. The response for the drug was linear and the regression equation was found to be y=19094x-10685 and correlation coefficient value of Altretamine was found to be 0.999. The results show that an excellent correlation exists between peak area and concentration of drug within the concentration range indicated. Limit of detection and limit of quantification: The limit of detection (LOD) and limit of quantification (LOQ) of the developed method were determined by injecting progressively low concentrations of the standard solution using the developed HPLC method. The LOD and LOQ for Altretamine were found to be 0.46 g/mL and 1.39 g/mL respectively. System suitability: System suitability parameters like retention time, theoretical plates and tailing factor were calculated and compared with standard values. Accuracy: The accuracy of the method was assessed by recovery study of Altretamine in the dosage form at three concentration levels. A fixed amount of preanalyzed sample was taken and standard drug was added at 50%, 100% and 150% levels. The standard concentration was fixed as 100 g/mL and three concentration levels of 50 g/mL, 100 g/mL and 150 g/mL were added to the standard concentration. Each level was repeated three times. The content of Altretamine per capsule was calculated. The percentage recovery ranges from 99.62-100.27% and the mean recovery of Altretamine was 99.92% and the recovery values of Altretamine indicate the method is accurate. Precision: The precision was determined for Altretamine in terms of system and method precision. For system precision evaluation, %RSD for Altretamine was 0.32% (limit %RSD < 2.0%). In addition, the method precision was November December 2013 Page 779
IJRPB 1(6)
www.ijrpb.com
Lakshmana Rao et.al
studied and the %RSD for Altretamine was 0.77% (limit %RSD < 2.0%). Ruggedness and robustness: The ruggedness of the method was determined by carrying out the experiment on different instruments by different operators using different columns of similar types. Robustness of the method was determined by making slight changes in the chromatographic conditions like changes in flow rate and mobile phase composition. It was observed that there were no marked changes in the chromatograms, which demonstrated that the HPLC method so developed is rugged and robust. Solution stability: The stability of solution under study was established by keeping the solution at room temperature for 24 hrs. The result showed no significant change in concentration and thus confirms the stability of the drug in the mobile phase used for the analysis. Analysis of the marketed formulations: The proposed method was applied for the determination of Altretamine in pharmaceutical formulatons of Altretamine capsules. 10 L of each standard and sample solution were injected and from the peak area of Altretamine, amount of drug present in samples were computed. The result of assay undertaken yielded 99.98% of label claim of Altretamine. The assay obtained is more than 99% and no interference of impurity peak observed in Altretamine peak. Acidic d egradation s tudies: To 1 mL of stock solution of Altretamine, 1 mL of 2N hydrochloric acid was added and refluxed for 30 mins at 600 C. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Alkaline d egradation s tudies: To 1 mL of stock solution of Altretamine, 1 mL of 2N sodium hydroxide was added and refluxed for 30 mins at 60 0 C. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Oxidative degradation studies: To 1 mL of IJRPB 1(6) www.ijrpb.com
stock solution of Altretamine, 1 mL of 20% hydrogen peroxide (H2O2) was added separately. The solutions were kept for 30 mins at 60 0 C. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Thermal degradation s tudies: The standard A l t r e t a m i n e solution w a s placed in oven at 1050 C for 6 hrs to study thermal degradation. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of the sample. Hydrolytic d egradation s tudies: Stress testing under hydrolytic conditions was studied by refluxing the standard Altretamine s o l u t i o n in water for 6 h r s at a temperature of 60C. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of the sample. Photolytic degradation studies: The photolytic stability of the drug Altretamine was studied by exposing the standard Altretamine solution to UV light by keeping the beaker in UV chamber for 7 days or 200 Watt hours/m2 in photo stability chamber. The resultant solution was diluted to obtain 100 g/mL solution and 10 L solution were injected into the system and the chromatograms were recorded to assess the stability of sample. RESULTS AND DISCUSSION In the present work, a simple, accurate and precise stability indicating HPLC method has been optimized, developed and validated for the determination of Altretamine in pharmaceutical formulations with UV detector by using Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 m) in isocratic mode with mobile phase composition of phosphate buffer pH 3.1: acetonitrile (90:10, v/v) and pH adjusted to 3.1 with orthophosphoric acid. The use of phosphate buffer and acetonitrile in the ratio of 90:10, v/v resulted in peak with good shape and resolution. November December 2013 Page 780
Lakshmana Rao et.al
The flow rate was 1.0 mL/min and the drug component was measured with UV detector at 227 nm. The results of optimized HPLC conditions were shown in Table 1. The method was linear in the range of 25150 g/mL for Altretamine with correlation coefficient of 0.999. The linearity results were shown in Table 2 and the linearity curve of Altretamine was shown in Figure 2. The % recoveries of Altretamine were found in the range of 99.62-100.27% and the % mean recovery was found to be 99.92% for Altretamine, which indicate the method is accurate. The results of recovery studies were shown in Table 3. The %RSD for system precision and method precision for Altretamine were found to be 0.32 and 0.77, which indicate the method is precise. The results of precision studies were shown in Table 4 and Table 5. The retention time of Altretamine was 2.533 min, cuts down on overall time of sample analysis and the method was more cost effective as it utilizes very less quantity of mobile phase. The number of theoretical plates was 4253 and tailing factor was 1.49 for Altretamine, which indicates efficient performance of the column. Typical chromatogram of drug Altretamine was shown in Figure 3. Selectivity of the method was demonstrated by the absence of any interfering peaks at the retention time of the drug. The limit of detection and limit of quantification for Altretamine were found to be 0.46 g/mL and 1.39 g/mL, which indicate the sensitivity of the method. A system suitability test was
performed to evaluate the chromatographic parameters and the summary of system suitability parameters were shown in Table 6. Validated method was applied for the determination of Altretamine in commercial formulations. The % assay was found to be 99.98% for Altretamine and the assay results were shown in Table 7. HPLC studies of Altretamine under different stress conditions indicated the following degradation behavior. In acidic degradation, the degradation product of Altretamine was appeared at retention time of 2.522 min and the % degradation is 9.08%. In alkaline degradation, the degradation product of Altretamine was appeared at retention time of 2.522 min and the % degradation is 6.96%. In oxidative degradation, the degradation product of Altretamine was appeared at retention time of 2.504 min and the % degradation is 7.40%. In thermal degradation, the degradation product of Altretamine was appeared at retention time of 2.498 min and the % degradation is 5.27%. In hydrolytic degradation, the degradation product of Altretamine was appeared at retention time of 2.503 min and the % degradation is 0.21%. In photolytic degradation, the degradation product of Altretamine was appeared at retention time of 2.498 min and the % degradation is 1.05%. The results of analysis are given in Table 8. The typical chromatograms of degradation behavior of Altretamine in different stress conditions are shown in Figure 4 to Figure 9.
Figure.1. Molecular structure of Altretamine
IJRPB 1(6)
www.ijrpb.com
Page 781
Lakshmana Rao et.al
Figure.2. Calibration curve of Altretamine
Figure.3. Typical chromatogram of Altretamine
Figure.4. Acidic degradation chromatogram of Altretamine
Figure.5. Alkaline degradation chromatogram of Altretamine
IJRPB 1(6)
www.ijrpb.com
Page 782
Lakshmana Rao et.al
Figure.6. Oxidative degradation chromatogram of Altretamine
Figure.7. Thermal degradation chromatogram of Altretamine
Figure.8. Hydrolytic degradation chromatogram of Altretamine
Figure.9. Photolytic degradation chromatogram of Altretamine
IJRPB 1(6)
www.ijrpb.com
Page 783
Lakshmana Rao et.al
Table.1. Optimized chromatographic conditions of Altretamine Parameter Condition Mobile phase Phosphate buffer:acetonitrile (90:10, v/v) pH 3.10.5 Diluent Water:acetonitrile (80:20, v/v) Column Hypersil BDS C18 column (100 mm x 4.6 mm, 5 m) Column temperature 300C Wave length 227 nm Injection volume 10 L Flow rate 1.0 mL/min Run time 6 min Table.2. Linearity results of Altretamine Concentration (g/mL) Area 25 450417 50 968416 75 1393682 100 1884563 125 2406916 150 2845543 Table.3. Recovery results of Altretamine Concentration Concentration % Recovery added (g/mL) found (g/mL) 50 49.81 99.62% 100 99.88 99.88% 150 150.42 100.27%
Level 50% 100% 150%
Mean recovery 99.92%
Table.4. System precision data of Altretamine S. No. Area of Altretamine 1 1889572 2 1891733 3 1888707 4 1883428 5 1894047 Average 1891566 SD 6188.9 %RSD 0.32
Table.5. Method precision data of Altretamine S. No. Area of Altretamine 1 1903347 2 1883489 3 1880659 4 1911086 5 1879578 6 1907331 Average 1894248 SD 14512.7 %RSD 0.77
Table.6. System suitability parameters of Altretamine Parameter Results Linearity range (g/mL) 25-150 Correlation coefficient 0.999 Theoretical plates (N) 4253 Tailing factor 1.49 LOD (g/mL) 0.46 LOQ (g/mL) 1.39 Retention time (min) 2.533
IJRPB 1(6)
www.ijrpb.com
Page 784
Lakshmana Rao et.al
Formulation CANTRET
Table.7. Assay results of Altretamine Label claim Amount found 50 mg 49.99 mg
%Assay 99.98%
Stress conditions
Table.8. Degradation studies of Altretamine Degradation Area of % % of active drug present time peak Degradation after degradation 30 mins 30 mins 30 mins 6 hours 6 hours 7 days 1891733 1720141 1760088 1751783 1792116 1887905 1872031 9.08% 6.96% 7.40% 5.27% 0.21% 1.05% 90.92% 93.04% 92.60% 94.73% 99.79% 98.95%
Standard Drug Acidic Alkaline Oxidative Thermal Hydrolytic Photolytic CONCLUSION
The present study represents the first report that deals with the development of a stability indicating HPLC method for determination of Altretamine. This study is a typical example for development of a stability indicating assay established by following the recommendations of ICH guidelines. The proposed method showed acceptable accuracy, precision, selectivity and wide linear concentration range. The results of analysis proved that the method is suitable for the determination of Altretamine in bulk and capsule dosage forms without any interference from the degradation products and it is recommended for routine quality control analysis of the Altretamine in pharmaceutical formulations. REFERENCES Barker IK, Crawford SM and Fell AF, Determination of Altretamine in human plasma with highperformance liquid chromatography, Journal of Liquid Chromatography B, 660(1), 1994, 121-126. Ghiorghis A and Talebian AH, High-pressure liquid chromatography separation of potential impurities of Altretamine, Journal of Liquid Chromatography, 14(12), 1991, 2331-2349.
ICH Harmonised Tripartite Guideline, Stability Testing of New Drug Substances and Products, Q1A(R2), International Conference on Harmonization, 2003, 1-18. ICH Harmonised Tripartite Guideline, Validation of analytical procedures: Text and methodology, Q2(R1), International Conference on Harmonization, 2005, 113. Neil OJM, The Merck Index, An Encyclopedia of Chemicals Drug and Biologicals, 14th Ed., Merck Research Laboratories, Division of Merck and Co. Inc., White House Station, NJ, 2006, 57. Rhoda LC and Diana F, Altretamine: A review of its pharmacodynamic and pharmacokinetic properties and therapeutic potential in cancer chemotherapy, Drugs, 49(6), 1995, 932-953. Snyder LR, Kirkland JJ and Glajch JL, Practical HPLC Method Development, 2nd Ed., New York, John Wiley and Sons, 1997, 184-185. Wiernik PH, Hexamethylmelamine and low or moderate dose cisplatin with or without pyridoxine for treatment of advanced ovarian carcinoma: a study of the eastern cooperative oncology group, Cancer Investigation, 10(1), 1992, 1-9.
IJRPB 1(6)
www.ijrpb.com
Page 785
Delhi Raj et.al
A review of various analytical methods on Atrovastatin

N.Delhiraj*, P.Ashok,U.Ravikiran,P.Abhinandhana Department of pharmaceutical analysis, A.S.N Pharmacy College, Tenali, Andhra Pradesh *Corresponding author E.Mail:pharmaraj1981@gmail.com ABSTRACT There is a review of analytical methods for atorvastatin, such as spectrophotometry, derivative spectrophotometry and various chromatographic procedures such as, high-performance liquid chromatography (HPLC), high-performance thin-layer chromatography (HPTLC), and liquid chromatography tandem mass spectrometry (LC-MS). This review is based on representative publications that were published between 2000 and 2013. Key Words: hypolipideamic drugs, HMG-COA analysis, review, spectrophotometry, chromatography INTRODUCTION Atorvastatin is the most efficacious and best tolerated hypolipideamic drugs introduced in 1980.They competitively inhibit conversion of 3hydroxy 3-methyl glutaryl coenzyme and (HMGCOA) to mevalonate Atorvastatin is the most efficacious and best tolerated hypolipideamic drugs. They competitively inhibit conversion of 3-hydroxy 3methyl glutaryl coenzyme and (HMG-COA) to mevalonate (rate limiting step in cholesterol (CH) synthesis) by the HMG-COA reductase. Therapeutic doses reduce cholesterol synthesis by 20-50%. This results in compensatory increases in Low density lipoprotein (LDL) receptor expression on liver cell leads to increased receptor mediated uptake and catabolism of Intermediate density lipoprotein (IDL) and LDL. Over long term feedback induction of HMG-COA reductase tends to increase CH synthesis but a steady is finally attained with a dose dependent lowering of LDL-CH levels. The daily dose of Atorvastatin for lowering LDL-CH levels by 30-35% is 10 mg. Morever at their maximum recommended doses atorvastatin can reduce CH up to 45-55%.5. The more efficacious atrovastatin given at their higher doses effectively reduce Triglycerides (TGs) (by 2535%) when they are moderately raised but not when they are markedly raised. Because HMG-COA reductase activity is maximum at midnight, statins are administered at bed time to obtain maximum effectiveness. All statins except rosuvastatin are metabolized primarily by CYP3A4. Inhibitors and inducers of this isoenzyme respectively increase and decrease statin blood levels. (Tripathi,KD 2008)
and atorvastatin in human serum using naproxen sodium as an internal standard. Effect of different experimental parameters and various particulate columns on the analysis of these analytes was evaluated. The method showed adequate separation for rosuvastatin and atorvastatin and best resolution was achieved with Brownlee analytical C18 column (1504.6 mm, 5 m) using methanol-water (68:32, v/v; pH adjusted to 3.0 with trifluoroacetic acid) as a mobile phase at a flow rate of 1.5 ml/min and wavelength of 241 nm. The calibration curves were linear over the concentration ranges of 2.0-256 ng/ml for rosuvastatin and 3.0-384 ng/ml for atorvastatin. The lower limit of detection (LLOD) and lower limit of quantification (LLOQ) for rosuvastatin were 0.6 and 2.0 ng/ml while for atorvastatin were 1.0 and 3.0ng/ml, respectively. All the analytes were separated in less than 7.0 min. The proposed method could be applied for routine laboratory analysis of rosuvastatin and atorvastatin in human serum samples, pharmaceutical formulations, drug-drug interaction studies and pharmacokinetics studies. (Shah Y, 2011) Two simple and accurate methods to determine atorvastatin calcium and ramipril in capsule dosage forms were developed and validated using HPLC and HPTLC. The HPLC separation was achieved on a Phenomenex Luna C18 column (250 x 4.6 mm id, 5 microm) in the isocratic mode using 0.1% phosphoric acidacetonitrile (38 + 62, v/v), pH 3.5 +/- 0.05, mobile phase at a flow rate of 1 ml/min. The retention times were 6.42 and 2.86 min for atorvastatin calcium and ramipril, respectively. Quantification was achieved with a photodiode November December 2013 Page 786
Chromatographic and spectrophotometric methods: A novel, precise, accurate and rapid isocratic reversed-phase high performance liquid chromatographic/ultraviolet (RP-HPLC/UV) method was developed, optimized and validated for simultaneous determination of rosuvastatin IJRPB 1(6) www.ijrpb.com
Delhi Raj et.al
array detector set at 210 nm over the concentration range of 0.5-5 g/ml for each, with mean recoveries (at three concentration levels) of 100.06 +/- 0.49% and 99.95 +/- 0.63% RSD for atorvastatin calcium and ramipril, respectively. The HPTLC separation was achieved on silica gel 60 F254 HPTLC plates using methanol-benzeneglacial acetic acid (19.6 + 80.0 + 0.4, v/v/v) as the mobile phase. The Rf values were 0.40 and 0.20 for atorvastatin calcium and ramipril, respectively. Quantification was achieved with UV densitometry at 210 nm over the concentration range of 50-500 ng/spot for each, with mean recoveries (at three concentration levels) of 99.98 +/- 0.75% and 99.87 +/- 0.83% RSD for atorvastatin calcium and ramipril, respectively. Both methods were validated according to International Conference on Harmonization guidelines and found to be simple, specific, accurate, precise, and robust. The mean assay percentages for atorvastatin calcium and ramipril were 99.90 and 99.55% for HPLC and 99.91 and 99.47% for HPTLC, respectively. The methods were successfully applied for the determination of atorvastatin calcium and ramipril in capsule dosage forms without any interference from common excipients. (Panchal HJ, 2010) Charged aerosol detector (CAD) detection approach was applied in a new HPLC method for the determination of three of the major statins used in clinical treatment-simvastatin, lovastain and atorvastatin. The method was optimized and the influence of individual parameters on CAD response and sensitivity was carefully studied. Chromatography was performed on a Zorbax Eclipse XDB C18 (4.6 mm x 75 mm, 3.5 microm), using acetonitrile and formic acid 0.1% as mobile phase. The detection was performed using both charged aerosol detector (CAD) (20 pA range) and diode array detector-238 nm(DAD) simultaneously connected in series. In terms of linearity, precision and accuracy, the method was validated using tablets containing atorvastatin and simvastatin. The CAD is designated to be a non-linear detector in a wide dynamic range, however, in this application and in the tested concentration range its response was found to be perfectly linear. The limits of IJRPB 1(6) www.ijrpb.com
quantitation (0.1 g/ml) were found to be two times lower than those of UV detection. (Patil UP, 2010) A simple, specific, accurate and precise high-performance thin-layer chromatographic method for analysis of Telmisartan and Atorvastatin calcium in fixed dose combination has been developed. The method uses aluminium plates coated with silica gel 60 F as stationary phase and toluene: methanol (7: 3, v/v) as mobile phase. Densitometric evaluation of the separated bands was performed at 280 nm. The two drugs were satisfactorily resolved with RF values 0.50 0.01 and 0.29 0.00 for Telmisartan and Atorvastatin calcium, respectively. The respective calibration plots were found to be linear over the range 2001000 and 200700 ng/band for Telmisartan and Atorvastatin calcium, respectively. This method has been successfully validated and applied for the analysis of drugs in pharmaceutical formulation. (Novakova, 2009)
254
A number of analytical methods were reported for the estimation of atorvastatin and ramipril from their individual dosage forms or in combination with other drugs (Valiyare, 2004; Vachareau and Neirinck, 2000). Here successful reverse phase-high performance liquid chromatographic method and spectroscopic methods were developed then validated for the analysis of combined dosage form of atorvastatin and ramipril. Individual lambda-max for atorvastatin is 247 nm and that of ramipril is 208 nm. They intersect at 215 nm which is fixed as wavelength for reverse phase-high performance liquid chromatographic method. (Joseph, 2008) A simple, accurate and precise highperformance thin-layer chromatographic method has been developed for the estimation of Atorvastatin Calcium and Metoprolol Tartarate simultaneously from a capsule dosage form. The method employed Silica gel 60F254 precoated plates as stationary phase and a mixture of Chloroform: Methanol: Glacial acetic acid (dil.) (9:1.5:0.2 ml %v/v) as mobile phase. Densitometric scanning was performed at 220 nm using Camag TLC scanner 3. The method was linear in the drug concentrations' range of 500 to 2500 ng/spot for Atorvastatin Calcium, also for November December 2013 Page 787
Delhi Raj et.al
Metoprolol Tartarate with correlation coefficient of 0.984 for Atorvastatin Calcium and 0.995 for Metoprolol Tartarate respectively. The retention factor for Atorvastatin Calcium was 0.45 0.04 and for Metoprolol Tartarate was 0.25 0.02. The method was validated as per ICH (International Conference on Harmonization) Guidelines, proving its utility in estimation of Atorvastatin Calcium and Metoprolol Tartarate in combined dosage form. (Patole SM, 2011) A rapid high performance liquid chromatographic method was developed and validated for determination of atorvastatin in pharmaceutical dosage forms, and for evaluation of its stability in the solid phase. Separation of atorvastatin was successfully achieved on a C-18 column utilizing water--acetonitrile at the volumetric ratio of 48:52, adjusted to pH 2.0 with 80% ortho-phosphoric acid. The detection wavelength was 245 nm. The method was validated and the response was found to be linear in the drug concentration range of 0.04 mg/mol 0.4 mg/mol. The mean values percentage relative standard deviation+/- (RSD) of the slope and the correlation coefficient were 8.192 +/- 0.260 and 0.999, respectively. The RSD values for intraand interday precision were < 1.00% and 0.90%, respectively. The degradation kinetic of atorvastatin at 363 K in a relative humidity of 76.4% was observed to be autocatalytic first order reaction. The kinetic parameters were as follows: k (where k represents the velocity constant; s (-1) = (1.42 +/- 0.19) 10(-6); t (0.5) (where t (0.5) represents the time needed for a 50% decay of atorvastatin; days) = 32.82 +/- 0.9; t (0.1) (where t (0.1) represents the time needed for a 10% decay of atorvastatin; days) = 13.86 +/- 0.8. (Stains B, 2006) A simple, precise and accurate reversedphase liquid chromatographic method has been developed for the simultaneous estimation of atorvastatin calcium and telmisartan in tablet formulations .The chromatographic separation was achieved on (Waters symmetry C18, 250mm x 4.6mm, 5) analytical column. A mixture of ammonium acetate (0.02M, pH 4.0 adjusted with glacial acetic acid) and acetonitrile in ratio (40:60 v/v) at flow rate of 1.0ml/min and detector IJRPB 1(6) www.ijrpb.com
wavelength 254 nm. The retention time of atorvastatin calcium and telmisartan was found to be 4.6 and 6.1 minutes respectively. The validation of the proposed method was carried out for its specificity, linearity, accuracy, precision, limit of detection and quantification for both atorvastatin calcium and telmisartan. The developed method can be used for routine quality analysis of titled drugs in combination in tablet formulation (Suresh Kumar GV, 2010). A simple, specific, accurate and stability indicating reversed phase high performance liquid chromatographic method was developed for the simultaneous determination of atorvastatin calcium and amlodipine besylate in tablet dosage forms. A Phenomenex Gemini C-18, 5 mm column having 2504.6 mm i.d. in isocratic mode, with mobile phase containing 0.02 M potassium dihydrogen phosphate:acetonitrile:methanol (30:10:60, v/v/v) adjusted to pH 4 using ortho phosphoric acid was used. The flow rate was 1.0 ml/min and effluents were monitored at 240 nm. The retention times of atorvastatin calcium and amlodipine besylate were 11.6 min and 4.5 min, respectively. The calibration curves were linear in the concentration range of 0.08-20 g/ml for atorvastatin calcium and 0.1-20 g/ml for amlodipine besylate. Atorvastatin calcium and amlodipine besylate stock solutions were subjected to acid and alkali hydrolysis, chemical oxidation and dry heat degradation. The degraded product peaks were well resolved from the pure drug peak with significant difference in their retention time values. The proposed method was validated and successfully applied to the estimation of atorvastatin calcium and amlodipine besylate in combined tablet dosage forms (Shah D.A, 2008) A reverse phase high performance liquid chromatographic method was developed for the simultaneous estimation of atorvastatin calcium and fenofibrate in tablet formulation. The separation was achieved by Luna C18 column and methanol: acetate buffer pH 3.7 (82:18 v/v) as mobile phase, at a flow rate of 1.5 ml/min. Detection was carried out at 248 nm. Retention time of atorvastatin calcium and fenofibrate was found to be 3.02+0.1 and 9.05+0.2 min, November December 2013 Page 788
Delhi Raj et.al
respectively. The method has been validated for linearity, accuracy and precision. Linearity for atorvastatin calcium and Fenofibrate were in the range of 1-5 g/ml and 16-80 g/ml, respectively. The mean recoveries obtained for Atorvastatin calcium and fenofibrate were 101.76% and 100.06%, respectively. Developed method was found to be accurate, precise, selective and rapid for simultaneous estimation of atorvastatin calcium and fenofibrate in tablets. (Jain N, 2008) An isocratic RP-HPLC method was developed and validated for the quantitation of Atorvastatincalcium and Amlodipine besylate in combined tablet dosage forms. Quantitation was achieved using a reversed-phase Hypersil silica BDS (250x4.6mm with 5+ particle size) column at ambient temperature with mobile phase consisting of 0.05M ammonium acetate buffer (pH-4) and acetonitrilein the ratio (40 + 60, v/v). The flow rate was 1.0 ml/min. Measurements were made at a wavelength of 240.0nm. The proposed method was validated for selectivity, precision, linearity and accuracy. The assay method was found to be linear from 30.070.0g/ml for Amlodipine besylate and 60.0140.0 g/ml for Atorvastatin calcium. All validation parameters were within the acceptable range. The developed method was successfully applied to estimate the amount of Atorvastatin calcium and Amlodipine besylate in combined dosage forms. (Mishra P, 2007) A stability indicating UPLC method was developed and validated for the simultaneous determination of atorvastatin, fenofibrate and their impurities in tablets. The chromatographic separation was performed on acquity UPLC BEH C18 column (1.7 microm, 2.1 mmx100 mm) using gradient elution of acetonitrile and ammonium acetate buffer (pH 4.7; 0.01 M) at flow rate of 0.5 ml/min. UV detection was performed at 247 nm. Total run time was 3 min within which main compounds and six other known and major unknown impurities were separated. Stability indicating capability was established by forced degradation experiments and separation of known degradation products. The method was validated for accuracy, repeatability, reproducibility and robustness. IJRPB 1(6) www.ijrpb.com
Linearity, loss of drying (LOD) and loss of quality (LOQ) was established. (Kadav AA, 2008) A simple, accurate, rapid and precise isocratic reversed-phase high-performance liquid chromatographic method has been developed and validated for simultaneous determination of aspirin, atorvastatin calcium and clopidogrel bisulphate in capsules. The chromatographic separation was carried out on an Inertsil ODS analytical column (1504.6 mm; 5 m) with a mixture of acetonitrile: phosphate buffer pH 3.0 adjusted with o-phosphoric acid (50:50, v/v) as mobile phase; at a flow rate of 1.2 ml/min. UV detection was performed at 235 nm. The retention times were 1.89, 6.6 and 19.8 min. for aspirin, atorvastatin calcium and clopidogrel bisulphate, respectively. Calibration plots were linear (r 2 >0.998) over the concentration range 5-30 g/ml for atorvastatin calcium and 30-105 g/ml for aspirin and clopidogrel bisulphate. The method was validated for accuracy, precision, specificity, linearity, and sensitivity. The proposed method was successfully used for quantitative analysis of capsules. No interference from any component of pharmaceutical dosage form was observed. Validation studies revealed that method is specific, rapid, reliable, and reproducible. The high recovery and low relative standard deviation confirm the suitability of the method for routine determination of aspirin, atorvastatin calcium and clopidogrel bisulphate in bulk drug and capsule dosage form. (Londhe SV, 2011) A UV spectrophotometric method was developed for the estimation of atorvastatin calcium & fenofibrate in table dosage form by using simultaneous equation method. The drug obeyed Beers law & showed good correlation near to 0.999. Absorption maxima of atorvastatin calcium & fenofibrate were found to be at 246 and 286nm respectively. Beers law was obeyed in concentration rang of 1-10 g/ml for atorvastatin calcium & 2-20g/ml for fenofibrate. The method has been validated for linearity, accuracy & precision. The recovery was more than 99%. The developed method was found to be accurate, simple, precise, economical, and selective for simultaneous estimation of November December 2013 Page 789
Delhi Raj et.al
atorvastatin calcium &fenofibrate in tablet dosage form. &fenofibrate in tablet dosage form. (Rupali Hiravr, 2010) A UV spectrophotometric method using simultaneous equation was developed for the simultaneous determination of Telmisartan and Atorvastatin calcium in a binary mixture. In the proposed method, the signals were measured at 296.0 nm and 247.0 nm corresponding to absorbance maxima of Telmisartan and Atorvastatin Calcium in methanol respectively. Linearity range was observed in the concentration range of 5-30 g/ml for both the drugs. Concentration of each drug was obtained by using the absorptivity values calculated for both drugs at two wavelengths, 296.0 nm and 247.0 nm and solving the simultaneous equation. Developed method was applied to laboratory mixture and its pharmaceutical formulation. The method was validated statistically and recovery study was performed to confirm the accuracy of the method. (Chaudhari KU, 2010) Atorvastatin calcium(ATC) is the active pharmaceutical ingredient (API) of the best selling lipid-lowering formulation Lipitor. Twelve ATC crystal forms are known and several pharmaceutical companies are developing or have developed generic drug formulations based on different ATC polymorphs. The strong overlap of the X-ray diffraction patterns (XRD) of the polymorphs with the respective patterns of the excipients, the presence of small API quantities in the tablet and the similarity of the crystal phase VIII XRD pattern used in the tablet examined in this work to that of phases IV and IX made identification difficult. Quantitative determination of Atorvastatin was attempted using Raman spectroscopy (RS), IR spectroscopy and X-ray powder diffraction. It was found that RS exhibited lower detection limit and a calibration model was constructed. Its application on commercial ATC tablets with 40mg strength yielded an error of 1.25%. (Skoda D, 2008) The aim of the proposed work was to develop and validate a simple and sensitive assay for the analysis of atorvastatin, ortho- and Parahydroxy-ATC, ATC lactone, and ortho- and Parahydroxy-ATC lactone in human plasma using IJRPB 1(6) www.ijrpb.com
liquid chromatography tandem mass spectrometry. All six analytes and corresponding deuterium (d5)-labeled internal standards were extracted from 50 L of human plasma by protein precipitation. The chromatographic separation of analytes was achieved using a Zorbax-SB Phenyl column (2.1 mm100 mm, 3.5 m). The mobile phase consisted of a gradient mixture of 0.1% v/v glacial acetic acid in10% v/v methanol in water (solvent A) and 40% v/v methanol in acetonitrile (solvent B). All analytes including ortho- and Para-hydroxy metabolites were baseline separated within 7.0 min using a flow rate of 0.35 ml/min. Mass spectrometry detection was carried out in positive electro spray ionization mode, with multiple reactions monitoring scan. The calibration curves for all analytes were linear (R20.9975, n=3) over the concentration range of 0.05100 ng/ml and with lower limit of quantitation of 0.05 ng/ml Mean extraction recoveries ranged between 88.6111%. Intra- and inter-run mean percent accuracy was between 85 115% and percent imprecision was15%. Stability studies revealed that ATV acid and lactone forms were stable in plasma during bench top (6 h on ice-water slurry), at the end of three successive freeze and thaw cycles and at 80 C for 3 months. The method was successfully applied in a clinical study to determine concentrations of ATV and its metabolites over12 h post-dose in patients receiving atorvastatin. (Macwan JS, 2011) A rapid, simple, sensitive and specific LC-MS/MS method has been developed and validated for the simultaneous estimation of atorvastatin, amlodipine, ramipril and benazepril using nevirapine as an internal standard. The API-4000 LC-MS/MS was operated under the multiple-reaction monitoring mode using electro spray ionization. Analytes and IS were extracted from plasma by simple liquid-liquid extraction technique using ethyl acetate. The reconstituted samples were chromatographed on C 18 column by pumping 0.1% formic acid-acetonitrile (15:85, v/v) at a flow rate of 1ml/min. A detailed validation of the method was performed as per the FDA guidelines and the standard curves were found to be linear in the range of 0.26-210ng/ml for ATO; 0.05-20.5ng/ml for amlodipine( AML); November December 2013 Page 790
Delhi Raj et.al
0.25-208ng/ml for RAM and 0.74-607ng/ml mean correlation coefficient of 0.99 for each analyte. The intra-day and inter-day precision and accuracy results were well within the acceptable limits. A run time of 2.5min for each sample made it possible to analyze more than 400 human plasma samples per day. The developed assay method was successfully applied to a pharmacokinetic study in human male volunteers. (Pilli NR, 2011) CONCLUSION This review is targeted at out lining the various analytical methods and other related aspects of atorvastatin it is however pertinent to state that newer analytical methods are being developed with respect to advancing technology and this may necessitate a future review. REFERENCES Bisulphate in Capsules, Indian J Pharm Sci, 73(1), 2011, 23-9. Chaudhari KU P.D. Gaikwad, V.H. Bankar and S.P. Pawar, Development and validation of uvspectrophotometric method for simultaneous estimation of telmisartan and atorvastatin calcium in bulk and tablet dosage form, Inj.Jour.PharmTech, 2(1), 2010, 255-264. Jain N, Raghuwanshi R, Jain D. Development and Validation of RPHPLC method for simultaneous estimation of Atorvastatin Calcium and Fenofibrate in tablet dosage forms, Indian J Pharm Sci, 70, 2008, 263-5. Joseph L, George M, Rao B VR, Simultaneous estimation of atorvastatin and ramipril by RPHPLC and spectroscopy, Pak J Pharm Sci, 21(3), 2008, 282-4. Kadav AA, Vora DN. Stability indicating UPLC method for simultaneous determination of atorvastatin, fenofibrate and their degradation products in tablets, J Pharm Biomed Anal, 48(1), 2008, 120-6. Londhe SV, Deshmukh RS, Mulgund SV, Jain KS, Development and Validation of a Reversedphase HPLC Method for Simultaneous IJRPB 1(6) www.ijrpb.com
Determination of Aspirin, Atorvastatin Calcium and Clopidogrel Macwan JS, Ionita IA, Dostalek M, Akhlaghi F. Development and validation of a sensitive, simple, and rapid method for simultaneous quantitation of atorvastatin and its acid and lactone metabolites by liquid chromatographytandem mass spectrometry (LC-MS/MS), Anal Bioanal Chem, 400(2), 2011, 423-33. Mishra P Alkagupta and K. Shah, Simultaneous estimation of atorvastatin calcium and amlodipine besylate from tablets, Indian journal of pharmaceutical sciences, 69(6), 2007, 831-833. Novkov L, Lopz SA, Solichov D, Satnsk D, Kulichov B, Horna A, Solich P, Comparison of UV and charged aerosol detection approach in pharmaceutical analysis of statins, Talanta, 78(3), 2009, 834-9. Panchal HJ, Suhagia BN, Simultaneous determination of atorvastatin calcium and ramipril in capsule dosage forms by highperformance liquid chromatography and highperformance thin layer chromatography, J AOAC Int, 93(5), 2010, 1450-7. Patil UP S. V. Gandhi M. R. Sengar, V. S. Rajmane A, Validated densitometric method for analysis of telmisartan and atorvastatin calcium in fixed dose combination, J. Chil. Chem. Soc., 55,2010,94-96. Patole S, Khodke A, Potale L, Damle M, A validated densitometric method for analysis of atorvastatin calcium and Metoprolol Tartarate as bulk drugs and in combined capsule dosage forms, J Young Pharm, 3(1), 2011, 55-9. Pilli NR, Inamadugu JK, Mullangi R, Karra VK, Vaidya JR, Rao JV, Simultaneous determination of atorvastatin, amlodipine, ramipril and benazepril in human plasma by LC-MS/MS and its application to a human pharmacokinetic study, Biomed Chromatogr, 25(4), 2011, 439-49. Rupali Hirave, Ravindra Bendagude, Manish Kondawar, RP-HPLC method for simultaneous estimation of Atorvastatin Calcium and Fenofibrate in tablet dosage forms, Journal of Pharmacy Research, 3(10), 2010, 2400-2401 November December 2013 Page 791
Delhi Raj et.al
Shah DA, K.K Bhatt, R.S Mehta, S.L Baldania and T.R Gandhi, Stability indicating RP HPLC estimation of atorvastatin calcium and amlodipine besylate in pharmaceutical formulations. Indian journal of pharmaceutical sciences, 70(6), 2008, 754-760. Shah Y, Iqbal Z, Ahmad L, Khan A, Khan MI, Nazir S, Nasir F, Simultaneous determination of rosuvastatin and atorvastatin in human serum using RP-HPLC/UV detection: method development, validation and optimization of various experimental parameters, J Chromatogr B Analyt Technol Biomed Life Sci, 879(9-10), 2011, 557-63 Skoda D, Kontoyannis CG, Identification and quantitative determination of atorvastatin calcium polymorph in tablets using FT-Raman spectroscopy, Talanta, 74(4), 2008, 1066-70. Stanisz B, Kania L, Validation of HPLC method for determination of atorvastatin in tablets and for monitoring stability in solid phase, Acta Pol Pharm, 63(6), 2006, 471-6. Suresh Kumar GV, Rajendraprasad Y, Chandrashekar SM, Development and validation of reversed-phase HPLC method for simultaneous estimation of Atorvastatin calcium and Telmisartan in tablet dosage form, International Journal of Pharma Tech Research, 2(1), 2010, 463-470. Tripathi KD, Essentials of medical pharmacology, sixth edition, Jaypee publication, 2008, 614-615.
IJRPB 1(6)
www.ijrpb.com
Page 792
Praveen and Ranadheer
A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular cancer

Praveen D*, Ranadheer Chowdary P School of Pharmaceutical Sciences, Vels University *Corresponding author: Email.id: praveennandan.1993@gmail.com, +919940510419 ABSTRACT Combination chemotherapy with vinblastine plus bleomycin in disseminated testicular cancer was pioneered by Samuels and represented a major therapeutic advance (Samuels ML, 1976). Another milestone in the chemotherapy of testicular cancer was the discovery of the activity of cis-diammine dichloro platinum (CDDP) in germinal neoplasm. Complete response rates between 60-80% have been reported for patients with advanced disease and the vast majority of these patients are cured of their disease as the relapse rates are less than 15% (Robert F, 1983). This discovery has led to a new and better chemotherapeutic combination in the treatment of testicular cancer. For the first time, in a random prospective cooperative group clinical trial evaluating the effectiveness of three Chemotherapy combinations in the treatment of a solid tumor, in which the dose of one drug is the only treatment variable, a clear-cut relationship has been shown for dose of therapy, not only with response and survival, but with an increased potential for cure as well. Their plasma half-lives, pharmacokinetic parameters, toxicities, adverse drug effects were also evaluated in various studies. This combination have been proved better than Bleomycin-cisplatin-etoposide as the former combination masks the toxic effects of bleomycin such as mucositis etc. Thus we conclude that this combination is a safer one with a good therapeutic efficacy and reduced toxicity. Key Words: Combination chemotherapy, bleomycin, cisplatin, testicular cancer INTRODUCTION Testicular cancer is a cancer that develops in the testicles, a part of the male reproductive system. Testicular cancer has one of the highest cure rates of all cancers: a five-year survival rate in excess of 90 % overall, and almost 100 % if it has not spread (metastasized). Even for the relatively few cases in which malignant cancer has spread widely, modern chemotherapy offers a cure rate of at least 80%. One of the first signs of testicular cancer is often a lump or swelling in the testes. The three basic types of treatment are surgery, radiation therapy, and chemotherapy. Surgery is performed by urologists; radiation therapy is administered by radiation oncologists; and chemotherapy is the work of medical oncologists. In most patients with testicular cancer, the disease is cured readily with minimal long-term morbidity. While treatment success depends on the stage, the average survival rate after five years is around 95%, and stage 1 cancers cases (if monitored properly) have essentially a 100% survival rate (which is why prompt action, when testicular cancer is a possibility, is extremely important) Testicular cancer: Testicular cancer is a disease in which cells become malignant (cancerous) in one or both testicles. The testicles (also called testes or gonads) are a pair of male sex glands. They produce and store sperm and are the main source of testosterone (male hormones) in men. These hormones control the development of the reproductive organs and other male physical characteristics. The testicles are located under the penis in a sac-like pouch called the scrotum. Based on the characteristics of the cells in the tumor, testicular cancers are classified as seminomas or nonseminomas. Other types of cancer that arise in the testicles are rare and are not described here. Seminomas may be one of three types: classic, anaplastic, or spermatocytic. Types of nonseminomas include choriocarcinoma, embryonal carcinoma, teratoma, and yolk sac tumors. Testicular tumors may contain both seminoma and nonseminoma cells. Epidemiology: Testicular cancer accounts for only 1% of all cancers in men in the United States. About 8,000 men are diagnosed with testicular cancer, and about 390 men die of this disease each year. Testicular cancer occurs most often in men between the ages of 20 and 39, and is the most common form of cancer in men between the ages of 15 and 34. It is most common in white men, especially those of Scandinavian descent. The testicular cancer rate has more than doubled among white men in the past 40 years, but has only recently begun to increase among black men. The reason for the racial differences in incidence is not known. Risk Factors: Undescended testicle (cryptorchidism): Normally, the testicles descend from inside the abdomen into the
IJRPB 1(6)
www.ijrpb.com
Page 793
scrotum before birth. The risk of testicular cancer is increased in males with a testicle that does not move down into the scrotum. This risk does not change even after surgery to move the testicle into the scrotum. The increased risk applies to both testicles. Congenital abnormalities: Men born with abnormalities of the testicles, penis, or kidneys, as well as those with inguinal hernia (hernia in the groin area, where the thigh meets the abdomen), may be at increased risk. History of testicular cancer: Men who have had testicular cancer are at increased risk of developing cancer in the other testicle. Family history of testicular cancer: The risk for testicular cancer is greater in men whose brother or father has had the disease. Symptoms: Common symptoms are painless lump or swelling in a testicle, pain or discomfort in a testicle or in the scrotum, any enlargement of a testicle or change in the way it feels, a feeling of heaviness in the scrotum, a dull ache in the lower abdomen, back, or groin, a sudden collection of fluid in the scrotum. Diagnosis: Blood tests that measure the levels of tumour markers. Tumour markers are substances often found in higher-than-normal amounts when cancer is present. Tumour markers such as alpha-fetoprotein (AFP), Beta-human chorionic gonadotropin (HCG), and lactate dehydrogenase (LDH) may suggest the presence of a testicular tumor, even if it is too small to be detected by physical exams or imaging tests. Ultrasound: A test in which high-frequency sound waves are bounced off internal organs and tissues. Their echoes produce a picture called a sonogram. Ultrasound of the scrotum can show the presence and size of a mass in the testicle. It is also helpful in ruling out other conditions, such as swelling due to infection or a collection of fluid unrelated to cancer. Biopsy: Biopsy (microscopic examination of testicular tissue by a pathologist) to determine whether cancer is present. In nearly all cases of suspected cancer, the entire affected testicle is removed through an incision in the groin. This procedure is called radical inguinal orchiectomy. Treatment: Chemotherapy is the use of anticancer drugs to kill cancer cells. When chemotherapy is given to testicular cancer patients, it is usually given as adjuvant therapy (after surgery) to destroy cancerous cells that may remain in the body. Chemotherapy may also be the initial treatment if the cancer is advanced; that is, if it has spread outside the
testicle at the time of the diagnosis. Most anticancer drugs are given by injection into a vein. Chemotherapy is a systemic therapy, meaning drugs travel through the bloodstream and affect normal as well as cancerous cells throughout the body. The side effects depend largely on the specific drugs and the doses. Common side effects include nausea, hair loss, fatigue, diarrhea, vomiting, fever, chills, coughing/shortness of breath, mouth sores, or skin rash. Other side effects include dizziness, numbness, loss of reflexes, or difficulty hearing. Some anticancer drugs also interfere with sperm production. Although the reduction in sperm count is permanent for some patients, many others recover their fertility. Some men with advanced or recurrent testicular cancer may undergo treatment with very high doses of chemotherapy. These high doses of chemotherapy kill cancer cells, but they also destroy the bone marrow, which makes and stores blood cells. Such treatment can be given only if patients undergo a bone marrow transplant. In a transplant, bone marrow stem cells are removed from the patient before chemotherapy is administered. These cells are frozen temporarily and then thawed and returned to the patient through a needle (like a blood transfusion) after the high-dose chemotherapy has been administered.
Combination
therapy: Bleomycin is a glycopeptide antibiotic with a unique mechanism of antitumor activity. The drug binds to guanosinecytosine-rich portions of DNA via association of the "S" tripeptide and by partial intercalation of the bithiazole rings. A group of five nitrogen atoms arranged in a square-pyramidal conformation binds divalent metals including iron, the active ligand, and copper, an inactive ligand. Molecular oxygen, bound by the iron, can produce highly reactive free radicals and Fe(III). The free radicals produce DNA singlestrand breaks at 3'-4' bonds in deoxyribose. This yields free base propenals, especially of thymine: cytotoxicity is cell-cycle-phase specific for G2 phase. In humans, bleomycin is rapidly eliminated primarily by renal excretion. This accounts for approximately half of a dose. In patients with renal compromise or extensive prior cisplatin therapy, the drug half-life can extend from 2 to 4 hours up to 21 hours. Thus, dose adjustments are needed when creatinine clearance is less than or equal to 3N mL/min (Dorr RT, 1992). Platinum complexes are clinically used as adjuvant therapy of cancers aiming to induce tumor cell death. Depending on cell type and concentration, cisplatin induces cytotoxicity, e.g., by interference with transcription and/or DNA replication mechanisms. Additionally, cisplatin damages tumors via induction November December 2013 Page 794
IJRPB 1(6)
www.ijrpb.com
of apoptosis, mediated by the activation of various signal transduction pathways, including calcium signalling, death receptor signalling, and the activation of mitochondrial pathways. Unfortunately, neither cytotoxicity nor apoptosis are exclusively induced in cancer cells, thus, cisplatin might also lead to diverse side-effects such as neuro- and/or renaltoxicity or bone marrow-suppression. Moreover, the binding of cisplatin to proteins and enzymes may modulate its biochemical mechanism of action ( AnaMaria Florea 2011). There are two high affinity vinblastinebinding sites per mole of embryonic chick brain tubulin (KA = 3-5 X 10(5) l./mol). Binding to these sites was rapid, and relatively independent of temperature between 37 and 0degreeC. Vincristin sulfate and desacetylvinblastine sulfate, two other active vinca alkaloid derivatives, competitively inhibited the binding of vinblastine. The inhibition constant for vincristine was 1.7 X 10(-5) M; and for desacetylvinblastine, 2 X 10(-5) M. The vinblastine binding activity of tubulin decayed upon aging, but this property was not studied in detail. Vinblastine did not depolymerize stable sea urchin sperm tail outer doublet microtubules, nor did it bind to these microtubules (Wilson L , 1975). Since 1974, with the introduction of platinum-based combination chemotherapy, the complete response rate of patients with metastatic germ cell neoplasms of the testis has improved from 10%-30% to 50%-75%. Furthermore, a significant proportion of patients entering complete remission are relapse free after 2 years, and may be considered cured of their disease. Important prognostic factors predicting for complete response include initial performance status, tumor histology, and tumor burden at presentation. Numerous in vivo studies of antitumor agents exposed to a variety of transplantable experimental tumors have indicated a steep dose-response and dosetoxicity. These observations apply to both cell cycle specific as well as non-cell-specific agents. In tumors composed of a heterogenous cell population with both drug-sensitive and drug-resistant subpopulations the dose response curve is modified, depending on the ratio of resistant to sensitive fraction. While there are few prospective randomized clinical trials addressing dose as a treatment variable, there appears to be a confirmation of the fore mentioned concepts in Hodgkin's and certain non-Hodgkin's lymphoma, acute lymphocytic leukaemia, and oat cell carcinoma of the lung, all regarded as chemotherapy-"sensitive" turners (Michael K, 1984). Previous clinical trials in testicular cancer incorporating cisplatin (DDP) have
employed either high-dose (100- 120 mg/m2) or low dose (75 mg/m2) schedules without a clear definition of dose response testicular cancer is regarded as a sensitive tumor, the Southwest Oncology Group (SWOG) initiated, in 1978, a prospective randomized Phase III comparative trial in which the primary objective was to determine whether a high dose of DDP (cisplatin) when combined with vinblastine and bleomycin resulted in a superior response and survival experience than a lower dose of DDP with the same combination of vinblastine and bleomycin (Lawrence H Einhorn, 1980). CONCLUSION Platinum, vinblastine, bleomycin combination chemotherapy consistently produces 70% complete remissions, and a further 10% of patients will be rendered disease free following surgical excision of residual disease. For the first time, in a random prospective cooperative group clinical trial evaluating the effectiveness of two chemotherapy combinations in the treatment of a solid tumour, in which the dose of one drug is the only treatment variable, a clear-cut relationship has been shown for dose of therapy, not only with response and survival, but with an increased potential for cure as well. Historically, testicular cancer was one of the first malignancies of nonhematologic origin in which long-term survival, and cure, could be achieved with combination chemotherapy (Lawrence H Einhorn, 1980; Robert F Ozols, 1983; Michael K. Samson, 1984). REFERENCES Ana-Maria Florea and Dietrich Bsselberg, Cisplatin as an Anti-Tumor Drug: Cellular Mechanisms of Activity, Drug Resistance and Induced Side Effects, Cancers, 2011, 3, 1351-1371 Dorr RT, Bleomycin pharmacology: mechanism of action and resistance, and clinical pharmacokinetics. Semin Oncology, 1992, 19 (2 Suppl 5), 3-8. Lawrence H Einhorn, and Stephen D, Chemotherapy of disseminated testicular cancer -a random prospective study, Cancer, 46, 1980, 1339- 1344. Michael K Samson, Dose-response and dose-survival advantage for high versus low-dose cisplatin combined with vinblastine and bleomycin in disseminated testicular cancer, Cancer, 53, 1029-1035, 1984. Robert F Ozols, Treatment of poor prognosis nonseminomatous testicular cancer with a "high-dose" platinum combination chemotherapy regimen, Cancer, 51, 1983, 1803-1807.
IJRPB 1(6)
www.ijrpb.com
Page 795
Samuels ML, Lanzotti VJ, Holoye PY, Boyle LE, Smith TL, Johnson DE, Combination chemotherapy in germinal cell tumors, Cancer Treat Rev, 3, 1976, 185204. Wilson L, Creswell KM, Chin D, The mechanism of action of vinblastine, Biochemistry, 30;14(26), 1975, 5586-92. Wozniak AJ, A randomized trial of cisplatin, vinblastine, and bleomycin versus vinblastine, cisplatin, and etoposide in the treatment of advanced germ cell tumors of the testis: a Southwest Oncology Group study, Journal of clinical oncology, 1991, 9(1), 70-76.
IJRPB 1(6)
www.ijrpb.com
Page 796
Bhargav et.al
Method development and validation for the simultaneous estimation of Ofloxacin and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method
Y.Bhargav*, K Haritha Pavani, S Amareswari Nimra College of Pharmacy, Vijayawada, A.P, India *Corresponding author: Email: bhargavy8@rediffmail.com; Phone no: 8466941272 ABSTRACT A new, simple, accurate, rapid, precise RP-HPLC method was developed for the simultaneous estimation of ofloxacin and tinidazole in bulk and pharmaceutical dosage form. A good chromatographic separation was achieved with Intersil ODS C18 (2504.6mm.5) column and ammonium acetate buffer pH 4.0, acetonitrile, and tetrahydrofuran 60:30:10 was used as mobile phase at a flow rate of 1.0ml/min and the detection was carried out at a wavelength of 304 nm. The retention times was found to be 2.350 min for ofloxacin and 3.613 min for tinidazole. The linearity of the method was in the concentration range of 15-35g/mL for ofloxacin and 45-105g/mL for tinidazole. The developed method was validated for system suitability, specificity, precision, recovery and linearity according to ICH guidelines. The method was successfully applied for routine analysis for the determination of oflaxacin and tinidazole in bulk and dosage forms. Key Words: Oflaxacin, Tinidazole, RP-HPLC, Validation. INTRODUCTION Ofloxacin was chemically (RS) 9-fluoro-2, 3dihydro-3-methyl-10-(4methl-1-piperazinyl)-7- oxo7H-prido [1, 2, 3-de]-1, 4benzoxazine-6-carboxylic acid. Ofloxacin belongs to class of drugs called quinolone antibiotics. Ofloxacin is a broad spectum antibiotic that is active against both Gram-positive and Gram-negitive. It inhibition of topoisomrase enzymes, which inhibits relaxation of supercoild DNA and promotes breakage of double stranded DNA. It is used to treat a variety of bacterial infections. Tinidazole was chemically 1-[ethanesulfonyl) ethyl]-2-methyl-5-nitro-1H-imidazole. Tinidazole is Antiprotozoal, Antibacterial agent. The nitro-group of tinidazole is reduced by cell extracts of trichomonas. The free nitro-radical generated as a result of this reduction may be responsible for antiprotozoal activiiaty. Chemically reduced Tinidazole was shown to release nitrites and cause damage to purified bacterial DNA in vitro. Literature survey revealed that very few methods have been reported for the analysis of Ofloxacin and Tinidazole combinational dosage forms which include UV spectroscopy, Reverse Phase High performance Liquid Chromatography, HPTLC methods. The present study illustrate development and validation of simple, economical, selective, accurate, precise RP-HPLC method for the determination of Ofloxacin and Tinidazole in bulk and Pharmaceutical dosage forms as per ICH guidelines. MATERIALS AND METHODS Shimadzu HPLC equipped with spinchrome software, Elico UV-Spectrophotometer, Intersil ODS C18 column (2504.6mm.5), polmon pH Meter, Weighing Balance Ax200 Shimadzu, LAB INDIA Sonicator, rheodyne injector. Preparation of mobile phase: 1.925g of Ammonium acetate was accurately weighed and dissolved in 500ml of distilled water. The pH of the buffer was adjusted to 4.0 with ortho phosphoric acid. A suitable quantity of degassed mixture of pH4.0 Ammonium acetate buffer, Acetonitrile, Tetra hydro furan in the ratio of 60:30:10 was prepared and filtered through 0.45 filter under vacuum filtration. Preparation of standard stock solution: Accurately weighed 10mg of Ofloxacin and 10mg of Tinidazole into a 10ml volumetric flasks and 10ml of diluents Ammonium acetate Buffer pH4.0:ACN:THF(60:30:10) was added and sonicated for 5min and make up to the volume with diluent. From the stock 1ml of the solution was taken and diluted to 10ml to get a concentration of 100g/ml solution from the above solution 2ml of Ofloxacin and 6ml of Tinidazole and mixed and injected. Preparation of sample: Twenty tablets were weighed and powdered the powder equivalent to 25mg of Ofloxacin and 75mg of Tinidazole were weighed and taken into a 200ml volumetric flask. To this 50ml of diluents was added and sonicated for 15min to dissolve the drugs then made up the volume to required volume with the diluents. From this solution 5ml was taken into a 50ml flask and made up to final volume with diluents to get a concentration of 100ppm filtered through 0.45 filter under vacuum filtration. From this stock solution further dilutions were made for the validation of the method developed.
IJRPB 1(6)
www.ijrpb.com
Page 797
Bhargav et.al
RESULTS AND DISCUSSION Optimized method development: Various experimental conditions were carried out to achieve the best chromatographic conditions for the simultaneous determination of the drug substances. Several column types and lengths were tried for better elution and for chromatographic parameters. A good chromatographic separation was achieved with Intersil ODS C18 (2504.6mm.5) column and ammonium acetate buffer pH 4.0, acetonitrile and tetrahydrofuran 60:30:10 was used as mobile phase at a flow rate of 1.0ml/min and the detection was carried out at a wavelength of 304nm. The retention times was found to be 2.350min for oflaxacin and 3.613min for tinidazole. System suitability: From the system suitability studies it was observed that theoretical plates were found to be more than 2125 for Ofloxacin and 3873 for Tinidazole. USP tailing factor was found to be 1.76 for Ofloxacin and 1.72 for Tinidazole. All the parameters were within the limit. The results of system suitability studies were given in Table.1 and the standard Chromatograms can be were shown in the Figure.1. Specificity: The Chromatograms of Standard and Sample are identical with nearly same Retention time. There is no interference with blank and placebo to the drugs. The results were tabulated in the Table.2. The chromatograms were shown in the Figures 2,3,4 for standard, sample, blank and placebo. Linearity: From the Linearity data it was observed that the method was showing linearity in the concentration range of 15-35g/ml for Ofloxacin and 45-105g/ml for Tinidazole. Correlation coefficient was found to be 0.999 and 0.998 for both the compounds. The linearity data was tabulated in Table.3. The Chromatograms for the linearity data were shown in the fig no: and the linearity curve was plotted and given in the Figures 5,6.
Accuracy: The recoveries of pure drug from the analyzed solution of formulation were 100.81 % for Ofloxacin and 99.15 % for Tinidazole, which shows that the method was accurate. The results were tabulated in the Table.4. The chromatograms were shown in the Figure.7. Precision: The %RSD for the sample chromatograms of method precision were found to be 0.52 & 0.73 for Ofloxacin and 0.41 &0.35 for Tinidazole. Hence it passes method precision. The results were tabulated in the Table.5. The chromatograms were shown in the Figure.8. Assay: The %assay of the Ofloxacin was found to be 99.87% and for Tinidazole 99.23%. The results were tabulated in the Table.6. The chromatograms were shown in the Figures 9,10. Ruggedness: Comparison of both the results obtained for two different Analysts shows that the method was rugged for Analyst-Analyst variability. The system suitability parameters of Ruggedness were found to be within the limits and were tabulated in Table.7. The Chromatograms for ruggedness were shown in Figures 11,12. Robustness: All the system suitability parameters are within limits for variation in flow rate (0.2 ml) and for variation in the wavelength (2nm). Forced degradation studies: A forced degradation study is an important step in drug development process to observe the drug products stability. An attempt has been made to stress the drug products to acid hydrolysis by using 0.1N HCl, base hydrolysis by using 0.1N NaoH, oxidative degradation by using 1% H2O2, thermal treatment heated at 800c, photolytic degradation for 4hrs to evaluate the stability of the propose method to separate the drugs and its degradation products. The results were tabulated in the Table: 8 The chromatograms were shown in the Figures 13,14,15,16,17.
Chemical structure of ofloxacin Chemical structure of tinidazole Table.1.System suitability data for Ofloxacin and Tinidazole Parameters Ofloxacin Tinidazole Acceptance Criteria Retention Time 2.350 3.613 Theoretical plates 2125 3873 >2000 Asymmetry 1.769 1.724 <2 Resolution 5.793 -
IJRPB 1(6)
www.ijrpb.com
Page 798
Bhargav et.al
Standard
Sample
Blank
Table.2. Specificity Data for Ofloxacin and Tinidazole Ofloxacin Tinidazole Retention Area Theoretical Retention Area Theoretical time Plates time Plates 2.88 314.464 4039 4.140 884.734 5918 2.80 295.781 3817 4.040 850.497 5636 2.88 326.538 4039 4.140 891.542 5918 2.80 298.113 3817 4.040 863.317 5636 2.88 328.148 4039 4.140 887.046 5918 2.78 303.004 3763 4.003 851.318 5534 Table.3. Linearity data for Ofloxacin and Tinidazole: Ofloxacin Tinidazole Area Rt Mcg/ml Area 160.368 2.750 45 473.440 212.082 2.740 60 589.513 281.411 2.800 75 776.017 350.32 2.733 90 928.174 319.149 2.727 105 1065.057 Table.4. Accuracy Data For Ofloxacin and Tinidazole %level Amount Amount found Avg added (mcg) (mcg) % reecovery 80 25 25.43 101.73 100 30 30.50 101.67 120 35 34.67 99.05 80 75 74.03 98.71 100 90 89.39 99.32 120 105 104.39 99.42 Table.5. Precision data for Ofloxacin and Tinidazole Ofloxacin Tinidazole Area Rt 300.079 4.014 298.969 4.012 302.438 4.040 296.614 4.003 297.816 4.008 301.438 4.040
Mcg/ml 15 20 25 30 35
Rt 3.953 3.940 4.140 3.933 3.920
Drug
Mean %recovery 100.81
Ofloxacin
Tinidazole
99.15
Rt 2.83 2.833 2.800 2.812 2.823 2.800
Area 857.704 851.606 857.331 858.53 852.506 857.331
Table.6.Assay data for Ofloxacin and Tinidazole Ofloxacin Tinidazole Standard Area Sample area Standard Area Sample area 301.472 290.755 831.425 831.363 300.928 302.911 835.201 827.911 301.613 303.766 827.911 828.218 301.472 308.66 831.845 834.333 306.062 303.37 842.884 828.432 99.87% 99.23% %Assay
IJRPB 1(6)
www.ijrpb.com
Page 799
Bhargav et.al
Table.7.Ruggedness data of Ofloxacine and Tinidazole Ofloxacin Tinidazole Area Retention time Area Retention time Actual 3532.65 2350 4312.863 3.613 Analyst 1 312.858 2.780 833.419 4.003 Analyst 2 306.953 2.717 836.314 3.930 Analyst 1 308.838 2.717 841.567 3.930 Analyst 2 305.234 2.780 852.013 4.003 Table No: 8 Forced degradation data for Ofloxacin and Tinidazole Stress Conditions Time (hrs) Retention Time Time Retention Time (hrs) (hrs) (hrs) As such 4hrs 2.350 4hrs 3.613 Acid Hydrolysis (0.1 N, at RT) 4hrs 2.703 4hrs 3.907 Base Hydrolysis (0.1 N, at RT) 4hrs 2.663 4hrs 3.873 Oxidation (1% H2O2 at RT) 4hrs 2.703 4hrs 3.907 Photolysis (UV light at 254nm at RT) 4hrs 2.663 4hrs 3.873 0 Thermal (at 80 C) 4hrs 2.663 4hrs 3.873 Table.9. Summary of validated parameters of Ofloxacin and Tinidazole Parameters Ofloxacin Tinidzole Linearity 15-35g/ml 45-105 g/ml Correlation Coefficient(r2) 0.999 0.998 Slope(m) 11.3 11.234 Intercept(c) 11.0793 68.5073 Precision (%RSD) 0.52,0.73 0.41,0.35 Accuracy 100.81% 99.15% LOD 2.31 7.06 LOQ 6.99 21.41 Assay % 99.87% 99.23%
Figure.1.Data for System suitability
Figure.2.Chromatogram for blank
Figure.3.Data for Specificity standard
Figure.4.Data for Specificity sample
IJRPB 1(6)
www.ijrpb.com
Page 800
Bhargav et.al
Linearity of Ofloxacin
450 400 350 300
Linearity of Tinidazole y = 11.3x + 11.234 r = 0.999

1200 1000 800
y = 11.0793x + 68.5073 r = 0.998
Area
Area
0 1 2 3 4 5 6
250 200 150 100 50 0
600 400 200 0 0 1 2 3 4 5 6
Conc
Conc
Figure.5.Linearity plot for Ofloxcin
Figure.6.Linearity plot for Tinidazole
Figure.7.Data for Recovery
Figure.8.Data for Precision
Figure.9.Data for Assay (standard)
Figure.10. Data for Assay (sample)
Fig No:11 Data for Ruggedness (standard)
Fig No:12 Data for Ruggedness (sample)
IJRPB 1(6)
www.ijrpb.com
Page 801
Bhargav et.al
Fig No:13 Acid Degradation
Fig No:14 Base Degradation
FigNo:15 Peroxide Degradation
FigNo:16 Thermal Degradation
Fig No: 17 Photolysis Degradation in tablet dosage form by RP-HPLC, Research journal of pharmaceutical, biological and chemical sciences, Finally it concludes that all the parameters are 1(4), 2010, 460-466. within the limits and meet the acceptance criteria of ich guidelines for method validation. The proposed Maduri D Game and D.M Sakarkar, Simultaneous method was simple, accurate, specific, precise, robust, spectrophotometric estimation of Nitazoxinide and rugged and economical. Hence this method is Ofloxcin in tablets, Indian Pharma Sciences, 73(1), validated and can be used for routine and stability 2011, 70-74. sample analysis. Manisha Puranik, DV Bhawsar Prachi Rathi, PG Yeole, Simultaneous determination of Ofloxacin and ACKNOWLEDGMENT Ornidazole in solid dosage form by RP-HPLC and The authors would like to thank all the staff of HPTLC techniques, Indian journal of pharmaceutical nimra college of pharmacy, beloved parents and all sciences, 2(4), 2010, 513-517. my well wishers, one and all who have helped me directly and indirectly in completing this project work. Nargesh Keshar, Kareti Srinivasa Rao, Arijit Banerjee, Spectrophotometric methods for REFERENCES simultaneous estimation of Ofloxacin and Tinidazole B Dhandapani, Method development and validation in bulk and pharmaceutical dosage forms, Chronicle for the simultaneous estimation of Ofloxacin and of young scientists, 2(2), 2011, 98-102. Ornidazle tablet dosage form, Indian journal of pharmaceutical sciences and research, 1(1), 2010, 7883. CONCLUSION M Rama Kotaiah, Shaik Harun Rasheed, Y Narasimha Rao, Y Venkateswarlu, Konda Ravi Kumar, Simultaneous estimation of Ofloxacin and Tinidazole
IJRPB 1(6)
www.ijrpb.com
Page 802
Bhargavi et.al
Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats
Kalluru Bhargavi*, N Deepa Ramani, Janarthan M, Duraivel S Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India. *Corresponding author: babychitty@gmail.com ABSTRACT The Objective of the study was to investigate the nephroprotective activity of methanolic extract of seeds of Vitisvinifera (family:vitaceae) against rifampicin induced and carbontetrachloride induced kidney damage in rats.Male albino wistar rats (150-250gm) were selected and divided in to six groups of six animals each. Group 1 served as normal control, group 2 served as positive control, group 3 served as standard, group 4 was treated with MEVV (low dose) and group 5 was treated with MEVV (high dose). The same grouping was followed for both models (rifampicin and carbon tetra chloride). Inducing agents are given 3 days once for two weeks to induce nephrotoxicity. The results are evidenced on the basis of physical, biochemical and histological parameters. One-way analysis of variance followed by tukeys multiple comparison tests were used for statistical analysis.Rifampicin and carbontetrachloride produced significant changes in physical (decreased liver and body weight), biochemical (increased levels of total protein, uric acid, urea, and creatinine), and histological parameters in rats. Pretreatment with MEVV and standard drug cystone significantly prevented the physical, biochemical and histological changes produced by rifampicin and carbon tetrachloride toxicity. Results of the present study suggest that MEVV has a significant nephroprotective activity probably by acting against free radicals. Key words: Vitis vinifera, nephrotoxicity, rifampicin, carbontetrachloride, biochemical parameters etc. INTRODUCTION Nephrotoxicity is one of the most common kidney problems and occurs when body is exposed to a drug or toxin. When kidney damage occurs, body unable to rid of excess urine and wastes from the body and blood electrolytes (such as potassium and magnesium) will all become elevated (Ramyapydi, 2011).A number of therapeutic agents can adversely affect the kidney resulting in acute renal failure, chronic interstitial nephritis and nephritic syndrome. Because of the increasing number of potent therapeutic drugs like aminoglycoside antibiotics, chemotherapeutic agents and NSAIDS have been added to the therapeutic arsenal in recent years. Exposure to chemical reagents like ethylene glycol, carbon tetrachloride, sodium oxalate and heavy metals like lead, mercury, arsenic and cadmium also induces nephrotoxicity which leads to acute kidney injury (AKI). MATERIALS AND METHODS: Materials: All chemicals were of analytical grade and obtained locally. Creatinine,totalprotein,urea and uric acid kit were procured from Robonik diagnostics, Hyderabad, India. Plant material: The fresh seeds Vitisvinifera were collected from Kadapa District; A.P. Identification of the plant was done by Dr. SreedharMurty, Assistant Professor, Department of Botany, Government College of Arts, Kadapa, A.P, India. Animals: Healthy adult male wistar rats weighing between 150-250gm were used for the present study. The animals were housed in groups of six and maintained under standard conditions (272C, relative humidity 44 - 56% and light and dark cycles of 10 and 14 hours respectively) and fed with standard rat diet and purified drinking water ad libitum for 1 week before and during the experiments. Preparation of the extract: The dried flowers of V. viniferawas collected, cleaned, dried and powdered in a grinder - mixer to obtain a coarse powder and then passed through 40 mesh sieve. About 1000 gm of powdered drug was extracted with aqueous methanol by soxhlet apparatus. The extraction was carried out until the drug becomes exhausted. The solvent was recovered from their extract by distillation under reduced pressure. The dried extract thus obtained was kept in a desicator and was used for further experiments. Induction of nephrotoxicity in rats: Rifampicin (1000mg/kg) was dissolved in distilled water and administered orally to rats for 14 consecutive days at an interval of 72 hrs to induce experimental nephro toxicity in rats. CCl4 (1ml/kg) was dissolved in olive oil and injected intraperitoneally to rats for 14 consecutive days at an interval of 24 hrs to induce experimental nephro toxicity in rats.
IJRPB 1(6)
www.ijrpb.com
Page 803
Bhargavi et.al
Rifampicin induced nephrotoxicity: The experimental animals were randomly divided in to 5 groups (n= 6) and treated for duration of 14 days as per the treatment schedule given in table no: 3. Nephrotoxicity was induced by administration of Rifampicin (1000 mg/kg oral) three days once for two weeks. Methanolic extract of V. vinifera was freshly suspended in distilled water and administered to animals by oral feeding needle. Carbon tetra chloride induced nephrotoxicity: The experimental animals were randomly divided in to 5 groups (n= 6) and treated for duration of 15 days as per the treatment schedule given in table no: 4. Nephrotoxicity was induced by injected intraperitoneally of ccl4 (1ml/kg i.p) with olive oil every day for two weeks. Methanolic extract of V. viniferawas freshly suspended in distilled water and administered to animals by oral feeding needle. Treatment schedule Evaluation of nephroprotective activity of V.vinifera against Rifapmicin induced nephrotoxicity in wistar Rats:
Groups Normal Control Standard Low dose High dose Treatment (14 days) Vehicle (1% CMC) Rifampicin (1000mg/kg,p.o.) Rifampicin (1000mg/kg,p.o.) + Cystone (500 mg/kg, p.o.) Rifampicin (1000 mg/kg, p.o.) + VVFE (100 mg/kg, p.o.) Rifampicin (1000 mg/kg, p.o.) + VVFE (200 mg/kg, p.o.)
using commercial glucometer kit on final day of the experiment by collecting blood. Urine Estimations: Levels of creatinine, total protein, urea, uric acid in urine were determined by using commercial glucometer kit on final day of the experiment by collecting urine. Histopathological studies: For histopathological studies, tissue obtained from the excised kidney was immediately fixed in 10% buffered neutral formalin solution. The fixed tissues were embedded in paraffin and serial sections were cut. Each section was stained with hematoxylin and eosin (H & E stain). The sections were examined under light microscope and photomicrographs were taken. Statistical analysis: All the data was expressed as mean S.E.M. Statistical significance between more than two groups was tested using one way ANOVA followed by the Tukeys multiple comparison test using computer based fitting program (Prism graph pad 5.0). Statistical significance was set accordingly. RESULTS Effect of plant extract on body and kidney weight: Carbon tetra chloride treated rats showed significant (p<0.05) decrease in body and kidney weight compared to control rats. Pretreatment with test-1, test-2 and standard significantly (p<0.05) increased body and kidney weights as compared to carbon tetra chloride treated rats (table 1) Rifampicin treated rats showed significant (p<0.05) decrease in body and kidney weight compared to control rats. Pretreatment with test-1, test-2 and standard significantly (p<0.05) increased body and kidney weights as compared to rifampicin treated rats (table 2) Effect of Plant extract on Blood and urine estimations: Carbon tetra chloride (CCl4) treated rats showed significant (p<0.05) increase in levels of Total Protein, urea, uric acid and Creatinine in blood and urine as compared to control rats. Pretreatment with test-1, test-2 and Standard significantly (p<0.05) decreased the elevated levels of these parameters as compared to CCl4 treated rats (table 3). Rifampicin treated rats showed significant (p<0.05) increase in levels of Total Protein, urea, uric acid and Creatinine in blood and urine as compared to control rats. Pretreatment with test-1, test-2 and Standard significantly (p<0.05) decreased the elevated levels of these parameters as compared to Rifampicin treated rats (table 4).
Treatment schedule Evaluation of nephroprotective activity of V.vinifera against carbon tetrachoride induced nephrotoxicity in wistar Rats:
Groups Normal Control Standard Low dose High dose Treatment (15 days) Olive oil (5ml/kg.p.o.) CCl4 (1ml/kg,i.p.) CCl4 (1ml/kg,i.p.) + Cystone (500 mg/kg, p.o.) CCl4 (1ml/kg,i.p.) + VVFE (100 mg/kg, p.o.) CCl4 (1ml/kg,i.p.) + VVFE (200 mg/kg, p.o.)
I.P = Intra peritoneal, P.O = Per oral. Parameters measured: Physical Parameters: The body weight was recorded on the first day and then last day of the study period in each group. Blood Estimations: Levels of creatinine, total protein, urea, uric acid in blood were determined by
Table.1.Effect of extract on Body and kidney weight (CCl4 induced)
IJRPB 1(6)
www.ijrpb.com
Page 804
Bhargavi et.al
Groups Normal Positive Control Standard Test-1 Test-2
Initial body weight (gm) 200 210 190 240 200
Final body weight (gm) 230 180 180 210 190
Change in body weight (gm) +301.065 -300.866* -100.578# -300.87# -100.613#
Kidney weight (gm) 0.950.033 0.610.029* 0.720.016# 0.820.012# 0.790.025#
All the values were expressed as Mean SEM using one way ANOVA followed by Tukeys multiple comparison test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Table 2: Effect of plant extract on body and kidney weights (Rifampicin induced) Groups Initial body weight Final body weight Change in body Kidney weight (gm) (gm) weight (gm) (gm) Normal 180 200 200.62 0.8150.021 Positive Control 210 180 -301.02 0.590.024 Standard 250 230 -201.21 0.860.027 Test-1 190 185 -50.39 0.620.021 Test-2 200 180 -200.66 0.750.028
All the values were expressed as Mean SEM using one way ANOVA followed by Tukeys multiple comparison test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance Table 4: Effect of Plant extract on blood and urine estimations in carbon tetra chloride induced nephrotoxic rats
Group Control Positive control Standard Test 1 Test 2 Total Protein 7.355+0.119 19.5+0.086* 7.74+0.084# 9.59+0.082# 9.05+0.103# Blood Parameters Urea Uric acid 22.89+0.8 52.626+0.958* 41.5+0.081# 34.67+0.89# 26.21+1.199# 2.561+0.133 7.49+0.109 3.12+0.173# 50.35+0.038# 4.26+0.01# Creatinine 0.603+0.037 1.85+0.036* 0.3+8.975# 0.218+0.011# 0.413+0.01# Total Protein 41.8+1 88.93+1.024* 43.51+0.097# 62.26+0.099# 51.95+0.16# Urine Parameters Urea Uric acid 25.253+1.302 56.75+2* 35.611+0.112# 40.363+2.127# 28.9+2.438# 3.468+0.052 10.63+0.089* 8.34+0.043# 4.708+0.035# 0.458+0.108# Creatinine 51.95+0.16 2.628+0.045* 0.675+0.029# 0.458+0.108# 0.348+0.032#
All the values were expressed as Mean SEM using one way ANOVA followed by Tukeys multiple comparison test, where n=6; * -when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance Table 5: Effect of Plant extract on blood and urine estimations in rifampicin induced nephrotoxic rats
Group Control Positive control Standard Test 1 Test 2
Total Protein 7.458+0.076 18.594+0.180* 7.22+0.079# 9.93+0.177# 8.85+0.032#
Blood Parameters Urea Uric acid 23.96+1.028 2.302+0.06 51.562+1.18* 7.66+0.076* 40.23+0.049# 33.4+0.079# 25.48+1.468# 3.007+0.168# 5.32+0.023# 4.242+0.003#
Creatinine 0.068+0.038 1.84+0.043* 0.284+0.0082# 0.504+0.273# 0.408+0.127#
Total Protein 39.46+1.29 90.76+1.196* 44.346+0.01# 61.63+0.007# 51.402+0.008#
Urine Parameters Urea Uric acid 26.132+1.507 3.368+0.541 62.43+1.467* 10.502+0.12* 36.6+0.032# 35.54+1.546 26.2+0.222# 8.274+0.393# 4.72+0.027# 4.68+0.02#
Creatinine 0.822+0.023 2.59+0.056* 0.644+0.028# 0.0386+0.123# 0.324+0.029#
All the values were expressed as Mean SEM using one way ANOVA followed by Tukeys multiple comparison test, where n=6; *-when compared with Control; #-when compared with Positive control;*--P<0.05 ; ns-no significance
Histopathological studies: Histological changes such as cortical glomerular, peritubular blood vessels congestion, and interstitial inflammation etc. were observed in the CCl4 and rifampicin administered
group. Pretreatment with standard (cystone), low and high dose of VVFE significantly prevented histopathological changes towards normal (fig A-E and F-J respectively)
Normal Group
Positive Control (CCl4)
IJRPB 1(6)
www.ijrpb.com
Page 805
Bhargavi et.al
Standard Group
Low dose Extract
High dose extract
F. Control
Positive Control (Rifampicin)
Standard
Low dose extract
High dose extract
DISCUSSION Percentage change in body weight and increased the levels of serum and urine markers such as Creatinine, urea, uric acid, and total protein when compared with control rats. Pretreatment with VVFE in CCl4 administered rats significantly reduced the elevated levels of serum and urine markers when compared to positive control group. It indicates protective effect of VVFE against rifampicin induced nephrotoxicity in rats. Histological changes such as cortical glomerular, peritubular blood vessels congestion, and interstitial inflammation were observed in the CCl4 and rifampicin administered group. The VVFE pretreated rats significantly prevented these histological changes, further indicating their nephroprotective activity. All the histological changes
observed were in correlation with the physical and biological parameters of the kidney. From the present study results, it indicates that VVFE has protective effect against rifampicin and carbon tetrachloride induced nephrotoxicity in rats individually. CONCLUSION In conclusion, Results of the present study suggest that VVFE provides adequate protection against rifampicin induced and carbon tetra chloride induced nephrotoxicity on albino wistar rats as evidenced by physical, biochemical and histological parameters. The protective effect of VVFE may be due to its antioxidant potential. However, further studies are needed to confirm its clear mechanism of action in nephroprotection and to characterize the chemical constituents responsible for it.
IJRPB 1(6)
www.ijrpb.com
Page 806
Bhargavi et.al
REFERENCES Hoitsma AJ, Wetzels JF and Koene RA, Drug induced nephrotoxicity, Aetiology, clinical features and management, Drug Saf, 6 (2), 1991, 131-147. Paller MS, Drug induced nephropathies, Med Clin North Am, 74 (4), 1990, 909-917.
Porter G. A, Bennett W.M, Nephrotoxic acute renal failure due to common drugs. American journal of Physiology, 241(7), 1981, 252-256. RamyaPydi, IRajalakshmi, S Indumathy, S Kavimani, Nephroprotective Medicinal Plants - A Review, International Journal of Universal Pharmacy and Life Sciences, (2), 2011, 266-281.
IJRPB 1(6)
www.ijrpb.com
Page 807
Vasavi and Patan
Method development and validation for the simultaneous estimation of Atazanavir and Ritonavir in tablet dosage form by RP-HPLC
Nuli Vasavi*, Afroz Patan Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India *Corresponding author: Email: vasavi14nooli@gmail.com, Phone +91-9966136060 ABSTRACT The present investigation describes about a simple, economic, selective, accurate, precise reverse phase high performance liquid chromatographic method for the simultaneous estimation of Atazanavir and Ritonavir in pure and pharmaceutical dosage forms of Atazanavir and Ritonavir were well separated using a X-Tera C18 (100 x 4.6mm, 3.5m) and Mobile phase consisting of Buffer(pH-2.5): Acetonitrile (40:60) adjusted to pH- 2.5 at the flow rate 1.2 ml/min and the detection was carried out at 247nm with PDA detector. The Retention time for Atazanavir and Ritonavir were found to be 1.982 & 2.576 respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully applied to Metronidazole and Norfloxacin combination pharmaceutical dosage form. Key Words: RP-HPLC, Atazanavir and Ritonavir Accuracy, Precision. 1. INTRODUCTION Atazanavir Sulphate Methyl is a Antiretroviral drug N- [(1S)-1-{ [(2S,3S) - 3 - hydroxy-4- [(2S)-2[(methoxycarbonyl) amino] - 3, 3 dimethyl - N' {[4-(pyridin-2-yl)phenyl]methyl} butanehydrazido]-1phenylbutan-2-yl] carbamoyl}-2, 2 - dimethylpropyl] carbamate sulphate is a azapeptide HIV-1 protease inhibitor The compound selectively inhibits the virusspecific processing of viral Gag and Gag-Pol polyproteins in HIV-1 infected cells, thus preventing formation of mature virions. Ritonavir is a Antiretroviral drug 1,3-thiazol5-ylmethyl N-[(2S,3S,5S)-3-hydroxy-5-[(2S)-3methyl-2 {[methyl({[2-(propan-2-yl)-1,3-tiazole-4yl]methyl})carbamoyl]amino} butanamido]-1,6diphenylhexan-2-yl] carbamate. Ritonavir inhibits the HIV viral protease enzyme. This prevents cleavage of the gag-pol polyprotein and, therefore, improper viral assembly results. This subsequently results in noninfectious, immature viral particles. Literature survey revealed that very few methods have been reported for the analysis of Atazanavir and Ritonavir combinational dosage forms which include UV spectroscopy, Reverse Phase High performance Liquid Chromatography, Densitometric method, HPTLC methods. The present study illustrate development and validation of simple, economical, selective, accurate, precise RP-HPLC method for the determination of Atazanavir and Ritonavir in bulk and Pharmaceutical dosage forms as per ICH guidelines. The goal of this study is to develop rapid, economical HPLC method for the analysis of Atazanavir and Ritonavir in combined dosage form using most commonly employed column (C18) and simple mobile phase preparation. In the present proposed work a successful attempt had been made to develop a method for the simultaneous estimation of Atazanavir and Ritonavir pharmaceutical dosage form and validate it. From the economical point of view and for the purpose of routine analysis, it was decided to develop a more economical RP-HPLC method with simple mobile phase preparation for the estimation of Atazanavir and Ritonavir combinational dosage form. The method would help in estimate of drugs in single run which reduces the time of analysis and does not require separate method for each drug. Thus, the paper reports an economical, simple and accurate RP-HPLC method for the above said pharmaceutical dosage forms. 2. MATERIALS AND METHODS Quantitative HPLC was performed on a high performance liquid chromatograph -Waters e2695Alliance HPLC system connected with PDA Detector 2487 and Empower2 Software. The drug analysis data were acquired and processed using Empower2 software running under Windows XP XTera C18 (100 x 4.6mm, 3.5m) particle size. In addition an analytical balance (AFCOSET Model ER200A), digital pH meter (ADWA Model AD102U), a sonicator (ENERTECH Model SE60US) were used in this study. Standards and chemicals used: The reference samples of Atazanavir and Ritonavir standards were kindly supplied as gift samples by Hetero Drugs Ltd., Hyderabad, Andhra Pradesh, India. All the chemicals were analytical grade. Potassium dihydrogen orthophosphate and phosphoric acid from Merck Ltd., Mumbai, India, while acetonitrile (HPLC
IJRPB 1(6)
www.ijrpb.com
Page 808
Vasavi and Patan
grade) and triethylamine (HPLC grade) from Merck Pharmaceuticals Private Ltd., Mumbai, India. Ortho phosphoric acid used was of HPLC grade and purchased from Merck Specialties Private Ltd.,Mumbai,India Preparation of mobile phase: A mixture of above prepared buffer 400 ml (40%) and 600 ml of HPLC grade Acetonitrile (60%) were mixed and degassed in ultrasonic water bath for 5 minutes. The mobile phase was filtered through 0.45 filter under vacuum. Preparation of calibration standards: Accurately weighed and transferred 30mg of Atazanavir and 10mg of Ritonavir working standard into a 10ml clean dry volumetric flask and added about 7ml of diluent. It was sonicated to dissolve completely and made volume up to the mark with the same diluent. (Stock solution)(3000, 1000 g/ml). From the above stock solution, 1ml of the solution was pipetted into a 10ml volumetric flask and diluted up to the mark with diluent. (300, 100g/ml). From this, 4ml of the solution was pipetted into another 10ml volumetric flask and diluted up to the mark with diluent. System suitability: System suitability is an integral part of chromatographic system. To ascertain its effectiveness, certain system suitability test parameters were checked by repetitively injecting the drug solutions at 100% concentration level for Atazanavir and Ritonavir to check the reproducibility of the system. At first the HPLC system was stabilized for 40 min. One blank followed by six replicate analysis of solution containing 100% target concentration of Atazanavir and Ritonavir were injected to check the system suitability. To ascertain the system suitability for the proposed method, a number of parameters such as theoretical plates, peak asymmetry, and retention time were taken and results were presented in Table 2. Calibration curves for Atazanavir and Ritonavir: Replicate analysis of solution containing 60-180 g/ml for Atazanavir and 20-60 g/ml for Ritonavir sample solutions respectively were injected into HPLC according to the procedure in a sequence and chromatograms were recorded. Calibration curves were constructed by plotting by taking concentrations on X-axis and ratio of peak areas of standards on Yaxis and regression equation were computed for both drugs and represented in fig:5&6 Analysis of marketed formulation: Accurately weighed and transferred 49.8mg of Atazanavir and Ritonavir tablet powder into a 10ml clean dry volumetric flask and added about 7ml of diluent. It
was sonicated to dissolve it completely and made volume up to the mark with the same diluent. (Stock solution). From the above stock solution, 1ml of the solution was pipetted into a 10ml volumetric flask and diluted up to the mark with diluent. From this, 4ml of the solution was pipetted into another 10ml volumetric flask and diluted up to the mark with diluent. 20 L of the standard and sample solutions were injected into the chromatographic system and areas for the Atazanavir and Ritonavir peaks were measured. Validation study of Metronidazole and Norfloxacin: An integral part of analytical method development is validation. Method validation is the process to confirm that the analytical procedure employed for a specific test is suitable for its intended use. The newly developed RP-HPLC method was validated as per International Conference on Harmonization (ICH) guidelines for parameters like system suitability, accuracy, linearity, precision (repeatability), Intermediate Precision limit of detection (LOD), limit of Quantification (LOQ) and robustness. Precision: precision study of sample (Atazanavir and Ritonavir) was carried out by estimating corresponding responses 5 times on the same day for the 100% target concentration. The percent relative standard deviation (%RSD) is calculated which is within the acceptable criteria of not more than 2%. The results were presented in Table 3. Linearity: The linearity graphs for the proposed assay methods were obtained over the concentration range of 30mg of Atazanavir and 10mg of Ritonavir. Method of least square analysis is carried out for getting the slope, intercept and correlation coefficient, regression data values and the results were presented in Table 5. The representative chromatograms indicating the sample were shown in fig.2&3. A calibration curve was plotted between concentration and area response and statistical analysis of the calibration curves were shown in fig. 5&6. Accuracy (Recovery studies): The Amount found and Amount added for Atazanavir & Ritonavir and the individual recovery and mean recovery values were calculated. Known amount of Atazanavir and Ritonavir at 50%, 100%, 150% is added to a pre quantified sample solution. The recovery studies were carried out in the tablet in triplicate each in the presence of placebo. The mean percentage recovery of Atazanavir and Ritonavir at each level is not less than 98% and not more than 102%.
IJRPB 1(6)
www.ijrpb.com
Page 809
Vasavi and Patan
Robustness: The robustness is evaluated by the analysis of Atazanavir and Ritonavir under different experimental conditions such as making small changes in flow rate (0.2 ml/min), max (5), column temperature (5), mobile phase composition (5%), and pH of the buffer solution. The results were presented in Table 4. LOD and LOQ: Limit of detection is the lowest concentration in a sample that can be detected but not necessarily quantified. Under the stated experimental conditions, the limit of quantification is the lowest concentration of analyte in a sample that can be determined with acceptable precision and accuracy. Limit of detection and limit of quantification were calculated using following formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD= standard deviation of response (peak area) and S= average of the slope of the calibration curve. 3. RESULTS AND DISCUSSION Reverse phase HPLC method was preferred for the determination of Atazanavir and Ritonavir. Preliminary experiments were carried out to achieve the best chromatographic conditions for the simultaneous determination of the drug substances. Several column types and lengths were tried considering other chromatographic parameters. C18 column with a 4.6 mm inner diameter and 3.5m particle size was chosen. The detection wave length was selected as 247nm with 2487 detector. Chromatographic conditions were optimized by changing the mobile phase composition and buffers used in mobile phase. Different experiments were performed to optimize the mobile phase but adequate separation of the drugs could not be achieved. By altering the pH of buffer results a good separation. Different proportions of solvents were tested. Eventually the best separation was obtained by the
isocratic elution system using a mixture of Acetonitrile (40:60) adjusted to Buffer (pH-2.5) at a flow rate of 1.2 ml/min. A typical chromatogram for simultaneous estimation of the two drugs obtained by using a above mentioned mobile phase. Under these conditions Atazanavir and Ritonavir were eluted at 1.982 & 2.567 minutes respectively with a run time of 5 minutes. The representative chromatogram of this simultaneous estimation shown in fig. 3 & 4 and results were summarized in Table 1. The Buffer (pH-2.5): Acetonitrile (40:60) was chosen as the mobile phase. The run time of the HPLC procedure was 5 minutes at flow rate of 1.2ml/min was optimized which gave sharp peak, minimum tailing factor. The system suitability parameters were shown in Table 1 were in within limit, hence it was concluded that the system was suitable to perform the assay. The method shows linearity between the concentration range 30mg of Atazanavir and 10mg of Ritonavir. The experimental results were shown in table 5 and fig.5&6. The % recovery of Atazanavir and Ritonavir was found to be in the range of 98.96 to 101.84 % and 98.29 to 100.54% respectively. As there was no interference due to excipients and mobile phase, the method was found to be specific. As both compounds pass the peak purity, the method was found to be specific. The method was robust and rugged as observed from insignificant variation in the results of analysis by changes in Flow rate, column oven temperature, mobile phase composition and wave length separately and analysis being performed by different analysts. The results were shown in Table 4. The LOD and LOQ values were calculated based on the standard deviation of the response and the slope of the calibration curve at levels approximately the LOD and LOQ. The limit of detection was obtained for Atazanavir and Ritonavir found to be 0.999 and 0.999. The results were shown in Table-6.
Table.1 optimized chromatographic conditions and system suitability parameters for proposed method Parameter Chromatographic conditions Instrument Waters e2695 Alliance HPLC with Empower2 software Column X-Tera C18 (100 x 4.6mm, 3.5m) Detector Detector 2487 Mobile phase Phosphate Buffer ( pH2.5): Acetonitrile (40:60) Flow rate 1.2ml/min Detection wavelength 247nm Temperature Ambient Injection volume 20l Retention time Atazanavir: 1.982; Ritonavir: 2.576 Theoretical plate count Tailing factor Resolution factor Atazanavir: 4092.8 ; Ritonavir: 4900.4 Atazanavir: 1.3; Ritonavir: 1.2 4.2
IJRPB 1(6)
www.ijrpb.com
Page 810
Vasavi and Patan
Fig. 1: Structure of Atazanavir Sulphate

Flow rate (ml/min) Atazanavir 1.0 1.2 1.4 1.0 1.2 1.4
Fig. 2: Structure of Ritonavir
Table.2.System suitability:Flow change observation of atazanavir and ritonavir

System suitability results Usp plate count 4028.2 4092.8 4010.7 4727.0 4900.4 4712.2 Usp tailing 1.3 1.3 1.3 1.2 1.2 1.2
Ritonavir
Sample Atazanavir
Table.3.Results of Precision study Injection number RT 1 1.978 2 1.976 3 1.979 4 1.982 5 1.974 Mean 1.977 %RSD(NMT 2.0) 1 2 3 4 5 Mean %RSD(NMT 2.0) 2.576 2.572 2.573 2.578 2.573 2.574
Precision Peak area 1647681 1647899 1642958 1649928 1649877 1633919 0.10 595172 596877 596609 597459 596311 596485.6 0.14
Ritonavir
Sample Atazanavir
Paraameters Flow rate(0.2)
Ritonavir
Table 4: Robustness studies Atazanavir and Ritonavir Optimized Used RT USP Tailing 1ml/min 1.0 2.541 1.3 1.2 1.982 1.3 1.4 1.786 1.3 Mobile 0% Less 2.432 1.3 phase Actual 1.982 1.3 variation More 1.785 1.3 Flow 1ml/min 1.0 2.956 1.2 1.2 2.576 1.2 rate(0.2) 1.4 2.291 1.2 Mobile 0% Less 2.952 1.2 phase Actual 2.576 1.2 variation More 2.290 1.2
Plate count 4028.2 4.92.8 4010.7 4131.8 4092.8 4013.1 4727.0 4900.4 4712.2 4918.2 4900.4 4878.1
IJRPB 1(6)
www.ijrpb.com
Page 811
Vasavi and Patan
Table.5.Linearity data of the Atazanavir and Ritonavir

Observation of Atazanavir Linearity Level Concentration I 60ppm II 90ppm III 120ppm IV 150ppm V 180ppm Correlation Coefficient Observation Of Ritonavir I 20ppm II 30ppm III 40ppm IV 50ppm V 60ppm Correlation Coefficient Area 899573 1254637 1648501 2027034 2469227 0.999 328807 457715 602795 744367 904976 0.999
Table.6.Limit of Detection and Limit of Quantification
Atazanavir
LOD LOQ mcg 1.979 1.978 Area 580 1962 mcg 2.578 2.577
Ritonavir
Area 687 2322
Figure.3.Typical Chromatogram of standard Atazanavir and Ritonavir
Figure.4.Typical chromatogram of Metronidazole and Norfloxacin tablets in marketed formulation
IJRPB 1(6)
www.ijrpb.com
Page 812
Vasavi and Patan
Figure.5.Linearity for Atazanavir
Figure.6.Linearity for Ritonavir

4. CONCLUSION The proposed RP-HPLC method was found to be specific, precise, accurate, rapid and economical for simultaneous estimation of Atazanavir and Ritonavir in Tablet dosage form. The developed method was validated in terms of accuracy, precision, linearity, robustness and ruggedness and results will be validated statistically according to ICH guidelines. The sample recoveries in all formulations were in good agreement with their respective Label Claims and this method can be used for routine Analysis. ACKNOWLEDGEMENT The authors would like to thank beloved parents and all my well wishers, one and all who have helped me directly and indirectly in completing this project work. REFERENCES Adrienne C. Muller, An efficient HPLC method for the quantitative determination of Atazanavir in Human Plasma suitable for Bioequivalence and Pharmacokinetic studies in healthy Human Subjects. Journal of Pharmaceutical and Biomedical Analysis, 53(1), 2010, 113118. J. Venkateswara Rao, K. Srinivasu, N. Appala Raju and K. Mukkanti, A Validated RP-HPLC method for the determination of Atazanavir in Pharmaceutical dosage form, E-Journal of Chemistry, 8(1), 2011, 453456. M. Padmalatha, K.Vanitha Prakash and Eranna Dopadally, Validated Reversed Phase High Performance Liquid Chromatography method for the estimation of Atazanavir Sulphate in Pharmaceutical formulations. Oriental Journal of Chemistry, 26(1), 2010, 123-127. R. K. Nanda, A.A. Kulkarni and P.B.Yadav, Simultaneous Spectrophotometric estimation of Atazanavir Sulphate and Ritonavir in tablets, Scholars Research Library Der Pharma Chemica, 3(3), 2011, 84-88. Ravindra Reddy Y. and A. Swetha Mallesh, Method development and validation of Atazanavir and Ritonavir in a combined dosage form by RP-HPLC
IJRPB 1(6)
www.ijrpb.com
Page 813
Vasavi and Patan
Method, International Journal of Pharmacy & Technology, 3(3), 2011, 3316-3334. S. Colombo, N. Guignard, C. Marzolini, A. Telenti, J. Biollaz and L.A. Decosterd, Determination of the new HIV-Protease Inhibitor Atazanavir by Liquid Chromatography after Solid-Phase Extraction. Journal of Chromatography B Analytical Technologies in the Biomedical and Life Sciences, 810 (1), 2004, 25-34. S.G. Khanage, V.K. Deshmukh, P.B. Mohite, V.M. Dhamak and S. Appala Raju, Development of Derivative Spectrophotometric estimation of Atazanavir Sulphate in bulk drug and Pharmaceutical dosage forms. Int.J.Pharm.& Health Sci., 1(3), 2010, 49-154. Sreenivasa Rao Chitturia, Yallappa Somappa Somannavara, Badrinath Gupta Peruria, Srinivas Nallapatia, and Hemant Kumar Sharmaa, Gradient RP-HPLC method for the determination of Potential Impurities in Atazanavir Sulfate, Journal of Pharmaceutical and Biomedical Analysis, 55(1), 2011, 31-47. Vishnu P. Choudhari, Nilesh A. Bari, Shailendra P. Kela, Shailesh N. Sharma and Saroj V. Shirse, Spectrophotometric simultaneous determination of Atazanavir and Ritonavir in combined tablet dosage form by Ratio Derivative and Area Under Curve Method, Scholars Research Library Der Pharma Chemica, 4(1),2012, 208-213.
IJRPB 1(6)
www.ijrpb.com
Page 814
Praveen and Janarthan
Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats
Marri Praveen*, M.Janarthan Nimra College of Pharmacy, Vijayawada, India *Corresponding author E.Mail:marripraveen.1@gmail.com ABSTRACT Rheumatoid arthritis is a chronic, inflammatory disorder that may affect many tissues and organs, but principally attacks flexible (synovial) joints. The process produces an inflammatory responses of the capsule around the joints, secondary swelling of the synovial cells. The aim of the present study was to investigate anti-arthritic activity of leaves of Hibiscus platinifolius linn on male Wister rats and estimation of paw edema, body weight measurement and measurement of activity of marker enzymes like alanine trans aminases(SGPT)and serum glutamate oxalo acetate transferases (SGOT) in serum by using Aqueous extract of hibiscus platinifolius line. The study of anti-arthritic activity involves induction of arthritis to rats of all groups using FCA and turpentine oil induced in i.p route, followed by subsequent treatment with aqueous extraction at two different doses. i.e AEHP 200mg/kg and AEHP400mg/kg respectively. Diclofenac sodium is used as a reference standard. paw edemas, paw height, paw volume were estimated from the serum by using Freunds complete adjuvant(FCA) and turpentine oil induced arthritis .The bio chemical parameters were increased in all arthritic rats, there parameters were decreased by the administration of aqueous extraction of Hibiscus platinifolius at dose of 200mg and 400 mg respectively. From this study it has been concluded that the aqueous extract of leaves of Hibiscus platinifonlius having good anti-arthritic activity, which is comparable to Diclofenac sodium. Key words: Hibiscus platinifolius linn, Anti-Arthritic, Rats, Paw volume, Paw width, and Paw height. INTRODUCTION Hibiscus platanifolius Linn (Malvaceae) known as Mapleleaved mallow is an important medicinal plant. It is an evergreen tree, growing up to 10 m tall. Leaves are alternate, simple, stipulate, petiolate and ovate to lanceolate, often with a toothed or lobed margin. Leaves are usually 3-5 lobed, 6-12 5-12 cm. Leaf are palmetely veined, entire or various lobed. Flowers are pale pink, with each petal having a deep pink base. Flowers are about 3-5 inches across. Sepals are leathery, hairy. Stamen-column is 2-2.5cm long, pale pink. Maple leaved mallow is native to India. MATERIALS AND METHODS Preparation of extraction: The Hibiscus platinifolius plant was collected during the march 2013 from Sri Venkateshwara University, Tirupati, India. The plant was authenticated by Dr. Madhava Chetty, Deparment of Botany and voucher specimen of the plant were preserved at institute herbarium library. Plant was separately washed, wiped-dry, and subsequently reduced to a coarse powder. About 100 g of the plant material were separately extracted for 24 h aqueous with intermittent vigorous shaking. The extracts were filtered, concentrated with a rotary evaporator and dried over a water bath at 45Cshaking. The extracts were filtered, concentrated with a rotary evaporator and dried over a water bath at 45C. The residue from the plant parts were used for experimental analysis. Acute toxicity: The acute toxicity of the Aqueous extract of Hibiscus platinifolius was determined as per the OECD guideline no. 423 (Organization for Economic Cooperation and Development). It was observed that the test extract was not mortal even at a dose of 2000 mg/kg body weight. Hence, 200 mg/kg and 400 mg/kg doses were selected for further study. Ist Model: Experimental protocol design: Assessment of the parameters: A) Effect of Aqueous extract Hibiscus platinifolius paw oedema against FCA induced chronic arthritis in rats: The FCA induced chronic anti-arthritic activity of Aqueous extract of Hibiscus platinifolius 200mg/kg and 400mg/kg was carried out and Wistar albino rats (150-200g) were divided into 4 groups, contains 6 animals in each group. Group I. Control group received vehicle (10 % v/v tween 80; p.o.) + FCA induced changes in rat paw oedema Group II. Effect of Diclofenac (10 mg/kg; p.o.) on FCA induced changes in rat paw oedema Group III. AEHP (200 mg/kg; p.o.) on FCA induced changes in rat paw oedema Group IV. AEHP (400 mg/kg; p.o.) on FCA induced changes in rat paw oedema. Adjuvant arthritis was induced by the subplantar injection of 0.1ml of Freunds complete adjuvant (FCA) on day zero (kalia et al). Everyday animals were carefully and thoroughly inspected, by
IJRPB 1(6)
www.ijrpb.com
Page 815
examining the affected paw and the animals general status. In FCA induced animals, the sub-plantar injection of FCA produces local oedema after few hours with a progressive increase reaching its maximum upto 21st thday. On 0th, 7th, 14th, and 21st day the paw-oedema volume of each rat was measured thoroughly in all groups. Inflammation in the paw oedema was measured by using Digital Plethysmometer (7140 UGO Basile). The change in the paw-oedema volume for the Aqueous extract of Hibiscus Platini folius was summarized in the Table1.
The percentage inhibition of paw oedema volume of each treated groups is calculated by using the following equation,Percentage inhibition, % = (Vc Vt / Vc) 100 Where, Vt = Mean paw volume of each treated group Vc= Mean paw volume of control group The width and height of the right paw of each rat was measured with a digital Vernier caliper ruler before and on subsequent testing days, after the induction of arthritis according to Andersen et al.
Table 1: Effect of Aqueous extract of Hibiscus platinifolius on Body weight against FCA induced chronic arthritis in rats Groups Body weight 0 day 7th day 14th day 21st day Control (10% tween80) 163.21.138 154.5 2.405 141.7 0.918 137.7 0.988 Diclofenac (10 mg/kg) 154.71.647 168.21.493** 180.51.544*** 179.31.764*** AEHP 200mg/kg 163.31.054 177.71.054* 189.32.333** 183.51.765*** AEHP 400mg/kg 159.51.708 181.51.708** 188.31.764** 183.52.604*** All values are expressed as mean SEM, n=6, One way Analysis Variance (ANOVA) followed by Dunnetts multiple comparison test; ***p<0.001 as compared to control group; AEHP200mg/kg, AEHP 400mg/kg. Table 2: Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats Groups Paw oedema volume (ml) (%EI) %inhibition of Oedema 1st day 7th day 14st day 21st day Control 10% tween80) 0.740.01 0.870.05 0.920.01 1.020.03 ----Diclofenac(10 mg/kg) 0.640.01ns 0.480.02** 0.370.01*** 0.310.01*** 69.55 AEHP 200 mg/kg 0.750.01ns 0.780.03* 0.710.02** 0.690.01*** 45.58 AEHP 400 mg/kg 0.710.00ns 0.740.01* 0.680.01*** 0.640.03*** 32.58 2nd model: (turpentine oil): turpentine oil induced granuloma pouch in rat: Subcutaneous dorsal granuloma pouch was made in ether anaesthetized rats by injecting 2 ml of air, followed by injection of 0.5 ml of turpentine oil into it. All drugs were administered orally one hour prior to turpentine oil injection and continued for seven consecutive days. On day 7, the pouch was opened under anesthesia, the amount of exudate was taken out with a syringe, and later on the volume was measured and compared with those of the control and standard group. The Turpentine induced Acute anti-arthritic activity of Aqueous extract Hibiscus platanifolius 200mg/kg and 400mg/kg was carried out on Wistar albino rats (150-200g) were divided into 4 groups, contains 6 animals in each group. Group I. Control group received vehicle (10 % v/v tween 80; p.o.) + Turpentine induced changes in rat paw oedema Group II. Effect of Diclofenac (10 mg/kg; p.o.) on Turpentine induced changes in rat paw oedema Group III. AEHP (200 mg/kg; p.o.) on Turpentine induced changes in rat paw oedema Group IV. AEHP (400 mg/kg; p.o.) on Turpentine induced changes in rat paw oedema
Figure.1.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats
IJRPB 1(6)
www.ijrpb.com
Page 816
Figure.2.Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats All values are expressed as mean SEM, n=6, One way Analysis of Variance (ANOVA) followed by Dunnetts multiple comparison, *p<0.05, **p<0.01 as compared to control group; AEHP 200mg/kg, AEHP 400mg/kg.
Statistical analysis: The data are expressed as mean SEM. Statistical comparisons were performed by oneway analysis of variance (ANOVA), followed by Dunnetts Multiple comparison test (DMCT). The results were considered statistically significant if the p values RESULTS AND DISCUSSION FCA Model: A. EEffect of Aqueousextract of Hibiscus platinifolius on Body weight against FCA induced chronic arthritis in rats: Body weight is one of the parameter in arthritis there is significant difference between body weights of each groups immediately after induction of arthritis in animals. Thereafter control group showed significant decrease in body weight after 3rd week (p<0.001) as compared to standard and extract treated groups. However there is significant increase body weight in treated groups after 3rd week. standard group (p<0.001), AEHP [200mg/kg (p<0.001)] and AEHP [400mg/kg (p<0.001)] as compared to control group.
Turpentine oil model: Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against Turpentine induced granuloma pouch in rats: The treatment of AEHP (200 and 400 mg/kg) significantly reduced the volume of exudates (P<0.001) in turpentine oilinduced granuloma pouch dose dependently, which was comparable with the effect of diclofenac (P <0.001). NSAIDs are widely used clinically for RA. However, despite their great number, their therapeutic efficacy seems to be hampered by the presence of a number of undesired and often serious side effects. Selective COX-2 inhibitors make alternative approach to arthritic treatment with reduced GI side effects, but on long term treatment leads to serious cardiovascular and thrombotic side effects. However, a series of new biological monoclonal antibodies (anti-TNF, anti IL-1Ra anti-CD 20, anti-IL-2, IL-4) were preferred for RA but these are highly expensive. The author has immensely fascinated by these aspects of drug research and looked for some new safer antiinflammatory and anti-rheumatic drugs represents a new challenging goal for acute and chronic inflammatory conditions. This is the dissertation work consists of four chapters with title of Evaluation of AEHP as potential anti-inflammatory and antiarthritic agents.
B. Effect of Aqueous extract of Hibiscus platinifolius on paw oedema volume against FCA induced chronic arthritis in rats: In FCA induced chronic arthritis model, control group animals showed increased paw oedema gradually upto 21st day. The test extract AEHP 200mg/kg and AEHP 400mg/kg and Diclofenac showed significant reduced right paw oedema (p<0.001), as compared to The chronic inflammation involves the release of control group. various inflammatory mediators like cytokines (IL-1 and TNF-), granulocyte monocytes colony stimulating C.Effect of Aqueous extract of Hibiscus platinifolius factor (GM-CSF), platelet derived growth factor (PGDF) on FCA induced rat chronic arthritis serum and others. These mediators are responsible for the pain, biochemical parameters: The biochemical marker ALT, destruction of cartilage and leads to severe disability. AST and ALP was increased significantly in Control Paw swelling is one of the major factors in assessing the (FCA) group. Diclofenac and test extract AEHP degree of inflammation and efficacy of the drugs. 200mg/kg and AEHP 400mg/kg was showed significantly (p<0.001) decreased in ALT, AST ansd Adjuvant induced arthritis is non-specific immune ALP level as compared to control group. response within the joint can also result in inflammatory and erosive disease. Paw swelling is an index of
IJRPB 1(6)
www.ijrpb.com
Page 817
measuring the anti-arthritic activity of various drugs and it is employed here to determine the activity of AEHP 200mg/kg and AEHP 400mg/kg. Reference standard Diclofenac sodium, AEHP 200mg/kg and AEHP 400mg/kg administered groups showed marked reduction in paw volume when compared with the arthritic control group by inhibiting the release of inflammatory mediators.
REFERENCES Anderson M.L, Eduardo H.R.S, Maria de Lourdes V.S, Ana A.B.S, Seirgo T, Evaluation of acute and chronic treatments with Harpagophytum procumbens on Freunds adjuvant induced arthritis in rats, J Ethno pharmacol, 2004; 91, 2004, 325-330.
Bradley D.W., Maynard J.E., Emery G., Webster H, Transaminase activities in serum of long-term The cytoplasmic enzymes like AST and ALT hemodialysis patients, Clinchem, 11 (18), 1972, 1442. serves as indicators and suggestive for disturbances of the cellular integrity induced by pathological conditions. Narendhirakannan R.T, Subramanain S, Kandaswamy M, These enzymes are used as sensitive markers for Antiinflammatory and lysosomal stability actions of evaluation of protective activity, these markers attribute Cleome gynandra L studied in adjuvant induced arthritic towards persistent inflammation. The increased enzyme rats, Food ChemToxicol, 45, 2007, 1001-1012. activity may result from one of the several mechanisms Paul H.W, What animal models are best to test novel which include the release of various enzymes from rheumatoid arthritis therapies? Current Rheum Review, leukocytes, from necrotic or inflammed synovial tissue 4, 2008, 277-288. and production and release of an increased amount of enzymes due to altered synovial tissue. A positive Robert A and Nezamis JE, The granuloma pouch as a correlation observed between the leukocytes in the field routine assay for antiphlogistic compounds, Acta and the enzyme levels is considered as evidence for the Endocr, 25, 1957, 1057. release of enzymes from the leukocytes. A loss of semipermeability of the synovial membrane has also been correlated with the significant elevation of enzyme levels. In present study, the decreased level of cytoplasmic enzymes ALT s upports the protective role of the AEHP 200mg/kg, 400mg/kg and Diclofenac sodium. Granuloma pouch technique was modified using turpentine oil as irritant. An aseptic inflammationresulting in large volume of haemorrhage exudate is elicited which resembles the subacute type of inflammation. Turpentine oilinduced granuloma pouch offer a model for exudative type of inflammation. Though, the chemical mediators of this type of response are unknown, protein synthesis is necessary for the formation of granuloma. AEHP has show potential inhibitory action on exudates formation. Kinin is said to be the main mediator of granuloma, as it not only vasodilate but also increase the vascular permeability in the early stages of inflammation. Thus, AEHP may possess antikinin like activity. CONCLUSION Therefore drugs appear to be effective against FCA induced arthritis and Turpentine induced Inflammation. This finding justifies the usefulness of AEHP in the treatment of inflammatory diseases associated like arthritis. It is concluded that Aqueous extract of Habiscus platinifolius possess significant antiarthritic activity, which is comparable to diclofenac sodium.
IJRPB 1(6)
www.ijrpb.com
Page 818
Sarkar et.al
Some H.R. methodology/ techniques for costs reduction in companies to improve profit
M. Sarkar*1, B. K. Sarkar2, M. D. Gora3, S. C. Verma4 1.Sri Balaji College of Engineering & Technology, Dept of Pharmaceutical Management, Jaipur, Rajasthan. 2. National Research Institute for Panchakarma Central Council for Research in Ayurvedic Sciences Cheruthuruthy, Trissur, Kerala. 3. Lohia College, Churu, Rajasthan, India. 4. Central Council for Research in Ayurvedic Sciences, New Delhi. *Corresponding author: bires.sharkar@gmail.com ABSTRACT It is not easy to compete in the market today. Rising prices, shifting fuel rates, global competition, varying labor rates around the world, and spiraling health insurance costs have made cost control a moving target. Sometimes it seems that a company gets one set of expenses under control, and in the meantime, another area of the company begins experiencing cost overruns. It is a never ending battle to maintain company profitability. Controlling cost means monitoring and controlling updates and changes to costs, budget, and the cost baseline of the project. Monitoring and controlling costs has two dimensions to it: expenditure of project funds and the work performed as a result of those expenditures. One major aspect of cost monitoring and controlling is to determine the relationship between the expenditures and the accomplishments. Departments are under increasing pressure to reduce costs. The scale of cost reduction required means that they will have to look beyond immediate short term savings and think more radically about how to take cost out of the business and how to sustain this longer term. This will require strong leadership, disciplined financial management and a corresponding change in organizational culture. Key words: Human resources, H R Methodology, Recruitment INTRODUCTION Human Resources (HR) is an indispensable part of every business and HR services ensure the development of a mutually satisfactory and productive employer-employee relationship. Small business also manages to have HR at their office. HR personnel are responsible for forming employee policies, recruiting and shortlisting candidates, managing payroll and employee benefits. Many small businesses appoint a staff member to manage HR related tasks. HR services have the expertise to manage tasks efficiently, protecting business from possible litigations. Now days HR have shifted its focus from administration to strategy development, an accurate assessment of HRrelated costs has become more crucial now. Organizations need to be realistic in their hiring and prioritize on the areas to focus on in order to find the right candidates. Ultimate goal of HR should be maximum utilization of resources to have desired profit with in confined cost investment; this all encourages HR to focus on cost reduction and now a days HR practicing many policies as a tool of cost reduction. (Risser R, 1993; Thomas K and Schmidt W, 1976) Methodology/techniques for cost reductions: (McClure L, 2000; Cox T, 1994; Decker B, 1998) Cost reduction through appropriate recruitment Manufacturing cost reduction and process optimization Selection of proper business model Cost reduction through supply chain Debit/Credit cost reduction Cost reduction through concession Reduction in transportation charges Utilization of resources Utilization of IT/communication techniques Outsourcing to reduce cost Cost reduction through appropriate recruitment: The hiring process needs to be designed to provide both parties with information, data and clues, on what the job will entail, much deeper than what is visible at the tip of the iceberg. It must provide information on aspects like information on the informal culture of the team, how decisions are taken, relationship dynamics etc. For some roles, job simulation can be a great aid where the person experiences some challenging aspect of the job to see how he/she perform and feel. This gives the candidate a chance to experience the job even before he/she is actually put on the job. These assessments are also useful for vertical movements in the organization, especially when moving from an operational job, to a managerial role. There are many situations where managers are not ready to handle a role as they have never been put in those situations, such as, giving feedback to an underperformer or
IJRPB 1(6)
www.ijrpb.com
Page 819
Sarkar et.al
handling delicate issues like complaints and conflicts. Organizations need to focus on accelerating development on the first days and weeks from joining so that the new employee can become productive faster. In reality, not many organizations focus on setting expectations, creating net worth for people, especially in a complex work environment. Early development has immense benefits: from fewer mistakes and faster productiveness, to early success. Developing a cost-reduction strategy that maximizes efficiency without compromising growth potential is a tricky proposition. This requires identification of core competencies where efficiency can be improved, trim and consolidate non-core functions, and reinvest the savings in critical business assets. Manufacturing cost reduction and process optimization: Challenging economic conditions and tough competition make production errors and waste unacceptable. Machine vision technology can help to reduce manufacturing costs and optimize processes. By networking vision systems throughout production to catch defects at the source and potentially prevent errors altogether, manufacturers can minimize scrap and costly rework. If profit margins are narrow, reduced manufacturing and supply chain costs can often be the difference between profit and loss. This can be optimized by Improving management of work in process, reducing inventory, optimizing availability and use of production tools and minimizing distribution of non-conforming products. Selection of proper business model Organization facing severe margin pressure has a greater imperative to reduce their costs through a wide range of cost levers. On the other hand, healthy companies can continue to focus on incremental process improvement. The most immediate cost savings may be achieved in streamlining General and Administrative functions (G&A) and cutting external spending on materials and services. Improvements in these areas can deliver significant savings almost immediately, with little or no adverse effect on the operations. Company should also look beyond organizational silos to include cost reduction opportunities across the entire enterprise. A quick but comprehensive analysis of actionable spending (i.e. costs that are within the companys control over the next 12 months) can help identify the biggest opportunities and set priorities. The selection of right business model in some cases may be the most effective way for a company to achieve the required savings through a transformation of its business model.
Cost reduction through supply chain: Reduce supply costs by shopping around to find the best deal on office supplies, production equipment, and raw materials. Consider hiring a procurement officer to monitor and maintain supply levels, as their training and knowledge are invaluable assets to organization. Ensure that the decision makers within the company know how to find the best prices by using a variety of tools and resources. Internal inventory management is cost efficient, however; larger companies may find external inventory management a viable option. Create an automated system to automatically order new supplies, which reduces back office labor expenses. Improve efficiency and maximize space by organizing inventory supplies and modifying the layout of the room or warehouse. Keep the aisles free of debris and narrow, with enough room for handcarts, forklifts, or other equipment. Consider liquidating products that are expiring soon or have a history of poor sales. Consider a variety of programs, such as vendor managed inventory systems (VIM), vendor stocking programs (VSP), and common supplier joint procurement policies. Choosing a VSP reduces inventory costs for less popular items and increases supplier reliability and dependency. Alleviate the nightmare of managing inventory by giving the responsibility to the vendor, which reduces inventory and related expenses. Debit/Credit cost reduction: Encourage cash-based transactions such as check, money order, and cash. Form partnerships with processing authorities and choose a plan that is cost effective for organization. Streamline the purchasing process by using autogenerated purchase orders and advanced notification systems. Additionally automate the shipping and receiving procedure by using electronic metered postage and bulk discounts when applicable. Review PO history as part of cost reduction strategy at the end of the year. Cost reduction through concession: Every company orders certain supplies more than other products. Consider purchasing non-perishable items with long shelf lives in bulk to reduce supply and labor costs. Ordering items less frequently reduces the costs associated with placing orders and saves money by lowering the cost per unit. Before placing the order, ensure the savings per unit are worth the risk, given current market demands. Reduction in transportation charges: Attempt to purchase items in large groups based on the manufacturer or vendor to save on freight charges, utilizing merge-in-transit techniques to reduce transit
IJRPB 1(6)
www.ijrpb.com
Page 820
Sarkar et.al
times. When shipping to consumers, utilize bulk discounts by shipping multiple quantities of the same item. Choose carriers and form partnerships with them to reduce shipping charges. Order inventory early to avoid rush-processing charges and expedited delivery fees, which add up quickly for bulk orders. Maximum utilization of resources Do comparison shopping and ask current service providers to match the lowest price. Reduce maintenance frequency for building, equipment, etc. Share office or building space with another business Review and refine receiving protocols to ensure products hit the shelves with minimal delay by maintaining adequate order supply rates and throughput levels. Maintain optimal levels by reducing safety stock inventory and increasing order fill rates. Utilization of IT/communication techniques Computer to computer phone calls are free and other rates are much lower than traditional business phone lines. Establish presence on social media sites for marketing instead of spending money on traditional media (newspaper, magazine, mail). Allow employees to telecommute, where possible, instead of leasing an office space. Cut down on printing and paper based communication. Use electronic communication, including emails and text messaging. Use video conferencing services with clients and employees instead of spending money on travel. Another great way to improve productivity while lowering costs is to eliminate paper flow. The best approach is to place all documents online for employees to download, read, and make changes to. Also, instruct all employees not to print e-mails and other unnecessary documents that will usually end up in the trash upon a few quick glances.
Outsourcing to reduce cost Hire temporary workers on as needed basis instead of permanent ones. Lease equipments as opposed to buying them. Outsource computer maintenance for a flat monthly fee rather than hiring a full-time employee. SUMMARY Companies that are losing money, need to increase profits, or must become more competitive need to cut expenses in order to succeed. Knowing how to implement effective cost reduction strategies can be the determining factor in the survival of a business. A good manager understands the importance of cost reduction to the health of a company. Bloated expense accounts can eat up profits quickly. A cost reduction plan is one that focuses on lowering costs in every business activity. The activities vary by type of business. The Cost reduction essential for increasing profits, improving competitive standing and to reduce waste; which all ultimately improve productivity. References Cox T, Cultural diversity in organizations: theory, research & practice. San Francisco: Berrett-Koehler Publishers; 1994. Decker B, The art of communicating: achieving interpersonal impact in business, Los Altos, CA: Crisp Publications: 1988. McClure L, Anger and conflict in the workplace: spot the signs, avoid the trauma, Manassas Park VA: Impact Publications; 2000. Risser R. Stay out of court: the managers guide to preventing employee lawsuits, Englewood Cliffs, New Jersey: Prentice Hall; 1993. Thomas K. and Schmidt W, A survey of managerial interests with respect to conflict, Academy of Management Journal, 1976.
IJRPB 1(6)
www.ijrpb.com
Page 821
Raja Rao and Agarwal
Analytical method development and validation of Artesunate and Amodiaquine hydrochloride in tablet dosage form by RP-HPLC
P RajaRao*, Nanda Kishore Agarwal Department of pharmaceutical analysis, Nimra College of Pharmacy, Jupudi, Vijayawada. *Corresponding author: rajuu787@gmail.com@gmail.com, phone no: 9652598593. ABSTRACT A simple, specific and accurate reverse phase high performance liquid chromatographic method was developed for the simultaneous determination of Artesunate (ART) and Amodiaquine hydrochloride (AMO) in pharmaceutical dosage form. The column used was inertsil ODS C18 (250*4.6mm,5) in isocratic mode, with mobile phase containing phosphate buffer- acetonitrile-methanol (50:30:20) adjusted to pH 5.8 using ortho phosphoric acid was used and injection volume of 20L, with a flow rate of 1.0ml/min. and effluents were monitored at 208 nm. The retention times of artesunate and amodiaquine hydrochloride were 5.03 min and 2.77 min, respectively. The linearity for Artesunate and Amodiaquine hydrochloride were in the range of 15-35 mcg/ml and 45.9-107.1 mcg/ml respectively with correlation coefficient of r2=0.999 for both.The assay of the proposed method was found to be 98.56% and 99.08%. The recoveries of artesunate and amodiaquine hydrochloride were found to be 99.81% and 99.3%, respectively. The % RSD from reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for routine quality control analysis of artesunate and amodiaquine hydrochloride in bulk and in Pharmaceutical dosage form. Key Words:, Artesunate & Amodiaquinehydrochloride RP-HPLC, Inertsil ODS, Validation, Forced degradation studies.
INTRODUCTION Artesunate belongs to artemesinin group effective in the treatment of malarial patients. Amodiaquinehydrochloride is an antimalarial agent similar to chloroquine in structure and activity which belongs to the class of 4aminoquinoline widely used in both antimalarial and anti-inflammatory pharmaceutical formulations, alone or combination with other drugs. Artesunate is chemically (3R,5aS,6R,8aS,9R,10S,12R,12aR) - Decahydro 3,6,9 - trimethyl-3, 12epoxy - 12H - pyrano [4,3j] -1,2-benzodioxepin-10-ol,hydrogensuccinate, and amodiaquine hydrochloride is 4-[(7-chloro4-quinolyl)amino]-2-[(diethylamino)methyl] phenol dihydro chloride dihydrate was successfully used as one content in association with other drugs in the treatment of malaria. Literature survey revealed that a various analytical methods have been reported for the determination of Artesunate and Amodiaquine
hydrochloride in pure drug, pharmaceutical dosage forms and in biological samples using liquid chromatography either in single or in combined forms. Confirmation of the applicability of the developed method was validated according to the International Conference on Harmonization (ICH) for the simultaneous determination of Artesunate and Amodiaquine hydrochloride in bulk and in tablet dosage form.
MATERIALS AND METHODS UV-3000 LABINDIA double beam with UV win 5software UV-VISIBLE spectrophotometer with 1cm matched quartz cells. Schimadzu HPLC equipped with SPD 20A UV-VIS detector and the column used was INERTSIL ODS C18 (250*4.6mm, 5). The data acquisition was performed by using LC solutions software. In addition an analytical balance (DENVER 0.1mg sensitivity), digital pH meter (Eutech pH 510), a sonicator (Unichrome associates UCA 701) were used in this study.
Figure.1.Structure of Artesunate
Figure.2. Structure of Amodiaquine hydrochloride
IJRPB 1(6)
www.ijrpb.com
Page 822
Chemicals and reagents: Artesunate and Amodiaquinehydrochloride pure sample was taken as a gift sample from local labs and dosage form falcinil manufactured by zuventus was purchased from local pharmacy. Other chemicals all are of HPLC grade. Preparation of mobile phase: Potassium dihydrogen phosphate was weighed (2g) and dissolved in 1000 ml of water. Finally the pH was adjusted to 5.8 with ortho phosphoric acid (0.1 M). The solution was sonicated for 10 minutes and filtered using Whatman filter paper (No.1) and used. Then mix the buffer, acetonitrile and methanol in 50:30:20 compositions respectively. Preparation of stock solutions: Artesunate standard stock solution: An accurately weighed quantity of artesunate 25 mg was transferred to the 100ml volumetric flask add 30ml of diluents (buffer:ACN:methanol 50:30:20), sonicate to dissolve, dilute upto the mark with diluent and mix well.(Concentration of artesunate is about 250 g/ml). Amodiaquine hydrochloride standard stock solution: An accurately weighed quantity of Amodiaquine hydrochloride 76.5 mg was transfer to the 100ml volumetric flask add 30ml of diluent, sonicate to dissolve, dilute up to the mark with diluent and mix well. (Concentration of Amodiaquinehydrochloride is about 765 g/ml). Preparation of standard: Take 10 ml solution from standard stock solution of Artesunate and 10ml solution from standard stock solution of Amodiaquine hydrochloride in 100 ml volumetric flask and make up the volume upto the mark with diluents. (Concentration of Artesunate is about 250 g/ml). (Concentration of Amodiaquine hydrochloride is about 765g/ml). Preparation of the sample solution: The powder equivalent to 25 mg of Artesunate and 76.5mg of Amodiaquine hydrochloride were weighed and taken into a 100mL volumetric flask. To this 25mL of diluents was added and sonicated for 15min to dissolve the drugs then made up the volume to required volume with the diluents. From this solution 10ml was taken into a 100mL flask and made up to final volume with diluents to get concentration of Artesunate is about 250g/ml, concentration of Amodiaquine hydrochloride is about 765g/ml and filtered through 0.45 filter under vacuum filtration. From this stock solution further dilutions were made for the validation of the method developed.
RESULTS AND DISCUSSION Method Validation: Specificity: Specificity is the ability of analytical method to measure accurately and specifically the analyte in the presence of components that may be expected to be present in the sample. The specificity of method was determined by spiking possible impurities at specific level to standard drug solution (100ppm). The diluent and placebo solutions were also injected to observe any interference with the drug peak. The results are tabulated in the table no-2 and the chromatogram was shown in the figure no- 2, 3. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of ARTESUNATE was in the concentration range of 15- 35 %, for AMODIAQUINEHYDROCHLORIDE 45.9-107.1%. From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 0.999 and shows good linearity for both the drugs. The results are tabulated in the table no-3 and the chromatogram was shown in the figure no-.4, 5. Precision: Precision is the degree of closeness of agreement among individual test results when the method is applied to multiple sampling of a homogeneous sample. Study was carried out by injecting six replicates of the same sample preparations at a concentration of Artesunate 25 ppm/ml & Amodiaquinehydrochloride 76.5 ppm/ml. The results are tabulated in the table no-5. Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (80%,100% ,120%) at three different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. The results are tabulated in the table n-5. LOD & LOQ: LOD is the lowest concentration of analyte in a sample that can be detected but not quantified under experimental conditions. The LOD values were determined by the formulae LOD=3.3/s (where is the standard deviation of the responses and s is the mean of the slopes of the calibration curves).
IJRPB 1(6)
www.ijrpb.com
Page 823
LOQ is the lowest concentration of analyte in a sample that can be determined with acceptable precision and accuracy under experimental conditions. It is a parameter of the quantitative determination of compounds in the mixtures. The LOQ values were determined by the formulae LOD=10/s. The results are tabulated in the table no-5 Forced degradation of Artesunate and Amodiaquine hydrochloride Acid degradation: Acid degradation was determined by taking 5ml of stock solution in 10ml volumetric flask and to this 2ml of 0.1N HCl was added and sonicate for 5min, kept aside for 12hrs at room temperature. After 12hrs the solution was neutralized with 2ml of 0.1N NaoH then diluted with diluents to get a concentration of 10g/ml solution and analysed to recorded chromatogram. Base Degradation: Base degradation was determined by taking 5ml of stock solution in 10ml volumetric flask and to this 2ml of 0.1N NaoH was added and sonicate for 5min, kept aside for 12hrs at room temperature. After 12hrs the solution was neutralized with 0.1N HCl then diluted with diluents to get a concentration of 10g/ml solution and analysed to recorded chromatogram. Oxidative degradation: Oxidative degradation was determined by taking 5ml of stock solution in 10ml volumetric flask and diluted up to the mark with 5% H2O2 and kept aside for 12hrs. After 12hrs the solution was diluted with diluents to get a concentration of 10g/ml solution and analysed to recorded chromatogram. Thermal degradation: Sample powder equivalent to 100mg of Artesunate and 12.5mg of Amodiaquine hydrochloride was taken and kept in a controlled temperature oven at 800c for 12hrs. After 12hrs the powder was diluted with diluents to get a concentration of 10g/ml solution and analysed to recorded chromatogram. Photolytic degradation: The Artesunate and Amodiaquine hydrochloride powder and solutions of both were prepared and exposed to light to determine the irradiation of light on the stability of solution and powder form of drugs. Approximately 100mg of drug powder and 1mg/ml solution were spread on a glass dish in a layer that was less than 2mm thickness and Brand name FALCINIL AQ
were placed in a light cabinet and exposed to UV light at 300-400nm for 12hrs. After 12hrs the samples are removed and diluted with diluents to get a concentration of 10g/ml solution and analysed to recorded chromatogram. Several trials has made until getting good peak resolution, acceptable plate count and tailing factor. Method was optimized and the retention times of Artesunate and Amodiaquine hydrochloride was reported as 5.03 &2.77 Specificity: The Chromatograms of Standard and Sample are identical with nearly same Retention time. There is no interference with blank and placebo to the drugs. Hence the proposed method was found to be specific. Linearity: From the Linearity data it was observed that the method was showing linearity in the concentration range of 15-35g/ml for Artesunate and 45.9-107.1 g/ml for Amodiaquinehydrochloride Correlation coefficient was found to be 0.999 for both the compounds. Accuracy: The recoveries of pure drug from analyzed solution of formulation were 99.81% Artesunate and 99.30% Amodiaquinehydrochloride, which shows that method was accurate. the for for the
Precision: The %RSD for the sample chromatograms of method precision were found to be 0.21 &1.48 (Rt & Area) for Artesunate and 0.24 &0.73 (Rt & Area) for Amodiaquinehydrochloride. Hence it passes method precision. Robustness: All the system suitability parameters are within limits for variation in flow rate (0.2 ml). Hence the allowable flow rate should be within 0.8 ml to 1.2 ml. All the system suitability parameters are within limits for variation (2nm) in wavelength. Hence the allowable variation in wavelength is 2nm
LOD & LOQ: LOD and LOQ of Artesunate was found to be 2.07, 6.27 and for Amodiaquine hydrochloride was found to be 1.58, 4.78 respectively. All the system suitability parameters are within in the limits when the drugs are subjected to stress conditions like acid, base peroxide, thermal and photolysis. The results obtained were satisfactory and good agreement as per the ICH guidelines. Table.1.Details of marketed Formulation Content Mfg.Company ART & AMO (100mg & 306mg Respectively) Zuventus
IJRPB 1(6)
www.ijrpb.com
Page 823 824
Table.2.Optimized chromatogram conditions for Artesunate and Amodiaquine hydrochloride Column Inertsil ODS C18 (250*4.6mm,5) Mobile phase Phosphate Buffer pH 5.8:ACN:Methanol(50:30:20) Flow rate 1.0 ml/ min Wavelength 208 nm Injection volume 20 l Column temperature Ambient Run time 8 min Table.3.Specificity Data for Artesunate and Amodiaquine hydrochloride
Standard Injection Artesunate Retention time 5.03 5.04 5.05 5.05 5.03 5.06 Area 315.58 324.64 298.92 319.49 304.96 309.21 Theoretical Plates 4028 4039 3919 4060 4338 4220 Amodiaquine hydrochloride Retention Area time 2.777 4586.64 2.780 4549.66 2.783 4538.27 2.783 4587.39 2.770 4512.74 2.790 4564.21 Theoretical Plates 2808 2973 2821 2980 2952 2995 -
Sample Injection Blank injection
Table.4.Linearity data for Artesunate and Amodiaquine hydrochloride

For Artesunate Mcg/ml Area 15 214.518 20 277.385 25 337.549 30 409.413 35 463.805 Slope 12.61 Correlation 0.9987 coefficient Intercept 25.233 Rt 5.060 5.023 5.053 5.063 5.060 For Amodiaquine hydrochloride Mcg/ml Area 45.9 2981.917 61.2 3680.566 76.5 4650.723 91.8 5266.344 107.1 6014.413 Slope 50.66 Correlation 0.9954 Coefficient Intercept 663.41 Rt 2.787 2.740 2.777 2.790 2.787
Table.5.Summary of validation parameters

Parameter Linearity Precision(% RSD) Accuracy LOD & LOQ Assay Artesunate 15-35g/ml 0.21 (Rt) 99.81% 2.07,6.27 98.56% 1.48(Area) Amodiaquine hydrochloride 45.9-107.1g/ml 0.24 (Rt) 0.73(Area) 99.3% 1.58, 4.78 99.08%
Table.6.Summary of Forced degradation data for Artesunate and Amodiaquinehydrochloride

Stress Condition As such Acid Hydrolysis (0.1 N, at RT) Base Hydrolysis (0.1N at RT) Oxidation (5% H2O2 at RT) Photolysis(UV Light and sunlight) Thermal (at 800c) Time(hrs) 12hrs 12hrs 12hrs 12hrs 12hrs 12hrs Retention Time 5.033 5.033 5.033 5.053 5.053 5.040 Time(hrs) 12hrs 12hrs 12hrs 12hrs 12hrs 12hrs Retention Time 2.777 2.777 2.777 2.783 2.783 2.780
IJRPB 1(6)
www.ijrpb.com
Page 824 825
Figure.1.Chromatogram of standard drug
Figure.2.Chromatogram for specificity sample
Figure.3.Chromatogrphy for blank

Linearity of Artesunatey = 12.612x + 25.233 r = 0.9987
500 450 400 350 300 250 200 150 100 50 0 0 10 20 30 40
Linearity of Amodiaquine Hcl

7000 6000 5000
y = 50.659x + 663.41 r2= 0.9954
Area
Area
4000 3000 2000 1000 0 0 20 40 60 80 100 120
Conc
Conc
Figure.4. Linearity plot for Artesunate
Figure.5.Linearity plot for Amodiaquine hydrochloride
IJRPB 1(6)
www.ijrpb.com
Page 825 826
Figure.6. Acid degradation
Figure.7. Base degradation
Figure.8.Thermal Degradation
Figure.9.Photolytic Degradation
Figure.10.Peroxide degradation
CONCLUSION Finally it concludes that all the parameters are within the limits and meet the acceptance criteria of ICH guidelines for method validation. The proposed method was simple, accurate, specific, precise, robust, rugged and economical. Hence this method is validated and can be used for routine and stability sample analysis REFERENCES
combined pharmaceutical dosage form, JPSBR, 2(3), 2012, 114-117. P.S.Jain, A.J.Chaudhari, and S.J.Surana, Selective high performance liquid chromatographic determination of amodiaquine and artesunate in bulk and pharmaceutical formulation, Journal of applied pharmaceutical science, 3(3), 2013, 066070. Santosh Gandhi, Padmanabh Deshpande, Pankaj Jagdale, Godbole Varun, A simple and sensitive RP-HPLC method for simultaneous estimation of Artesunate and Amodiaquine in combined tablet dosage form, Journal of Chemical and Pharmaceutical Research, 2(6), 2010, 429-434 429.
Catherine Orrell, Francesca Little, Peter Smith, Peter Folb, Walter Taylor, Piero Olliaro, Karen I. Barnes, Pharmacokinetics and tolerability of Artesunate and Amodiaquine alone and in combination in healthy volunteers, Eur J Clin Pharmacol, 64, 2008, 683690. Odedara MH, Faldu SD, Dadhania KP, RPHPLC Method for Simultaneous Estimation of Artesunate and Amodiaquine HCL in their IJRPB 1(6) www.ijrpb.com
Page 826 827
Shaheda and Agarwal
Analytical method development and validation for the simultaneous estimation of Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by RP-HPLC
Syed Shaheda*, Nanda Kishore Agarwal, Nimra College of Pharmacy, Jupudi, Vijayawada, A.P, India *Corresponding author: Email: syedshaheda15@gmail.com, Phone +91-9030167419 ABSTRACT The present investigation describes about a simple, economic, selective, accurate, precise reverse phase high performance liquid chromatographic method for the simultaneous estimation of Rabeprazole sodium and Itopride hydrochloride in pure and pharmaceutical dosage forms. Rabeprazole and Itopride were well separated using a Thermohypersil ODS C18 column of dimension 250 4.6, 5m and Mobile phase consisting of Sodium dihydrogen orthophosphate:Acetonitrile ( pH-5.8) in the ratio of 60:40v/v at the flow rate 1 ml/min and the detection was carried out at 209nm. The Retention time for Rabeprazole and Itopride were found to be 1.950, 5.027 respectively. The developed method was validated for recovery, specificity, precision, accuracy, linearity according to ICH guidelines. The method was successfully applied to Rabeprazole sodium and Itopride hydrochloride combination pharmaceutical dosage form. Key Words: RP-HPLC, Rabeprazole sodium, Itopride hydrochloride. INTRODUCTION Rabeprazole is chemically 2- [[[4-(3Methoxypropoxy) 3 Methyl 2 - Pyridinyl] Methyl]Sulfinyl]-1H-Benzimidazole Sodium salt, belongs to a class of antisecretory compounds (substituted benzimidazole proton-pump inhibitors) that do not exhibit anticholinergic or histamine H2receptor antagonist properties, but suppress gastric acid secretion by inhibiting the gastric H+/K+ATPase (hydrogen-potassium adenosine triphosphatase) at the secretory surface of the gastric parietal cell. Because this enzyme is regarded as the acid (proton) pump within the parietal cell, rabeprazole has been characterized as a gastric proton-pump inhibitor. Rabeprazole blocks the final step of gastric acid secretion. Itopride hydrochloride, N - [[4 - (2 Dimethylaminoethoxy) phenyl] methyl] - 3, 4dimethoxybenzamide is a synthesized gastroprokinetic agent. It has been shown to involve an amplification of the prokinetic action of acetylcholine in the gastrointestinal tract by increasing the release of acetylcholine through the inhibition of the D2 receptors, as well as decreasing the metabolism of this transmitter by inhibiting acetylcholinesterase enzyme. Itopride increases acetylcholine concentrations by inhibiting dopamine D2 receptors and acetylcholinesterase. Higher acetylcholine increases GI peristalsis, increases the lower esophageal sphincter pressure, stimulates gastric motility, accelerates gastric emptying, and improves gastroduodenal coordination. Literature survey revealed that very few methods have been reported for the analysis of Rabeprazole and Itopride combinational dosage forms which include UV spectroscopy, Reverse Phase High performance Liquid Chromatography, HPTLC methods. The present study illustrate development and validation of simple, economical, selective, accurate, precise RP-HPLC method for the determination of Rabeprazole sodium and Itopride hydrochloride in bulk and Pharmaceutical dosage forms as per ICH guidelines. The goal of this study is to develop rapid, economical HPLC method for the analysis of Rabeprazole sodium and Itopride hydrochloride in combined dosage form using most commonly employed column (C18) and simple mobile phase preparation. In the present proposed work a successful attempt had been made to develop a method for the simultaneous estimation of pharmaceutical dosage form a Rabeprazole sodium and Itopride hydrochloride and validate it. From the economical point of view and for the purpose of routine analysis, it was decided to develop a more economical RPHPLC method with simple mobile phase preparation for the estimation of Rabeprazole sodium and Itopride hydrochloride combinational dosage form. The method would help in estimate of drugs in single run which reduces the time of analysis and does not require separate method for each drug. Thus, the paper reports an economical, simple and accurate RP-HPLC method for the above said pharmaceutical dosage forms. MATERIALS AND METHODS Quantitative HPLC was performed on a high performance liquid chromatograph Shimadzu prominance HPLC system connected with
IJRPB 1(6)
www.ijrpb.com
Page 828
Shaheda and Agarwal
Spinchrome-CFR Software. The drug analysis data were acquired and processed using Spinchrome-CFR software running under Windows XP on a Pentium PC and Thermohypersil ODS C18 column of dimension 250 4.6, 5m particle size. In addition an analytical balance (SHIMADZU 0.1mg sensitivity), digital pH meter (Polmon Lp-137), a sonicator (Lab india) were used in this study. Standards and chemicals used: Pharmaceutical grade Rabeprazole sodium and Itopride hydrochloride were kindly supplied as a gift sample by Chandra Labs, Hyderabad,Andhra Pradesh, India. Acetonitrile was of HPLC grade and Purchased from E. Merck, Darmstadt, Germany. Water HPLC grade was obtained from a Milli-QRO water purification system. Rabeprazole sodium and Itopride hydrochloride Capsules available in the market as Rablet-IT (Hetero labs limited, Himachalpradesh, India.) in composition of Rabeprazole sodium (20mg), Itopride hydrochloride (150mg). Preparation of mobile phase: Transfer 0.4825gm of Sodium Dihydrogen Orthophosphate into 100ml of beaker, dissolve and dilute up to the volume with water. Then adjust its pH to 5.8. Now,The buffer adjusted pH to 5.8:Acetonitrile were mixed to the ratio (60:40 v/v) and filtered through 0.45 membrane filter and degassed by sonication. Preparation of calibration standards: 75mg Itopride and 10mg Rabeprazole was taken into a 100 ml of volumetric flask, diluted to 50ml with mobile phase and sonicated for 10 minutes and made up with mobile phase. This is taken as a 100% concentration. From the above, pipette out 0.6,0.8,1.0,1.2 and 1.4 ml of solution and transfer each of them in to a 10ml volumetric flask. Dilute with mobile phase to get concentrations of 60,80,100,120 and 140 g/mL respectively. Linearity of the method was determined by mean of calibration graph using an increasing amount of each analyst. Linearity was evaluated by visual inspection of a calibration graph.The calibration curves were plotted over a concentration range of 6-14 g/ml for Rabeprazole sodium and 25-125 g/ml Itopride. calibration curves were constructed by plotting absorbance versus concentration and the regression equations were calculated. System suitability: System suitability are an integral part of chromatographic system. To ascertain its effectiveness, certain system suitability test parameters were checked by repetitively injecting the drug solutions at 100% concentration level for Rabeprazole sodium and Itopride hydrochloride to check the reproducibility of the system. At first the HPLC system was stabilized for 40 min. One blank
followed by six replicate analysis of solution containing 100% target concentration of Rabeprazole sodium and Itopride hydrochloride were injected to check the system suitability. To ascertain the system suitability for the proposed method, a number of parameters such as theoretical plates, peak asymmetry, and retention time were taken and results were presented in Table 1. Recommended procedure: Calibration curves for Rabeprazole sodium and Itopride hydrochloride: Replicate analysis of solution containing 6-14g/mL, 25-125g/mL of Rabeprazole sodium and Itopride hydrochloride sample solutions respectively were injected into HPLC according to the procedure in a sequence and chromatograms were recorded. Calibration curves were constructed by plotting by taking concentrations on X-axis and ratio of peak areas of standards on Yaxis and regression equation were computed for both drugs and represented in Table .6 Analysis of marketed formulation: The content of ten capsules were weighed accurately. Their average weights were determined. Powder of capsules equivalent to 75mg of Itopride and 10mg of Rabeprazole sodium were weighed and taken in a 50 ml volumetric flask, dissolved in Mobile phase, shaken and sonicated for about 20 minutes then filtered through 0.45 membrane filter. The filtered solution was further diluted (5 to 50ml) in the mobile phase to make the final concentration of working sample equivalent to 100% of target concentration. The prepared sample and standard solutions were injected into HPLC system according to the procedure. from the peak areas of Rabeprazole sodium and Itopride hydrochloride the amount of the drugs in the sample were computed. The contents were calculated as an average of six determinations and experimental results were presented in Table 4. The representive standard and sample chromatograms were shown in fig.4 and fig.5. Validation study of Rabeprazole sodium and Itopride hydrochloride: An integral part of analytical method development is validation. Method validation is the process to confirm that the analytical procedure employed for a specific test is suitable for its intended use. The newly developed RP-HPLC method was validated as per International Conference on Harmonization (ICH) guidelines for parameters like specificity, system suitability, accuracy, linearity, precision (repeatability), limit of detection (LOD), limit of Quantification (LOQ) and robustness. Specificity: The effect of wide range of excipients and other additives usually present in the formulation
IJRPB 1(6)
www.ijrpb.com
Page 829
Shaheda and Agarwal
of Rabeprazole sodium and Itopride hydrochloride in the determination under optimum conditions were investigated. The specificity of the RP-HPLC method was established by injecting the mobile phase and placebo solution in triplicate and recording the chromatograms. The common excipients such as lactose anhydrous, microcrystalline cellulose and magnesium stearate have been added to the sample solution injected and tested. Precision: precision study of sample (Rabeprazole and Itopride) was carried out by estimating corresponding responses 6 times on the same day for the 100% target concentration. The percent relative standard deviation (%RSD) is calculated which is within the acceptable criteria of not more than 2.0. Linearity: The linearity graphs for the proposed assay methods were obtained over the concentration range of 6-14g/ml and 25-125g/mL Rabeprazole sodium and Itopride hydrochloride respectively. Method of least square analysis is carried out for getting the slope, intercept and correlation coefficient, regression data values and the results were presented in Table 6. The representative chromatograms indicating the sample were shown in fig.5. A calibration curve was plotted between concentration and area response and statistical analysis of the calibration curves were shown in fig. 6&7. Accuracy (Recovery studies): The accuracy of the method is determined by calculating recovery of Rabeprazole sodium and Itopride hydrochloride by the method of addition. Known amount of Rabeprazole sodium and Itopride hydrochloride at 50%, 100%, 150% is added to a pre quantified sample solution. The recovery studies were carried out in the tablet in triplicate each in the presence of placebo. The mean percentage recovery of Rabeprazole sodium and Itopride hydrochloride at each level is not less than 99% and not more than 101%. Robustness: The robustness is evaluated by the analysis of Rabeprazole sodium and Itopride hydrochloride under different experimental conditions such as making small changes in flow rate (0.2 ml/min), max (5), column temperature (5), mobile phase composition (5%), and pH of the buffer solution. LOD and LOQ: Limit of detection is the lowest concentration in a sample that can be detected but not necessarily quantified. Under the stated experimental conditions the limit of quantification is the lowest concentration of analyte in a sample that can be determined with acceptable precision and accuracy. Limit of detection and limit of quantification were calculated using following formula LOD=3.3(SD)/S
and LOQ=10(SD)/S, where SD= standard deviation of response (peak area) and S= average of the slope of the calibration curve. RESULTS AND DISCUSSION Reverse phase HPLC method was preferred for the determination of Rabeprazole sodium and Itopride hydrochloride. Preliminary experiments were carried out to achieve the best chromatographic conditions for the simultaneous determination of the drug substances. Several column types and lengths were tried considering other chromatographic parameters. C18 column with a 4.6 mm inner diameter and 5m particle size was chosen. The detection wave length was selected as 209nm with UV detector. Chromatographic conditions were optimized by changing the mobile phase composition and buffers used in mobile phase. Different experiments were performed to optimize the mobile phase but adequate separation of the drugs could not be achieved. By altering the pH of buffer results a good separation. Different proportions of solvents were tested. Eventually the best separation was obtained by the isocratic elution system using a mixture of Sodium dihydrogen orthophosphate buffer (adjusted the pH to 2): Acetonitrile (60:40, v/v) at a flow rate of 1 ml/min. a typical chromatogram for simultaneous estimation of the two drugs obtained by using a above mentioned mobile phase.Under these conditions Rabeprazole sodium and Itopride hydrochloride were eluted at 5.027min and 1.950minutes respectively. The representative chromatogram of this simultaneous estimation shown in fig. 3, 4 & 5 and results were summarized in Table 1. The Sodium dihydrogen orthophosphate buffer (NaH2PO4): ACN (60:40, v/v) was chosen as the mobile phase. The run time of the HPLC procedure was 6 minutes at flow rate of 1ml/min was optimized which gave sharp peak, minimum tailing factor. The system suitability parameters were shown in Table 1 were in within limit, hence it was concluded that the system was suitable to perform the assay. The method shows linearity between the concentration range of 6-14g/ml for Rabeprazole and 25-125g/ml for Itopride. The experimental results were shown table 6 and fig.6&7. The % recovery of Rabeprazole and Itopride was found to be in the range of 100.99 to 101.87% & 98.10 to 101.35% respectively. As there was no interference due to excipients and mobile phase, the method was found to be specific. As both compounds pass the peak purity, the method was found to be specific. The method was robust and rugged as observed from insignificant variation in the results of analysis by changes in Flow
IJRPB 1(6)
www.ijrpb.com
Page 830
Shaheda and Agarwal
rate, column oven temperature, mobile phase composition and wave length separately and analysis being performed by different analysts. The results were shown in Table 5. The LOD and LOQ values were calculated based on the standard deviation of the response and the slope of the calibration curve at
levels approximately the LOD and LOQ. The limit of detection was obtained as 0.17g/mL for Rabeprazole and 4.74g/mL for Itopride. The limit of quantitation was obtained as 0.50g/mL for Rabeprazole and 14.36g/mL for Itopride which shows that the method is very sensitive. The results were shown in Table. 7.
Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method
Parameter Instrument Column Detector Diluent Mobile phase Flow rate Detection wavelength Temperature Injection volume Retention time Theoretical plate count Tailing factor Chromatographic conditions Schimadzu HPLC with Spinchrome software thermohypersil C18, (5, 250 x 4.6mm) UV Detector Methanol Sodium dihydrogen orthophosphate (adjusted pH 5.8): methanol (60:40 v/v) 1ml/min 209nm 25c 20l Itopride hydrochloride:1.950; Rabeprazole sodium:5.027 Itopride hydrochloride:2810; Rabeprazole sodium:4659 Itopride hydrochloride:1.33; Rabeprazole sodium1.50
Table.2.Specificity study Name of the solution Blank Itopride hydrochloride Rabeprazole sodium
Retention time in min No peaks 1.950 5.027
Sample Itopride hydrochloride
Rabeprazole sodium
Table.3.Results of precision study Injection number RT 1 2.01 2 1.99 3 2.007 4 1.950 5 1.973 6 1.950 Mean %RSD(NMT 2.0) 1 5.157 2 5.123 3 5.140 4 5.027 5 5.107 6 5.027 Mean %RSD(NMT 2.0)
Precision Peak area 3652.679 3623.413 3604.924 3560.842 3582.141 3562.597 3597.766 1.35 592.427 605.424 602.195 599.185 620.111 611.206 605.091 1.11
IJRPB 1(6)
www.ijrpb.com
Page 831
Shaheda and Agarwal
Table.4.Recovery data of the proposed Itopride hydrochloride and Rabeprazole sodium Sample Spiked Amount Recovered Amount %Recovered %Average (g/ml) (g/ml) recovery 75 73.98 98.64 Itopride 99.36% hydrochloride 100 98.10 98.10 125 126.69 101.35 10 10.14 101.43 Rabeprazole 101.43% sodium 12 12.22 101.87 14 14.14 100.99
Sample
Itopride hydrochloride
Table.5.Robustness results of Itopride hydrochloride and Rabeprazole sodium Parameters Optimized Used Rt Tailing Plate count
Flow rate (0.2) Wavelength (2 nm) 1ml/min 0.8 1 1.2 207 209 211 0.8 1 1.2 207 209 211 2.583 1.950 1.683 2.050 5.027 2.047 6.637 5.027 4.323 5.237 5.027 5.220 1.62 1.33 2.65 2.07 1.50 2.32 1.61 1.50 1.60 1.56 1.50 2.57 2477 4659 1470 2396 2560 2378 3802 4659 1447 3557 4659 3534
209 nm
Rabeprazole sodium
Flow rate (0.2) Wavelength (2 nm)
1ml/min
209 nm
Table.6.Linearity data of the Itopride hydrochloride and Rabeprazole sodium

sample Itopride hydrochloride Linearity level (g/ml) 25 50 75 100 125 6 8 10 12 14 Peak area 2056.371 2605.348 3483.719 4120.135 4739.482 394.802 512.594 647.862 772.627 891.9 Slope 27.5 Y-intercept 1336 r 0.995
Rabeprazole sodium
62.71
16.84
0.999
Table.7.Limit of Detection and Limit of Quantification Parameter Itopride hydrochloride Rabeprazole sodium Limit of detection(LOD) 4.74g/mL 0.17g/mL Limit of Quantification(LOQ) 14.36g/mL 0.50g/mL
Figure.1.Structure of Itopride hydrochloride
Figure.2. Structure of Rabeprazole sodium
IJRPB 1(6)
www.ijrpb.com
Page 832
Shaheda and Agarwal
Figure.3.Typical chromatogram of blank solution
Figure.4.Typical chromatogram of standard Itopride and Rabeprazole
Figure.5.Typical chromatogram of Itopride hydrochloride and Rabeprazole sodium in marketed formulation

Linearity of Rabeprazole
1000 900 800 700
y = 62.711x + 16.843 R = 0.9995
Area
600 500 400 300 200 100 0 0 2 4 6 8 10 12 14 16
Conc
Figure.6.Linearity of Itopride hydrochloride
IJRPB 1(6)
www.ijrpb.com
Page 833
Shaheda and Agarwal
Indian Journal of Research in Pharmacy and Biotechnology Linearity of Rabeprazole

1000 900 800 700 600 500 400 300 200 100 0 0 2 4 6 8 10 12
y = 62.711x + 16.843 R = 0.9995
Area
14
16
Conc
Figure.7.Linearity of Rabeprazole sodium CONCLUSION A new validated RP-HPLC method has been developed for the quantitative and Qualitative determination of Rabeprazole sodium and Itopride hydrochloride in capsule dosage forms in bulk and pharmaceutical dosage forms was established. The method was completely validated shows satisfactory results for all the method validation parameters tested and method was free from interferences of the other active ingredients and additives used in the formulation. Infact results of the study indicate that the developed method was found to be simple, reliable, accurate, linear, sensitive, economical and reproducible and have short run time which makes the method rapid. Hence it can be concluded that the proposed method was a good approach for obtaining reliable results and found to be suitable for the routine analysis of Rabeprazole hydrochloride and Itopride hydrochloride in Bulk drug and Pharmaceutical formulations. ACKNOWLEDGEMENT The authors would like to thank beloved parents and all my well wishers, one and all who have helped me directly and indirectly in completing this project work. REFERENCES Akkamma H, Sai Kumar S, Sreedhar C, Rao S, Kanagala S, Manogna K, Development and Validation of New Analytical Method for Simultaneous Estimation of Domperidone and Rabeprazole in Pharmaceutical Dosage Forms, Research Journal of Pharmaceutical, Biological and Chemical Science, 3(3), 2010, 705. Padmalatha M, Snehalatha T, Ramya S, Kanakadurga M, A simple and validated RP-HPLC method for the simultaneous estimation of Rabeprazole and Levosulpiride in bulk and pharmaceutical dosage forms, International Research Journal of Pharmaceutical and Applied Sciences, Int. Res J Pharm. App Sci, 2(2), 2010, 99-106 Patel AH, Patel JK, Patel KN, Rajput GC, Rajgor NB, Development and Validation of derivative Spectrophotometric method for Simultaneous estimation Domperidone and Rabeprazole Sodium in bulk and dosage forms, International Journal on Pharmaceutical and Biological Research, 1(1), 2010:1-5. Reddy M, Bodepudi C, Shanmugasundaram P, Method Development and Validation of Rabeprazole in Bulk and Tablet dosage form by RP-HPLC Method, International Journal of ChemTech Research, 3(3), 2011, 1580-1588.
IJRPB 1(6)
www.ijrpb.com
Page 834
Anusha et.al
Formulation and evaluation of herbal anti-dandruff shampoo

Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India *Corresponding author: Email:anupharma88@gmail.com ABSTRACT Dandruff is a common disorder affecting the scalp condition caused by yeast Pityrosporum. Dandruff cannot be completely eliminated but can only be managed and effectively controlled. A shampoo is a preparation containing surfactant (i.e. surface active material) in a suitable form liquid, solid or powder which when used under the specified conditions will remove surface grease, dirt, and skin debris from the hair shaft and scalp without adversely affecting the user. Various anti-fungal agents are employed in hair care preparations for the treatment dandruff. These products show many side effects like loss of hair, increased scaling, itching, irritation, nausea, and headache. Hence an attempt was made to formulate herbal anti-dandruff shampoo which is effective in terms of safety and treating the dandruff condition better than the chemical based anti-dandruff shampoo. Herbal anti-dandruff shampoos were formulated using herbal based ingredients like Lemon Grass Oil, Neem oil, Henna, Aloe Vera gel and other ingredients for preparing base shampoo. The formulated shampoos were subjected to evaluation parameters like visual inspection, pH, viscosity, Percentage of solids contents, Dirt dispersion, Surface tension, Foaming ability and foam stability, anti-fungal activity test using Pityrosporum Ovale strain. Formulation (F8) exhibited good antifungal activity i.e., maximum zone of inhibition. Hence it was subjected to safety studies on animals, such as eye irritation test and skin sensitivity test. The (F8) exhibited good safety without any irritation and sensitivity. Stability studies for a period of three months were conducted for F8 formulation and showed negligible changes in their physicochemical properties. Key words: Dandruff, herbal anti-dandruff shampoo, Pityrosporum ovale. INTRODUCTION Dandruff represents one of the most common dermatological skin conditions and is a chronic, non inflammatory condition of the scalp that is characterized by excessive scaling of scalp tissue. Dandruff is apparently caused by a fungus called Malassezia restricta and M. globosa. Malassezia formerly called Pityrosporum is a yeast causing infection of skin and scalp. It often causes itching. Warm and humid atmosphere, overcrowding and poor personal hygiene are ideally suited for the growth of Malassezia. Dandruff affects 5% of the population and mostly occurs after puberty, between 20-30 years and dandruff affects males more than females. Dandruff occurs exclusively on skin in areas with high levels of sebum. Symptoms of dandruff mainly include itching, flakes; redness of scalp. Dandruff can be treated in two ways, by using herbal based antidandruff shampoo and by using chemical based antidandruff shampoo. A shampoo is a preparation containing surfactant (i.e. surface active material) in a suitable form liquid, solid or powder which when used under the specified conditions will remove surface grease, dirt, and skin debris from the hair shaft and scalp without adversely affecting the user. Most shampoos contain water, a detergent (cleaning agent), surfactant (lather making agent), salt, fragrance (natural and artificial), preservative and food coloring. With the exception of water and salt (sodium chloride), different chemical compounds are used depending on the desired result of the shampoo. Many shampoos also contain vitamins and moisturizing alcohols to prevent too much of the hair and scalp's natural oils from being stripped away during cleansing. Herbal Cosmetics, here in after referred as Products, and are formulated, using various permissible cosmetic ingredients to form the base in which one or more herbal ingredients are used to provide defined cosmetic benefits only, shall be called as Herbal Cosmetics. Herbal drugs or their formulations are viable alternative to synthetic drugs. During the past few decades, there has been a dramatic increase in the use of natural products in cosmetics. Now-a-days, many herbal shampoos are available in the market which contains herbal ingredients such as plant extracts and essential oils. There are large number of plants which are reported to have beneficial effects on hair and are commonly used in shampoos.many herbas such as Hibiscus rosasinensis, Lawsonia inermis, Citrus aurantifolia, Phyllanthus emblica, Ocimum sanctum, Zingiber officinalis, Azadirecta indica, aloe vera have been used as an anti dandruff agents in many shampoo formulations. MATERIALS AND METHODS Lemon Grass Oil, Neem Oil, Aloe Vera Gel, Henna was obtained as a gift samples from cavin care pvt lmtd, Chennai, sodium lauryl sulfate was obtained
IJRPB 1(6)
www.ijrpb.com
Page 835
Anusha et.al
from Cipla Ltd., Daund, glycerine was procured form Signet, Mumbai and EDTA was obtained from Syned Labs Limited, Medak, AP. Preparation of anti-dandruff shampoo: Shampoo was formulated using simple mixing process. Herbal anti-dandruff shampoo was formulated by adding the required amounts of herbal ingredients as given in the formulation table no 1 Evaluation of prepared herbal shampoo: The prepared herbal shampoo formulation should be evaluated for its appearance, pH, viscosity, foaming ability, surface tension, percentage solid content, detergency ability, rheology, dirt dispersion and antifungal activity against pityrosporum ovale. Antifungal activity against Pityrosporum ovale: The herbal anti-dandruff shampoo formulations (F5-F8) were subjected to anti-fungal activity by adopting disc-diffusion method. Potato Dextrose Agar (PDA) medium was used for growing fungus. PDA was prepared with addition of Butter. Dandruff was dissolved in Potato dextrose broth for its further use as
inoculum. The inoculum obtained was serially diluted to 10-6 and 10-7 dilutions and 100l of inoculum was inoculated onto the PDA plate which was spread using an L-Shaped spreader. The Petri plates were then sealed using a parafilm and incubated at 30 degree Celsius for 48 hours to get plates with uniform growth of fungus. Then different dilutions of shampoo as prepared and poured into petriplates and incubated, the growth of fungus were checked at regular intervals. Disk diffusion method was used to check the zone of inhibition for all the dilutions of shampoo. Safety evaluation: Safety is an important aspect of a shampoo; it should be tested by conducting animal studies like eye irritation test and skin sensitization test, using albino rabbits. Stability studies: Stability studies were carried out by placing glass tubes and in humidity chamber at 45Cand 75% relative humidity. And their appearance, physical stability were inspected for a period of 3 months at interval of one month.
RESULTS AND DISCUSSION Table.1.Formulation of herbal anti-dandruff shampoo

Ingredients Neem oil(ml) Lemon Grass Oil (ml) Aloe Vera gel(ml) Henna oil(ml) Sodium lauryl sulfate(gm) Carbopol(gm) Glycerin(ml) Guar gum(gm) Methyl paraben(gm) Propyl paraben(gm) EDTA(gm) Sodium hydroxide Water Perfume Total F1 0.5 0.5 0.5 0.5 6 2.0 1.2 0.180 0.120 To adjust pH
F2 1.0 1.0 1.0 1.0 3.0 1.0 0.60 0.180 0.120 To adjust pH
F3 1.5 1.5 1.5 1.5 1.5 1.0 0.30 0.180 0.120 To adjust pH
F4 2.0 2.0 2.0 2.0 0.75 1.0 0.15 0.180 0.120 To adjust pH
F5 0.5 0.5 0.5 0.5 15 1 0.15

To adjust pH
F6 1.0 1.0 1.0 1.0 10 1 0.15

To adjust pH
F7 1.5 1.5 1.5 1.5 5 1 0.15

To adjust pH
F8 2.0 2.0 2.0 2.0 1 0.15

To adjust pH
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
q.s q.s 100ml
Table 2: Evaluation of Formulations for physical appearance, pH and %Solids

Formulation Appearance pH %solids Surface tension (dy/cm) Cleansing action (%) Dirt dispersion
F5 F6 F7 F8
Off white, good foaming Off white, good foaming Off white, good foaming Off white, good foaming
4.9+0.02 5.1+0.07 5.2+0.02 5.5+0.01
21.10+0.01 23.01+0.05 26.02+0.02 28.05+0.04
30.12+0.02 31.25+0.01 33.17+0.01 34.20+0.01
22.12+0.05 25.02+0.01 27.52+0.03 32.06+0.04
Moderate Light Light None
IJRPB 1(6)
www.ijrpb.com
Page 836
Anusha et.al
Table.3.Evaluation of formulations for viscosity

RPM 0.5 1.0 2.5 5 10 Viscosity(cp F5 82150.00 54150.00 50916.67 25425.00 15775.00 F6 60765.00 42666.66 33350.00 14645.33 8541.00 F7 51516.67 40450.00 28851.66 13651.66 8041.66 F8 17533.33 14916.67 11478.33 9158.33 7766.66
Table.4.Evaluation of Foam Stability of Herbal Shampoo formulations

Time in min 1min 2min 3min 4min 5min Foam volume(ml) F5 176 173 170 169 168 F6 170 168 167 166 165 F7 168 166 165 164 163 F8 156 152 148 142 136
Table.5.Evaluation of Antifungal activity of Herbal Shampoos formulations

Zone of inhibition Marketed product 26.06mm Formulation code F5 F6 10.26mm 18.52mm
F7 25.04mm
F8 27.06mm
Table.6.Evaluation of Stability of Herbal Shampoo formulations

Evaluation parameter Appearance pH Viscosity(cp) % Solids Surface tension (dy/cm) Dirt dispersion Foaming volume(ml) Stability After 1month Off white, good foaming 5.5+0.01 17533.33 28.05+0.04 30.45+0.02 None 136 After 2 months Off white, good foaming 5.5+0.24 17450.02 28.54+0.56 31.22+0.78 None 134 after 3months Off white, good foaming 5.5+0.85 16477.36 29.35+0.11 31.85+0.056 None 130
foam volume(ml)
200 150 100 50 0 1min 2min 3min 4min 5min time (min) Foam volume(ml) F5 Foam volume(ml) F6 Foam volume(ml) F7 Foam volume(ml) F8
Figure.1.Foam Stability of Herbal Shampoo Formulations (F5-F8)
IJRPB 1(6)
www.ijrpb.com
Page 836 837
Anusha et.al
Figure.2.Initial Skin Condition of Albino Rabbit
Figure.3.Skin Sensitivity for F8 after 1hr
Figure.4.Skin Sensitivity for F8 after 2hrs
Figure.5. Skin sensitivity for F8 after 3hrs
Figure.6. Skin sensitivity for F8 after 4hrs
Fig no 7 Initial Eye Condition of Rabbit without Applying Shampoo
Figure.8.Eye Irritation after 30seconds for Formulation F5
Figure.9.Eye Irritation after 30seconds for Formulation F6
Figure.10.Eye Irritation after 30seconds
Figure.11. Eye Irritation after 30seconds for Formulation F8
Figure.12.Antifungal activity of marketed herbal antidandruff shampoo (NIZORAL) against Pityrosporum ovale
Figure.13.Antifungal activity of prepared herbal antidandruff shampoo formulation F8 against Pityrosporum ovale
IJRPB 1(6)
www.ijrpb.com
Page 837 838
Anusha et.al
Total 8 formulations were made. Out of 8 formulations F1, F2 F3, F4 showed consistency, foaming and stability problems. Formulations F5, F6, F7, F8 showed good consistency, foaming. Hence the formulations F5, F6, F7, and F8 were used for further study. The results of visual inspection of formulations are listed in Table 2. All formulations had the good characteristics with respect to foaming. The pH of shampoos has been shown to be important for improving and enhancing the qualities of hair, minimizing irritation to the eyes and stabilizing the ecological balance of the scalp. As seen from Table 2, all the shampoos were acid balanced and were ranged4.9-5.5, which is near to the skin pH. If the shampoo has too many solids it will be hard to work into the hair or too hard to wash out. The result of percent of solids contents is tabulated in table 2, and was found between 21-28%. As a result, they were easy to wash out. It has been mentioned that a proper shampoo should be able to decrease the surface tension of pure water to about 40 dynes/cm12. The reduction in surface tension of water from 72.8 dynes/cm to 34.2 dynes/ cm by the herbal shampoos is an indication of their good detergent action. The results are shown in Table 2. Cleaning action was tested on wool yarn in grease. As seen from the results, there is a significant difference in the amount of sebum removed by the different shampoos. The foam stability of herbal shampoos is listed in table 4. The results of antifungal activity are described in table no 5 and zone of inhibition was shown in fig no 12 and 13. The formulation F8 showed maximum zone of inhibition. Therefore it is concluded that as the concentration of the herbs increased, the zone of inhibition was also increased, hence the formulation F8 was the best formulation for treating dandruff. The same was compared with marketed product, Nizoral antidandruff shampoo containing ketaconazole as an active ingredient and found that the formulated product shows better control over dandruff than the marketed product. Eye irritation for F5 formulation is more compared to other formulation and it is less for F6 and F7. F8 formulation was without any eye irritation. Hence it is safe for use without any side effects. Hence IJRPB 1(6) www.ijrpb.com
the formulation F8 was found to be best for formulation for treating the dandruff as it exhibit maximum zone of inhibition, and without any eye irritation. CONCLUSION The formulation of Anti-dandruff hair shampoo provides a method for treating a scalp dandruff or seborrheic dermatitis. Herbal antidandruff hair shampoo containing 2ml (F8) of herbs concentration of neem oil, lemon grass oil, henna, aloe vera gel with sodium lauryl sulfate base could be used as an effective in treatment of Dandruff on scalp. The formulated shampoos were not only safer than the chemical dandruff agents, but may also greatly reduce the hair loss during combing as well as strengthen the hair growth. The pH of the shampoos was adjusted to 5.5, to retain the acidic mantle of scalp. However, the aesthetic attributes, such as lather and clarity, of the laboratory shampoo are not comparable with the marketed shampoos. REFERENCES Chandrani D, Lubaina SZ and Soosamma M, A review of antifungal effect of plant extract vs. chemical substances against malassezia spp., Int J Pharm Bio Sci, 3(3), 2012, 773 780. Mansuang Wuthi-udomlert, Ployphand Chotipatoomwan, Sasikan Panyadee and Wandee Gritsanapan, Inhibitory effect of formulated lemongrass shampoo on Malassezia furfur: a yeast Associated with dandruff, Southeast asian j trop med public health, 42(2), 2011, 363-369. Naveen S, Karthika S, Sentila R, Mahenthiran R, Michael A, In-vitro evaluation of herbal and chemical agents in the management of Dandruff, J. Microbiol. Biotech. Res., 2 (6), 2012, 916-921. Richa Madhu Sharma, Kinjal Shah, Janki Patel, Evaluation of Prepared Herbal Shampoo Formulations and To Compare Formulated Shampoo with Marketed Shampoos, Int J Pharm Pharm Sci, 3(4), 2011, 402-405. Singla chhavi, Drabu sushma, Ali mohammed, Potential of herbals as an antidandruff agents, 2(3), 2011, 16-18.
Page 835 839
Praveen et.al
Analytical method development and validation for the simultaneous estimation of Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms
V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy. Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India *Corresponding author: praveenpharma786@gmail.com; Phone no: 8985549686. ABSTRACT A simple rapid, accurate, precise and reproducible validated reverse phase HPLC method was developed for the determination of Paracetamol and Tapentadol in bulk and pharmaceutical dosage forms. The quantification was carried out using Thermo hypersil BDS C18 (100 X 4.6 mm, 5 m) column run in isocratic way using mobile phase comprising of Ammonium acetate buffer and methanol in the ratio of 50:50 w/v by adjusting the pH to 6.5(0.5) with orthophosphoric acid and a detection wavelength of 280nm, and injection volume of 10L, with a flow rate of 1.0ml/min. The retention times of Paracetamol and Tapentadol was found to be 1.362 and 2.273. The linearity ranges of the proposed method lies between 0.50 mg/mL to 0.150 mg/mL, which is equivalent to 50% to 150% and with correlation coefficient of r2=1.0 and 0.999 for Paracetamol and Tapentadol . The assay of the proposed method was found to be 101.0% and 98.0%. The recovery studies were also carried out and mean % Recovery was and found to be 99.0% to 99.0%. LOD values for Paracetamol and Tapentadol was found to be 0.22 and 0.64 respectively and LOQ were found to be 0.68 and 1.96 respectively. The % RSD from reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for routine quality control analysis of Paracetamol and Tapentadol in bulk and in Pharmaceutical dosage form. Key Words: Paracetamol,Tapentadol, RP-HPLC, Thermo hypersil BDS C18 (100 X 4.6 mm, 5 m), tablets, validation. INTRODUCTION Paracetamol is (4) N-(4-Hydroxyphenyl) ethanamide /Para-acetylaminophenyl. The molecular weight is 151.169, molecular formula is C8H9NO2. It is used as Anti-pyretic and Analgesic.Tapentadol is 3[(1R, 2R)-3-(dimethylamino)1ethyl-2methylpropyl]HCL. The molecular weight is221.339, molecular formula is C14H23NO. Tapentadol is a synthetic, centrally-acting analgesic that is effective for the treatment of moderate to severe acute or chronic pain. It has a unique dual mode of action as an agonist at the -opioid receptor and as a norepinephrine reuptake inhibitor. As a mu-opioid agonist, it binds to and activates -opioid receptors in the central nervous system. It modifies sensory and affective aspects of pain, inhibits the transmission of pain at the spinal cord and affects activity at parts of the brain that control pain perception. Literature review reveals very few methods are reported for the assay of Paracetamol and Tapentadol in Tablet dosage forms using RP-HPLC method. The reported HPLC methods were having disadvantages like high flow rate, more organic phase and use of costly solvents. The proposed RP-HPLC method utilizes economical solvent system and having advantages like better retention time, less flow rate, very sharp and symmetrical peak shapes. The aim of the study was to develop a simple, precise, economic and accurate RP-HPLC method for the estimation of Paracetamol and Tapentadol in Tablet dosage forms. MATERIALS AND METHODS UV-3000 LABINDIA double beam with UV win 5software UV-VISIBLE spectrophotometer with 1cm matched quartz cells. Schimadzu HPLC equipped with SPD 20A UV-VIS detector and the column used was THERMO HYPERSIL BDS C18 (100*4.6mm,5).The data acquisition was performed by using LC solutions software. Chemicals and reagents: Paracetamol and Tapentadol pure samples were obtained from Laurus laboratories, Hyderabad, India and dosage form Lazid-E marketed by EMCURE was purchased from local pharmacy. Other chemicals all are of HPLC grade.
IJRPB 1(6)
www.ijrpb.com
Page 840
Praveen et.al
Figure.1.Structure of Paracetamol
Preparation of mobile phase: A suitable quantity of degassed mixture of methanol and water in the ratio of 65:35 v/v was prepared and filtered through 0.45 filter under vacuum filtration. Preparation of standard solution: Accurately weighed and transfer about 32.50 mg of Paracetamol and 5 mg of Tapentadol in 100 ml volumetric flask, add to it about 50 ml of diluents and sonicate to dissolve, dilute up to the mark with diluents and mix well. Transfer above solution in to 5ml in to 50 ml of volumetric flask dilute to volume with diluent.Filter the solution through Nylon filter 0.45, The final concentrations will be0.0325 mg/ml for Paracetamol, 0.005 mg/ml for Tapentadol. Preparation of sample solution: A powder quantity equivalent to 610mg was accurately weighed and transferred to a 100ml volumetric flask and 50ml of diluent was added to the same. The flask was sonicated for 30 min and volume was made up to the mark with diluent. Transferred 5ml of solution into a 50ml volumetric flask and dilute up to the mark with diluent so as to obtain a concentration of 610 g/mL mixed well and injected. The amount present in each tablet was calculated by comparing the area of standard Paracetamol ,Tapentadol and tablet sample. Method development: Method optimization: The chromatographic separation was performed using column Thermo hypersil BDS C18 (100*4.6mm, 5). For selection of mobile phase, various mobile phase compositions were observed for efficient elution and good resolution. The mobile phase consisting of Ammonium acetate buffer:Methanol (50:50) by adjusting the pH to 6.5(0.5) with ortho phosporic acid was found to be the optimum composition for efficient elution of analyte. The mobile phase was injected to the column at a flow rate of 1.0 ml/min for 4min. The column temperature was maintained at 35oC. The analyte was monitored at 280 nm using UV-detector. The retention time of the drugs was found to be 1.362 and 2.76. Mobile phase was used as diluent during the standard and test samples preparation.
Figure.2.Structure of Tapentadol
RESULTS Method validation: System suitability: System suitability tests are an integral part of method validation and are used to ensure adequate performance of the chromatographic system. Retention time (RT), number of theoretical plates (N) or column efficiency and tailing factor (T) were evaluated for five injections of standard solution at a solution of 100g/ml of paracetamol and Tapentadol. Specificity: Specificity is the ability of analytical method to measure accurately and specifically the analyte in the presence of components that may be expected to be present in the sample. The specificity of method was determined by spiking possible impurities at specific level to standard drug solution (100ppm). The diluent and placebo solutions were also injected to observe any interference with the drug peak. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of Paracetamol and Tapentadol was in the concentration range of 50-150%.From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 1for Paracetamol and 0.999 for Tapentadol shows good linearity for three drugs. Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (50%,100% ,150%) at three different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. Precision: The precision of the analytical method was studied by analysis of multiple sampling of homogeneous sample. It is expressed as standard deviation or relative standard deviation. Precision was measured in terms of repeatability of application and
IJRPB 1(6)
www.ijrpb.com
Page 841
Praveen et.al
measurement. Study was carried out by injecting six replicates of the same sample preparations at a concentration of 0. 61mg/mL. Method precision: Method precision was performed by analyzing a sample solution of Paracetamol and Tapentadol at working concentrations six times (Six individual sample preparations). Robustness: Robustness shows the reliability of an analysis with respect to deliberate variations in method parameters. If measurements are susceptible to variations in analytical conditions, the analytical conditions should be suitably controlled or a precautionary statement should be included in the procedure. System suitability: From the system suitability studies it was observed that retention time of Paracetamol and Tapentadol was found to be 1.362 and 2.273min. % RSD of peak area was found to be 0.7 and 1.0. Theoretical plates were found to be more than 4000. USP tailing factor was found to be 1.334 and 1.129 for Paracetamol and Tapentadol. All the parameters were within the limit. Specificity: The Chromatograms of Standard and Sample are identical with nearly same Retention time.
Column Mobile phase Flow rate Wavelength Injection volume Column temperature Run time Sample cooler
There is no interference with blank and placebo to the drugs. Hence the proposed method was found to be specific. Linearity: From the Linearity data it was observed that the method was showing linearity in the concentration range of 50-150g/ml for Paracetamol and Tapentadol. Correlation coefficient was found to be 1 and 0.999 for two compounds. Accuracy: The recoveries of pure drug from the analyzed solution of formulation were in the range of 99.3%-101.6%, which shows that the method was accurate. Precision: The percentage relative standard deviation (RSD) for the peak area of paracetamol and tapentadol were 0.4 and 1.3. Robustness: As the % RSD of retention time and asymmetry were within limits for variation in flow rate ( 0.1 ml). Hence the allowable flow rate should be within 0.9 ml to 1.1 ml. As the % RSD of retention time and asymmetry was within limits for variation (+ 20C) in column oven temperature. Hence the allowable variation in column oven temperature is + 20C. The results obtained were satisfactory and are in good agreement as per the ICH guidelines.
Table.1.Optimized chromatogram conditions for Paracetamol and Tapentadol

Thermo hypersil BDS C18 (100*4.6mm,5) Ammonium acetate buffer: Methanol (50:50) 1 ml/ min 280 nm 10 l 35o C 4 min 25o C
Table.2.System suitability Data for Paracetamol and Tapentadol

S.No 1 2 3 4 5 Average SD %RSD Theoretical plates Tailing factor Retention time Paracetamol Peak area 2369806 2352610 2364950 2396542 2369554 2370692 16049 0.7 4428 1.334 1.362 Tapentadol Peak area 206088 200880 204747 204226 205778 204344 2078 1.0 4194 1.129 2.276
Table.3. Specificity Data for Paracetamol and Tapentadol

Name of the solution Blank Paracetamol Tapentadol Retention time in min No peaks 1.36 2.27
IJRPB 1(6)
www.ijrpb.com
Page 842
Praveen et.al
Table.4. Linearity Data for Paracetamol and Tapentadol

Paracetamol Level Con. (mg/ml) Peak area 1199804 1787490 2383485 2985724 3575403 60155 23856 1.0 Tapentadol Con. (mg/ml) 2.5 3.75 5.0 6.25 7.5 Peak area 106313 153382 201678 251788 302257 55995 2023 0.999
50% 16.25 75% 24.37 100% 32.5 125% 40.62 150% 48.75 Slope Intercept Correlation coefficient
Table.5.Accuracy Data for Paracetamol and Tapentadol

% Level 50% Amount Added ( g/ml) 162.500 160.902 161.967 163.033 160.902 163.033 325.000 325.533 325.000 479.508 480.574 482.705 481.639 479.308 480.574 Area 1197918 1191018 1195828 1191389 1196479 1198386 2395924 2353829 2364429 3572403 3579690 3574256 3573376 3564202 3573106 Amount Founded ( g/ml) 162.58 161.64 162.30 161.70 162.39 162.64 325.17 319.45 320.90 484.85 485.84 485.10 484.98 483.73 484.94 % recovery 100 100 100 99 101 100 100 98 99 101 101 100 101 101 101 % Mean 100
100
99
150
101
Table.6.Precision Data for Paracetamol and Tapentadol

S.No 1 2 3 4 5 6 Average SD % RSD Paracetamol Assay (%) 101.0 100.0 101.0 100.0 100.0 100.0 100.0 9409 0.54 RT 1.359 1.360 1.360 1.360 1.361 1.361 Tapentadol Assay (%) 98.0 101.0 98.0 98.0 100.0 98.0 99.0 2707 1.36 RT 2.259 2.260 2.260 2.263 2.261 2.262 -
Table.7.Variation in flow rate and temperature of Paracetamol

Parameter Increased flow rate Actual flow Decreased flow rate Increased temperature Actual temperature Decreased temperature Rt (Min) 1.137 1.362 1.693 1.361 1.359 1.362 Peak Area 2029076 2395429 3094749 2454401 2369554 2424044 Column Efficiency 4255 4364 4737 4420 4466 4384 Tailing Factor 1.268 1.331 1.325 1.274 1.303 1.291
IJRPB 1(6)
www.ijrpb.com
Page 843
Praveen et.al
Table.8.Variation in flow rate and temperature of Tapentadol

Parameter Increased flow rate Actual flow Decreased flow rate Increased temperature Actual temperature Decreased temperature Rt (Min) 1.884 2.267 2.806 2.243 2.273 2.255 Peak Area 176068 200880 270335 220414 206088 209903 Column Efficiency 4028 4716 5302 4681 4194 4721 Tailing Factor 1.184 1.245 1.143 1.117 1.129 1.127
Figure.3.Standard chromatogram
Figure.4.Sample chromatogram
Figure.5.Chromatogram for Specificity
Figure.6.Chromatogram for Systemsuitability
Figure.7.Linearity plot for Paracetamol CONCLUSION Finally it concludes that all the parameters are within the limits and meet the acceptance criteria of ICH guidelines for method validation. The proposed method was simple, accurate, specific, precise, robust, rugged and economical. Hence this method is validated and can be used for routine sample analysis. ACKNOWLEDGEMENT The authors thankful to Mr. Satyanarayana Goud (Research scientist-II), Mr. Murthy (G.M), Laurus Laboratories for providing necessary facilities to carry out the research work.
Figure.8.Linearity plot for Tapentadol
REFERENCES
Bhupendrasinh M Rao, Patel Bimal, Nurrudin Jivani, Kumar Digbijay, Solanki Nitin, RP-HPLC method for the simultaneous estimation of Paracetamol and Tapentadol in tablet dosage form, Pharm Analysis & Quality Assurance, 15(15), 2013, 1756-1763. Dharmishtha N Bhakhar, Ashok R Parmar, Hitesh J Vekaria, Chetana D Ribadiya, Chandani, RP-HPLC method for the simultaneous estimation of Paracetamol and Tapentadol in tablet dosage forms, Pharm Analysis & Quality Assurance, 2(15), 2013, 353-362.
IJRPB 1(6)
www.ijrpb.com
Page 844
Praveen et.al
Samil D Desai, Bhavna A.Patel, Shraddha J Parmar, Naitik N, Champaneri, Spectrophotometric method for Simultaneous estimation of Paracetamol and Tapentadol Hydrochloride by employing first order derivative zero crossing method in 0.1 N Sodium Hydroxide, International Journal of Pharmaceutical sciences and Research, 5(4), 2013, 1777-1781.
Shailesh V. Malaviya, Dharmishtha N. Bhakhar, Kavita N. Golakiya, Nehal H. Kothadiya, Hitesh J. Vekaria, Ashok R. Parmar, Gunjan N. Pandya, Shruti D. Dobariya, High performance thin layer chromatographic method has been developed for the simultaneous determination of Tapentadol Hydrochloride (TAPE) and Paracetamol (PCM) in pharmaceutical dosage form, Indo American Journal of Pharmaceutical Research, 4(3), 2013, 117-122.
IJRPB 1(6)
www.ijrpb.com
Page 845
Radha et.al
Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and Gentamycin induced nephrotoxicity in Albino rats
Radha.B,* Janarthan M, Durraivel S Nimra College of Pharmacy,Vijayawada, Andhra Pradesh, India *Corresponding author: radhaborra4u@gmail.com, 9160508071 ABSTRACT The nephroprotectic effect of Methanolic extract of Polygonum glabrum willd was studied in Cisplatin,Gentamycin induced Albino Rats. Oral administration of extract to albino rats [200mg/kg and 400mg/kg for 14, 8 days] produced significant (p<0.01) in animals treated with extract dependent manner, when compared to control drugs(cis platin 12mg/kg andgentamycin 80mg/kg). Treatment with extract 200mg/kg and 400mg/kg showed significant (P<0.01) improvement in body weight and serum and urine urea,uric acid,total protein,creatinine, when compared to nephroprotective control. Histopathological studies also confirmed biochemical findings. Thus our study shows that Methanolic extract of polygonum glabrum willd (200mg/kg and 400mg/kg) significantly improves the nephroprotectic activity Key words: Polygonum glabrum willd, Methanolic extract, Cisplatin, Gentamycin. INTRODUCTION Nephrotoxicity is a poisonous effect of some substances, both toxic chemicals and medication, on the kidney. There are various forms of toxicity. Nephrotoxicity should not be confused with the fact that some medications have a predominantly renal excretion and need their dose adjusted for the decreased renal function (e.g. heparin). Several drugs are nephrotoxic. Reactions to drugs and other compounds are relatively common and have been described for many substances. They are commonly associated with renal dysfunction although the actual incidence of drug-induced renal failure has not been reported, since incidence is complicated by the complexity of the causes of ARF in seriously ill patients. Nephrotoxicity arises through several mechanisms, including general and local vascular effects, direct effects on renal tubules, tubular obstruction and acute interstitial nephritis. Acute glomerulonephritis can also occur although this less common MATERIALS AND METHODS Materials: All chemicals were of analytical grade and obtained locally. Serum urea,uric acid,creatinine,total protein kit were procured from Robonik diagnostics, Hyderabad, India. Plant material: The fresh plant polygonum glabrum willd was collected from Kolli hills and foot hill of Yercaud, Tamilnadu, India. Identification of the plant was done by Dr. K.Madhava Chetty assistant professor, department of botany, Sri Venkateswara University, Tirupati, A.P, India. Animals: Albino rats weighing 180-250g were selected and housed in polypropylene cages in a room where the congenial temperature was 27C 1C and 12 hrs light and dark cycles were maintained. Each of these treatment groups consisted of six animals/group. The protocol of this study was approved by the Institutional Animal Ethics Committee (IAEC) constituted under Committee for Purpose of Control and Supervision of Experiments on Animals (CPCSEA). Preparation of the extract: The whole plant were isolated, chopped into small pieces and dried under shade at room temperature for seven days. The dried plant were powdered and passed through the sieve (coarse 10/44). This powder was used for the preparation of methanolic extract. Methanolic extract: Methanolic extract was prepared by Heat Soxhlet extractor. The dried coarse powdered of plant (250 gm) were transferred to a round bottom flask, 75% of methanol was added to the flask and soaked for 2 hours. This was then boiled for 4 hours. The extract so obtained was decanted in a beaker and then concentrated to 1/6th of the total volume on a water bath. This was preserved by adding a few drops of chloroform and kept in the refrigerator. This extract was administered to the animals by making the concentration required. By weighing the water-evaporated extract (24.5% yield). The extract was assigned a code name MEPG (methanolic extract of polygonum glabrum) Experimental protocol: In order to induce at nephrotoxicity, the method was followed. The animals were divided into four groups of six rats each Group I: Normal animals Group II: control animals (Cisplatin, Gentamycin) Group III: control drugs+ extract (200mg/kg/day) Group IV: control drugs+ extract (400 mg/kg/day). At the end of the treatment the rats were sacrificed on
IJRPB 1(6)
www.ijrpb.com
Page 846
Radha et.al
15 and 9 day. Serum was separated and stored in refrigerator until assay Experimental protocol: In order to induce at nephrotoxicity, the method was followed. The animals were divided into four groups of six rats each Group I: Normal animals Group II: control animals (Cisplatin, Gentamycin) Group III: control drugs+ extract (200mg/kg/day) Group IV: control drugs+ extract (400 mg/kg/day). At the end of the treatment the rats were sacrificed on 15 and 9 day. Serum was separated and stored in refrigerator until assay
Measurement of various Parameters: Physical Parameters: The body weight was recorded on the first day and then last day of the study period in each group. Biochemical Estimations: Serum urea, uric acid, creatinine, total protein kit were procured from Robonik diagnostics, animals were taken and blood was collected from retro orbital plexus under light ether anesthesia, centrifuged at 2500 rpm for 20 minutes. The serum obtained will be kept at 4oC until used then sacrificed the rats and remove the kidneys for histopatological evaluation.
RESULTS AND DISCUSSION

Table.1. Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on serum creatinine, blood urea and serum uric acid,total protien in treated rats for 14 days (serum parameters)
Treatment groups Normal Control T1 T2 Creatinine mg/dl 0.333+0.309 26.70+11.23a 2.09+0.878*** 1.205+0.509*** Total protein mg/dl 7.313+3.118 3.495+1.590a 5.316+2.27*** 4.065+1.750** Uric acid mg/dl 3.223+1.469 8.43+3.556a 5.58+2.496*** 4.075+1.689*** Urea mg/dl 40.52+16.69 65.06+26.86a 28.58+12.04*** 24.59+10.27***
All the values are mean+SEM,n=6,ns=not significant (ANOVA) one way analysis of variance followed by the multiple comparision of the Dunnetts test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
Table.2.Effect of 12 mg/kg/day intraperitoneal cis platin and graded oral PG on urine creatinine; urine urea and urine uric acid,total protien in treated rats for 14 days (Urine parameters)
Treatement groups Normal Control T1 T2 Creatinine mg/dl 0.886+0.395 2.598+1.166a 1.383+0.594*** 1.088+0.454*** Total protein mg/dl 8.85+3.73 18.23+7.47a 11.228+4.605*** 9.2233+.789*** Uric acid mg/dl 22.285+9.21 55.03+26.58a 32.23+13.32*** 29.23+11.95*** Urea mg/dl 25.18+10.38 61.21+25.07a 35.05+14.43*** 30.07+12.47***
All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision of the Dunnetts test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
Table.3.Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on serum creatinine; blood urea and serum uric acid,total protien in treated rats for 8 days (Blood parameters)
Treatment Groups Normal Control Polygonum glabrum(T1) Polygonum glabrum(T2) Creatinine mg/dl 0.205+0.0093 11.35+0.0981a 0.215+0.0043*** 3.23+0.2460*** Total protein mg/dl 6.44+0.224 4.15+0.163a 6.7+0.268*** 5.35+0.151* Uric acid mg/dl 3.77+0.168 7.5+0.116a 3.166+0.339*** 5.19+0.278*** Urea mg/dl 45.305+0.130 63.29+0.126a 45.07+0.202*** 57.12+1.458***
All the values aree mean+ SEM,n=6,ns=not significant,(ANOVA) one way analysis of variance followed by the multiple comparision of the Dunnetts test, p<0.005, p<0.001, and p<0.001 v/s control and ap<0.001,bp<0.001 and cp<0.05 v/s normal group
Table.4. Effect of 80 mg/kg/day intraperitoneal gentamycin and graded oral PG on urine creatinine; urine urea and urine uric acid,total protien in treated rats for 8days (Urine parameters (gentamycin))
Treatment groups Normal Control T1 T2 Creatinine mg/dl 6.496+0.188 2.315+0.325a 6.455+0.188*** 7.243+0.2406*** Total protein mg/dl 3.36+1.53 10.48+4.45a 7.88+3.35*** 4.08+1.960*** Urea mg/dl 59.85+2.507 95.06+38.85a 78.03+31.92*** 65.05+26.62*** Uric acid md/dl 0.565+0.052 2.666+0.159a 1.153+0.1485*** 0.761+0.0576***
All the values are mean+SEM,n=6,ns=not significant(ANOVA) one way analysis of variance followed by the multiple comparision of the Dunnetts test,*p<0.05,**p<0.01and***p<0.001 v/s control and ap<o.001,bp<0.01nd cp<0.05 v/s normal group
IJRPB 1(6)
www.ijrpb.com
Page 847
Radha et.al
Effect of administration of Methanolic extract of polygonum glabrum willd (200 and 400mg / kg once daily for 14, 8days)/ Cisplatin (12mg /kg/day) Gentamycin (80mg/kg/day) on Histopathological changes in aorta of rats 14, 8 days: Group1: Section studied shows renal parenchyma with intact normal architecture. The glomerular and tubular changes appear unremarkable. Some of the blood vessels are dilated and congested within the interstitium. Also few scattered mononuclear inflammatory infiltration is seen within the interstitium. Important Highlights: Some blood vessels show congestion Group2: Section studied shows renal parenchyma with intact architecture. There are seen diffuse glomerular congestion, focal hydropic degeneration of the tubular epithelial cells and peritubular congestion. Some of the tubules show partial desquamation of the epithelial cells. Also seen are blood vessel congestion and scattered mononuclear inflammatory cell infiltrations within the interstitium. Important Highlights: Diffuse glomerular congestion, Tubular casts. Group3: Section studied shows renal parenchyma with intact architecture. There is seen focal glomerular congestion. Few the tubular epithelial cells show hydropic degeneration and peritubular congestion. Also seen are few scattered mononuclear inflammatory cell infiltrations within the interstitium. Important Highlights: Focal glomerular congestion, Peritubular congestion Group 4: High fatty die Section studied shows renal parenchyma with intact architecture. The glomerular and tubular changes appear unremarkable. Some of the blood vessels are dilated and congested. Within the interstitium, also seen are few scattered mononuclear inflammatory infiltration is seen within the interstitium. Due to cisplatin administration, platinumsulphydryl group complexes formed are taken up by renal cells and stabilized by intracellular GSH for several hours. In case of intracellular GSH depletion, the complexes undergo rapid transformation to reactive metabolites28. Thus GSH depletion results in increased toxicity of cisplatin.The use of gentamicin, an aminoglycoside antibiotic with a wide spectrum of activities against Gram-positive and Gram-negative bacterial infections but with high preference for latter is equally associate with
nephrotoxicity as its side effect. Thus gentamicin induced nephrotoxicity is well established experimental model of drug induced renal injury. Many animal experiments have demonstrated overwhelmingly, the positive correlation between oxidative stress and nephrotoxicity. Gentamicin induced nephrotoxicity by causing renal phospholipidosis through inhibition of lysosomal hydrolases such as sphingomylinase and phospholipases in addition to causing oxidative stess. Nephrotoxic activity can be lowered significantly with extract of polygonum glabrum. CONCLUSION In case of cis platin treated group there will be rise in serum marker such as urea, uric acid and creatinine and decrease in the level of protein. The same is observed in kidney diseases in clinical practice and hence are having diagnostic importance in the assessment of kidney function. In the present study, the stem extract of polygonum glabrum significantly reduced the toxicant elevated levels of above mentioned serum markers and increase in the levels of protein. Hence, at this point it is concluded that the extract of polygonum glabrum offers nephroprotection. In gentamicin treated animals there will be found glomerular, peritubular and blood vessel congestion and result in presence of inflammatory cells in kidney sections. The same is observed in case of humans who are suffering from major kidney disorders. In the present study, the extract of polygonum glabrum treated group animals were found to reduce such changes in kidney histology induced by gentamicin, indicating nephroprotection. Further documented reports reveal that, plant material containing phenols, flavonoids, alkaloids and saponins offers organ protection by virtue of their free radical scavenging activity ACKNOWLEDGEMENT Authors are grateful to Dr. Durivel, head of the institution, Dr. Janardhan, head of the department, Nimra College of pharmacy. REFERENCES George JK, Enrique PM, Aminoglycoside nephrotoxicity, Kidney Int, 8, 1980, 571 -582. Jones S and Janardhanan KK, Antioxidant and antitumor activity of Ganoderma lucidum (Curt. Fr.) P. Karst-Reishi (Aphyllophoromycetideae) from South India, Int. J. Med. Mushr, 2000, 195200.
IJRPB 1(6)
www.ijrpb.com
Page 848
Radha et.al
Leelavathy, K. M. and Ganesh, P. N., Polypores of Kerala, Daya Publishing House, Delhi, 2000, 166. Shiao M, Lee K R, Lin L J and Wang C T, Natural productsand biological activities of the Chinese medicinal fungus Ganoderma lucidum in Food
Phytochemicals II. Teas, Spices and Herbs, American Chemical Society, Washington DC, 1994, 342354. Vijay KK, Naidu MUR, Shifow AA, Ratnakar KS, Nephroprotective and antioxidant activity of ehanolic extract of the bark of Madhuca longifolia (koenig), Indian J Pharmacol, 32, 2000, 108.
IJRPB 1(6)
www.ijrpb.com
Page 849
Radha et.al
Analytical method development and validation for the simultaneous estimation of Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid chromatography
M. Sumalatha, K.Haritha Pavani Nimra College of Pharmacy, Vijayawada, A.P, India *Corresponding author: Email: maddineni51@gmail.com, Phone +91-9494899371 ABSTRACT A new, simple, precise, accurate and reproducible RP-HPLC method for Simultaneous estimation of Rosuvastatin (ROS) and Fenofibrate (FEN) in bulk and pharmaceutical formulations was developed. Separation of ROS and FEN was successfully achieved on a Hypersil C18 (4.6 x 250mm, 6.5 m, Make: Waters) or equivalent in an isocratic mode utilizing OPA buffer (pH 3.0): Methanol (65:35%v/v) at a flow rate of 1.2 mL/min and eluate was monitored at 238 nm, with a retention time of 1.950 and 3.858 minutes for ROS and FEN. The method was validated and the response was found to be linear in the drug concentration range of 50 g/mL to 150 g/mL for ROS and 50 g/mL to 150 g/mL for FEN. The values of the slope, intercept and the correlation coefficient were found to be 2 2 507, 7467 and 0.999 for ROS and 21157, 16980 and 0.999 for FEN respectively. The LOD and LOQ for Rosuvastatine were found to be 0.0053, 0.017 respectivly. The LOD and LOQ for Fenofibrate were found to be 0.00019, 0.00063 respectively. This method was found to be good percentage recovery for Rosuvastatine and Fenofibrate were found to be 99.00 and 99.00 respectively indicates that the proposed method is highly accurate. The specificity of the method shows good correlation between retention times of standard with the sample so, the method specifically determines the analyte in the sample without interference from excipients of tablet dosage forms. The method was extensively validated according to ICH guidelines for Linearity, Range, Accuacy, Precesion, Specificity and Robustness. Key words: Rosuvastatin, Fenofibrate, High performance liquid chromatography. INTRODUCTION Rosuvastatin (3R, 5S, 6E) 7 - [4 - ( 4 fluorophenyl ) 2 ( N - methylmethanesulfonamido ) 6 - (proan-2-yl) pyrimidine-5-yl ] - 3, 5dihydoxyhept-6-enoic acid. Rosuvastatin is an antilipidemic agent that competitively inhibits hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase.HMG-CoA reducuase catalyzes the conversion of HMG-CoA to mevalonic acid, the ratelimiting step in cholesterol biosynthesis. Rosuvastatin belongs to a class of medications called Statins and is used to reduce plasma cholesterol levels and prevent cardiovascular disease. Fenofibrate propan - 2 - yl2 - {4 - [(4chlorophenyl) carbonyl] phenoxy} 2methylpropanoate is an antilipidemic agent which reduces both cholesterol and triglycerides in the blood. Fenofibrate exerts its therapeutic effects through activation of peroxisome proliferator activated receptor a (PPARa). This increases lipolysis and elimination of triglyceride-rich particles from plasma by activating lipoprotein lipase and reducing production of apoprotein C-III. The resulting fall in triglycerides produces an alteration in the size and composition of LDL from small, dense particles, to large buoyant particles. These larger particles have a greater affinity for cholesterol receptors and are catabolized rapidly. Literature survey revealed that very few methods have been reported for the analysis of Rosuvastatin and Fenofibrate combinational dosage forms which include UV spectroscopy, Reverse Phase High performance Liquid Chromatography, Densitometric method, HPTLC methods. The present study illustrate development and validation of simple, economical, selective, accurate, precise RP-HPLC method for the determination of Rosuvastatin and Fenofibrate in bulk and Pharmaceutical dosage forms as per ICH guidelines. The goal of this study is to develop rapid, economical HPLC method for the analysis of Rosuvastatin and Fenofibrate in combined dosage form using most commonly employed column (C18) and simple mobile phase preparation. In the present proposed work a successful attempt had been made to develop a method for the simultaneous estimation of Rosuvastatin and Fenofibrate pharmaceutical dosage form and validate it. From the economical point of view and for the purpose of routine analysis, it was decided to develop a more economical RP-HPLC method with simple mobile phase preparation for the estimation of Rosuvastatin and Fenofibrate combinational dosage form. The method would help in estimate of drugs in single run
IJRPB 1(6)
www.ijrpb.com
Page 850
Radha et.al
which reduces the time of analysis and does not require separate method for each drug. Thus, the paper reports an economical, simple and accurate RP-HPLC method for the above said pharmaceutical dosage forms. MATERIALS AND METHODS Quantitative HPLC was performed on a high performance liquid chromatograph -Waters e2695Alliance HPLC system connected with PDA Detector 2998 and Empower2 Software. The drug analysis data were acquired and processed using Empower2 software running under Windows XP on a Pentium PC and Hypersil ODS C18 column of dimension 250 4.6, 5m particle size. In addition an analytical balance (DENVER 0.1mg sensitivity), digital pH meter (Eutech pH 510), a sonicator (Unichrome associates UCA 701) were used in this study. Standards and chemicals used: The reference samples of Rosuvastatin and Fenofibrate standards were kindly supplied as gift samples by Dr.Reddys., Hyderabad, Andhra Pradesh, India. All the chemicals were analytical grade.ortho phosphoric acid from Dr.Reddys., Hyderabad,Andhra Pradesh, India, while Methanol (HPLC grade) and Water (HPLC grade) from Merck Pharmaceuticals Private Ltd., Mumbai, India. Rosuvastatin and Fenofibrate Tablets available in the market as RosvasF (J.B. Chemicals & Pharmaceuticals Ltd.) in composition of Rosuvastatin (190mg), Fenofibrate (6mg). Preparation of mobile phase: Transfer 1000ml water into 1000ml of beaker.Then adjust its pH-3.0 with Ortho phosphoric acid (OPA) and filtered through 0.45 membrane filter and degassed by sonication. Preparation of calibration standards:Rosuvastatin 6mg and 190mg Fenofibrate was taken into a 10, 25ml of volumetric flask and add 10ml of Diluent and sonicated for 10 minutes and made up with Diluent. It was further diluted to get stock solution of Rosuvastatin and Fenofibrate.This is taken as a 100% concentration. Working standard solutions of Rosuvastatin and Fenofibrate was prepared with mobile phase. To a series of 10 ml volumetric flasks, standard solutions of Rosuvastatin and Fenofibrate in the concentration range of 50- 150g/ml were transferred respectively. System suitability: System suitability is an integral part of chromatographic system. To ascertain its effectiveness, certain system suitability test parameters were checked by repetitively injecting the drug solutions at 100% concentration level for
Rosuvastatin and Fenofibrate to check the reproducibility of the system. At first the HPLC system was stabilized for 40 min. One blank followed by six replicate analysis of solution containing 100% target concentration of Rosuvastatin and Fenofibrate were injected to check the system suitability. To ascertain the system suitability for the proposed method, a number of parameters such as theoretical plates, peak asymmetry, and retention time were taken and results were presented in Table 1. Calibration curves for Rosuvastatin and Fenofibrate: Replicate analysis of solution containing 50-150g/mL of Rosuvastatin and Fenofibrate sample solutions respectively were injected into HPLC according to the procedure in a sequence and chromatograms were recorded. Calibration curves were constructed by plotting by taking concentrations on X-axis and ratio of peak areas of standards on Yaxis and regression equation were computed for both drugs and represented in Table .6 Analysis of marketed formulation: The content of ten tablets was weighed accurately. Their average weights were determined. Powder of tablets equivalent to one tablet weight (488mg) were weighed and taken in a 50 ml volumetric flask, dissolved in diluents, shaken and sonicated for about 20 minutes then filtered through 0.45 membrane filter. The filtered solution was further diluted (5 to 50ml) in the diluents to make the final concentration of working sample equivalent to 100% of target concentration. The prepared sample and standard solutions were injected into HPLC system according to the procedure. From the peak areas of Rosuvastatin and Fenofibrate the amount of the drugs in the sample were computed. The contents were calculated as an average of six determinations and experimental results were presented in Table 4. The representive standard and sample chromatograms were shown in fig.2 and fig.3. Validation study of Rosuvastatin and Fenofibrate: An integral part of analytical method development is validation. Method validation is the process to confirm that the analytical procedure employed for a specific test is suitable for its intended use. The newly developed RP-HPLC method was validated as per International Conference on Harmonization (ICH) guidelines for parameters like specificity, system suitability, accuracy, linearity, precision (repeatability), limit of detection (LOD), limit of Quantification (LOQ) and robustness. Specificity: The effect of wide range of excipients and other additives usually present in the formulation
IJRPB 1(6)
www.ijrpb.com
Page 851
Radha et.al
of Rosuvastatin and Fenofibrate in the determination under optimum conditions were investigated. The specificity of the RP-HPLC method was established by injecting the mobile phase and placebo solution in triplicate and recording the chromatograms. Precision: precision study of sample (Rosuvastatin and Fenofibrate) was carried out by estimating corresponding responses 6 times on the same day for the 100% target concentration. The percent relative standard deviation (%RSD) is calculated which is within the acceptable criteria of not more than 2.0. Linearity: The linearity graphs for the proposed assay methods were obtained over the concentration range of 50-150g/ml Rosuvastatin and Fenofibrate respectively. Method of least square analysis is carried out for getting the slope, intercept and correlation coefficient, regression data values. The representative chromatograms indicating the sample were shown in fig.2&3. A calibration curve was plotted between concentration and area response. Accuracy (Recovery studies): The accuracy of the method is determined by calculating recovery of Rosuvastatin and Fenofibrate by the method of addition. Known amount of Rosuvastatin and Fenofibrate at 50%, 100%, 150% is added to a pre quantified sample solution. The recovery studies were carried out in the tablet in triplicate each in the presence of placebo. The mean percentage recovery of Rosuvastatin and Fenofibrate at each level is not less than 98% and not more than 102%. Robustness: The robustness is evaluated by the analysis of Rosuvastatin and Fenofibrate under different experimental conditions such as making small changes in flow rate (0.2 ml/min), max (5), column temperature (5), mobile phase composition (5%), and pH of the buffer solution. LOD and LOQ: Limit of detection is the lowest concentration in a sample that can be detected but not necessarily quantified. Under the stated experimental conditions, the limit of quantification is the lowest concentration of analyte in a sample that can be determined with acceptable precision and accuracy. Limit of detection and limit of quantification were calculated using following formula LOD=3.3(SD)/S and LOQ=10(SD)/S, where SD= standard deviation of response (peak area) and S= average of the slope of the calibration curve. RESULTS AND DISCUSSION Reverse phase HPLC method was preferred for the determination of Rosuvastatin and Fenofibrate.
Preliminary experiments were carried out to achieve the best chromatographic conditions for the simultaneous determination of the drug substances. Several column types and lengths were tried considering other chromatographic parameters. C18 column with a 4.6 mm inner diameter and 5m particle size was chosen. The detection wave length was selected as 238nm with PDA detector. Chromatographic conditions were optimized by changing the mobile phase composition and buffers used in mobile phase. Different experiments were performed to optimize the mobile phase but adequate separation of the drugs could not be achieved. By altering the pH of buffer results a good separation. Different proportions of solvents were tested. Eventually the best separation was obtained by the isocratic elution system using a mixture of OPA buffer, Methanol in the ratio of (65:35) adjusted to pH- 3.0 at a flow rate of 1.2 ml/min. A typical chromatogram for simultaneous estimation of the two drugs obtained by using a above mentioned mobile phase. Under these conditions Rosuvastatin and Fenofibrate were eluted at 1.950min and 2.858 minutes respectively with a run time of 6 minutes. The OPA buffer, MeOH in the ratio of (65:35) adjusted to pH- 3.0 was chosen as the mobile phase. The run time of the HPLC procedure was 6 minutes at flow rate of 1.2ml/min was optimized which gave sharp peak, minimum tailing factor. The system suitability parameters were shown in Table 1 were in within limit, hence it was concluded that the system was suitable to perform the assay. The method shows linearity between the concentration range of 50150g/ml for Rosuvastatin and Fenofibrate. The experimental results were shown in table 6 and fig.6&7. The % recovery of Rosuvastatin and Fenofibrate was found to be in the range of 98.00 to 101.00 % and 98.00to 101.00% respectively. As there was no interference due to excipients and mobile phase, the method was found to be specific. As both compounds pass the peak purity, the method was found to be specific. The method was robust and rugged as observed from insignificant variation in the results of analysis by changes in Flow rate, column oven temperature, mobile phase composition and wave length separately and analysis being performed by different analysts. The results were shown in Table 5. The LOD and LOQ values were calculated based on the standard deviation of the response and the slope of the calibration curve at levels approximately the LOD and LOQ. The limit of detection was obtained as 0.0053g/mL for Rosuvastatin and 0.00019g/mL for
IJRPB 1(6)
www.ijrpb.com
Page 852
Radha et.al
Fenofibrate. The limit of quantitation was obtained as Fenofibrate which shows that the method is very 0.017g/mL for Rosuvastatin and 0.00063g/mL for sensitive. Table.1.Optimized chromatographic conditions and system suitability parameters for proposed method
Parameter Instrument Column Detector Diluents Mobile phase Flow rate Detection wavelength Temperature Injection volume Retention time Theoretical plate count Tailing factor USP Resolution Chromatographic conditions Waters e2695 Alliance HPLC with Empower2 software C18 Hypersill ODS (2504.6mm.5) PDA Detector 2998 Methanol Methanol :OPA buffer pH 3.0(35:65) 1.2ml/min 238nm 25c 10l Rosuvastatin:1.950; Fenofibrate:30858 Rosuvastatin:4726; Fenofibrate:3170 Rosuvastatin:1.138; Fenofibrate:1.400 10.310 Table.2.Specificity study Name of the solution Retention time in min Blank No peaks Rosuvastatin 1.950 Fenofibrate 3.858 Table.3.Recovery data Table.3a.Recovery data of the proposed Rosuvastatin Sample Sample area g/ ml g/ ml found % Recovery weight added 732.00 1132260 29.400 29.71 101 1464.00 2203343 57.800 57.81 98 2196.00 3363910 88.200 88.25 100 Table.3b.Recovery data of the proposed Fenofibrate Sample area g/ ml g/ ml found added 10666213 950.400 951.38 21488849 1900.800 1916.72 31569646 2851.00 2815.89 Table.4.Results of Precision study Injection number RT 1 1.941 2 1.944 3 1.941 4 1.938 5 1.938 6 1.938 Mean %RSD(NMT 2.0) 1 3.838 2 3.838 3 3.836 4 3.831 5 3.830 6 3.830 Mean
Spiked level 50% 100% 150%
% Mean
100
Spiked level 50% 100% 150%
Sample weight 732.00 1464.00 2196.00
% Recovery 100 100 99
% Mean
100
Sample
Precision Peak area 2255177 2252365 2223745 2223773 2252119 2252119 2243216 0.72 21070608 21107354 21246011 21284382 21532673 21532673 21295617
Rosuvastatin
Fenofibrate
%RSD(NMT 2.0)
0.94
IJRPB 1(6)
www.ijrpb.com
Page 853
Radha et.al
Table.5.Robustness studies Table.5a.Robustness data for Rosuvastatin Parameter RT Theoretical plates Decreased flow rate 2.205 2670 Actual flow ate 1.950 3233 Increased flow rate 1.752 2473 Decreased temperature 2.358 2567 Actual temperature 1.950 3233 Incrased temperature 2.659 3045 Table.5b.Robustness data for Fenofibrate RT Theoretical plates 4.366 4011 3.858 4734 3.426 3658 4.874 3729 3.858 4734 5.317 4770 Table.6.Linearity data Table.6a.Linearity data of the Rosuvastatin Conc(g/ml) RT 50 1.930 75 1.922 100 1.917 125 1.916 150 1.916
Asymmetry 1.474 1.403 1.502 1.461 1.403 1.486
Parameter Decreased flow rate Actual flow ate Increased flow rate Decreased temperature Actual temperature Incrased temperature
Asymmetry 1.218 1.128 1.244 1.266 1.128 1.313
S.No 1 2 3 4 5 Std.dev Slope Intercept Correlation coefficient (r2)
Area 1136335 1691065 2259388 2817812 3386369 889685 22507 7467 0.999
S.No 1. 2. 3. 4. 5. Std.dev Slope Intercept Correlation coefficient (r2)
Table.6b.Linearity data of the Fenofibrate Conc(g/ml) RT 50 3.801 75 3.786 100 3.784 125 3.789 150 3.798
Area 10624304 15847690 21180479 26450357 31769938 8363306 21157 16980 0.999
Table.7.Limit of Detection and Limit of Quantification Name LOD LOQ Rosuvastatin 0.0053 0.017 Fenofibrate 0.00019 0.00063
Rosuvastatin
Fenofibrate
IJRPB 1(6)
www.ijrpb.com
Page 854
Radha et.al
Figure.1.Typical Chromatogram of standard Rosuvastatin and Fenofibrate
Figure.2.Typical chromatogram of Rosuvastatin and Fenofibrate tablets in marketed formulation
Figure.3.Linearity of Rosuvastatin
4000000 3500000 3386369 y = 21157x + 16980 3000000 2817812 R = 0.99999 2500000 2259388 2000000 1691065 1500000 1136335 1000000 500000 0 0 50 100 150 200 Axis Title Area
Linearity Of Fenofibrate
Figure.4.Linearity of Fenofibrate CONCLUSION A new validated RP-HPLC method has been developed for the quantitative and Qualitative determination of Rosuvastatin and Fenofibrate in tablet dosage forms in bulk and pharmaceutical dosage forms was established. The method was completely validated shows satisfactory results for all the method validation parameters tested and method was free from interferences of the other active ingredients and additives used in the formulation. Infact results of the study indicate that the developed method was found to be simple, reliable, accurate, linear, sensitive, economical and reproducible and have short run time which makes the method rapid. Hence it can be concluded that the proposed method was a good approach for obtaining reliable results and
IJRPB 1(6)
www.ijrpb.com
Page 855
Radha et.al
found to be suitable for the routine analysis of Rosuvastatin and Fenofibrate in Bulk drug and Pharmaceutical formulations. ACKNOWLEDGEMENT The authors would like to thank beloved parents and all my well wishers, one and all who have helped me directly and indirectly in completing this project work. REFERENCES D A Skoog. J. Holler, T.A. Nieman, Principle of Instrumental Analysis, 5th edition, Saunders College Publishing, 1998, 778-787. Gurdeep Chatwal, Sahm K. Anand, Instrumental methods of Chemical Analysis, 5th edition, Himalaya publishing house, New Delhi, 2002, 1.1-1.8, 2.5662.570 H.H. Willard, L.L. Merritt, J.A. Dean, F.A. Settle, Instrumental Methods of Analysis, 7th edition, CBS publishers and Distributors, New Delhi, 1986, 518521, 580-610. Hiren N. Mistri, S, C.Seetman, C.Saravanan, Rajiv Sharma, K.Mukkanti, Developed simultaneous
quantification of Rosuvastatin and Fenofibrate in human plasma by Mass spectroscopy. International Journal of Chem Tech Research, 2011, 3(1), 2011, 455-463. John Adamovies, Chromatographic Analysis of Pharmaceutical, Marcel Dekker Inc. New York, II Ed, 74, 5-15. John Wiley, Mahesh Duggamati,B.Dejaegher,Development and validation of a LCMSMS method for simultaneous determination of Rosuvastatin and Fenofibrate in tablet dosage form, Acta pharmacutica Sinica B, 2(6), 2008, 345-355. Sharma BK, Instrumental methods of chemical analysis, Introduction to analytical chemistry, 23th edition, Goel Publishing House Meerut, 2004, 12-23. Skoog, Holler, Nieman, Principals of Instrumental Analysis, 5thEdition, Harcourt Publishers International Company, 2001, 543-554.
IJRPB 1(6)
www.ijrpb.com
Page 856
Sravani and Haritha
A new development and validated RP-HPLC method for the assay and related substances of Itraconazole in capsule dosage form
Sarvani Paruchuri*, Haritha Pavani K Nimra College of Pharmacy, Vijayawada, Andhra Pradesh, India *Corresponding author:Email:sarvani4anu@gmail.com ABSTRACT The present investigation reveals about a simple, economic, selective, precise and accurate reverse phase high performance liquid chromatography method for analysis of Itraconazole and Related Substances of Itraconazole was developed and validated according to ICH guidelines. Itraconazole was well separated using ThermoHypersil BDS C18, 150mm 4.6 mm, 5m column for assay quantification in isocratic mode with mobile phase comprising of buffer: Acetonitrile (65:35) with a flow rate of 1.5ml/min and ThermoHypersil BDS C18, 100 mm x 4.6 mm, 3 m column for Related substances quantification in gradient mode with mobile phase comprising of 0.08M tetra butyl ammonium hydrogen sulphate: Acetonitrile with a flow rate of 1.5ml/min. the retention time was found to be 6.2min and % assay was found to be 99.9%. The percentage recovery was found to be 99.6 to 101.2%. Proposed method was validated for precision, accuracy, linearity, range, specificity and robustness. The drug was subjected to forced degradation and stability studies. The drug was found to be stable for 4 days in Assay and for 3 days in Related compounds determination. This method was appropriate for the purpose of quantitating Itraconazole in Drug Product and the Related Substances of Itraconazole in the Finished Product and has been successfully validated. Key words: Itraconazole, HPLC, Method development, Method validation, Analysis method would help in estimation of the drug in single INTRODUCTION Itraconazole is a (1-(butan-2-yl)-4-{4-[4-(4run which reduces the time of analysis and does not {[2R,4S)-2-(2,4-dichlorophenyl)-2-(1H-1,2,4 triazolerequire separate method for the drug. Thus the paper 1- ylmethyl) 1, 3 dioxolan 4 -yl] methoxy}phenyl) reports an economical, simple and accurate RP-HPLC piperazin -1-yl ] phenyl} 4, 4-dihydro-1H-1,2,4method for the above said pharmaceutical dosage triazole-5-one) is member of the drug class known as form. anti-fungal. It is used for the inhibition of fungal MATERIALS AND METHODS cytochrome p450 enzyme lanosterol 4 demethylase, Quantitative HPLC was performed on used in the conversion of lanosterol to ergosterol, Schimadzu 2010 CHT system connected with UV which is a main sterol in fungal cell membrane, thus Visible detector and LC solution software. The drug inhibits replication and promotes cell death in case of analysis data were acquired and processed using LC the yeast cells transformation into hypothetically solution software running under windows XP on a invasive hyphae. Pentium PC and thermohypersil BDS C18 column of Literature survey revealed that very few dimension 150 4.6, 5m particle size. In addition an methods have been reported for the analysis of analytical balance (Mettler Toledo 0.1mg sensitivity), Itraconazole which include UV spectroscopy, Reverse digital pH meter (Polmon), and an ultra sonicator were Phase High Performance Liquid Chromatography, used in this study. Ultra Pressure Liquid Chromatography, LCMS, Standards and Chemicals used: Itraconazole pure HPTLC methods. The present study illustrate sample was taken as a gift sample from local labs and development and validation of simple, economical, dosage forms Sporanox marketed by Janssen selective, accurate, precise RP-HPLC method for the Pharmaceuticas was purchased from local pharmacy. determination of Itraconazole and Related Substances Other chemicals all are of HPLC grade. of Itraconazole in pharmaceutical dosage forms as per Preparation of Mobile Phase: A suitable quantity of ICH guidelines. The goal of the present study is to degassed mixture of buffer and acetonitrile in the ratio develop rapid, economical HPLC method for the of 65:35 was prepared and filtered through 0.45 filter analysis of Itraconazole in pharmaceutical dosage under vaccum filtration. (27.2gm of tetra butyl form using most commonly employed column (C18) ammonium hydrogen sulphate was prepared in and simple mobile phase preparation. In the present 1000ml volumetric flask and is used as buffer) work a successful attempt had been made to develop a Preparation of Diluent: Prepare 99:1 mixture of method for the determination of Itraconazole in Methanol and Hydrochloride (v/v) pharmaceutical dosage form and validate it. The
IJRPB 1(6)
www.ijrpb.com
Page 857
Sravani and Haritha
Preparation of Standard stock solution: About 25mg of itraconazole working standard was taken into a 50ml volumetric flask and add 30ml of diluent and sonicate to dissolve. Make up the volume with diluent to get a concentration of 500g/ml. From this solution 5ml was taken in to 25ml volumetric flask and make up the volume with diluent to get a concentration of 200 g/ml. Preparation of Sample Solution: The average fill weight was determined for 20 capsules was added weigh 25mg equivalent of itraconazole was taken and transferred in to 50ml volumetric flask. Add 30ml of diluent and sonicate to dissolve and make up the volume with diluent. From this solution 5ml was taken in to 25ml volumetric flask and make up the volume with diluent to get a concentration of 200 g/ml. Method optimisation: The chromatographic separation was performed using Hypersil BDS C18 (1504.6mm, 5m) column. For selection of mobile phase, various mobile phase compositions were observed for efficient elution and good resolution. The mobile phase consisting of Tetra Butyl Ammonium Hydrogen Sulphate and acetonitrile in the ratio of 65:35 was found to be the optimum composition for efficient elution of analyte. The mobile phase was injected to the column at a flow rate of 1.5 ml/min for 12min. The column temperature was maintained at 35 10C. The analyte was monitored at 225nmusing UVdetector. The retention time of the drugs was found to be 6.2min. 99:1% of methanol and HCl was used as diluent.
Figure.1.Structure of Itraconazole RESULTS AND DISCUSSION Method validation: System suitability:System suitability of the HPLC was conducted to find out the system performance and the results we are getting were accurate. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of Itraconazole was in the concentration range of 10-200g/ml. From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 1.000 and shows good linearity for the drug.
Precision: Precision is the degree of closeness of agreement among individual test results when the method is applied to multiple sampling of a homogeneous sample. Study was carried out by injecting six replicates of the same sample preparations at a concentration of 200ppm/ml. The results were tabulated in table No 3 Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (50%,100% ,150%) at three different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. Forced degradation of Itraconazole: Acid/base hydrolysis: Weigh 25mg equivalent of Itraconazole and transfer into 50ml volumetric flask. To this add 2.5ml of 5N HCl/NaOH and place in a water bath at about 600c for about 1hr with occasional shaking. After 1hr, add about 2.5ml of 5N NaOH/HCl to neutralize, to this add 10ml of Diluent. Sonicate for 30min and allow the solution to equilibrate to room temperature and dilute with diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. The results were tabulated in table No 4 and the chromatogram was shown in fig no7,8 Oxidative degradation: Weigh 25mg equivalent of Itraconazole and transfer into 50ml volumetric flask. To this add 2.5ml of 1%H2O2 and place in dark for about 1 day. After 1 day add about 10ml of diluent, sonicate for 30min and allow the solution to equilibrate to room temperature and then dilute with Diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. The results were tabulated in table No 4 and the chromatogram was shown in fig no 9 Thermal degradation: Weigh 25mg equivalent of Itraconazole and transfer into 50ml volumetric flask. Place it in oven at 1050C and let stand for 24hrs. After 24hrs, add 30ml of diluent and sonicate with occasional shaking for 30min and allow the solution to equilibrate to room temperature and then dilute with diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. Photolytic degradtion: (UV/LUX): Itraconazole samples were prepared and the solutions were exposed to light to determine the irradiation of light on the stability of the solution. Approximately 200mg of the drug powder was taken and is spread as a thin layer
IJRPB 1(6)
www.ijrpb.com
Page 858
Sravani and Haritha
and is placed in a photo stability chamber at 200watt hr/sq mt. After attaining 200 watt hours/sq mt/1.2million LUX hrs, quantitatively transfer a portion of the pellets equivalent to about 25mg of itraconazole into a 50ml volumetric flask and add 30ml of diluent and sonicate, and then dilute to volume with diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. Stability: Analyse the stored samples and standards. Evaluate the stability of the stored stability solutions by quantitating the amount of itraconazole found in the stored solutions against freshly prepared standard after one to seven days of storage and test atleast 3 days. Filter study: Make one injection of the filtered diluent, the filtered standard fractions, the unfiltered standards, the filtered sample fractions and the centrifuged sample fractions. Calculate, as area percentage of the average area from system suitability working standard injections, any peaks found in the retention time window of itraconazole from the filtered diluent blank injections. The percentage recovery for the filtered standards was calculated, the unfiltered standards, and the filtered sample and centrifuged samples. Discussions: Several trials has made until getting good peak resolution, acceptable plate count and tailing factor. Method was optimized and the retention time was reported as 6.12 minutes. System suitability: For the system suitability studies it was found that the %RSD was found to be 0.8%, theoretical plates 5623, and tailing factor 1.1. Linearity: From the linearity data it was observed that linearity concentration range was 500g/ml. Correlation coefficient was found to be 1.000 Precision: The percentage RSD for sample was found to be 0.2 Accuracy: The recovery of pure drug from the analysed solution of formulation was found to be 100.2%. Specificity: The chromatograms of standard and sample are identical with nearly same Retention time. No interference due to Placebo and Sample at the retention time of analyte which shows that the method was specific Robustness: The %RSD of retention time was within the limits for variation in flow rate (1.3ml and 1.7ml). Hence the flow rate should be between 1.3ml to 1.7ml. The % RSD of retention time was within the limits for variation in pH (1.3 and 1.7) hence the pH should be with in 1.3 and 1.7. The %RSD of retention time was within the limits for variation in Buffer
composition (63:37 and 67:33). The system suitability requirements were met for the method specified parameters. The % itraconazole found was between 97.0% and 103.0%. Filter Study: The mean recovery from the filtered standards was within of the mean from the unfiltered standards. The mean recovery from the filtered samples was with in of the mean from the centrifuged samples Methods for related substances validation: Preparation of mobile phase: Mobile phase was introduced in gradient mode. Mobile phase A: 0.08M tetra butyl ammonium hydrogen sulfate (27.2 g of tetra butyl ammonium hydrogen sulfate per 1000 mL volume of preparation. Add DI Water and stir to mix. No pH adjustment is required.) Mobile phase B: Acetonitrile Gradient programme Time Mobile phase Mobile Phase (min) A (%) B (%) 0 80 20 20 50 50 25 50 50 30 80 20 35 80 20 Preparation of diluent: In a suitable flask, prepare a 1:1 mixture of methanol and tetrahydrofuran (v/v). Preparation of Standard Solution: 50mg of Itraconazole working standard was transferred into 25ml volumetric flask. From this take 5ml of the solution and transferred to 100ml volumetric flask. From the above solution transfer 10ml of the solution in to 100ml volumetric flask to make a concentration of 10g/ml Preparation of sample Solution: Determine the average fill weight of 20 capsules and weigh 500mg equivalent of itraconazole and transfer into 100ml volumetric flask and add 70ml of diluent and sonicate and dilute to volume with diluent and mix well (Concentration: 5000g/ml Itraconazole). Method optimisation: The chromatographic separation was performed using Hypersil BDS C18 (1004.6mm, 3m) column. For selection of mobile phase, various mobile phase compositions were observed for efficient elution and good resolution. The mobile phase consisting of 0.08MTetra Butyl Ammonium Hydrogen Sulphate and acetonitrile in gradient phase was found to be the optimum composition for efficient elution of analyte. The mobile phase was injected to the column at a flow rate of 1.5 ml/min for 35min. The column temperature was maintained at 30 10C. The analyte was monitored at
IJRPB 1(6)
www.ijrpb.com
Page 859
Sravani and Haritha
225nmusing UV-detector. The retention time of the drugs was found to be 12.2min. 99:1% of methanol and HCl was used as diluent. The optimised chromatographic conditions were mentioned in Table No 1 and the chromatograms were shown in Fig 10, 11 and 12 RESULTS AND DISCUSSION Method validation: RRT and RRF: (Relative retention time, relative retention factor): Impurity B and Impurity G Stock Standard Solution: 25mg of itraconazole WRS was transferred into 50ml volumetric flask. From this take 5ml of the solution and transferred to 100ml volumetric flask. Working Itraconazole standard solutions with impurities: Prepared 50, 100, 200% of proposed specification level concentration by preparing aliquot solutions of 2.5, 5 and 10ml of impurity standard stock solution into 100ml volumetric flask individually and dilute to volume with diluent and mix well. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of Itraconazole was in the concentration range of 20-300g/ml. From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 1.000 and shows good linearity for the drug. Precision: Precision is the degree of closeness of agreement among individual test results when the method is applied to multiple sampling of a homogeneous sample. Study was carried out by injecting six replicates of the same sample preparations at a concentration of 5000g/ml. Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (50%,100% ,200%) at three different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. Forced degradation of Itraconazole: Acid/base hydrolysis: Weigh 500mg equivalent of Itraconazole and transfer into 100ml volumetric flask. To this add 2.5ml of 5N HCl/NAOH and place in a water bath at about 600c for about 1hr with occasional shaking. After 1hr, add about 2.5ml of 5N NAOH/HCl to neutralize, to this add 10ml of diluent. Sonicate for
30min and allow the solution to equilibrate to room temperature and dilute with diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. Oxidative degradation: Weigh 500mg equivalent of Itraconazole and transfer into 100ml volumetric flask. To this add 10ml of 30%H2O2 and place in water bath at 800c for 4 hrs. After 4hrs add about 60ml of diluent, sonicate for 30min and allow the solution to equilibrate to room temperature and then dilute with Diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. Thermal degradation: Weigh 500mg equivalent of itraconazole and transfer into 100ml volumetric flask. Place it in oven at 1050C and let stand for 24hrs. After 24hrs, add 70ml of diluent and sonicate with occasional shaking for 30min and allow the solution to equilibrate to room temperature and then dilute with Diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. The results were tabulated in table No 4 and the chromatogram was shown in fig no16 Photolytic degradtion: (uv/lux): Itraconazole samples were prepared and the solutions were exposed to light to determine the irradiation of light on the stability of the solution. Approximately 1000mg of the drug powder was taken and is spread as a thin layer and is placed in a photo stability chamber at 200watt hr/sq mt. After attaining 200 watt hours/sq mt/1.2million LUX hrs, quantitatively transfer a portion of the pellets equivalent to about 25mg of itraconazole into a 50ml volumetric flask and add 30ml of diluent and sonicate, and then dilute to volume with diluent and mix well. Pipette 5.0ml of the above solution into a 25ml volumetric flask, dilute to volume with diluent. Filter study: Three of the six 100% Accuracy Samples prepared in Intermediate Precision were used. Place an aliquot from the three preparations into three 15-mL volumetric flasks and spin at high speed for 5 minutes. Remove an aliquot of the supernatant and place in an auto sampler vial for analysis. Remove a second aliquot from each of the three preparations and individually filter and analyse Preparation of Filter Blanks: Filter the Diluent through a 0.45 m Nylon (Millipore Brand) filter, fill an auto sampler vial for analysis. Repeat this two more times using a new 0.45 m Nylon (Millipore Brand) filter each time. Stability of standard and sample solutions: Specificity known impurities: The method was shown to be specific with regards to the Known
IJRPB 1(6)
www.ijrpb.com
Page 860
Sravani and Haritha
Impurities of Itraconazole with a Resolution between adjacent peaks of 14.1, 4.5, 4.2, 6.8, 4.6, 3.9 and 6.7. The Acceptance Criteria for the determination of RRT and RRF was met for all the Known Impurities. Specificity placebo: The method was shown to have a 0.05% of Placebo interference, thus the method was shown to be specific with regards to the Placebo. Specificity forced degradation: The method was shown to be capable of resolving the Known and Unknown peaks from each other and from the Itraconazole peak. The Peak Purity data confirmed that all peaks detected were pure. Linearity and range: The method was shown to be Linear (Correlation Coefficient of 1.0000) over a Range of 20% to 300% of the Working Standard Concentration which corresponds to the 2.00 g/mL to 30.00 g/mL of the Test concentration. Precision - injection repeatability: The method was shown to have a 0.8% RSD for 10 replicate working standard injections thus demonstrating acceptable Injection Reproducibility. Precision - analysis repeatability: The method was shown to have a 0.8% RSD for Impurity-B, 0.7% RSD for Impurity-G. Spiking/Recoveries at the proposed specification limit for each known impurity thus demonstrating acceptable analysis reproducibility. Intermediate precision ruggedness: A second Analyst on a different day, using a different HPLC
Parameters Column Mobile phase Flow rate Wave length Injection volume Column temperature Run time
and a different column serial number was able to reproduce Mean Recoveries and %RSD as the first Analyst thus demonstrating method Ruggedness. The difference in the mean recovery between analysts was not greater than 10.0% for each Known Impurity. The method was found to be Rugged. Accuracy and recovery from placebo: The method was shown to be Accurate and Precise by the successful demonstration of spiking and recovering the Known Impurities at 50%, 100% and 200% Levels of the proposed specification limit concentrations. The mean recovery of replicate preparations at each spiking level was between 85.0% and 115.0%. The %RSD at each level was not greater than 10.0%. The Accuracy and Recovery of this Method was found to be acceptable. Robustness: The method was shown to be Robust with regards to Flow Rate and Organic Phase composition. Filter Study: The use of 0.45 m Nylon Membrane Filters from Millipore was shown not to contribute additional components or to absorb the Known Impurities as long as at least 3-mL of filtrate was discarded. There were no new peaks found in the Filtered Diluent. Stability of standard and sample solutions: The Standards and Sample Solutions were shown to be stable for a period of 3 days at room temperature.
Table.1.Optimised chromatographic conditions Assay Related substances Thermohypersil BDS C18 Thermohypersil BDS C18 1004.6mm, 3m 1504.6mm, 5m Buffer: ACN (65:35) M.P A: 0.08M tetra butyl ammonium hydrogen sulphate M.P B: ACN 1.5ml/min 1.5ml/min UV at 225nm UV at 225nm 10l 10l 250 c 300 c 12min 35min Table.2.Linearity data
Assay Mcg/ml Area 10 168080 25 424817 50 849375 100 1675595 150 2502949 200 3339989 Correlation coefficient = 1.000 Intercept = 8150
Rt 6.14 6.13 6.13 6.14 6.13 6.14
Mcg/ml 20 50 100 150 200 300
Related substances Area 36127 92550 180452 268940 359644 544138 Correlation coefficient 1.000 Intercept = -16
Rt 11.46 11.05 10.84 10.69 10.62 10.58
IJRPB 1(6)
www.ijrpb.com
Page 861
Sravani and Haritha
Parameters Linearity Precision (%RSD) Accuracy Assay Ruggedness(%RSD)
Table.3.Validation parameters Assay 10-200mcg/ml 0.2 100.2 99.9 0.33
Related substances 20-300mcg/ml 0.8,1.5 101.2,101.0 101.0 1.3,1.8
Parameter Stress As such Acid Base Oxidation Photolysis Thermal
Assay Time 24hrs 2hrs 2hrs 24hrs Until attaining of temperature 24hrs
Table.4.Forced degradation studies Related substances Rt Time Rt 6.2 6.19 6.20 6.21 6.2(UV) 6.22(LUX) 6.22 24hrs 6hrs 2hrs 4hrs Until attaining of temperature 24hrs Imp B 8.49 8.53 8.67 8.53 8.46(UV) 8.59 (LUX 8.81 Imp G 16.43 16.47 16.38 16.46 16.6 (UV) 16.72 (LUX) 16.56 Drug 12.42 12.49 12.45 12.47 12.63 (UV) 12.74 (LUX) 12.57
Parameter Centrifuged
Name Impurity B Impurity G Itraconazole Impurity B Impurity G Itraconazole
Filtered
Table.5.Filter study Assay Area Rt 1555452 6.23 1571516 6.23 Table.6.Solution stability
Related substances Area Rt 566978 8.97 66778747 12.78 357711 16.62 5566193 8.87 71257184 12.67 358784 16.51
parameter Area Day 1
Assay Rt 6.07 Name Impurity B Impurity g Itraconazole Impurity B Impurity G Itraconazole Impurity B Impurity G Itraconazole Impurity B Impurity G Itraconazole Impurity B Impurity G Itraconazole
1710459
Day 2
1703686
6.09
Day 3
1710149
5.97
Day 4
1761776
6.19
Day 7
1943533
6.13
Related substances Area 532302 366761 57636383 556700 385432 62725307 610776 415865 67293568 673402 422648 65746332
Rt 8.18 15.80 11.92 8.16 15.79 11.91 8.16 15.78 11.90 8.48 16.18 12.28
Figure.1.Chromatogram of sample
Figure.2.Chromatogram of standard
IJRPB 1(6)
www.ijrpb.com
Page 862
Sravani and Haritha
Figure.3.Linearity plot
Figure.4. Photolytic degradation (UV)
Figure.5. Photolytic degradation(LUX)
Figure.6. Thermal degradation
Figure.8. Base degradation
Figure.9.Oxidative degradation
Figure.10.Chromatogram of blank
IJRPB 1(6)
www.ijrpb.com
Page 863
Sravani and Haritha
Figure.11.Chromatogram of std
Figure.12. Chromatogram of sample
Figure.13. Linearity plot
Figure. 14. Photolytic degradation (UV)
Figure.15. Photolytic degradation (LUX)
Figure.16. Thermal degradation
Figure.18.Base degradation
CONCLUSION finally it concludes that all the parameters are within the limits and meet the acceptance criteria of ICH guidelines for method validation. The proposed method was simple, accurate, specific, precise, robust,
rugged and economical. Hence this method is validated and can be used for routine and stability sample analysis.
IJRPB 1(6)
www.ijrpb.com
Page 864
Sravani and Haritha
REFERENCES Beckett and Stenlake, Chromatography, Beckett A.H, editor, Practical pharmaceutical chemistry, 4th ed, New Delhi, CBS publishers; 2007, 157 161 Guru deep R. Chatwal, Sham K Anand, High performance liquid chromatography, Arora M, editor, Instrumental Methods of Chemical Analysis, 5th ed, Mumbai, Himalaya Publishing House Pvt ltd, 2009, 624 638
IJRPB 1(6)
www.ijrpb.com
Page 865
Thirumala K et.al
Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats
Thirumala K*, Janarthan M, Firasat Ali M Nimra College of Pharmacy, Vijayawada, India *Corresponding author: Email: thirumala.kondragunta@gmail.com, Phone +91-9505483894 ABSTRACT The anti-urolithiatic activity of the Aqueous extract of the stem core of Musa paradisiaca (family: musaceae) was investigated on Ethylene glycol and ammonium chloride induced on albino rats. A comparison was made between both plant extract and a known anti urolithiatic drug cystone (5mg/kg-1). The dried powder ofstemcore of Musa paradisiaca was subjected to extraction by continuous hot extraction method using Distilled water as a solvent. Phytochemical estimation was done for the presence of phytoconstituents. Dose selection was made on the basis of acute oral toxicity study (200mg/kg-1, 400mg/kg-1 bodyweight) as per OECD guidelines. Oral administration of extract of Musa paradisiaca for 28days resulted in significant reduction in urine level. Ethylene glycol and Ammonium chloride induced lithiatic rat model and oral urine tolerance test (OUTT) model was used for evaluation of anti lithiatic activity. The biochemical parameters were analysed. All rats in the lithiatic groups had urine and serum levels well within the lithiatic range, at the initial stage of the experiment but after four weeks of treatment with extracts or cystone the urine, serum significantly dropped in dose-dependent manner. The results suggest that the aqueous extracts of the Stem core of Musa paradisiaca restored the metabolic changes in Ethylene glycol and ammonium chloride lithiatic rats. Key words: Musa paradisiacal, cystone, ethylene glycol andammonium chloride, anti-urolithiatic activity INTRODUCTION Urolithiasis also called Nephrolithiasis or kidney stone. Urolithiasis is the presence of calculi in the urinary tract. Renal stone disease affects up to 15% of men and 6% of women. Eighty percent of calculi are composed of calcium (either oxalate or phosphate), with others composed of struvite, uric acid or cystine (Bihl G, Meyers A-2001) approximately one million Americans develop a kidney stone each year and an estimated 12% of the population forms a stone some time during their life (Gerstenbluth RE, Resnick ML-2004). Approximately 0.10.4% of the population is believed to have kidney stones every year in the USA and Europe; about 25% of the population in Asia, 815% in Europe and North America, and 20% in Saudi Arabia develop renal stones in their lifetime (Pak CYC-1998) Kidney stones occur more frequently with increasing age and among men. Within ten years, the disease usually recurs in more than 50% of patients. Nowadays, about 80% of all kidney stones contain calcium salts (calcium oxalate and/or calcium phosphate) as their main crystalline components. Because human urine is commonly supersaturated with respect to calcium salts as well as to uric acid, crystalluria is very common, i.e. healthy people excrete up to ten millions of microcrystals every day. Recurrent stone formers appear to excrete lower amounts or structurally defective forms of crystallization inhibitors which allows for the formation of large crystal aggregates as precursors of stones. Alternatively, crystal adhesion to urothelial surfaces may be enhanced in stone formers. (Hess B.) MATERIALS AND METHODS Chemicals: Cystone (Himalaya Lab., India.), ethylene glycol and ammonium chloride and all other reagents used were of analytical grade Plant material: The stem core of Musa paradisiaca were collected from Sugguna lanka, near to tenali,Guntur district (A.P). The plant material was identified and authenticated by Dr.Madhava chetty department of Botany, SV. University Tirupathi Chitoor (dist). Preparation of plant extraction: The collected stem core was shade dried and powdered in mixer grinder to get coarse powder. The powdered plant material (100gms) was extracted with Distilled water by using soxhlet apparatus. The extract was air dried to evaporate solvent Phytochemical screening: The preliminary phytochemical screening of aqueous extract of Musa paradisiaca was carried by using standard procedures. Acute Toxicity Study: toxicity studies performed according to OECD-423guidelines. were
IJRPB 1(6)
www.ijrpb.com
Page 866
Thirumala K et.al
Experimental model: Ethylene glycol and ammonium chloride was weighed individually for each animal according to their body weight and solubilised with saline just prior to injection. Lithiasis was induced by injecting it at a dose of 200 mg/kg body weight Orally. The animals were kept under observation and after 24 hrs urine level level was measured. The lithiatic rats (urine level 200-300 mg/dl) were separated and divided into five different groups for experimental studies, with each group containing six animals. Present study has confirmed that the treatment of aqueous extract of Musa paradisiaca for a period of 4weeks caused a significant decreased in urine, serum levels) of lithiatic rats 200&400 mg/kg of plant extract were screened for anti lithiatic activity against ethylene glycol and ammonium chloride induced lithiatic rats. It produced significant anti lithiatic activity in a dose dependent manner. The animals treated with ethylene glycol and ammoniumchloride had low urine level. The anti urolithiatic activity exhibited by extract was compared with that of standard drug (cystone). Experimental design: The rats were divided into five groups each consist of six rats. Significant lithiacis was achieved within 24 hrs after ethylene glycol and ammonium chloride (200 mg/kg body weight oral) injection. Group I- Served as normal control and did not receive any treatment Group II- Served as lithiatic control and received Inducer (ethylene glycol and ammonium chloride200mg/kg) and vehicle Group III- Ethylene glycol and ammonium chloride + cystone (5 mg/kg p.o.) and served as standard Group IV- ethylene glycol and ammonium chloride + AEMP extract (200 mg/kg, p.o.) Group V- ethylene glycol and ammonium chloride + AEMP extract (400 mg/kg, p.o.) Statistical Analysis: The result of the study were subjected to one way analysis of variance (ANOVA) fallowed by Dunnets test for multiple comparisions. Values with p<0.05 were consider significant. RESULTS AND DISCUSSION Phytochemical Screening: Phytochemical screening of Aqueous extract of Musa paradisiaca showed the presence of various chemical constituents mainly alkaloids, Proteins, glycosides, and saponins. Extract may be responsible for antilithiatic properties. The
results obtained were comparable and satisfied the standard literature. Acute oral toxicity studies: In the present study the AEMP was subjected for toxicity studies. For the LD50 dose determination was administered the dose level of 1000 mg/kg and 2000 mg/kg body weight and both doses did not produce any mortality. Hence onefifth of the dose tested i.e. 200mg/kg and 400mg/kg body weight was selected for the study in order to ascertain a scientific base for the useful of this plant in the treatment of lithiasis. It was decided to evaluate experimental design of an activity by Ethylene glycol and ammonium chloride induced model. Anti-urolithiatic activity: Ethyleneglycol and ammonium chloride lithiatic model: The anti-urolithiatic effect of AEMP in ethylene glycol and ammoniumchloride induced lithiatic animals is presented. The results showed that after single dose treatment of the extract in individual group of ethylene glycol and ammonium chloride induced rats; there was a significant reduction in serum, urine levels throughout the entire period of study (28 days) as compared to lithiatic, control group. Musa paradisiacal stem core extract were screened for antilithiatic activity in rats where ethylene glycol and ammoniumchloride (200 mg/kg, i.p.) used as the lithiogenetic agent. The results obtained from the present investigation demonstrated that the stem core extract of Musa paradisiaca constantly maintained significant increase of the urine level in ethylene glycol the experimental period suggesting the antilithiatic property of the title plant. Urolithiasis is a chronic pathological condition characterized by excessive deposition of minerals in the kidney leading to formation of large crystals thus obstructing the urine flow. In the present study, it was observed that the extract reversed the weight loss of the lithiatic rats. Different chemicals used to induce Lithiasis in experimental animals include ethylene glycol (EG), and ammonium ammonium chloride (Malani M, 1995). To achieve a uniformly high rate of kidney crystal deposition, the kidney is especially susceptible to the action of induced ethylene glycol and ammonium chloride. The dose of 200mg/kg of ethylene glycol and ammonium chloride can induces an autoimmune process that results in the destruction of kidney; it also results in the toxicity.
IJRPB 1(6)
www.ijrpb.com
Page 867
Thirumala K et.al
Table.1.Effect of Musa Paradisiaca on urinary parameters

Groups Vehicle control Lithiatic control Standard Test I Test II Urinary volume Calcium Magnesium Phosphate Oxalate 31 1.73 1.25 0.0115 1.30 0.0117 3.54 0.0150 0.49 0.0128 15.66 0.05 4.17 0.0192 0.25 0.0066 7.45 0.0114 3.52 0.0079 30 1.50*** 1.50 0.0076*** 1.23 0.0154*** 3.87 0.0265*** 1.23 0.0076*** 25 0.035*** 3.11 0.0071*** 0.43 0.0031*** 5.37 0.0183*** 2.87 0.0095*** 27 2.14*** 1.97 0.0047*** 1.12 0.0054*** 4.14 0.0182*** 1.76 0.0070*** The values are expressed in Mean SEM value. Statistical comparisons are made with Dunnetts comparison test at significance value P<0.0001. *** (P<0.0001) comparison made with Lithiatic control
Groups Vehicle control Lithiatic control Standard Test I

Test II
Table.2.Effect of Musa paradisiaca on serum parameters BUN Creatinine Calcium 36.57 0.0057 0.85 0.0060 6.53 0.1358 48.55 0.0135 2.61 0.0453 21.64 0.0060 37.41 0.0113*** 0.94 0.0095*** 7.85 0.0118*** 43.50 0.0094*** 1.12 0.0114*** 16.13 0.0126*** 38.93 0.0192*** 1.05 0.0136*** 9.23 0.0067***
The values are expressed in Mean SEM value Statistical comparisons are made with Dunnetts comparison test at significance value P<0.0001. *** (P<0.0001) comparison made with Li
Table.3.Effect of Musa paradisiaca on tissue parameters

Groups Vehicle control Lithiatic control Standard Test I Test II SOD Catalase GSH MDA (LPO) 7.27 0.0048 33.55 0.0113 17.14 0.0117 175.30 0.0076 3.13 0.0105 18.13 0.0169 10.63 0.0067 340.20 0.0058 6.33 0.0049*** 29.55 0.0127*** 16.27 0.0054*** 147.32 0.0088*** 4.55 0.018*** 21.64 0.0043*** 12.35 0.0094*** 220.34 0.0099*** 5.76 0.0088*** 27.83 0.0070*** 15.75 0.0152*** 199.44 0.0128*** The values are expressed in Mean SEM value Statistical comparisons are made with Dunnetts comparison test at significance value P<0.0001. *** (P<0.0001) comparison made with Lithiatic control.
CONCLUSION The results of the present study indicated that Musa paradisiacal stem core extract possessessignificant anti lithiatic activity against ethylene glycol and ammonium chloride induced lithiatic rats. Thus justifies the traditional use of this plant in the treatment of diabetes mellitus. Bark extract of the title plant possesses almost equipotent anti lithiatic activity when compared with reference standard Cystone REFERENCES Bihl G, Meyers A, Recurrent renal stone disease: advances in pathogenesis and clinical management, Lancet, 358, 2001, 65156.
Gerstenbluth RE, Resnick ML, Medical management of calcium oxalate urolithiasis, Med Clin North Am, 88, 2004, 431-42. Hess B, Pathophysiology, diagnosis and conservative therapy in calcium kidney calculi, Ther. Umsch, 60(2), 2003, 79-87. Malani M M,Baskar R and Varalaxmi P, Effect of lupol, a pentacyclic ,tri terpens on urinary enzymes in hyperoxiluricrats, Jpn J Med Sci Biol, 48(5-6), 1995, 211-220. Pak CYC, Kidney stones, Lancet, 351, 1998, 1797801.
IJRPB 1(6)
www.ijrpb.com
Page 868
Hardeep and Sankar
Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride

Hardeep Singh Dhaliwal*, Dhruba Sankar Goswami, Nidhi uppal, Mona Seth, Swati Kashyap, Kapil Sharma, S.D. College of Pharmacy, Barnala, Punjab, India *Corresponding author:Email id- jaidboy@rediffmail.com ABSTRACT The objective of the present investigation was to prepare and characterize a contraceptive vaginoadhesive Propranolol hydrochloride gel. To achieve this, various mucoadhesive polymers including Na CMC (1-4% w/w) and tragacanth gum (1-4% w/w), were dispersed in an aqueous-based solution containing the drug (0.5% w/w). The mucoadhesive properties of the gels were assessed on sheep vaginal mucosa in citrate phosphate buffer pH 4 at 37C. Formulations containing charged functional groups in their polymeric structure, showed higher mucoadhesive strengths in comparison to those composed of neutral polymers. In vitro drug release profiles of the gels were determined in citrate phosphate buffer pH 4. Results indicated that, formulation F4 (containing Na CMC 4% w/w), released the drug over 54 hrs, with a burst release at the initial phase followed by a sustained release pattern. The formulation showed good bioadhesive strength (24.60.05 gm). The %yield was found to be 95.30.02. In conclusion, formulation F4 was considered as the most desirable formulation as it exhibited appropriate mucoadhesive properties while having the potential of providing a prolonged drug release which is assumed to render longer contraceptive efficacy. Key words: Propranolol hydrochloride, Contraceptive gel, Vaginoadhesive, Na CMC, Tragacanth. INTRODUCTION Vaginal drug delivery system refers to the system in which drug formulations are directly applied in vaginal cavity for producing local action. It is an important route of drug administration for both systemic and local effect. The vagina has dense network of blood vessels and rich blood supply, which makes the drug absorption so effective. The drug formulations contain bioadhesive polymers, due to which drug formulations remain attached to the vaginal mucosa for longer periods and release drug on controlled rate. Thus vaginal route is used to treat vaginal infections, to prevent the sexually transmitted diseases or for contraception. The main advantages of vaginal route are local effect, large surface area, rich blood supply, avoidance of the first pass effect and self-insertion. For this route semisolid and solid dosage forms are preferred for good bioadhesion to prolong the residence time in the vaginal cavity. The most commonly used mucoadhesive polymers are synthetic polyacrylates, polycarbophil, chitosan, cellulose derivatives, hyaluronic acid derivatives, pectin, tragacanth, carrageenan and sodium alginate. (Alexander NJ, 2004) Gels are the semisolid formulations, with water base (hydrogels), or organic liquid base (organogels). Hydrogels also possess a degree of flexibility very similar to natural tissue, due to their significant water content. These pseudohydrogels swell infinitely and the component molecules dissolve from the surface of the matrix. Drug molecules are released through the spaces in the network and also by the dissolution and/or disintegration of the matrix. Mucoadhesive polymers of natural, semisynthetic or synthetic origin are able to form hydrogels. In the simplest case the drug is dispersed in a mucoadhesive polymer, which swells in the presence of water and exhibits bioadhesive properties. (Kumar L and Verma R, 2010) Vaginal gels are used for topical delivery of contraceptives and anti-bacterial drugs. The desirable properties of vaginally administered gel against microbicides are acceptability and feasibility. They must be easy to use, non-toxic and non-irritating to the mucus membrane. (Patil SA, 2011) Propranolol hydrochloride is a -adrenergic blocker that is used to treat tremors, angina, hypertension, heart rhythm disorders etc. Its bioavailability is very limited (30%) due to the hepatic first pass effect. Its elimination half life is also relatively short (3-4 hrs). This drug also possesses local anesthetic activity of short latency and fairly long duration and is a potent inhibitor of human sperm motility in vitro and has a similar effect in vivo in rats. The concentration of Propranolol hydrochloride, which inhibits sperm motility by 50%, is 0.3 mM. The local anesthetic properties of the drug are in fact, the underlying mechanism which is responsible for inhibition of sperm motility, rather than its -blocking potential. These characteristics give a potential to this
IJRPB 1(6)
www.ijrpb.com
Page 869
Hardeep and Sankar
drug for use as a vaginal contraceptive or for incorporation in an intrauterine contraceptive drug delivery system, while being devoid of numerous adverse effects reported from use of other types of contraceptives. (Hussain A and Ahsan F, 2005) MATERIALS AND METHODS Propranolol hydrochloride was purchased from Balaji Drugs, Gujarat. Na CMC, tragacanth, methyl paraben, propyl paraben, citric acid and
Formulation code F1 F2 F3 F4 F5 F6 F7 F8
disodium hydrogen phosphate were obtained from Central Drug House Pvt. Ltd., New Delhi. Preformulation studies of drug including organoleptic properties, melting point and flow properties were studied. Preparation of bioadhesive vaginal gel: Propranolol hydrochloride gel formulations were prepared using sodium alginate and guar gum as gelling agents.
Table.1.Formulation chart of Propranolol bioadhesive gel Drug Na CMC Tragacanth Methyl Propyl paraben (mg) (gm) (gm) paraben (gm) (gm) 1 ----2 ----3 ----4 ----500 0.4 0.6 ----1 ----2 ----3 ----4
Gelling agent was dispersed in small quantity of citrate phosphate buffer [0.1(M), pH 4] and stored overnight to ensure complete hydration. The drug was initially dissolved in a mixture of PVP K30 and water (5:3) and added to polymer dispersion. Methyl paraben and propyl paraben were also added slowly with continuous stirring. The final weight of the gel was adjusted to 100 gm with citrate phosphate buffer [0.1(M), pH 4]. Entrapped air bubbles were removed by keeping the gels in vacuum desiccators. Evaluation of bioadhesive vaginal gel: Percentage yield: The percent yield was calculated as the weight of the formulations recovered from each batch divided by total weight of drug and other all ingredients used to prepare Formulations multiplied by 100. The percentage yield of each formulation was replicated three times. The yield was calculated by the following formula: Y={Pm-Zg}/Tm[P+Ig]100, Where Y = yield, Pm = practical mass, ZG = vaginal gel, Tm = theoretical mass, P = polymer and Ig = ingredients. (Chatterjee A, 2011) Determination of pH: The pH of the gel was determined by a digital pH meter. 1 gm of gel was dissolved in 25 ml of distilled water and the electrode was then dipped in to gel formulation and constant reading was noted. The measurement of pH of each formulation was replicated three times. (Nayak SB, 2010) Syringibility: Syringibility study was carried out by using a 22 gauze needle. (Yellanki SK, 2010)
Estimation of drug in vaginal gel: About 6 gm of gel was weighed accurately and dissolved in citrate phosphate buffer pH 4 of sodium lauryl sulphate (1% w/v SLS). After appropriate dilutions, the drug content was analyzed spectrophotometerically at 290 nm. (Nayak S, 2010) Drug content uniformity: Initially, the formulations were tested for homogeneity by visual inspection. To ensure the homogeneity of drug content in the formulation of the gel, six tubes were sampled from the different locations of the mixer and assayed for the drug content as stated above. Studies were performed in triplicate for all the formulations. (Nayak SB, 2010) Determination of spreadability: Spreadability study was carried out by transferring the 6 gm of gel formulation to the center of a glass plate and compressed under several glass plates having wt 1005 gm each after every 1 min and the spread diameters recoded each time. (Yellanki SK, 2010) Extrudability study: In conducting the test, a closed collapsible tube containing above 20 gm of the gel was pressed firmly at the crimped end and a clamp was applied to prevent any rollback. The cap was removed and the gel was allowed to extrude until the pressure was dissipated. (Nayak SB, 2010) Bioadhesion measurement: Isolated goat vaginal tissue (Capra hircus, local breed, obtained immediately after killing of animals at a slaughter house) was cleaned and then separated from the supporting muscular and connective tissues taking care to maintain integrity of mucosa, and kept at 0C
IJRPB 1(6)
www.ijrpb.com
Page 870
Hardeep and Sankar
till further use. Before experiments, goat vaginal tissue was thawed in normal saline. The bioadhesion measurement was performed using a modified balance method intact with freshly excised goat vaginal mucosal membrane as an in vitro model. The two pans of physical balance were removed. Right pan was replaced with a 100 ml beaker and on left side, a glass slide was hanged. For balancing the assembly, a weight of 20 gm was hanged on left side. Another glass slide was placed below the hanged slide. Portions of vaginal membranes were attached with both slides. The height of this setup was so adjusted, in such a way that it leaves a space of about 0.2 cm between two vaginal membrane faces. 1 gm of gel was placed between two vaginal membrane faces. Little pressure was applied to form bioadhesion bond, and then slowly drop of water was added on right side beaker, till the gel was separated from one face of vaginal membranes attached. Volume of water added was converted to mass. This gave the bioadhesive strength of gel in gm. An initial investigation examined the reproducibility of the system using three same formulations. The study was carried out for all formulations. (Yellanki SK, 2010) Partition coefficient determination: An equal volume from n-octanol and citrate phosphate buffer pH 4 were saturated with each other for 24 hrs, the two phases were separated. Certain weight of either the drug or an equivalent weight of the gel was dissolved in 10 ml of the aqueous phase to give the concentration of 0.5 mg/ml. The final solution transferred to a stoppered glass bottle. The final solution transferred to a stoppered glass bottle containing 10 ml of n-octanol. The systems were agitated in a thermostated water bath at 371C for 24 hrs, the phases were then separated, the aqueous phase was filtered and the concentration of the max drug was determined spectrophotometrically at 290 nm against a blank solution prepared in an analogous manner. The concentration of the drug in octanol was calculated from the difference between the initial and final concentrations of the drug in the buffer phase. The partition coefficient was calculated according to Nernst equation. K = Corg/Caqu. Where: K = partition coefficient, Corg is the concentration of the drug in organic phase, Caqu is the
concentration of the drug in buffer. (Ramadan AA, 2008) In vitro drug release: The in vitro release of drug was determined from different vaginal gel formulations using a dialysis bag prepared by cellophane membrane placed in the release medium. A cellophane membrane cut to suitable size boiled in distilled water for 1 hr, soaked in absolute alcohol for half an hour and stored in citrate phosphate buffer pH 4 for 24 hrs before use. 6 gm of gel formulations were packed into the cellophane membrane bags (50 mm). The release medium was 100 ml citrate phosphate buffer pH 4 containing 1% tween 80, providing sink conditions for Propranolol hydrochloride. The medium was maintained at 37C and stirred at 100 rpm. At various time intervals (1 hr), 5 ml of dissolution fluid was collected. Levels of drug in the samples were analyzed with the UV spectrophotometer at 290 nm. (Chatterjee A, 2011) Accelerated stability study: Stability studies were performed according to ICH guidelines. The formulations were stored at room temperature and accelerated storage conditions at 451C for a period of 3 months. The samples were analyzed for drug content by UV spectrophotometer at 290 nm. (Nayak SB, 2010) RESULTS AND DISCUSSION In this study bioadhesive vaginal gel of Propranolol hydrochloride with different amounts of Na CMC and tragacanth were prepared and prolonged release of the drug was demonstrated. The compatibility between the drug and polymers were confirmed by IR spectrophotometer. The pH, %yield and drug content of the gel formulations F1-F8 was found to be in the range of 4.020.06 to 4.280.04, 91.90.13 to 95.30.02 and 25.370.05 to 27.780.1respectively (Table 3). The bioadhesion strength of the gel formulations F1-F8 was found to be in the range of 13.20.01 to 24.60.05 gm respectively (Table 4). The optimum partition coefficient of either Propranolol hydrochloride alone or formulated into vaginal gel between n-octanol and citrate phosphate buffer pH 4 was determined and found to be 3.120.14 at 37C. It was also observed that with increase in polymer concentration the syringibility becomes difficult but the extrudability improved.
IJRPB 1(6)
www.ijrpb.com
Page 871
Hardeep and Sankar
Table.2.Preformulation parameters of Propranolol hydrochloride

Characters Nature Colour Odour Taste Melting point Solubility: In water In acetone In methanol In ethanol In chloroform Bulk density Tapped density Carrs index Hausners ratio Angle of repose Assay Inference Crystalline powder. White Odourless Slightly bitter taste 165C Practically insoluble Fully soluble Soluble Soluble Soluble 0.650.03 gm/cc 0.550.02 gm/cc 19.230.12 1.240.03 Good flow 26.50.05 99.1%
Table 3: Physical appearance, pH, %yield and drug content of Propranolol hydrochloride gel formulations (F1-F8)
Formulation F1 F2 F3 F4 F5 F6 F7 F8 Physical appearance White emulsion Off white emulsion Off white lotion Off white lotion Dark gray cream Gray emulsion Blackish gray lotion Light brown
#
pH# 4.130.11 4.020.06 4.160.07 4.210.05 4.080.11 4.280.04 4.240.07 4.120.06
%yield# 94.60.07 92.10.03 94.50.08 95.30.02 92.70.12 93.50.11 91.90.13 92.80.06
Drug content# 27.780.1 27.420.07 26.970.09 26.40.11 26.680.12 26.190.03 25.840.08 25.370.05
MeanSD (n=3)
Table.4.Bioadhesion strength, syringibility and extrudability study of Propranolol hydrochloride gel formulations F1F8
Formulation F1 F2 F3 F4 F5 F6 F7 F8
#
Bioadhesion strength# (gm) 19.80.03 21.20.07 23.10.09 24.60.05 13.20.01 14.70.04 16.30.12 18.10.13
Syringibility *** *** *** *** *** *** ** **
Extrudability * * * * * * * *
MeanSD (n=3), *-poor, ** good, *** very good, **** excellent
Figure.1.Spreadability of mucoadhesive vaginal gel formulations F1-F4
IJRPB 1(6)
www.ijrpb.com
Page 872
Hardeep and Sankar
Figure.2.Spreadability of mucoadhesive vaginal gel formulations F5-F8
Figure 3: In vitro drug release profile of formulation F1F4
Figure.4. In vitro drug release profile of formulation F5F8 Table.2.Stability study of formulation 8 pH# Syringability Extrudability Drug content# (mg) 4.210.05 *** * 26.40.11 4.450.05 ** ** 25.80.08 5.230.05 ** ** 24.60.07 # MeanSD (n=3), *-poor, ** good, *** very good, **** excellent
Time(months) 1 2 3
%CDR 87.542613 90.654467 93.123223
CONCLUSION In-vitro drug release of Propranolol hydrochloride from the bioadhesive gel formulations showed that the films containing higher concentration of polymers released the drug slowly as compared to the formulations with lower concentration. The formulations maintained the sustained drug release for a period of more than 54 hrs. The formulation F4 having 4% Na CMC concentration was selected as the best formulation. The results of the study give a rational guideline for formulating a sustained release
vaginal drug delivery system of Propranolol hydrochloride for effective contraception. REFERENCE Alexander NJ, Baker E, Kaptein M and Miller L, Why consider vaginal drug administration, Fertilization Sterilization, 8(2), 2004, 1-12. Chatterjee A, Bhowmik BB and Thakur YS; Formulation, in vitro and in vivo pharmacokinetics of anti HIV vaginal bioadhesive gel, Journal of Young Pharmacists, 3(2), 2011, 83-89.
IJRPB 1(6)
www.ijrpb.com
Page 873
Hardeep and Sankar
Hussain A and Ahsan F, The vagina as a route for systemic drug delivery, Journal of Controlled Release, 103, 2005, 301-313. Kumar L, Verma R, Advantages of intra-vaginal drug delivery system: an overview, International Journal of Pharmaceutical Research and Development, 2(6), 2010, 15-23. Nayak SB, Rout PK, Nayak UK and Bhowmik BB, Development and characterization of bioadhesive gel of microencapsulated metronidazole for vaginal use, Iranian Journal of Pharmacy Research, 9(3), 2010, 209-219. Patil SA, Rane BR, Bakliwal SR and Pawar SP, Pragmatic hydrogels, International Journal of
Research in Ayurveda and Pharmacy, 2(3), 2011 758766. Ramadan AA, Formulation and evaluation of bioadhesive gels containing miconazole nitrate, Journal of Applied Science and Research, 4(9), 2008, 1052-1065. Yellanki SK, Narella NK, Goranti S and Deb SK, Development of metronidazole intravaginal gel for the treatment of bacterial vaginosis, effect of mucoadhesive natural polymers on the release of Metronidazole, International Journal of Pharmaceutical Research and Development, 2(3), 2010, 1-6.
IJRPB 1(6)
www.ijrpb.com
Page 874
Sadat Ali et.al
Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment of osteoarthritis of the knee: a randomized controlled trial
Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali*, Ahmed A Tantawy Department of Orthopaedic Surgery, College of Medicine, University of Dammam, Saudi Arabia. King Fahd Hospital of the University, AlKhobar, 31952, Saudi Arabia. *Corresponding author: Email: drsadat@hotmail.com, Tel: +966505848281, Fax: +966138820887 ABSTRACT Osteoarthritis of the knee is common among Saudi Arabian men and women. Oral NSAIDS are most commonly used, however, it often have serious adverse effects especially GI complications. This study is designed to determine if this herbal topical cream (Max-Relief-MR a combination of menthol, camphor and Bosweilla serrata) has beneficial, long-term effects on osteoarthritis (OA) comparable or superior to the gold standard Diclofenac gel. Key words: Osteoarthritis, Herbal topical cream, Bosweilla serrata, NSAIDS 1. INTRODUCTION Osteoarthritis (OA) is the degenerative aging process, which can affect any joint of the body but the weight bearing joints like knee and the hip are most commonly affected. It has been suggested that age, sex and body weight influence the severity of the disease. The prevalence of OA of the knee is unknown but recently it was estimated that 12.5% of the general population aged 45 years suffer from OA of the knee (Jordan, 2005). Among the ethnic Saudi Arabian population OA of the knee was reported to be between 1.19 to 3.5% (Sadat-Ali, 1996; Ahlberg, 1990), but in a decade and half the prevalence of clinical OA of the knee jumped to 13% (Al-Arfaj, 2003) and radiological OA of knee to 53% in males and 60.9% in females (AlArfaj, 2002). In the last decade the incidence of OA among the Saudi Arabian population has increased drastically (Sadat-Ali, 1996; Al-Arfaj, 2003), but still our treatment modalities have not changed beyond NSAIDs and physical therapy. Although majority of patients show progression with increase of pain, joint destruction and decrease in the quality life. The severity of the disease varies among ethnic populations and among the same populations groups. Traditionally OA has been managed by pharmacological treatments which include NSAIDS, Opioid analgesics, topical applicants, intra-articular injections and nutritional supplements (Jawad, 2007; Brabant, 2005; Schuh, 2007; Bellamy, 2006; Bruyere, 2007; Sadat-Ali, 2006). NSAIDS often have serious adverse effects especially GI complications, renovascular and respiratory complications. Recent research witnessed innovations in technology of drug delivery to overcome the disadvantages of oral drug therapy (Alarcon, 2002). As a result topical applications of NSAIDs are formulated to penetrate the skin, subcutaneous fatty tissue, and muscle in amounts sufficient to exert local therapeutic effects, without reaching higher plasma drug concentrations. Volume 1(4) Recently herbal products have been used in the management of early in OA and one, which stands out, is Bosweilla Serrata (BS) (Frankincense). Frankincense is the resin from the trees of the genus Boswellia, native to Arabia and Asia. It has a long history of use and its medicinal properties have been appreciated for millennia. Several trials of the oral use of BS in the treatment of osteoarthritis have been published (Sander, 1998; Kimmatkar, 2003; Sontakke, 2007; Schuh, 2007; Abdel-Tawab, 2011), but to date there is no report of topical use of BS. Max-Relief is a topical analgesic for use of arthritis, backache, sprains etc was developed at King Fahd University Hospital of the University of Dammam, University of Dammam. Max-Relief is USFDA approved as over the counter (OTC) use and sold in US market since 2008. We have embarked on this study for use of Max-Relief in OA of knee and its efficacy as an herbal topical agent and to compare with topical diclofenac. The study will also assess the safety of the herbal topical applicant NSAID over a 12-week treatment course in symptomatic primary OA of the knee. 2. MATERIALS AND METHODS King Fahd Hospital of the University, AlKhobar is a 480-bed tertiary care hospital of the College of Medicine, Dammam University, Dammam. The study was carried out at the Osteoarthritis and Arthroplasty Unit of the Department of Orthopaedic Surgery, between February 2012 and January 2013. Two hundred and fifty consecutive patients with a confirmed diagnosis of OA of the knee were included in the study after informed consent was obtained. The demographic data such age, sex weight and height, duration of OA, known diseases, medications in use were collected at the interview and from the medical records. The physical function and pain were assessed by mWOMAC score. After recruitment, the subjects were randomly distributed into two groups. The inclusion criteria included participants who were able Page 875
July-August 2013
Mir Sadat-Ali et.al
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology consent assessment of function was measured by the modified Western Ontario and McMaster Universities (mWOMAC) grading and pain assessment by VAS (Visual Analouge Scale). Patients were randomized into two groups, oral NSAIDs were discontinued and they received either Max-Relief or Diclofenec gel. Patients were allowed to take Paracetamol unto 1.5 gm/day along with the ointment if required. If patients required more analgesia the case was excluded from the study and it was considered failure of treatment. Participants were instructed to apply either of the treatment modality three times a day directly to the painful knees for 12 weeks. The patients were evaluated after a run-in period of one week (week 0) and then at 6 weeks and 12 weeks. The clinical assessments included visual analog scale (VAS) score that assessed pain and stiffness and measured by the (mWOMAC) LK3 , as well as physician's and patients' overall opinions on improvement. Safety assessments included any adverse events directly related to the topical applications. Baseline demographic data and clinical variables were analysed by Chi-square or Student's t-Test. The incidence of adverse event will be analyzed by Fisher's Exact Test. Continuous variables (WOMAC dimensions, PGA and pain on walking) were analyzed by ANCOVA with baseline score as the covariate. 3. RESULTS AND DISCUSSION Two hundred and forty-two patients (122 study group and 120 control group) completed the stay for 12 weeks. There were no complications in both the groups to stop the treatment protocol. All the parameters in the demographic data was not statistically significant except the weight for the study group was more than the control group 79.4618.05 versus 75.3216.4 (p<0.006). The comparison of stiffness, pain during day and pain at night showed that at 6 weeks pain improved significantly during day P<0.01 and 12 weeks the three parameters improved significantly in the study group patients at P<0.001. The fourth parameters compared of daily activities; prayers, STS (sit to stand), walking flat and climbing stairs. There was no improvement at prayers at 12 weeks in both the groups but walking on flat surface the improvement at 876 6 weeks (P<0.002) and 12 weeks of P<0.3, stairs climbing was improved in the study group at 12 weeks P<0.001. (Table.3). In this randomized controlled trial, we tested the Max-Relief (a combination of Bosweilla Serrata, Camphor and Menthol) and were evaluated for its clinical efficacy in patients suffering from OA of knee Page 877
to understand risks and benefits of the protocol and be able to give informed consent. Patients (both male and female) between 40 to 70 years of age with radiographically confirmed grade 1, 2 & 3 were included the study. Following adhered: Exclusion criteria will be strictly
Secondary arthritis (inflammatory arthropathy, rheumatoid arthritis, gouty arthritis) Prior knee surgery History of ligament instability of knee, traumatic meniscal tear or traumatic cartilage damage Known or suspected pregnancy. Hypersensitivity to nonsteroidal antiinflammatory drugs, abnormal liver or kidney function tests, history of peptic ulceration and upper gastrointestinal hemorrhage. Severe OA requiring surgical intervention (Grade-4) Intra-articular corticosteroid or Hyaluronic acid within the preceding 6 months. After enrollment Subjects were helped to complete baseline questionnaires, blood work and radiological study was performed to assess grade of osteoarthritis and rule out secondary causes. WOMAC scoring was recorded before starting their treatment. (Changes made because WOMAC scoring is a functional scoring system). Patients were asked to apply approximately 5 ml of the ointment three times a day for 12 weeks. They were seen clinically at 0 weeks, 6 weeks and 12 weeks. Investigators interviewed each subject on a preset questionnaire. Various parameters of serum biochemistry, hematology were carried out on each evaluation day (at 0, 6 and 12 weeks). Safety was monitored by clinical and laboratory assessments during the study visits and patient-reported adverse events during the treatment will be recorded. The data was analyzed using SPSS (Statistical Package for the Social Sciences), version 14.0, Chicago, Illinois. Data was expressed as mean standard deviation (SD). Statistical significance differences between groups were determined with Student's t-test and p values of 0.05 using Confidence Interval (CI) of 95% were considered as significant. Two hundred and forty two men and women, age 4073 years, with radiologically confirmed primary OA of the knee and who presented to the Osteoarthritis and Arthroplasty Unit (OAU) of the King Fahd Hospital of the University, AlKhobar for pain relief were the study individuals. After informed Volume 1(4)
July-August 2013
Mir Sadat-Ali et.al
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology Reports indicate that topical NSAIDs are comparable and alternative to oral NSAIDs with fewer severe adverse events and provide good levels of pain relief in knee osteoarthritis (Klinge, 2013). Camphor and menthol are well known analgesics and the addition of BS an anti-arthritic proved to be a better combination in the relief of pain but also reduced stiffness and increased the quality of daily life of the men and women suffering with OA knee. Our clinical study has some limitations. Firstly, we did not assess the biomarkers for synovial inflammation and to detect the articular changes and CII degradation biomarkers, such as CTX-II, C1, 2C and C2C and secondly for a condition like OA we should have more of patients, as this is a pilot study the results and its implications are justified. The strength of this pilot study is that this is the first study randomized to test the topical BS and was compared with a known NSAID. In conclusion our study has shown that BS in combination of camphor and menthol (Max-Relief) is a safe potent analgesic and anti-arthritic ointment, which improves the pain, stiffness and daily life activities in patients with OA of knee. We believe the product should be further investigated in large-scale patients. 4. CONCLUSION This randomized control study shows that Max-Relief a combination of camphor, menthol and Bosweilla serrata is potentially a safe and effective topical treatment in the management of OA and produced comparative pain relief to the Diclofenac gel. ACKNOWLEDGEMENT The authors thank deanship of scientific research, University of Dammam for awarding a grant to complete this study vide # 2012099 of 2011.
P Value 0.9 0.3 0.4 0.8 0.006 (CI at 95% <7.05) 0.4 0.8
(K/L grades mainly IIII). Our data supports the efficacy of the of MR in the reduction of pain and improvement in activities between 6 and 12 weeks of the continuous use from the baseline compared to the control group who were using diclofenac in patients with OA of knee. This study suggests that MR was effective in improving pain and some of the symptoms associated with knee OA. However, one thing was certain that the patients using MR was better than diclofenac and MR did not significantly improve all the parameters tested. In the recent past the gum resin extracted from the ancient herb, Frankincense (Boswellia serrata) has gained lot of attention as a potent anti-inflammatory, anti-arthritic and analgesic agent (Ethan, 2004; Singh, 1986). 3-O- acetyl-11-ketobeta-boswellic acid (AKBA) is the most active component of Boswellia extract and has been demonstrated to be a potent inhibitor of 5-lipoxygenase (5-LOX), which is a key enzyme in the biosynthesis of leukotrienes from arachidonic acid in the cellular inflammatory cascade (Sailer, 1996). Sengupta, 2008, showed that 5-Loxin reduces pain and improves physical function in patients with OA and it is safe for human use. This study which used topical BS showed that it could be used in the management of OA of knee. Pharmacologic agents in the management of for OA include, from oral analgesics to anti-inflammatory agents, intra-articular corticosteroids, and hyaluronic acid in mild-to-moderate OA-related pain (Zhang, 2008; Zhang, 2007; Zhang, 2005; Jordan, 2003). Presently based on evidence it is recommended that the use of topical NSAIDs and rubefacients (Walker-Bone, 2000; Altman, 2000) as a therapeutic option be potentially with fewer gastrointestinal risks than oral NSAIDs (Evans, 1995).
Parameter
Table.1. Demographic Data of the Study and the Control Groups Study Group Control Group 122 59.189.25 45 77 43.49 58.1 79.4618.05 165.28.31 2.481.20 120 59.128.1 50 70 42.739.1 75.3216.4 164.657.49 2.460.96
Number of Patients Age in years Males Females Duration of Symptoms months Weight in KGs Height in centimeters Kellegren and Lawrence Grading
Volume 1(4)
July-August 2013
Page 877
Mir Sadat-Ali et.al

Parameter Stiffness 0 Stiffness 6 Stiffness 12 weeks Pain during day 0 Pain at 6 weeks Pain at 12 weeks Night Pain at 0 Night pain at 6 weeks Night Pain at 12 weeks
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology
Table.2. Pain and stiffness parameters Study Group Control Group 5.961.29 5.98 1.34 3.451.6 3.541.57 2.151.36 3.181.23 4.681.26 4.781.43 2.230.94 2.761.1 1.330.92 1.930.94 5.61.98 5.391.75 2.961.3 3.141.2 1.631.32 2.841.27 Table.3.Comparison of the daily activities Study Group Control Group 6.452.76 6.361.89 4.861.41 4.651.38 3.21.4 3.321.3 6.271.89 6.321.89 3.631.39 3.751.36 2.21.43 2.391.13 4.630.9 4.650.9 2.121.26 2.460.94 1.271.46 1.531.36 6.121.07 6.151.07 3.60.96 3.720.97 2.51.11 2.971.1 P Value 0.8 0.7 0.001 (CI at 95% <-0.8117) 0.4 0.001 (CI at 95% <0.3348 0.001 (CI at 95% <-0.4332) 0.1 0.1 0.001 (CI at 95% <-0.9840)
Parameter Prayers at 0 Prayers at 6 Prayers at 12 Sit to Stand 0 Sit to Stand 6 Sit to Stand 12 Walk Flat 0 Walk Flat 6 Walk Flat 12 Stairs 0 Stairs at 6 Stairs at 12
P Value 0.5 0.7 0.1 0.6 0.8 0.1 0.7 0.002 (CI at 95% <-0.1732) 0.03 (CI at 95% <-0.0187 0.8 0.1 0.001(CI at 95% <-0.2748)
REFERENCES Abdel-Tawab M, Werz O, Schubert-Zsilavecz M, Boswellia serrata: an overall assessment of in vitro, preclinical, pharmacokinetic and clinical data, Clin Pharmacokinet, 50(6), 2011, 349-69. doi: 10.2165/11586800. Ahlberg A, Linder B, Binhemd TA. Osteoarthritis of the hip and knee in Saudi Arabia, Int Orth, 14(1), 1990, 29-30. Alarcon L, Escnbano E, A comparative study of the transdermal penetration of a series of nonsteroidal antiinflammatory drugs, Journal of Pharmaceutical Sciences, 86 (24), 2002, 503-308. Al-Arfaj A, Al-Boukai AA, Prevalence of radiographic knee osteoarthritis in Saudi Arabia, Clin Rheumatol, 21(2), 2002, 142-5. Al-Arfaj AS, Alballa SR, Al-Saleh SS, Al-Dalaan AM, Bahabry SA, Mousa MA, Knee osteoarthritis in AlQaseem, Saudi Arabia, Saudi Med J, 24(3), 2003, 2913.
Altman RD, Hochberg MC, Moskowitz RW, Schnitzer TJ, Recommendations for the medical management of osteoarthritis of the hip and knee: New OA practice management guidelines from the ACR, Arthritis Rheum, 43, 2000, 1905-1915. Bellamy N, Campbell J, Robinson V, Gee T, Bourne R, Wells G. Intra-articular corticosteroid for treatment of osteoarthritis of the knee, Cochrane Database Syst Rev, 19;(2), 2006, CD005328. Brabant T, Stichtenoth D, Pharmacological treatment of osteoarthritis in the elderly, Z Rheumatol, 64(7), 2005, 467-72. Bruyere O, Reginster JY, Glucosamine and chondroitin sulfate as therapeutic agents for knee and hip osteoarthritis, Drugs Aging, 24(7), 2007, 573-80. Ethan B, Heather B, Theresa DH, Ivo F, Sadaf H, Jens H, David S, Catherine U, Boswellia: An evidencebased systematic review by the natural standard research collaboration, J Herbal Phar- macother, 4, 2004, 63-83. Page 877 878
Volume 1(4)
July-August 2013
Mir Sadat-Ali et.al
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology Safayhi H, Mack T, Sabieraj J, Anazodo MI, Subramanian LR, Ammon HPT: Boswellic acids: novel, specific, nonredox inhibitors of 5lipoxygenase, J Pharmacol Exp Ther, 26, 1992, 11431146. Sailer ER, Subramanian LR, Rall B, Hoernlein RF, Ammon HPT, Safayhi H: Acetyl-11-keto--boswellic acid (AKBA): structure requirements or binding and 5lipoxygenase inhibitory activity, Br J Pharmacol, 117, 1996, 615-618. Sander O, Herborn G, Rau R. Is H15 (resin extract of Boswellia serrata, incense) a useful supplement to established drug therapy of chronic polyarthritis? Results of a double-blind pilot study. [German] Z Rheumatol, 57, 1998, 11-16. Schuh A, Jezussek D, Fabijani R, Honle W, Conservative therapy of knee osteoarthritis, MMW Fortschr, 149, 2007, 31-32. Sengupta K, Alluri KV, Satish AR, Mishra S, Golakoti T, Sarma KV, A double blind, randomized, placebo controlled study of the efficacy and safety of 5Loxin(R) for treatment of osteoarthritis of the knee, Arthritis Res Ther, 10, 2008, R85. doi:10.1186/ar2461. Singh GB, Atal CK, Pharmacology of an extract of salai guggal ex-Boswellia serrata, a new non-steroidal anti-inflammatory agent, Agents Actions, 18, 1986, 407-412. Sontakke S, Thawani V, Pimpalkhute P, Kabra P, Babhulkar S, Hingorani H, Open, randomized, controlled clinical trial of Boswellia serrata extract as compared to valdecoxib in osteoarthritis of knee, Indian J Pharmacol, 39, 2007, 27-9. Walker-Bone K, Javaid K, Arden N, Cooper C, Regular review:medical management of osteoarthritis, BMJ, 321, 2000, 936-940. 6. Zhang W, Doherty M, Arden N, et al. EULAR evidence based recommendations for the management of hip osteoarthritis: report of a Task Force of the EULAR Standing Committee for International Clinical Studies Including Therapeutics (ESCISIT), Ann Rheum Dis, 64(5), 2005, 669-681. Page 877 879
Evans JM, McMahon AD, McGilchrist MM, White G, Murray FE, McDevitt DG, MacDonald TM, Topical non-steroidal anti- inflammatory drugs and admission 878 to hospital for upper gastrointestinal bleeding and perforation: a record linkage casecontrol study, BMJ, 311, 1995, 22-26. Jawad AS, Irving K, Drug treatment modalities in patients with chronic osteoarthritis of the hip or knee, Saudi Med J, 28(3), 2007, 375-8. Jordan K, Croft P, The prevalence and history of knee osteoarthritis in general practice: a casecontrol study, Family Practice, 22(1), 2005, 103-108. Jordan KM, Arden NK, Doherty M, Bannwarth B, Bijlsma JW, Dieppe P, EULAR Recommendations 2003: an evidence based approach to the management of knee osteoarthritis: Report of a Task Force of the Standing Committee for International Clinical Studies Including Therapeutic Trials (ESCISIT). Ann Rheum Dis, 62, 2003, 1145-1155. 5. Kimmatkar N, Thawani V, Hingorani L, Khiyani R, Efficacy and tolerability of Boswellia serrata extract in treatment of osteoarthritis of kneea randomized double blind placebo controlled trial, Phytomedicine, 10, 2003, 3-7. Klinge SA, Sawyer GA, Effectiveness and safety of topical versus oral nonsteroidal anti-inflammatory drugs: a comprehensive review, Phys Sportsmed, 41(2), 2013, 64-74. Mazieres B, Rouanet S, Velicy J, Topical Ketoprofen Patch (100 mg) for the treatment of Ankle Sprain, a randomized, double-blind, placebo-controlled study, American Journal of Sports Medicine, 33 (4), 2005, 515- 524 Sadat-Ali M, Al-Gindan Y, Al-Mousa M, Al-Rubaish A, Al-Omari E, Osteoarthritis of the knee among Saudi Arabian security forces personnel, Mil Med, 161(2), 1996, 105-7. Sadat-Ali M, Al-Habdan I, El-Hassan AY, Is there an alternative to NSAIDs and Cox-2 Inhibitors in the Management of Osteoarthritis of Knee, Ostetoporosis Inter, 17(1), 2006, 192. Volume 1(4)
July-August 2013
Mir Sadat-Ali et.al
ISSN: 2321-5674(Print) ISSN: 2320 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology
Zhang W, Doherty M, Leeb BF, EULAR evidence based recommendations for the management of hand osteoarthritis: report of a Task Force of the EULAR Standing Committee for International Clinical Studies Including Therapeutics (ESCISIT), Ann Rheum Dis, 66(3), 2007, 377-388. Zhang W, Moskowitz RW, Nuki G, OARSI recommendations for the management of hip and knee osteoarthritis, part II: OARSI evidence-based, expert consensus guidelines, Osteoarthritis Cartilage, 16(2), 2008, 137-162.
Volume 1(4)
July-August 2013
Page 877 880
Farhana Pattan et.al
Analytical method development and validation for the estimation of Olmesartan medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms
Farhana Pattan1, Haritha Pavani1, Chandana N1, Karimulla M2 1.Department of pharmaceutical analysis, Nimra College of Pharmacy, Vijayawada 2.Department of pharmaceutical analysis, Krishna University, Machilipatnam *Corresponding Author: E.mail:farhana.pattan@gmail.com, Phone no: 8885818293 ABSTRACT A simple rapid, accurate, precise and reproducible validated reverse phase UPLC method was developed for the determination of Olmesartan medoxomil in bulk and pharmaceutical dosage forms. The quantification was carried out using Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 m) column run in Isocratic way using pH 3.4 Buffer: Acetonitrile (60:40% v/v)] and a detection wavelength of 250nm, and injection volume of 4L, with a flow rate of 0.3mL/min. The retention times of Olmesartan medoxomil was found to be 3.418. The method was validated in terms of linearity, precision, accuracy, LOD, LOQ and robustness in accordance with ICH guidelines. The linearity ranges of the proposed method lies between 0.080 mg/mL to 0.120 mg/mL, which is equivalent to 10% to 150% and with correlation coefficient of r2=0.9999.The assay of the proposed method was found to be 98.79%. The recovery studies were also carried out and mean % Recovery was found to be 100.5%. The % RSD from reproducibility was found to be <2%. The proposed method was statistically evaluated and can be applied for routine quality control analysis of Olmesartan medoxomil in bulk and in Pharmaceutical dosage form. Key Words: Olmesartan medoxomil, RP-UPLC, Waters acquity UPLC BEH C18, Tablets, Validation. 1. INTRODUCTION Olmesartan medoxomil is (5-methyl-2-oxo2H-1,3-dioxol-4-yl)methyl 4-(2-hydroxypropan-2-yl)2-propyl-1-({4-[2-(2H-1,2,3,4-tetrazol-5yl)phenyl]phenyl}methyl)-1H-imidazole-5carboxylate.The molecular weight is 558.59,molecular formula is C29H30N6O6. Olmesartan is a prodrug that works by blocking the binding of angiotensin II to the AT1 receptors in vascular muscle; it is therefore independent of angiotensin II synthesis pathways, unlike ACE inhibitors. By blocking the binding rather than the synthesis of angiotensin II, olmesartan inhibits the negative regulatory feedback on renin secretion. As a result of this blockage, olmesartan reduces vasoconstriction and the secretion of aldosterone. This lowers blood pressure by producing vasodilation, and decreasing peripheral resistance and is used as antihypertensive. Literature review reveals very few methods are reported for the assay of Olmesartan medoxomil in Tablet dosage forms using RP-HPLC method and no method has been developed by RP-UPLC. The proposed RP-UPLC method utilizes economical solvent system and having advantages like less time consuming, better retention time, less flow rate, very sharp and symmetrical peak shapes. The aim of the study was to develop a simple, precise, economic and accurate RP-UPLC method for the estimation of Olmesartan medoxomil in Tablet dosage forms.
Figure.1.Structure of olmesartan medoxomil 2. MATERIALS AND METHODS UV-3000 LABINDIA double beam with UV win 5software UV-VISIBLE spectrophotometer, with 1cm matched quartz cells. UPLC ACQUITY; 2996 PDA, Waters Acquity UPLC BEH column Chemicals and reagents: Gifted sample of Olmesartan medoxomil pure sample and dosage form of marketed formulation was purchased from local pharmacy. Other chemicals all are of HPLC grade and GR grade. Preparation of mobile phase: Preparation of pH 3.4 Buffer: Dissolve 2.04gm of monobasic potassium phosphate in 1000mL of water, mix well adjust to pH 3.4 with diluent OPA (1mL in 10mL of water) and filtered through 0.22m filter.and mix the pH3.4Buffer and CAN in the ratio of(60:40%v/v) Standard solution preparation: weighed and transferred about 50mg of Olmesartan medoxomil working standard in to a 100ml volumetric flak, added 60ml of acetonitrile and sonicated to dissolve, diluted up to the volume with acetonitrile. Diluted 4ml of the above solution to 50ml with diluents and filtered through 0.22um filter.
IJRPB 1(6)
www.ijrpb.com
Page 881
Preparation of sample solution: Five tablets were weighed and finely powdered and a powder quantity equivalent to 50mg of Olmesartan medoxomil were accurately weighed and transferred to a 100ml volumetric flask and 60ml of acetonitrile was added to the same. The flask was sonicated and volume was made up to the mark with acetonitrile. Diluted 4ml of the above solution to 50ml with diluents and filtered through 0.22um filter,mixed well and injected. The amount present in each tablet was calculated by comparing the area of standard Olmesartan medoxomil and tablet sample. Method optimization: The chromatographic separation was performed using Waters Acquity UPLC BEH C18 (100 mm X 2.1 mm, 1.7m) column. For selection of mobile phase, various mobile phase compositions were observed for efficient elution and good resolution. The mobile phase consisting of pH 3.4 Buffer: ACN (60:40% v/v)] was found to be the optimum composition for efficient elution of analyte. The mobile phase was injected to the column at a flow rate of 0.3 ml/min for 6min. The column temperature was maintained at 25oC, Injection volume was 4L. The analyte was monitored at 250 nm using PDAdetector. The retention time of the drugs was found to be 3.418min. Water:ACN(50:50) was used as diluent during the standard and test samples preparation. The optimized chromatographic conditions are mentioned in Table-1 and chromatogram for standard was shown in the figure no: 2 3. RESULTS AND DISCUSSION Method Validation System suitability: System suitability tests are an integral part of method validation and are used to ensure adequate performance of the chromatographic system. Retention time (RT), number of theoretical plates (N) or column efficiency and tailing factor (T) were evaluated for six injections of standard solution at a solution of 40g/ml of Olmesartan medoxomil. Specificity: Specificity is the ability of analytical method to measure accurately and specifically the analyte in the presence of components that may be expected to be present in the sample. The specificity of method was determined by spiking possible impurities at specific level to standard drug solution (40ppm). The diluent and placebo solutions were also injected to observe any interference with the drug peak. Linearity: Linearity is the ability of the method to produce results that is directly proportional to the concentration of the analyte in samples with given range. The linearity of Olmesartan medoxomil was in
the concentration range of 10-150%.From the linearity studies calibration curve was plotted and concentrations were subjected to least square regression analysis to calculate regression equation. The regression coefficient was found to be 0.9999 shows good linearity. Accuracy: Accuracy is the closeness of results obtained by a method to the true value. It is the measure of exactness of the method. Accuracy of the method was evaluated by standard addition method. Recovery of the method was determined by spiking an amount of the pure drug (50%,75%,100% ,150%) at four different concentration levels in its solution has been added to the pre analyzed working standard solution of the drug. Precision: The precision of the analytical method was studied by analysis of multiple sampling of homogeneous sample. The Precision expressed as standard deviation or relative standard deviation. System precision: System precision was performed by injecting a standard solution of Olmesartan medoxomil for six times. Method precision: Method precision was performed by analyzing a sample solution of Olmesartan medoxomil by injecting six replicates of the same sample preparations at a concentration of 44.8ppm/mL. Intermediate precision(Ruggedness): Intermediate precision was performed by analyzing a standard and sample solutions of Olmesartan medoxomil by injecting six replicates of the same standard and sample preparations at a concentration of 40ppm/mL Robustness: Robustness shows the reliability of an analysis with respect to deliberate variations in method parameters. If measurements are susceptible to variations in analytical conditions, the analytical conditions should be suitably controlled or a precautionary statement should be included in the procedure. LOD and LOQ:Calibration curve was repeated for five times and the standard deviation (SD) of the intercepts was calculated.The results shows,the limit of detection with a signal to noise ratio of 3:1 was found to be 0.010 g/ml. the limit of quantification with a signal to noise ratio of 10:1 was found to be 0.032 g/ml. System suitability: From the system suitability studies it was observed that retention time of Olmesartan medoxomil was found to be 3.418 min. % RSD of peak area was found to be 0.08. Theoretical
IJRPB 1(6)
www.ijrpb.com
Page 882
plates were found to be more than 40289. USP tailing factor was found to be 1. All the parameters were within the limit. Specificity: The Chromatograms of Standard and Sample are identical with nearly same Retention time. There is no interference with blank and placebo to the drugs. Hence the proposed method was found to be specific. Linearity: From the Linearity data it was observed that the method was showing linearity in the concentration range of 10-150g/ml. Correlation coefficient was found to be 0.9999. Accuracy: The recoveries of pure drug from the analyzed solution of formulation were in the range of 98%-102%, which shows that the method was accurate. Precision: System precision: The percentage relative standard deviation (RSD) for the peak area 0.08.
Method precision: The percentage relative standard deviation for the assay values found to be 1.06 Ruggedness: Comparison of both the results obtained for two different Analysts shows that the method was rugged for Analyst-Analyst variability. The %RSD for intermediate precision was 0.09. Robustness As the % RSD of retention time and asymmetry were within limits for variation in flow rate ( 0.2 ml). Hence the allowable flow rate should be within 0.1 ml to 0.5 ml. As the % RSD of retention time and asymmetry were within limits for variation (+ 50C) in column oven temperature. Hence the allowable variation in column oven temperature is + 50C. The results obtained were satisfactory and are in good agreement as per the ICH guidelines.
Table.1.Optimized chromatogram conditions for Olmesartan medoxomil Column Waters acquity UPLC BEH C18 (100 X 2.1 mm, 1.7 m) Mobile phase pH 3.4 Buffer: ACN (60 :40 % v/v) Flow rate 0.5 ml/ min Wavelength 250 nm Injection volume 4 L Column temperature Ambient Run time 6 min Table.2.System suitability data for Olmesartan medoxomil System suitability parameters Results % RSD 0.08 Tailing factor 1 Theoretical plates 40289 Table.3.Linearity Data for Olmesartan medoxomil Level Con. (mg/ml) Peak area 10% 5 65673 50% 20 259905 75% 35 395268 100% 45 525796 150% 65 787084 Slope 11674.33 Intercept 826.20 Correlation coefficient (R2) 0.9999 Table.4.Accuracy Data for Olmesartan medoxomil % Recovery % RSD 100 65673 100.6 259905 100.8 525796 100.6 787084
Level 50% 75% 100% 150%
IJRPB 1(6)
www.ijrpb.com
Page 883
Table.5. System precision of Olmesartan medoxomil No of injections Area RT 1 524321 3.418 2 523789 3.417 3 523912 3.418 4 524832 3.418 5 524721 3.416 6 524198 3.416 Average 524297 SD 420.1 % RSD 0.08 Table.6.Method precision and intermediate precision Data for Olmesartan medoxomil Sample no. Assay Method precision Intermediate precision 98.79 98.76 1 98.74 98.66 2 98.94 98.86 3 98.76 98.76 4 98.94 98.86 5 98.9 98.66 6 98.81 98.76 Mean 1.06 0.090 %RSD Table.7.Variation in flow rate, column temperature for Olmesartan medoxomil Flow (mL/min) Temperature(oC) Low Actual High Low Actual High (0.1ml/min) (0.3ml/min) (0.5ml/min) (20 oC) (25 oC) (30 oC) 0.16 0.08 0.11 0.15 0.089 0.1 4.451 3.336 2.528 3.856 3.418 3.014 51056 40289 38529 42106 40289 40562 1 1 1 1 1 1
Parameter
%RSD Retention time Plate count Tailing factor
Figure.2.Standard chromatogram
Figure.3.Sample chromatogram
Figure.4.Linearity plot
Figure.5.Chromatogram for specificity
IJRPB 1(6)
www.ijrpb.com
Page 884
4. CONCLUSION Finally it concludes that all the parameters are within the limits and meet the acceptance criteria of ICH guidelines for method validation. The proposed method was simple, accurate, specific, precise, robust, rugged and economical. Hence this method is validated and can be used for routine sample analysis. REFERENCES Abdullah Al Masud, Md. Mahfuzur Rahman, Moynul Hasan, Validated Spectrophotometric method for estimation of Olmesartan medoxomil in pharmaceutical formulation, International journal of pharmaceutical and life sciences volume, 1 (11), 2012, 2305-0330. Chaitanya Prasad MK, Vidyasagar G, Sambasiva Rao KRS, developed RP-HPLC method for the estimation of olmesatan medoxomil in tablet dosage form, Der pharma chemica, 3(6), 2011, 208-212 Jain Pritam, Chaube Udit, Chaudhari Rakesh, UVSpectrophotometric method for determination of Olmesartan medoxomil in bulk and in formulation,
Internationale pharmaceutica sciencia, 1(7), 2011, 2231-5896. Lakshmi surekha M, Kumara swamy G, RP-HPLC method for the estimation of olmesartan medoxomil in bulk and tablet dosage form, Contemporary Investigations and observations in pharmacy, 2(1), 2013, 3-6, 2278-7429. Selvadurai Muralidharan, Kumar, developed Sensitive estimation of olmesartan medoxomil tablets by RPHPLC method, International journal of pharmacy & life sciences, 1(7), 2012, 0976-7126. Sharma Ritesh, Pancholi Syam S, RP-HPLC-DAD method for determination of Olmesartan medoxomil in bulk and tablets exposed to forced conditions, INIST-CNRS, 60, 2010, 1330-0075. Suman.avula.K.Naveen babu, M.V.Ramana, RPHPLC method for the estimation of olmesatan medoxomil in bulk and tablet dosage form, An international journal of advances in pharmaceutical sciences, 2(2-3), 2011, 0976-3090.
IJRPB 1(6)
www.ijrpb.com
Page 885
T N Murthy et.al
Modern hygienic industrial canteen amenity: A change factor for healthy physical work environment of the work force in Indian industrial units
TN Murty1*, GV Chalam2, Md Aasif Siddique Ahmed Khan3, T Abhinov3 and T Abhilash3 1. Director, Nimra College of Business Management, Vijayawada- 512456. 2. Professor in Commerce & Business Administration, Acharya Nagarjuna University, Nagarjuna Nagar- 522 510 3. Shadan Institute of Medical Sciences, Hyderabad *Corresponding author: Email: thamminaina@yahoo.com ABSTRACT Physical Working environment influences to a greater extent of the health of the workers. Hygienic environment is an important requisite for the maintenance of good health. The term hygiene includes not only the material environment but also personal hygiene. The importance of the personal hygiene should continually be brought home to the industrial workers. The pre-employment interview with the doctor, nurse or welfare officer gives an opportunity for hints on personal hygiene. All the employees in a factory should become health-minded as Human Resources (HR) Capital plays a very crucial role in the growth and prosperity of any industry. The fundamental conditions of a healthy working environment must be maintained in every factory. In this connection good canteen assumes an importance, in keeping the air fresh and free from germs. The main purpose of this study is to study work environment of the workforce and its impact on the employees hygiene and to know the modern hygienic canteen faci lity as welfare amenity being provided by selected Indian Industrial Units. The study may help to the policy makers like management, trade unions, Government to improve the existing state of affairs mainly by emphasizing on the amenities and welfare of the employees in corporate sectors. Key words: Hygiene, Workforce, Work Environment, Motivation, Canteen. INTRODUCTION Human Resources (H R) Capital plays a very crucial role in the growth and prosperity of any industry. The workers can be motivated and their productivity can be increased only when a conducive and hygienic physical work environment is created and adequate Canteen facility is provided by the management irrespective of the sector. The subject of Canteen facility is thus fairly wide and is not limited to any one country, one region, on sector, one industry or occupation. Its scope has been described by different writers in different perspectives. But the common objective of canteen facility is to provide quality food stuff at reasonable price to the workers. Canteen provision is neither philanthropy nor charity. It is a method of creating more satisfactory working conditions for men and women employed in an industry. It is quoted that by Narayana Murty (2000) in his work Labour Welfare Measures in Indian Industrial Organizations that the welfare measure would greatly reduce turnover and absenteeism among workers and improves workers efficiency to a greater extent and also create a permanent settled labor force by making service attractive to the labor. A canteen can help in improving the morale of the workers further, the availability of food stuff within the factory areas reduces the botheration and saves time of the workers. (Report of the Bombay Textiles Labor Enquiry Committee, 1953, P: 166). The high rate of absenteeism and turnover in Indian Industries is indicative of the lack of commitment on the part of the workers, for they want to escape from their environment whenever possible. Bigger undertakings like private and public sectors have provided modern and hygienic canteens as compared with co-operative sector. But in some organizations the management passes on the responsibility of running the canteens to the contractors. Similarly the managements of public and private sector units feel that the Labor Welfare is their social responsibility. So, the representatives of the both workers and management make the canteen facility more attractive to the workers. Objectives of the Study 1. To Study work environment of the workforce and its impact on the employees hygiene, 2. To Know the modern hygienic canteen facility as welfare amenity being provided by selected Indian Industrial Units, and 3. To make appropriate suggestions to policy makers for the improvement of hygienic canteen facility in order to maintain healthy work environment of workforce in selected Indian Industrial Units. REVIEW OF THE LITERATURE Canteen is a very important facility for the workers through which a better standard of food and refreshments can be obtained, when compare to the
IJRPB 1(6)
www.ijrpb.com
Page 886
T N Murthy et.al
make shift hotels that spring up around factories. Moreover, through these canteens wholesome food and refreshments can be provided to the workers at reasonable prices so as to make available to them a balanced sand hygienic food. This is likely to improve their health and efficiency. Canteens also serve as places where workers can meet informally and refresh themselves by a relaxing conversation. The canteens are also instruments of social change, as the workers belonging to different religions and castes will have to sit at the same tables and take their food. Thus, a canteen can help in improving the morale of the employees. Further, the availability of the food stuffs within the factory area reduces botheration and saves time of the workers; otherwise they will have to go out of the factory. The review of the literature has been done in order to assess the extent and quality of Hygienic Canteen facility to employees provided by various organizations in various industries. There have been a number of studies conducted so far in this area. However, a few studies of importance have been presented here. 1. Rizwana Ansari (2011) found out in her study physical environment and employee industrial safety, a remarkable improvement of employee performance. It is found that one fourth of the employees in public sector units are dissatisfied with the provision of safety, health amenities and canteen facilities to the workforce. 2. Maja Dijkic (2008) in his study on physical environment an expanded model of job satisfaction concludes with positive correlation. The purpose of the study was to examine the effect of perceived physical work environment on job satisfaction. 3. Kudchedkar (2008) differentiates between the labour welfare activities and the personnel functions and gives some suggestions for better working and living standards. 4. Morris (2008) describes industrial history of Bombay and gives the growth of labour force, work regulation, wages, discipline, trade unions and arbitration between 1854 to 1917 in the Cotton Mills of Bombay (India). It is found that the Bombay Mills Association Voluntarily appointed personal officers to look into the matters on safety, welfare, canteen, health and other personnel functions. 5. Saxena (2000) gives socio-economic background of workers in the five selected units in Meerut district and discussed promotion policies, training, transfers, welfare measures, bonus, remuneration and the functioning of the
trade unions. It is found that the personnel policies on promotion, training, internal mobility, wage and welfare includes canteen are created healthy work environment in the units in Meerut ( India). 6. Narayana Murty (2000) has studied socioeconomic profile of the workforce and employee welfare activities in Indian Industrial Organizations. It is found that majority of the Employees in Co-operate Sector Units are satisfied with the existing welfare, canteen, and health facilities. All these studies help the management, unions and governments to improve the existing state of affairs mainly by emphasizing on functional areas of Human Resources Management and existing welfare amenities in a single unit or two units or more with a comparative study in the same sector like private or public or co-operative. There have been very few comprehensive studies in the field of work environment and less concentration on the provision of welfare facilities and amenities provided by the Government and the managements of the undertakings as well. However, surprisingly, very few attempts have been made by the researchers to study the extent of Canteen facility to the employees of any unit. The study shows the gap and also furnishes the reasons between the practice and precept. METHODOLOGY OF THE STUDY The Coastal Districts of Andhra Pradesh, India have been deliberately chosen in data collection and also to obtain meaningful insights. The provision of Canteen laid down in the Factories Act, 1948 are common to all the public, private and co-operative sectors. The public sector undertakings will think to implement them seriously as they are bound by it. The private sector seeks to implement the measures up to the level as exactly how they are incorporated in laws. They do not beyond what the enactment provide for. Finally the co-operative sector seeks to implement the provisions at a minimum level thinking that the burden of implementation falls on both the management and the workers. Keeping these in view, some industrial units in Andhra Pradesh, India are selected for field study. The study is conducted by using both analytical and descriptive type of methodology. The study depends on primary and secondary data. By using Pilot Study, the filled up Questionnaires are collected from 290 (130 in Private Sector Unit and160 in Public Sector Unit) respondents. Based on the pilot study, the questionnaire is modified suitably to elicit response from the sample group. Primary data were
IJRPB 1(6)
www.ijrpb.com
Page 887
T N Murthy et.al
collected on the basis of stratified random sample survey of employees. The views of the workers are elicited by way of well-structured Questionnaire, Interviews, Discussions, and Observations. The Secondary data were collected from Journals, Magazines, Publications, Reports, Books, Dailies, Periodicals, Articles, Research Papers, Websites, Company Publications, Manuals and Booklets. The processing, classification, tabulation and interpretation and analysis of data are done with the help of Statistical and Mathematical Techniques. These have been employed depending on the nature of the data collected from the respondents. Modern Hygienic Canteen Facility- An Analysis: The canteens are also instruments of social change, as the workers belonging to different religions and castes will have to sit at the same tables and take their food. In this context the Bombay Textiles Labor Enquiry Committee observed. Besides good lighting and ventilation, adequate dining accommodation is also an essential requirement for the workers. It is necessary that such accommodation should be more ample for night workers than for day workers because it is usually not possible at night to go outside the company premises for that purpose. The view of ILO in this connection is that the Canteen movement must be accepted by the State as a definite changes and running of canteens must be accepted by the employers as a national investment. The object of the canteen was laid down very clearly by the Labor Investigation Committee in its report when it said to introduce an element of nutritional balance into the otherwise deficient unbalanced dietary of the workers, to provide cheap and clean food and an opportunity to relax in comfort near the place of work, to save time and trouble to workers on account of exhausting journey to end from work after long hours in factory and to enable them to surmount the difficulties experienced in obtaining meals of foodstuffs are imperative of factory management. Section 46(1) of the Factories Act, 1948, provides that the The State Government may make rules requiring that in any specified factory wherein more than 250 workers are ordinarily employed, a canteen or canteens will be provided and maintained by the occupier for the use of the workers. Sub section (2) of the same section also empowers the State Government to provide for the standards in respect of construction, accommodation, furniture and other equipment of the canteen and the food stuffs to be served therein and the charges which may be made thereof.
DISCUSSIONS AND RESULTS Public Sector Unit provided a full pledged canteen with all modern facilities like proper ventilation, adequate number of fans, neatness and cleanliness. The canteen is run on no profit no loss basis. The cost of power, fuel, furniture utensils are borne by the management of Public Sector Unit. This canteen will cater to the needs of the employees in each shift. The canteen is working under the supervision of Personnel Officer (Welfare- Canteen) and a canteen committee comprising of the representatives of workmen nominated by the management of Public Sector Unit. The rates of the items in the canteen have been fixed by the management in consultation with the trade union leaders. The Personnel officer (Welfare Canteen) sells the tokens to the workers from first to tenth of every month and there is also a credit facility available to the workers. Price level of items in modern hygienic canteens: The canteens are located in the midst at the yard of the factory with an easy access to all workmen. And there is a separated canteen also available to the supervisors, officers and managers of Public Sector Unit. It is observed that all the canteens in Public Sector Unit look very neat at all times. Breakfast and Lunch are served at the canteen for A ( 6 am to 2 pm) and G ( 8 am to 4 pm) shift employees, dinner is served for B(2 pm to 10 pm) shift employees. Tea is also served twice during the shift time at the respective working spots. For B shift employees along with tea, snacks are also supplied at subsidized price. The management of Private Sector Unit is spending huge amount per year for the running of the canteen. Canteen is supervised by an Assistant Welfare Officer and Canteen Manager. The list of items which are available in canteen with price are placed in the canteen and have been fixed by the management in consultation with the office bearers of the recognized union. The canteen also provides meal consist of cooked rice, vegetable curry, sambar, rasam, pickles, (Chutney), dall and curd. In addition to the canteen there is also one tea stall, which works round the clock to supply tea and snacks. Besides, the various stated purposes of the canteen provision, the objective of the industrial canteen is to provide food to the employees at minimum Price. The Indian worker still belongs to the low income group and cannot afford to spend much on his food in the canteen through his/her position is gradually improving, and in not distant future, the skilled worker at least would be classified
IJRPB 1(6)
www.ijrpb.com
Page 888
T N Murthy et.al
as belonging to middle class if not to the upper middle class.
Frequency of visit to modern hygienic canteens by the workers: Table 1 shows the data on the extent to which the workers are utilizing the canteen facilities available in the selected units. It is evident from the information that in these units, about half of the Table.1.Frequency of visits to canteen in selected units
Public Sector Unit Opinion Service Wise ( Years) Native Background Type of Employee Total Service Wise ( Years) Native Background Type of Employee Total 1-10 11-20 Above 20 Rural Urban Skilled Unskilled 1-10 11-20 Above 20 Rural Urban Skilled Unskilled Frequently 22 (44.00) 33 (44.00) 14 (42.86) 39 (43.33) 31 (44.28) 49 (43.75) 21 (43.75) 70 (43.75) 18 (66.67) 45 (65.20) 22 (64.70) 78 (65.00) 07 (70.00) 39 (65.00) 46 (65.70) 85 (65.38) Sometimes 26 (52.00) 39 (52.00) 18 (51.43) 47 (52.22) 26 (37.14) 58 (51.79) 25 (52.08) 83 (51.88) 09 (33.33) 24 (34.80) 12 (35.30) 42 (35.00) 03 (30.00) 21 (35.00) 24 (34.30) 45 (34.62)
workers are frequent visitors to the canteen. However, it is obvious that 44.14 percent of the workers are not motivated to visit the canteen frequently. They are going to the canteen only now and then and only a small and negligible portion of the workers (2.41 percent) never visited the canteen for utilizing canteen facility in their organizations.
Never 02 (4.00) 03 (4.00) 02 (5.71) 04(4.45) 03 (4.28) 05 (4.46) 02 (4.17) 07 (4.37) Total 50 (100.00) 75 (100.00) 35 (100.00) 90 (100.00) 70 (100.00) 112 (100.00) 48 (100.00) 160 (100.00) 27 (100.00) 69 (100.00) 34 (100.00) 120 (100.00) 10 (100.00) 60 (100.00) 70 (100.00) 130 (100.00)
Private Sector Unit
Note: Figures in parentheses are Percentages Unit wise analysis shows that in case of Public Sector Unit, 43.75 percent of the workers are frequent visitors to the canteen, about half of the workers are not visit the canteen frequently. When we observe the service wise and native background wise data, it is clear from the table that the workers in the service group of 1-20 years and urban background and making best utilization of the canteen facility, while the workers with more than 20 years of service and rural background were making less utilization of the canteen. And a negligible percentage of the workers never visited the canteen in Public Sector Unit. In Private Sector Unit, about two-third of the workers are frequent visitors to the canteen and the rest of the workers are not habituated to visit the canteen frequently. They are going to the canteen only now and then. When we make service-wise analysis, it can be observed from the table that the workers in the service-group of 11-20 years are making best use of the canteen. It is also evident that the urban workers are more frequent visitors of the canteen in Private Sector Unit. It is found from the foregoing discussion that an overwhelming majority of the respondents are frequent visitors to the canteen in Private Sector Unit than that of the Public Sector Unit. It is interesting to note that the workers in the service of 11-20 years are making best utilization of the canteen facility, while the workers with more than 20 years of service were making less visits of the canteen and the urban workers are more frequent visitors of the canteen in the selected units of the study. Quality of Items in the Modern Hygienic Canteens: Table2 gives the information on the opinion of the respondents on the quality of items in canteen in the selected units. It is obvious from the information that half of the workers in the selected units of the study felt that the quality of the items in their canteen was good and 42.90 percent of them in these units felt satisfactory about the quality of the items in their canteens. Unit wise data shows that in case of in Public Sector Unit 43.75 percent of the workers expressed good opinion and 48.12 percent of the workers felt that the quality of items in the canteen was satisfactory. However, 4.38 percent of them did not say anything and 3.57 percent of them expressed their opinion on the quality of items in canteen was poor. When we make service wise analysis it is clear from the data that 44 percent of the workers in the service group of 1-20 years and 42.86 percent of the workers in the service group of above 20 years had expressed good opinion on the quality of items of canteen. In Private Sector Unit 57.69 percent of the workers felt that the quality of the items in canteen was good. It is obvious from the data that 36.15
IJRPB 1(6)
www.ijrpb.com
Page 889
T N Murthy et.al
percent of the workers felt that the quality of the items in the canteen was satisfactory and the negligible percentage of them had negative opinion on the quality of items in modern Canteen in Private Sector Unit. On the whole, it is found that the majority of the workers in the service group of 1-10 years, 11-20
Opinion Service Wise ( Years) Native Background Type of Employee Total Service Wise ( Years) Native Background Type of Employee Total Good 22 (44.00) 33 (44.00) 14 (42.86) 39 (43.33) 31 (44.28) 49 (43.75) 21 (43.75) 70 (43.75) 16 (59.25) 40 (58.00) 19 (55.90) 69 (57.50) 06 (60.00) 35 (58.35) 40 (57.15) 75 (57.69)
years and urban background had positive opinion on the quality of items which are available in their respective canteens. It is very interesting to note that on the whole or individual unit-wise less than 4.83 percent of the workers felt that the quality of items in their canteen was poor.
Satisfactory 24(48.00) 36 (48.00) 17 (48.57) 43 (47.77) 34 (48.57) 54 (48.21) 23 (47.91) 77 (48.12) 10 (37.00) 25 (36.25) 12 (35.30) 43 (35.85) 04 (40.00) 22 (36.65) 25 (35.70) 47 (36.15) Poor 02 (4.00) 03 (4.00) 01 (2.86) 04 (4.45) 02 (2.86) 04 (3.57) 02 (4.17) 06 (3.75) 01(3.75) 04(5.75) 03 (8.80) 08 (6.65) 03 (5.00) 05 (7.15) 08 (06.16) Not Aware 02 (4.00) 03 (4.00) 02 (5.71) 04 (4.45) 03 (4.29) 05 (4.47) 02 (4.17) 07 (4.38) Total 50(100.00) 75 (100.00) 35 (100.00) 90 (100.00) 70 (100.00) 112 (100.00) 48 (100.00) 160 (100.00) 27 (100.00) 69(100.00) 34(100.00) 120 (100.00) 10 (100.00) 60 (100.00) 70 (100.00) 130 (100.00)
Table.2.Respondents opinion on quality of items in canteen in selected units

Public Sector Unit 1-10 11-20 Above 20 Rural Urban Skilled Unskilled 1-10 11-20 Above 20 Rural Urban Skilled Unskilled
Private Sector Unit
Note: Figures in parentheses are Percentages resources. Table3 shows the data on the workers Quality of services in the modern hygienic canteens: Quick supply refers to speediness of opinion on the supply of items in the canteen of the service. The worker normally would like to take his selected units for the study. It is evident from the lunch in about 15 minutes and rest for some time Table that on the whole about half-of the workers felt before he resumes work for the second half of his that the service in the canteen was satisfactory. shift. Speedy meal and service depend on the type of However, it is also clear from the data that 4.83 the canteen services practiced, the number of staff in percent of the workers felt that the service in their the canteen, the equipment available and other canteens was poor. Table 3: Respondents opinion on services in canteen in selected units
Public Sector Unit Opinion Service Wise ( Years) Native Background Type of Employee Total Service Wise ( Years) Native Background Type of Employee Total 1-10 11-20 Above 20 Rural Urban Skilled Unskilled 1-10 11-20 Above 20 Rural Urban Skilled Unskilled Good 22 (44.00) 33 (44.00) 14 (42.86) 39 (43.33) 31 (44.28) 49 (43.75) 21 (43.75) 70 (43.75) 11 (40.75) 27 (39.15) 14 (41.20) 48 (40.00) 04(40.00) 24(40.00) 28(40.00) 52 (40.00) Satisfactory 24 (48.00) 36 (48.00) 17 (48.57) 43 (47.77) 34 (48.57) 54 (48.21) 23 (47.91) 77 (48.12) 15 (55.55) 37 (53.60) 18 (52.95) 65 (54.15) 05(50.00) 32(53.35) 38(54.30) 70(53.84) Poor 02 (4.00) 03 (4.00) 01 (2.86) 04 (4.45) 02 (2.86) 04 (3.57) 02 (4.17) 06 (3.75) 01(03.70) 05(07.25) 02(05.85) 07(05.85) 01(10.00) 04(06.65) 04(05.70) 08 (6.16) Not Aware 02 (4.00) 03 (4.00) 02 (5.71) 04 (4.45) 03 (4.29) 05 (4.47) 02 (4.17) 07 (4.38) Total 50 (100.00) 75 (100.00) 35 (100.00) 90 (100.00) 70 (100.00) 112 (100.00) 48 (100.00) 160 (100.00) 27 (100.00) 69 (100.00) 34 (100.00) 120(100.00) 10(100.00) 60(100.00) 70(100.00) 130(100.00)
Private Sector Unit
Note: Figures in parentheses are Percentages The analysis on unit-wise indicates that in case of Public Sector Unit 43.75 percent of the workers had good opinion, 48.12 percentage of them satisfied with the service available in canteen and a very low percent of the workers viewed on the services available in canteen was poor and only 4.38 percent of them did
IJRPB 1(6)
www.ijrpb.com
Page 890
T N Murthy et.al
not say anything on the service in the Canteen. In Private Sector Unit, about more than half-of the workers felt that the service in the canteen was satisfactory, whereas 6.16 percent of the workers felt that the service in the canteen was poor. It is found that more than 93 percent of the workers in the Selected Industrial units were satisfied with the quality of canteen services. It is observed that the services in Private Sector Unit canteen as controlled by canteen committee and labor officer, and Public Sector Unit canteen was controlled by the Canteen Committee and Senior Personnel officer. Cleanliness in modern hygienic canteens: The canteen should be installed in a clean and hygienic place and its kitchen, counter as well as the dining rooms. The canteen area should be maintained in clean and health conditions, free from the files, dust and dirt. The Computed Data shows the information on workers opinion on the sanitation and cleanliness in their respective canteens of the selected units. It is evident from the data that 63.45 percent of the workers on an average in the industrial units, felt that the cleanliness in their canteens was good, about 30.68 percent of the workers opined that the cleanliness in their canteens was satisfactory and only less than 3.79 percent of them felt dissatisfied with the cleanliness in the canteens of the selected units for the study. Unit-wise data reveals that in case of Public Sector Unit 48.12 percent of the workers felt that the cleanliness and sanitation in canteen was good, about 43.75 percent of them had expressed satisfactory opinion and 3.75 percent of the workers in did not say anything about the sanitation conditions in their canteen. However, a very low percentage of the workers felt dissatisfied with the cleanliness in the Public Sector Unit canteen. In Private Sector Unit about four fifths of the workers felt that the cleanliness in Private Sector Unit canteen was good. It is also interesting to note that only an insignificant portion of the workers felt dissatisfied with the cleanliness in the canteen. Major Findings of the Study 1. It is found that the bigger organization in the private sector and public sector units are financially sound and they are able to provide the clean and hygienic food items to their worker at minimum price in the Canteens in Indian Industrial Organizations. 2. It is found that the Indian workers in the selected units expressed their satisfaction and
3.
4.
5.
6.
7.
the prices are reasonably charged in the hygienic canteens. It is found that an overwhelming majority of the respondents are frequent visitors to their hygienic canteen in Private Sector Unit than that of the Public Sector Unit. It is found from the foregoing analysis that half-of the workers in the selected unit felt that the quality of items in the canteen was good. It is also found that an insignificant percentage of the respondents had poor opinion on the quality of items in their canteen. It is found that an average earning in Indian Industrial worker is not in a position to take his/her food items with quality in his house as compared with the items in their canteens at their work spots. It is found that more than 93 percent of the Indian Industrial workers in were satisfied with the service in the canteen. It is also found that the majority of the Indian Industrial workers were satisfied with the cleanliness and sanitation in their canteens.
Suggestions for the improvement of Canteen for Healthy Physical Work Environment of the Workforce: 1. It is suggested that the management of private and public sector units can provide the clean and hygienic food items to their worker at minimum price in their canteens and to mitigate the dissatisfied workers in Indian Industrial Units. 2. It is suggested that the management of private and public sector units may maintain the same price for food items in the Canteen in future also through subsidy created by the management of Industrial units. 3. It is suggested that the management of private and public sector units may create the habit of visits in the minds of employees to visit canteen and to take their food in the canteen in order to save their productivity time on the work-spot and to get some relax. 4. It is suggested that the management of private and public sector units may take steps to improve the services in their canteen in speedy and quick manner. 5. It is suggested that management of Public Sector Unit should maintain cleanliness and to establish good sanitation at the canteen as a part of the welfare and health of workmen in India.
IJRPB 1(6)
www.ijrpb.com
Page 891
T N Murthy et.al
6.
It is suggested that the managements of Indian Industrial Units should maintain high quality of items and to mitigate the rest of the dissatisfied workers also.
Institute of Medical Sciences, Hyderabad, India, Dr. K V Rao, Vice- Chancellor, Acharya Nagarjuna University, India for their support and encouragement during this study. REFERENCES Bhatia W.J, Principles and Practices of Personnel Management and Human Resource Management, Edition II, Deep & Deep Publication, New Delhi, 1994. Bhattacharya S.K, Organizational Culture and Indian Perspectives, 1988. Dale S.Beach, Human Resource and Personnel Management, Tata McGraw Hill, Ed.3, New Delhi, 2002. Frederick Herzberg, B.Mausner and B. Synderman, The Motivation to work, John Wiley and Sons, New York, 1985. Garry Steiner, Human Behavior, New York Harcourt, Brace & World, 1964. Gupta C.B, Human Resource Management, Sultan Chand and Sons, V Edition, 2006. Maslow A.H, Motivation and Personality, Harper & Row, New York, 1954. Memoria C.B, Personnel Management, Himalaya Pub. House, Bombay, 1984. Narayana Murty.T, Labour Welfare Measures in Indian Industrial Organizations, Un- Published Thesis, Nagarjuna University, Nagarjuna Nagar, India, 2000. Rizwana Ansari, Physical work environment and industrial safety of the employees in power sector, unpublished thesis, Vinayaka missions university, Salem, India, 2011. T. N. Murty and T Abhinov, Safety and Health Environment of Workforce in Indian Public sector Units- An Injection for Occupational Health Hazards, ICME 2013Sri Lanka, ISBN 978-955-1507-23-7, February 2013, Matara, Sri Lanka.
Scope for Further Research The study can be extended to the related business Information Technology Export Services (ITES) and Business Process Outsourcing industry (BPO). Leadership and administration styles are to be studied as the employees are lagging behind in these qualities in India and similar studies can be conducted on other type of industries. Society comprises of the workers, management, Government and general public. The present study is of much relevance from the point of view of the society. The Central and State Government are enabling several labor legislations and adopted a policy to create better working of industrial canteen to the workers. CONCLUSION On the basis of the results obtained in the study, it is observed that the canteen in the units prevailing have deep impact on workers psychology and the presence of such factors always motivate the workers towards their job in a laudable manner. Hence, it is concluded that the workers employed are satisfied with their job and their positive approach towards the management has been responsible for the overall growth of in the Indian corporate sector. Besides, it has also been found that the concept of canteen facility assumes immense importance in the present business scenario which requires highly skilled and competent human resources for the transformation of traditional economies into the modern and industrial economies. ACKNOWLEDGEMENTS We thank Smt. S. Tehniath Khan President of Nimra and Shadan Group of Colleges, India, Dr. Mohd Saqib Rasool Khan, Secretary, Nimra College of Business Management, Vijayawada, India, Dr. Mohd Sarib Rasool Khan, Managing Director, Shadan
IJRPB 1(6)
www.ijrpb.com
Page 892
Venkateswara Rao et.al
Design and development of Metformin hydrochloride Trilayered sustained release tablets

Venkateswara Rao T1*, Bhadramma N1, Raghukiran CVS2 and Madubabu K3 Bapatla College of Pharmacy, Bapatla, Guntur-522101 Tigala Krishna Reddy College of Pharmacy, Hyderabad. Hetro Drugs Ltd, Hyderabad Corresponding author: E-Mail: tv_rao2@yahoo.com ABSTRACT Diabetes is one of the major causes of death and disability in the world. Diabetes results from decreased secretion of insulin, decreased insulin action or both. The main aims of the investigation was to design and development of trilayer floating tablets of metformin hydrochloride and also study the influence of concentrations of HPMCK 100 on various properties of tablet and tri-layer tablets were formulated by wet granulation method. Drug - excipient compatibility studies were conducted by FTIR spectroscopy. The prepared granules, tablets were evaluated. In-vitro release data revealed that F5 formulation sustained the release for 12 hours and the release data was fitted into zero order, first order, Higuchi and Peppas equations. The drug release from the formulation followed zero kinetics and exhibits Peppas mechanism. Release exponents n was found less than 0.85 indicating the release governed by non-fickian anomalous transport mechanism. Key words: Tri ilayer floating tablets, Hydroxy propyl methyl cellulose (HPMCK100) the bioavailability of the drug, to increase its INTRODUCTION bioavailability gastro retentive drug delivery systems Diabetes is one of the major causes of death were choosen for development in the form of tablet. In and disability in the world. Diabetes mellitus is a this way it stands as an advantage over conventional group of metabolic diseases characterized by dosage form, which needs to be administered twice or hyperglycemia (fasting plasma glucose 7.0 mmol / thrice a day. 1 or 2 hours post 75 g oral glucose load plasma glucose 11.1 mmol / on two or more occasions). MATERIALS AND METHODS Diabetes results from deficient insulin secretion, Metformin hydrochloride was received from decreased insulin action, or both. The oral route of Alkem laboratories ltd, Mumbai as gift sample, drug administration was most convenient method for HPMC, sodium bicarbonate, talc was procured from controlled delivery of drug. It provides the continuous S.D fine chem.All other chemicals and solvents used oral delivery of a drug also the system that target the in this study were LR grade delivery of a drug to a specific region within the GI Preparation of tri-ilayer Metformin Hydrochloride tract for either local / systemic action. One of the floating tablets: The preparation of tri layer tablet most feasible approaches for affecting a prolonged involves three steps and the granules were prepared and predictable drug delivery in the GI tract is to by wet granulation method using water as binding control the GRT. solution, lactose as diluent. Metformin hydrochloride is an antiFormulation of the upper and bottom layer: The hyperglycemic agent, which improves the glucose granules for upper and bottom layer were prepared as tolerance in type 2 diabetes. People with type 2 per the formulae shown in table no 1.1.The cohesive diabetes are not able to make enough insulin or mass were prepared passed through sieve no 12. The respond normally to the insulin their bodies make. granules were dried in an oven at 550 for 2 hrs. the This leads to serious medical problems including dried granules were passed through sieve no 16, kidney damage, amputations and blindness. The lubricated with talc and magnesium stearate for absolute bioavailability of Metformin hydrochloride is compression into tablet. 50-60% , biological half life is 1.5 - 3 hours and the main site of absorption of metformin hydrochloride is Formulation of the middle layer: The granules were proximal end of small intestine. The HBS system was prepared by wet granulation method as per the planned for Metformin hydrochloride as such a system formulae shown in table no 1.1.The dough mass was when administered it remain buoyant on the gastric prepared by the addition of water as binding a solution fluids for a prolonged period of time and the drug it into the mixture of drug, polymer and diluent . The remain buoyant on the gastric fluids for a prolonged obtained dough mass was passed through sieve no 12 , period of time and the drug would be available in the granules were dried in an oven at 550 for 2hrs. The dissolved format. This would leads to improvement in dried granules were passed through sieve no 16. The
IJRPB 1(6)
www.ijrpb.com
Page 893
dried granules were mixed with talc and magnesium stearate, then subjected to compression.
Compression of tri layer tablet: The compression of the tablet involves three steps. The granules for bottom layer were compressed slightly, then the granules for middle layer were poured over the above Table.1.Composition of metformin hydrochloride trilayer floating tablets with HPMC K100M
Floating bottom layer Floating bottom layer Floating bottom layer Floating bottom layer Ingredients ( mg/ tablet) Sustained layer F1 Floating upper layer Sustained layer F2 Floating upper layer Sustained layer F3 Floating upper layer Sustained layer F4 Floating upper layer Sustained layer F5 Floating upper layer
compact, again compressed with minimum force to form a second layer and then top layer granules were added over the above layer, then compressed into a tablet by Cadmach Rotary tablet machine ie trilayered tablet by using a16 mm flat - faced punches.
Metformin hydrochloride HPMC K 100 M Sodium bicarbonate Lactose Talc Magnesium stearate Total weight
500 60 80 7.5 7.5
40 45 825 40 45
500 80 60 7.5 7.5
40 45 825 40 45
500 100 40 7.5 7.5
40 45 825 40 45
500 120 20 7.5 7.5
40 45 825 40 45
500 140 7.5 7.5
40 45 825 40 45
Characterization of granules: The granules were evaluated for the parameters[10,11].
prepared following
Bulk density: The bulk density was determined by measuring the volume occupied by the pre weighed granules,It was calculated by the following equation. Bulk density = Mass of Granules /Volume of packing Tapped bulk density: The granules whose weight was determined earlier was transferred in to 100ml of graduated cylinder and subjected to 100 taps. Then the volume occupied by the granules (Tapped volume) were determined. Tapped density was calculated by the following formula Tapped density = Mass of granules/tapped volume Carr'sindex: The percentage of compressibility of granules was determined by Carr's/Compressibility index. Carr's index (%) = Tapped density- Bulk density /tapped density 100 Hausners ratio: Hausnerratio of granules determined by comparing the tapped density to the bulk density by using the formulae Hausner,s ratio = Tapped density/Bulk density
Angle of repose: The prepared granules were assessed for its flow property by determining the angle of repose by open tube method. The angle of repose was determined by the following formula
h = height of heap r = radius of the base. Loss on drying: Granules (Igm) were kept in an oven at 105 c and dried up to constant weight. Loss on drying was calculated using the following formulae. Loss on drying = (Initial weight - Final weight)/initial weight 100 Moisture content: Granules (1gm) were kept in an oven at 105 c and dried up to constant weight. Moisture content was calculated using the following formulae. Moisture content = (Initial weight - Final weight)/final weight 100 Evaluation of tablets: The formulated tablets were evaluated for the following parameters. Thickness: The thickness and diameter of the formulated tablets were measured by using Vernier calipers.
IJRPB 1(6)
www.ijrpb.com
Page 894
Floating bottom layer
Weight variation: The formulated tablets were tested for weight uniformity. 20 tablets were collectively and individually. From the collective weight, average weight was calculated. Each tablet weight was then compared with average weight to ascertain whether it is within permissible limits or not. % Weight Variation = (Average weight-Individual weight)/ average weight 100 Hardness: The tablet crushing strength, which is the force required to break the tablet by compression in the diametric direction was measured in triplicate by using Pfizer tablet hardness tester. Friability: The Roche friability test apparatus was used to determine the friability of the tablets. 20 pre weighed tablets were placed in the apparatus, which was subjected to 100 revolutions. Then the tablets were reweighed. The percentage friability calculated was using the formula. % Friability = Initial weight- Final weight / initial weight 100 Floating characteristics: Floating characteristics were determined by using USP dissolution XI apparatus at 100 rpm using 900 ml of 0.1 N HCl and temperature was maintained at 37c. Floating lag time: The tablet was placed in dissolution apparatus and the time taken to float on the dissolution medium was noted. Floating time: The total duration of the time that the tablets float on dissolution medium was noted. Swelling index: Tablet was weighed (W0) and placed in dissolution medium containing 0.1N HClmaintained at 37c. At predetermined time intervals the tablet was and blotted to remove excess water and weighed (Wt). The percentage of swelling index calculated. Swelling index = (Wt - Wo)/Wt x 100 Wt= final weight of the tablet Wo = initial weight of the table Drug content: Twenty tablets were weighed and powdered. The quantity of powder equivalent to 100 mg of Metformin hydrochloride was dissolved in 0.1 N HC1 diluted to 100ml with 0.1N HC1 then the solution was filtered and suitably diluted. The drug content was estimated spectrometrically at 233 nm. In-vitro dissolution studies: In-Vitro dissolution studies were conducted by using USP type II paddle dissolution apparatus with 900ml of 0.1N Hydrochloric acid as dissolution medium, maintained the temperature of medium at 370.5 and stirrer speed
at 100 rpm. 5 ml of aliquots of dissolution medium was withdrawn at regular time intervals and the same volume of pre-warmed (370.5) fresh dissolution medium was replaced. The samples were filtered and drug content of Metformin hydrochloride in each sample was analyzed after suitable dilutions, filtered and filtrates are analyzed by Shimadzu UVspectrophotometer at 233 nm.
RESULTS AND DISCUSSION Drug- excipient compatibility studies were conducted by FTIR spectroscopy, results revealed that no chemical interactions were observed from the FTIR as shown in fig 2, 3 and 4. The prepared granules for floating layer and sustained release layer were evaluated found to have free flow properties, results given in table 2 and also the tablets were subjected to thickness, weight variation, hardness, floating time, floating log time, swelling index, drug content and in-vitro dissolution studies.The thickness of the tablets was found in the range of 3.1+ 0.01mm to 3.8+0.05mm. The weight variation ranged between 4.2+ 0.02 to 4.62+0.02, the hardness of the floating tablets were ranged between 6.0 kg/cm2 to 7..3kgcm2. The percent friability of prepared tablets was well as within the acceptable limit. The range between the formulations had desired floating log time 3.0 + 0.01 to 4.0 + 0.04mg and total floating time found between 6.5 -9hrs regardless of concentrations of polymers incorporated, results given in the table 3. The swelling index result was observed in a range between 28.17 0.02 to 46.62 0.03, that increase in percent swelling was increasing with increasing concentration of polymers. The drug content in all formulations was within the range of 499.2mg 0.01 to 499.5mg 0.03, ensuring the uniformity of the drug content in the formulation. The percentage of drug release for F1, F2, F3, F4, F5 were found to be 98.44 0.23, 98.42 0.53, 99.32 0.04, 98.33 0.85 and 82.81 0.357 at the end of 6.5, 7.5, 8.5, 9 and 11hours respectively, in vitro release profiles as shown in fig 1. In vitro release data fitted into the zero order, first order, matrix and peppas equations. The formulations followed zero order kinetics and exhibited peppas transport mechanism, release exponent found less than 1, indicates non fickian diffusion mechanism. Results revealed that as concentration of polymer increases, the floating time was found to be increased and prolonged the release of the drug due to the swelling of HPMC and high uptake of medium, floating time influenced by the gas generating agent and also it influences the drug release. Among all prepared formulation F5 sustained the release for prolonged time; hence it was suitable for the sustained release for the patient in the treatment of diabetes and enhances the bioavilabilty of the drug in the form of floating delivery system. In trilayer tablet, the drug was sustained for prolonged period of time due to the gelling property of polymer and drug layer sand witched between the two layers formulated with the HPMCK100M so drug release was prolonged for more time.
IJRPB 1(6)
www.ijrpb.com
Page 895
Table.2.Characterization of Metformin hydrochloride trilateral floating granules formulated with HPMC K100M
Formulations F1 F2 F3 F4 F5 Bulk density(g/ml) 0.23700.6 0.3420.01 0.2490.02 0.3540.03 0.2510.06 Tapped density(g/ml) 0.2620.01 0.3680.03 0.2770.03 0.3890.04 0.3970.02 Carrs index (%) 5.900.02 7.010.04 6.40.03 8.930.04 7.210.03 Hausners ratio 1.0740.04 1.0760.03 1.0800.01 1.0980.02 1.0990.02 Angle of repose (0) 21.610.05 20.820.04 22.910.03 21.030.02 24.170.03 Loss on drying (%) 6.90.01 7.80.02 5.40.03 6.30.05 5.90.01 Moisture content (%) 7.50.01 6.40.03 7.70.02 6.00.04 5.80.01
Table.3.Characterization of Metformin hydrochloride trilayer floating tablets formulated with HPMC K 100 M
Formulations Thickness(mm) Weight variation(%) Hard ness(kg/cm2) Friability( %) Floating lag time(min) Floting time (hr) Swelling index)(%) Drug content(mg)
F1 F2 F3 F4 F5
3.10.01 3.50.02 3.50.04 3.80.03 3.80.05
4.200.01 4.420.04 4.470.03 4.270.02 4.620.02
6.00.04 6.20.03 6.40.01 6.10.02 7.30.03
0.980.01 0.970.02 0.970.03 0.960.02 0.940.04
40.04 40.02 40.03 30.02 30.03
6.5 7.5 8.5 9 9
28.170.02 31.010.03 37.92 0.01 46.010.02 46.620.03
489.20.01 479.3 0.03 499.20.01 488.40.05 499.50.03
Figure.1. Dissolution profiles of Metformin hydrochloride bilayer floating tablets formulated with HPMC k100m
100
90 80
% Drug Released
70
F1
60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 8 9 10
F2 F3 F4 F5
T ime(hrs)
Figure.2.IR spectrum of Metformin hydrochloride
Figure.3. IR Spectrum of HPMC K 100 M
IJRPB 1(6)
www.ijrpb.com
Page 896
Figure.4. IR spectrum of best formulation
CONCLUSION The objective of present study was design and development of tri-layered floating tablet of Metformin hydrochloride for sustained the release. The HPMCK 100M as a polymer more reliable and sustained the drug for a prolonged period of time by increasing the concentration of it. More over the high swelling property of the polymer helped in maintaining the buoyancy with the minimal utilization of gas evolving excipients such as sodium bicarbonate which increased a marked impact on the gastro intestinal fluids by its alkaline nature. The formulations followed zero order kinetics and exhibits the peppas transport mechanism and hence finally concluded that tri layer formulations were found to be suitable for the floating drug delivery systems. REFERENCES Atyabi F, Sharma HL, Mohammed HAH, Fell JT, In vivo evaluation of a novel gastro retentive formulation based on ion exchange resins, J. Control Release, 42, 1996, 105 -113. Dave B.S, Amin A.F & Patel M.M , G astro retentive drug delivery system of ranidine hydrochloride formulation and in vitro evaluation, AAPS Pharm. Sci. Tech, 5(2), 2004, 1-6. Hwang J, H. Park, K. Park, Gastric retentive drug delivery systems, Drug carrier Syst, 15, 1998, 243 284 Indian pharmacopoeia, The controller of publications, New Delhi, 4th edition, vol II, 1996, 469. Vantrappen GR., Peeters TL, Janssen SJ, The secretary component of interdigestive migratory motor complex in man: scan d J. Gastro enterol, 19, 1979, 663-667. Yeole P.G, Khan S., Patel V.F, Floating drug delivery systems: Need and development, Indian. J. pharma.sci, 67(3), 2005, 265 -272.
IJRPB 1(6)
www.ijrpb.com
Page 897
Sivaranjani et.al
Amlodipine: the upcoming threat to Periodontist

Sivaranjani*, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, Dept of Periodontics, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Indira nagar, Gorimedu, Pondicherry-6. *Corresponding Author: Dr. Sivaranjani, E.Mail:sivaranjanimds@gmail.com. ABSTRACT Gingival hyperplasia is one of the side effects commonly caused by three major groups of drugs such as a) anticonvulsants b) antihypertensives calcium channel blockers c) immunosuppressants. Previously among antihypertensives Nifedipine induced enlargements were commonly reported in literature with prevalance rate of 10%. Amlodipine a second generation ca channel blocker was considered as rare drug causing enlargement with a prevalence rate of about only 3.3%.This paper discusses about a 60 yr old male hypertensive patient who received amlodipine at a dose of 5 mg /day remained asymptomatic for 2 yrs later which he reported with massive enlargement of gingiva. Key words: Amlodipine, gingival enlargement, after 2 yrs at low dose. Key Messages: Among Ca channel blockers Amlodipine was considered as rare drug causing gingival enlargement. Recently has become drug of concern since the prevalence of gingival enlargement among patients under this drug is being reported widely. Regular follow of patients under Amlodipine by Periodontists is being emphasised in this case report. since two years and was under Amlodipine 5mg/day. INTRODUCTION Amlodipine induced gingival enlargements He had no other significant medical or dental history. occurs only in 3.3 % of cases under Amlodipine On intra oral examination patient revealed massive therapy.(Jorgenson et al).It commonly occurs at a dose gingival overgrowth covering 2/3rd of crown surface of of 10 mg /day and within two months of drug intake. lower anterior teeth & in upper anterior teeth Earlier studies have reported that Amlodipine cant involving interdental gingiva& marginal gingiva. induce gingival enlargements at a dosage of 5 mg/day. Supra gingival plaque was present in entire dentition Our case was unique because patient was and there was generalised bleeding on probing (Figure receiving a daily dosage of only 5 mg. He was 1: Preoperative view- showing combined gingival asymptomatic for two years. After which he reported enlargement (inflammatory& drug induced). with Drug induced gingival enlargement. Patient was Based on medical history and clinical findings neither receiving 10 mg /day and the symptoms did drug induced gingival hyperplasia with concomitant not appear in two months the occurrence such cases inflammatory enlargement was diagnosed. Patient were not reported in the recent literature. We received a session supra and sub gingival scaling. Oral emphasise the regular follow up of patients under hygiene measures were instructed & and was under Amlodipine therapy even at low doses and for long Chlorhexidine mouth wash for a period of four weeks. term by the Periodontist. On re-evaluation patient still revealed the presence of gingival overgrowth which favoured our initial CASE HISTORY A 60 year old male patient reported to diagnosis (Figure 2: One month post operative view Department of Periodontics, with the complaint showing persistent gingival enlargement even after unaesthetic appearance of gingiva following gingival removal of inflammatory component by oral overgrowth in maxillary and mandibular anteriors prophylaxis). Patient was referred to physician for &causing discomfort during speech and mastication. opinion regarding drug substitution and presently is His medical history revealed that he was hypertensive under regular follow up.
Figure 1: Preoperative view showing combined gingival enlargement (inflammatory& drug induced)
Figure 2: One month post operative view showing persistent gingival enlargement even after removal of inflammatory component by oral prophylaxis
IJRPB 1(6)
www.ijrpb.com
Page 898
Sivaranjani et.al
DISCUSSION An increasing number of medications are associated with gingival enlargement. Currently, more than 20 medications are associated with gingival enlargement (Jimmy Jose, 2011). Amlodipine a newer agent of dihydropyridine, used for treatment of hypertension and angina, was first reported for causing gingival overgrowth as side effect, by Seymour et al in 1994. Compared to conventional therapy (diuretics &beta blockers) ca channel blockers have been found to be more effective and hence these are more frequently prescribed (Levine CB, 2003). The dihydropyridines have been found to be associated with enlargement of the gums with nifedipine having the highest incidence of about 6 % (Ellis JS, 1999). Amlodipine however is also being found to be associated with gingival overgrowth and more& more such cases are being reported. A recent study comparing the effect of calcium channel blockers& Renin angiotensin system drugs showed that gingival enlargements are twofold greater in the former group of drugs. This association was dose dependant& was higher in dihydropyridine derivatives (KaurG, 2010). The pathogenesis of this gingival overgrowth remains to be fully understood still. These drugs affect intracellular calcium metabolism or transport may stimulate gingival fibroblasts to cause increased deposition of extracellular matrix components such as glyosaminoglycans in some patients (Dongari Bagtzoglou A, 2004). The other proposed non inflammatory mechanisms include defective collagenase activity, blockage of aldosterone synthesis in adrenal cortex which is also calcium dependent& causes a consequent feedback increase in ACTH levels & upregulation of keratinocyte growth factor (Das SJ, 2002). Recent studies have demonstrated abnormally high levels of specific cytokines such as IL-6, IL-1 beta, Platelet derived growth factor, Fibroblast growth factor, Transforming growth factor beta & connective tissue growth factor in gingival overgrowth tissue (Trackman P.C, 2004). Drug induced gingival enlargements are usually associated with a superimposed inflammatory component which has to be minimised as it is a major contributor to the gingival overgrowth (Seymour RA, 2006). Meticulous oral hygiene measures should be done by the dentist &patient maintenance of the same plays a major role in decreasing the inflammatory
component. This helps in decreasing the degree of gingival overgrowth present& improves overall gingival health. In cases of severe enlargements consideration for substitution of amlodipine with isradipine, lercanidipine or lacidipine which are newer fourth generation dihydropyridines may be an option. Substitution with other classes of antihypertensives such as Beta blockers, A.C.E inhibitors or Thiazide diuretics can also be considered (Rashi Chaturvedi, 2011). But in cases for drug substitution systemic health should given prime importance. Discontinuing the causative drug has been found to reduce the gingival overgrowth but in cases where enlargement causes esthetic& masticatory difficulties for the patient periodontal surgical treatment should be considered. CONCLUSION Though the incidence of Amlodipine induced gingival enlargements are rare, presently many cases are being reported even with a minimal dose and also as late presentation as seen in our patient. The exact mechanism by which drug causes gingival enlargement is yet to be explored! Research in this area would benefit large number of hypertensive patients. Hence physians and Periodontistss should be made aware of this fact & regular follow up to be emphasised for all patients under Amlodipine therapy. REFERENCES Das SJ, Olsen I, Keratinocyte growth factor is upregulated by hyperplasia- inducing drug Nifedipine, Cytokine, 12, 2000, 1566-9. Dongari Bagtzoglou A, Research, Science and Therapy Committee, American Academy of Periodontology, Drug associated gingival enlargement, J Periodontol, 75, 2004, 1424-31. Ellis JS, Seymour RA, Steele JG, Robertson P, Butler TJ, Thomason JM, Prevalence of gingival overgrowth induced by calcium channel blockers: A community based study, J Periodontol, 70, 1999, 63-7. Jimmy Jose, Santhosh Y, Naveen MR, Vijay kumar, Asian J Pharm Clin Res, 4, 2011, 65-6. KaurG, Verhamme K. M. C, Dieleman J.P, Vanrolleghem A,Van Soest E. M., Stricker B.H.C.et al. Association between calcium channel blockers and gingival hyperplasia, J Clin Periodontol, 37, 2010, 62530.
IJRPB 1(6)
www.ijrpb.com
Page 899
Sivaranjani et.al
Levine CB, Fahrbach KR, Frame D, Connelly JE, Estok RP, Stone LR et al. Effect of amlodipine on systolic blood pressure, Clin Ther, 25, 2003, 35-57. Nyska A, Shemesh M, Tal H, Dayan D. Gingival hyperplasia induced by calcium channel blockers: mode of action. Med Hypotheses, 43, 1994, 115-8. Rashi Chaturvedi, Ashish Jain. Amlodipine induced gingival enlargement - presentation of a clinical case series, J Clin Exp Dent, 3, 2011, 390-4.
Seymour RA, Effects of medications on the periodontal tissues in health and disease, Periodontol 2000, 40, 2006, 120-9. Trackman P.C, Kantarci A, Connective tissue metabolism and gingival overgrowth, Crit Rev Oral Biol Med, 15, 2004, 165-75.
IJRPB 1(6)
www.ijrpb.com
Page 900
Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets of Diltiazem hydrochloride
Venkateswara Rao T*, Bhadramma N, Raghukiran CVS2 and Madubabu K3 Department of pharmaceutics, Bapatla college of Pharmacy, Bapatla, India. Tigala Krishna Reddy College of Pharmacy, Hyderabad. Hetro Drugs Ltd, Hyderabad *Corresponding author: Email: tv_rao2@yahoo.com ABSTRACT In the present study an attempt was made to study the effect of formulation variables on bilayered floating tablet of Diltiazem hydrochloride. Immediate release layer was formulated by using various super disintegrants such as sodium starch glycolate, cross carmellose sodium, crospovidone and sustained release layer was formulated with different grades of hydrophilic polymers like HPMCK4M, HPMCE5 and HPMCK100M by wet granulation method. The influence of polymer and citric acid concentrations were also investigated. The prepared tablets were characterized and rate of drug release from an immediate release layer was 99.9% were found at the end of 20 minutes followed by sustained the drug release for 12hrs from sustained release layer. The dissolution data were fitted into zero order, first order, Higuchi and Peppas equations. Results revealed that the drug release from the formulation F20 followed zero order kinetics and exhibited Peppas transport mechanism. Key words: Diltiazem hydrochloride, wet granulation method, first order kinetics, HPMC-Hydroxy propyl methylcellulose. dosage forms such as floating systems, swelling INTRODUCTION systems, hydro dynamically balanced systems and low The oral route is considered as the most promising and density systems etc. In the present investigation predominant route of drug delivery1. Effective oral Diltiazem Hydrochloride was selected as model drug drug delivery may depend upon the factors such as GI is a calcium channel blocker and it is widely used in transit time of dosage form, gastric emptying process, the treatment of hypertension. The drug has short drug release from the dosage form and site of biological half life 3-4 hrs, low bioavailability and absorption of drug. Most of the oral dosage forms narrow absorption window in upper part of GIT. Multi possess several physiological limitations such as layer concepts have been utilized in this present variable GI transit, because of variable gastric investigation. The compatibility studies were emptying, leading to incomplete drug release, nonconducted by FT-IR spectroscopy, no compatibility uniform absorption profiles and shorter residence time between drug and polymers were found. Bi-layered of the dosage form in the stomach. This leads to floating tablets having immediate release layer and incomplete absorption of drugs having absorption sustained release layer, the drug was released within window especially in the upper part of the small 20 minutes from the IR layer leads to a sudden raise in intestine, as once the drug passes down the absorption blood concentration, blood level was maintained at site, the remaining quantity goes unabsorbed. steady state as the drug was released from the To overcome these limitations, various sustained release layer. approaches have been proposed to increase gastric MATEARIALS AND METHODS residence of drug delivery systems in the upper part of the GI tract. Dosage forms that can be retained in the Diltiazem Hydrochloride, gift sample from stomach are called gastro retentive drug delivery Medreich ltd Banglore, Sodium starch glycolate, systems (GRDDS). GRDDS can improve the Croscarmellose sodium, Crospovidone, controlled delivery of drugs that have an absorption HPMCK100M, HPMCK4M and HPMCE5 were window by continuously releasing the drug for a procured from (Medreich ltd Bangalore),PVPk-30 and prolonged period of time before it reaches its Lactose (SD Fine Chem., Mumbai, India),Talc and absorption site, thus ensuring its optimal Magnesiumstearate was obtained from (Qualigens bioavailability. Fine Chem., Mumbai, India). One of the novel approaches in the area of sustained drug delivery was Gastro retentive drug delivery systems (GRDDS).Several techniques have been proposed to increases the Gastric residence time of Drug- Excipient Compatibility Study by IR spectroscopy: IR spectrums of pure drug of Diltiazem Hydrochloride and its physical mixtures were carried out by using FT-IR (Thermonickolat, USA)
IJRPB 1(6)
www.ijrpb.com
Page 901
employing the KBR pellet method. The spectra were scanned over a wave range of 400-4000cm-1 Preparation of Diltiazem Hydrochloride Bilayer Floating tablets: The preparation of Bilayer floating tablets involved two steps prepared by wet granulation method. The excipients used in the formulation are superdisintegrants such as SSG, Croscarmellose sodium, Crospovidone, PVP in isopropyl alcohol as binding solution, HPMCK4M, HPMCE5 and HPMCK100M as polymers, lactose as diluent, and talc and magnesium stearate as glidant and lubricant. The dose calculation for the loading dose and maintenance are given below Pharmacokinetic parameters of Diltiazem hydrochloride:
Fraction of drug absorbed (F) Elimination half life (t1/2) Elimination rate constant (Ke) Clearance Volume of distribution 0.44 3.7 hrs 0.187hr-1 12 ml/min/kg 3.1 lit/kg
Compression of bilayer floating tablets: The required quantity of granules for the SR layer was compressed slightly by using a rotary punch tablet machine with 9mm punches. Then the required quantity of granules for the IR layer were placed over the above compact ,both the layers were compressed by 9 mm round shaped punches with Cadmach tablet machine to obtained the tablets. Evaluation of Diltiazem Hydrochloride bi-layered floating tablets: All the prepared bi-layered floating tablets were evaluated for following parameters. Weight Variation: Formulated tablets were tested for weight uniformity, in which 20 tablets were weighed collectively and individually. From the collective weight, average weight was calculated. The percent weight variation was calculated by using the following formula.
Calculation of Loading dose (DL):

Loading dose But, Css avg Css avg Css avg DL Loading dose(DL) (Css avg Vd)/F (FDose/)/Clearance (0.4490mg/12hrs)12ml/min/kg 6.5410-8mg/ml (6.5410-8mg/ml3.1lit)0.44 34.57
Hardness: The hardness of tablets was measured by Monsanto hardness tester. The hardness was measured in terms of kg/cm2. Friability: The Roche friability test apparatus was used to determine the friability of the tablets. Twenty pre-weighed tablets were placed in the apparatus and operated for 100 revolutions and then the tablets were reweighed. The percentage friability was calculated according to the following formula.
Calculation of Maintainance dose (DM):

Maintainance dose But, Ko Maintainance dose Maintainance dose So, DM Ko (T-t1/2) Ke loading dose Ke loading dose(T-t1/2) 0.18734.57 (12-3.7) 54.87 mg
Based on the above calculations, the immediate release dose was considered as 35mg and the maintenance dose was considered as 55mg. Preparation of the immediate release layer: The immediate release layer was prepared as per the formula given in table 1. The damp mass was passed through sieve no 12. The granules thus obtained were dried in an oven at 50 OC. The dried granules were sieved through sieve no16 and lubricated with talc and magnesium stearate. Preparation of the floating sustained release layer: The SR layer was prepared as per the formula shown in table2. The damp mass was passed through sieve no 12 to obtain granules. The granules thus obtained were dried in an oven at 50 OC. The dried granules were sieved through sieve no 16 and lubricated with talc and magnesium stearate.
Drug content: Twenty tablets were weighed, powdered and quantity of powder equivalent to 100 mg of Diltiazem hydrochloride was dissolved in 0.1 N HC1 diluted to 100ml with 0.1N HC1 then the solution was filtered and suitably diluted. The drug content was estimated spectrometrically at 237 nm. Swelling index: Tablet was weighed (W0) and placed in 0.1N hydrogen chloride maintained at 37c. At predetermined time intervals the tablets were reweighed and blotted to remove excess water and weighed (Wt). The percentage of swelling index calculated by the following formula
Wt = final weight of the tablet Wo = initial weight of the table.
Floating characteristics: Floating characteristics were determined using USP dissolution apparatus at 100rpm using 900 ml of 0.1 N HCl, temperature was maintained at 37c.
IJRPB 1(6)
www.ijrpb.com
Page 902
Floating lag time: The tablet was placed in dissolution apparatus and the time taken to float on the dissolution medium was noted. Floating time: The total duration of the time that the tablet float on dissolution medium was noted. In-vitro dissolution studies: In-Vitro Dissolution rate was studied by using USP type II paddle dissolution apparatus in 900ml of 0.1N Hydrochloric acid at 370.5at 50 rpm. 5ml of aliquot of dissolution medium was withdrawn at regular time intervals, the same volume of pre-warmed (370.5) fresh dissolution medium was replaced. The samples were filtered and drug content of diltiazem hydrochloride in each sample was analyzed after suitable dilution by Shimadzu UV-spectrophotometer at 237 nm. Results and discussion: The IR spectra of Diltiazem Hydrochloride, crospovidone, HPMCK100M and its physical mixtures were given in fig 1, fig 2 , Fig 3, fig 4 and fig 5.. The following principle peaks were observed in the IR spectra of Diclofenac sodium.
Amine stretching N-H (Stretching) Acetate C=O (Stretching O-Substituted aromatic C-H out of plane deformation C-H (Stretching, aliphatic) P-Substituted aromatic C-H out of plane deformation C N (amide) C=O 2386.15 cm-1 1737.15 cm-1 832.80 cm-1 2964.58 cm-1 774.45 cm-1 1290 cm-1 1650 cm-1
zero order, drug release from formulations exhibited the first order kinetics, the order of drug release from the formulations were in the following order F12>F8>F11>F4>F7>F10>F3>F6>F2>F9>F1>F5 i.e. increasing the concentrations of SSG, Croscarmellose sodium and Crospovidone in formulations the drug release rate was found to be increased. Finally F12 was optimized for development of the bi layer Diltiazem hydrochloride tablets. In vitro drug release profiles for bilayer tablets were shown in fig 9,10,11 and 12, percentage of drug release for the formulations F13, F14, F15, F16, F17, F18, F19, F20, F21, F22, F23 and F24 are 95.602 0.34, 92.98 0.34, 98.30 0.34,97. 10 0.34, 98.610.34, 99.360.34, 98.880.34, 99.710.34, 86.210.34, 97.790.34, 99.810.34 and 99.230.34 observed at the end of 6, 8, 10, 4, 6, 8, 6,1 2, 12, 10, 8 and 6 hours respectively. Among all the formulations F20 retarded the drug release for 12 hrs where as F21 formulation prolonged the drug release for more than 12 hrs. So tablets formulated with HPMCK 100M (F20) was selected and studied the influence of citric acid on drug release. By the addition of citric acid into the formulations, floating lag time and total floating time was decreased when compared with the previous studies, that is due to liberation of excess amount of corbondioxide and hence the total amount of the drug was also released within 10 hours when compared with the formulations formulated without citric acid. The In-vitro release data were fitted into various kinetic models i.e. First order, zero order, Higuchi and Peppas equations, drug release from formulations exhibited zero order kinetics and exhibited the Peppas transport mechanism. The exponential coefficient from the Peppas plots was found to be <0.5 indicating Fickian diffusion transport mechanism, the order of release retardant was as follows HPMCK100M>HPMCE5>HPMCK4M, from the results it indicated that release rate was retarded by increasing the concentration of the polymer. In- vitro buoyancy studies revealed that tablets of hardness 2-4 Kg/cm2 after immersion into the floating media floated immediately, tablets with hardness of 4-5 Kg/cm2 sank for 3-4minutes, and then floated on to the surface. Tablets with different hardness remained floating for 8-12 hrs. The buoyancy of the tablets is governed by both the swelling of the poly hydrocolloid particles in the tablet surface when it the contacts the gastric fluids and presence of the internal voids in the centre of the tablet, hence altering a bulk density <1. The
The principle peaks of pure peaks were also observed in the spectra of spectra of physical mixtures, it was confirmed that no chemical or physical interactions were exists between the drug and the excipients employed in this investigation. Micromeritic properties for formulations were evaluated, the results revealed that IR layer and SR layer granules exhibited good flow properties; it was also further supported by Carrs Index and Hausners ratios values. The formulated tablets were subjected to various quality control tests and the results were shown in table 3. The obtained results were found to be within limits of pharmacopoeia. The % drug content in all bilayer formulaitons were observed in the range of 98.60.03% to 99.0.02%.The floating lag time for the prepared formulations were found to be decreased while increasing the concentration of polymer and also total floating time of SR layer formulations were increased by increasing the concentration of polymer. The formulations of immediate release layer were shown in table1. In vitro release profiles were shown in fig 6,7 and 8, in-vitro release data were fitted into various kinetic models i.e. First order and
IJRPB 1(6)
www.ijrpb.com
Page 903
formulation F20 formulated with HPMC K 100 M sustained the release for 12 hrs, when compared with formulations made with HPMC K4 M and HPMC E5 grade of polymers this may be due to the viscosity of the polymer i.e formation of gel structure. The concentration of citric acid in the formulations were also investigated, by increasing the concentration of citric acid per tablet from 10-20mg, the floating lag time were found to be decreased due to its reaction with sodium bicarbonate resulting in generation of carbon dioxide gas of a faster rate i.e in presence of
excess carbon dioxide and also release rate were observed very faster. Finally concluded that, results of the studies based on the in- vitro performance clearly suggested that, sustained release floating matrix tablets can be prepared by immediate release layer of drug with crospovidone and SR layer comprises the sodium bicarbonate, citric acid with HPMC K 100 M for achieving the sustained action and restricted the drug release in the stomach.
Table.1.Composition of Immediate release layer for bi-layered floating tablets of Diltiazem Hydrochloride formulated with SSG, Croscarmellose sodium, Crospovidone
Ingredients Diltiazem hydrochloride Sodium starch glycolate Croscarmellose sodium Crospovidone PVPk-30 Lactose Talc Magnesium stearate Total weight(mg) F1 35 1.5 1.5 35.5 0.75 0.75 75 F2 35 2.25 1.5 34.75 0.75 0.75 75 F3 35 3 1.5 34.75 0.75 0.75 75 F4 35 3.75 1.5 33.25 0.75 0.75 75 Quantity per single tablet(mg) F5 F6 F7 F8 35 35 35 35 1.5 1.5 35.5 0.75 0.75 75 2.25 1.5 34.75 0.75 0.75 75 3 1.5 34 0.75 0.75 75 3.75 1.5 33.25 0.75 0.75 75 F9 35 1.5 1.5 35.5 0.75 0.75 75 F10 35 2.25 1.5 34.75 0.75 0.75 75 F11 35 3 1.5 34 0.75 0.75 75 F12 35 3.75 1.5 33.25 0.75 0.75 75
Table.2.Composition of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 4 M, HPMCK E 5 and HPMCK100M
Ingredients F13 Diltiazem hydrochloride Crospovidone PVPk-30 Lactose Talc Magnesium stearate Diltiazem hydrochloride HPMCK 4 M HPMCK E 5 HPMCK100M HPMCK100M Citric acid Sodium bi carbonate Lactose Talc Magnesium stearate Total weight(mg) 35 3.75 1.5 33.25 0.75 0.75 55 60 30 49 2 2 275 F14 35 3.75 1.5 33.25 0.75 0.75 55 80 30 31 2 2 275 F15 35 3.75 1.5 33.25 0.75 0.75 55 100 30 11 2 2 275 Quantity per tablet (mg) F16 F17 F18 F19 Immediate release layer 35 35 35 35 3.75 3.75 3.75 3.75 1.5 33.25 0.75 0.75 55 60 30 49 2 2 275 F20 35 3.75 1.5 33.25 0.75 0.75 55 80 30 31 2 2 275 F21 35 3.75 1.5 33.25 0.75 0.75 55 100 30 11 2 2 275 F22 35 3.75 1.5 33.25 0.75 0.75 55 80 10 30 49 2 2 275 F23 35 3.75 1.5 33.25 0.75 0.75 55 80 20 30 31 2 2 275 F24 35 3.75 1.5 33.25 0.75 0.75 55 100 20 30 31 2 2 275
1.5 1.5 1.5 33.25 33.25 33.25 0.75 0.75 0.75 0.75 0.75 0.75 Sustained release layer 55 55 55 60 30 49 2 2 275 80 30 31 2 2 275 100 30 11 2 2 275
IJRPB 1(6)
www.ijrpb.com
Page 904
Table.3.Physico-chemical evaluation of the for bi-layered floating tablets of Diltiazem Hydrochloride

Formulation F13 F14 F15 F16 F17 F18 F19 F20 F21 F22 F23 F24 Average weight (mg) 2750.21 2750.23 2750.34 2750.3 2750.12 2750.24 2750.3 2750.18 2750.19 2750.25 2750.12 2750.26 Hardness (kg/sq cm) 3.90.31 4.50.22 5.30.17 4.20.24 5.40.18 5.20.2 4.60.15 4.90.36 3.60.24 3.30.45 3.50.36 5.60.01 Friability (%) 0.68 0.66 0.75 0.70 0.67 0.64 0.73 0.71 0.68 0.7 0.72 0.61 Drug content (%) 97.30.01 97.80.04 98.60.05 96.50.02 97.40.03 98.10.04 99.10.05 98.20.04 97.60.02 96.60.03 96.20.05 99.30.02 Swelling index (%) 37.40.03 52.50.03 56.20.04 39.40.03 46.10.02 54.50.02 45.90.03 46.10.05 48.20.04 37.50.03 45.10.03 49.60.02 Floating lag time (sec) 77 60 55 68 60 58 71 59 55 69 60 59 Total floating time (hrs) 10 12 >12 3 6.5 8.5 5 6.5 8.5 2.5 4.5 6
Figure.1. IR spectra of Diltiazem Hydrochloride
Figure.2.IR spectra of Crospovidone
Figure.3.IR spectra of HPMCK100M
IJRPB 1(6)
www.ijrpb.com
Page 905
Figure.4. IR spectra of optimized formulation
Figure.5.IR spectra of Diltiazem Hydrochloride, HPMCK100M and Crospovidone
Figure.6.In-vitro release profile of IR layer formulated with SSG
Figure.7.In- vitro release profile of IR layer formulated with Croscarmellosesodium
Figure.8. In- vitro release profile of IR layer formulated with Crospovidone
Figure.9.In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 4 M
Figure.10. In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK E 5
Figure.11.In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 100M
IJRPB 1(6)
www.ijrpb.com
Page 906
Figure.12.In-vitro release profile of bi-layered floating tablets of Diltiazem Hydrochloride formulated with HPMCK 100M
CONCLUSION The drug and excipients were found to be compatible, it can be confirmed by FTIR spectral analysis.. The characteristics of the granules such as angle of repose, bulk density, tapped density, carrs index, hausners ratio were studied, found to be good flow properties. Evaluation parameters of the tablets such as weight variation, hardness, friability, drug content, swelling index, floating characteristics, was found to be satisfactory. The buoyancy lag time was found to be satisfactory. The swelling index was found to be increased with increase in the amount of the polymer employed. The formulations F20 was found to be, sustained the drug release for 12hrs and also investigated the effect of citric acid on release rate of drug. The optimized tablet formulations showed a satisfactory dissolution profile and floating characteristics. The drug release from all formulations followed zero order kinetics and Fickian diffusion.In the present investigation, successfully developed the bilayer floating tablets of Diltiazem Hydrochloride by wet granulation method using super disintegrants Crospovidone for IR layer and HPMCK100M for SR layer. ABBREVIATIONS IRLayer=Immediate release layer, SRLayer=Sustained release layer, HPMC=Hydroxy propyl methyl cellulose, HCl=Hydrochloric acid, hrs=Hours, rpm=Rotation per Minute. USP=United States Pharmacopoeia and UV=Ultra-Violet. ACKNOWLEDGEMENTS The authors express their gratitude to Medreich ltd. Banglore for providing gift sample of Diltiazem Hydrochloride. The authors are thankful to Bapatla Educational Society, Bapatla for providing facilities to carry out research.
REFERENCES: A.A.Shirwaikar and A. Srinath1, sustained release Bilayered tablets of Diltiazem hydrochloride using insoluble matrix system: Indian journal of pharmaceutical science, 2004, 66(4):433-437. Bharadia P.D, Patel M.M., Gayatri C.Patel, Girish N.Patel, A primary investigation on sesbania excipients, Int.J.Pharma.Excip, 2004, 99-102. Leon lachman, Herbert A Liberman, Joseph L.Kang, The theory and practice of industrial pharmacy, Varghese publishing house, Mumbai, 1987, 3rd edition, 52-53. S.P.Vyas., Roop K. Khar., Gastrovetentive systems. In: controlled drug delivery concepts & Advances, vallabh prakashan, 2005, 96-199. Shah S.H., Patel J.K., Patel N.V, Stomach specific floating drug delivery system: A review: International journal of pharmaTech Research, 1(3), 2009, 623-633. Tejal Soni, Chirag Nagda, Tejal Gandhi, and N. P. Chotai, Development of discriminating method for dissolution of aceclofenac marketed formulations, Dissolution Technologies, 2008, 31-35. United States Pharmacopeia, Asian edition, US Pharmacopieal convention, Rockville, 1995, 19801982. USP 27/NF 22, Asian edition, General test procedures, U.S. Pharmacopoeial convention, Rockville MD, 2004, 1204. Viniia V.Kale, Rahul Kasliwal, Subrat K. Pari da, Jasmine G.Awari, Formulation and release characteristics of guar gum tablet containing Metformin hydrochloride, Int.J.Pharma.Excip, 2004, 75-80.
IJRPB 1(6)
www.ijrpb.com
Page 907
Kamalkannan and Arul
Development and optimization of Diltiazem hydrochloride loaded microspheres by using different Eudragit polymers
V. Kamalakkannan*1, K.S.G.Arul Kumaran2 1.Department of Biotechnology (Pharmacy) Periyar Maniammai University, Thanjayur, Tamil Nadu, India 2.Department of pharmaceutics, K.M.C.H College of Pharmacy, Coimbatore, Tamil Nadu, India * Corresponding author: Email: kamalpharma79@rediffmail.com; Contact: +918973750397 ABSTRACT The problems of frequent administration and variable low bioavailability (40-60%) after oral administration of conventional dosage forms of Diltiazem hydrochloride can be attenuated by designing it in the form of microspheres which would prolong the residence time at the absorption site to facilitate intimate contact with the absorption surface and thereby improve and enhance the bioavailability. Microspheres of Diltiazem hydrochloride were formulated using Eudragit S 100 and Eudragit L 100 alone by solvent evaporation methods with an aim to prolong its release. Six formulations prepared by using different drug to polymer ratios, were evaluated for relevant parameters. Depending upon the drug to polymer ratio, the entrapment efficiency were found to range between 86.11 0.37, 88.84 0.28, 91.80 0.29, 94.38 0.26, 95.57 0.39, 98.11 0.29 respectively. The scanning electron microscopic study indicated that the microspheres were spherical in shape and the drug remained dispersed in the polymer matrix at amorphous state, In vitro studies were carried out at different pH for a period of 12 hours. Drug polymer interaction was absent as evidenced by FT-IR. Keywords: Diltiazem hydrochloride, mucoadhesive microspheres, solvent evaporation technique, Eudragit S and L 100, in vitro evaluation. INTRODUCTION Diltiazem h y d r o c h l o r i d e are easily absorbed from gastrointestinal tract (GIT) and have a short half-life are eliminated q u i c k l y f r o m blood c i r c ul at i on . This drug undergoes substantly hepatic first pass effect it shows to o r a l b i o a va i l a b i l i t y 40%. So they require frequent Dosing to avoid these drawback, the oral sustained control release formulation have been developed in an attempt to release the drug surely in to the GIT and maintained an effective drug concentration in the serum for longer period of time Diltiazem hydrochloride an effective drug in treatment of hypertension and angina pectoris is a benzodiazepines derivative and Diltiazem hydrochloride is a calcium channel blockers which cases coronary and peripheral vasodilatation by reducing calcium influx through the slow channel of vascular smooth muscle and cardiac cell membranes . Administration of conventional tablet of Diltiazem Hydrochloride has been reported to exhibit fluctuations in plasma drug level resulting either in side effect of reduction in drug concentration at receptor side, also the maintenance of constant plasma concentration of cardiac vascular drug is important in ensuring the designed therapeutic response, again since the half life of Diltiazem HCL is 3-4 hrs multiple dos e of drug need to maintained constant plasma concentration for good therapeutic response and improve patients compliance. Hence the objective of study was made to develop control release microsphere system of Diltiazem Hcl using polymer like Eudragit L/S 100 which controlled the released of drug increase the bioavailability of drug and dose decreasing the dosing frequency of drug. For formulation of microsphere formulation was preferred over conventional tablet or capsule formulation has it as several advantage like it control the release pattern thus decreasing the dosing frequency. MATERIALS AND METHODS Diltiazem Hcl was received as a gift from M/s Microlabs, Bangalore, India. Eudragit S-100, L-100 were obtained Gift sample from Dr.Reddys Lab, Hyderabad, India. All other reagents and solvents used were of pharmaceutical or analytical grade. Preformulation Studies of Pure Drug: Identification of pure drug: Identification of Diltiazem Hydrochloride was carried out by Infrared Absorption Spectroscopy. Drug - Excipients Compatibility Studies: Compatibility of Diltiazem Hydrochloride with the respective polymers that is Eudragit L100 and S100, and physical mixture of main formulation was established by Infrared Absorption Spectral Analysis FTIR. Any changes in the chemical composition after combining with the excipients were investigated with IR spectra.
IJRPB 1(6)
www.ijrpb.com
Page 908

DITIAZEM DRUG
90

1292.508 110.346 1138.251 45.290 1111.860 75.176 863.236 123.200 736.893 58.922
80 1321.062 38.426 2499.490 54.143
415.794 82.985 691.144 120.615 435.884 91.363 568.653 120.071 635.236 102.545 531.706 118.491 665.573 150.053 479.737 218.088 755.708 65.550 781.477 195.473
%Transmittance
70 1582.429 98.353 60 2380.215 272.180 1741.135 517.708 50 1443.181 31.995 40 1607.113 176.450 1677.176 506.127 30 1215.336 547.746 1474.152 227.122 1411.885 106.259 1509.160 330.859 1084.204 108.010 1159.107 46.164 911.019 164.217 1007.890 70.993 975.073 227.949 1237.199 54.842 1056.239 168.260 1026.085 160.930 1253.174 156.567 1178.237 154.926
839.163 149.179
3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 Wavenumber 1800 1600 1400 1200 1000 800 600 400 200
Figure.1.IR Spectrum of Diltiazem Hydrochloride in KBr

100 95 90 85 80 %Transmittance 75 70 65 60 55 50 45 3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 1800 1600 1400 1200 1000 800 600 400 200 911.107 44.021 1719.488 -0.009 3000.574 2.480 2384.520 1.378 1607.417 37.041
DITIAZEM HCL + FM1+ PF1

1582.481 23.143 1508.695 50.904 1388.458 40.893 1026.203 42.485 665.278 33.312
1474.329 105.891 2950.942 214.033 1442.975 38.038 974.385 74.696 1252.041 105.720 1193.201 39.705 781.231 48.056 1060.073 102.523 754.878 49.822 479.740 99.855 839.169 50.642
1150.889 313.281
Wavenumber
Figure.2.IR spectrum of DTZ.HCl, FM1, PF1(Physical mixture corresponding to FM1)

100 95 90 85 %Transmittance 80 75 70 1437.891 58.917 65 60 55 50 45 3800 3600 3400 3200 3000 2800 2600 2400 2200 2000 Wavenumber 1800 1600 1400 1200 1000 800 600 400 1719.726 171.523 1147.625 839.850 1190.428 90.980 2952.065 43.878 2993.239 -4.318 1388.079 89.597 751.211 256.837 1244.796 822.435 484.899 12.503
DITIAZEM HCL + FM2+ PF2

1477.842 1.166 840.039 158.695 964.392 57.718
Figure.3.IR spectrum of DTZ.HCl, FM2, PF2 (Physical mixture corresponding to FM2) Table.1. Wave- number of different functional groups present in Diltiazem.HCl
Code Composition O-CH C-H sretch
3 -1
Aromatic
Peak for Diltiazem hydrochloride CAmine HCl N-H Acetate

-1 -
Lactam
-
DTZ.HCl FM1PF1 FM2 PF2
Diltiazem Hcl Formulation FM1 Formulation FM2
(cm ) 3057.27 3055.35 3057.27 3055.35 3057.27
H Stretch (cm 1 2837.38 ) 2847.03 2839.31 2850.88 285088
stretch (cm ) 2391.81 2391.81 2389.88 2389.88 2389.88
C=O stretch (cm 1 1743.71 ) 1743.71 1745.64 1743.71 1745.64
C=O stretch (cm 1 1681.98 ) 1681.98 1681.98 1681.98 1681.98
IJRPB 1(6)
www.ijrpb.com
Page 909
Preparation of Diltiazem Hcl microspheres: Diltiazem hydrochloride loaded microspheres were prepared by solvent evaporation method. Diltiazem hydrochloride and each polymer mixture were dissolved completely in acetone-methanol mixture by stirring at 500rpm with magnetic stirrer. Magnesium stearate was added and the mixture was stirred with magnetic stirrer at 500 rpm in ice-bath at 10o C for 10 minute. Above mixture was poured into the liquid paraffin previously cooled at 10oC, while it was being
stirred by mechanical stirrer at 1000 rpm. Resulting emulsion was stirred at 35oC for 4 hours using mechanical stirrer and the organic solvent, acetonemethanol were removed completely by evaporation. Solidified microspheres were filtered through Whatmann filter paper (No.1), washed six times with 50 ml n-hexane. Dried under vacuum at room temperature for 12 h and stored in desiccators containing calcium chloride.
Table no-2 Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and Polymer mixtures (Drug: Polymer =1:1)
Contents of Formulations Diltiazem hydrochloride (gm) Eudragit L 100 (gm) Eudragit S 100 (gm) Magnesium Stearate (gm) (Dispersing Agent) Methanol (ml) Acetone (ml) Liquid paraffin (ml) FM1 2.0 2.0 0.300 3.0 7.0 100 FM2 2.0 2.0 0.300 3.0 7.0 100 FM3 2.0 1.0 1.0 0.300 3.0 7.0 100
Table.3. Formulations of Diltiazem hydrochloride Microspheres prepared with different Polymers and Polymer mixtures (Drug: Polymer =1:2 )
Contents of Formulations Diltiazem hydrochloride (gm) Eudragit L 100 (gm) Eudragit S 100 (gm) MMagnesium Stearate (gm) Methanol (ml) Acetone (ml) Liquid paraffin (ml) FM4 2.0 4.0 0.600 6.0 14.0 200 FM5 2.0 4.0 0.600 6.0 14.0 200 FM6 2.0 2.0 2.0 0.600 6.0 14.0 200
Evaluation of microspheres Particle Size analysis: The particle size of microspheres was determined by optical microscopy method; approximately 100 microspheres were counted for particle size using a calibrated optical microscope. The microspheres were uniformly spread on a slide. The particle size of the microsphere was measured, along the longest axis and the shortest axis (cross shaped measurement). Average of these two readings was given as mean diameter of particles. The diameter of a minimum number of 100 microspheres in each batch was calculated. SEM Photographs of Microspheres: Instrument used Lieca stereomicroscope EZ4D and Magnified 10x 20x and 10x30x. Micromeritic properties of microspheres: The floating microspheres are characterized by their micromeritic properties such as bulk density, compressibility index, Hausners ratio and angle of repose.
Determination of percentage yield: The prepared microspheres were collected and weighed. The measured weight was divided by the total amount of all non-volatile components which were used for the preparation of the microspheres
Determination of entrapment efficiency (%): 50 mg of the microspheres were taken for evaluation. The amount of drug entrapped was estimated by crushing the microspheres and extracting with aliquots of 0.1N Hcl repeatedly. The extract was transferred to a 100 ml volumetric flask and the volume was made up using 0.1N HCL. The solution was filtered and the absorbance measured after suitable dilution spectrophotometrically (UV 1700, Shimadzu, Japan) at 266 nm against appropriate blank. The entrapment efficiency (%) was calculated according to the following relationship
IJRPB 1(6)
www.ijrpb.com
Page 910
In-vitro Release Study of the microspheres:
Dissolution studies were carried out by using USP XXIII dissolution test apparatus (Basket) method. Capsules were placed in a basket so that the capsule should be immersed completely in dissolution media but not float. In order to simulate the pH changes along the GI tract, three dissolution media with pH 1.2, 7.4 and 6.8 were sequentially used referred to as sequential pH change method. When performing experiments, the pH 1.2 medium was first used for 2 hrs (since the average gastric emptying time is 2 hrs) then removed and the fresh pH 7.4 phosphate buffer saline (PBS) was added. After 3 hrs (average small intestinal transit time is 3 hrs) the medium was removed and fresh pH 6.8 dissolution medium was added for subsequent hrs. 900ml of the dissolution medium was used at each time. Rotation speed was 100 rpm and Table.4.Particle Size Distribution of Formulations FM1 to FM6
Particle Size Range 0-50 50-100 100-150 150-200 200-250 250-300 300-350 350-400 400-450 450-500 500-550 550-600 600-650 FM1 0 0 10 41 55 56 23 10 5 0 0 0 0 FM2 0 0 9 60 71 43 10 3 2 2 0 0 0 FM3 0 0 8 44 71 41 22 8 4 2 0 0 0 FM4 0 0 0 8 9 12 28 49 47 22 17 8 0
temperature was maintained at 370.5 C. 5ml of dissolution media was withdrawn at predetermined time intervals and fresh dissolution media was replaced. The withdrawn samples were analyzed at 237 nm, by UV absorption spectroscopy. RESULTS AND DISCUSSION Particle Size analysis: It has been observed that the particle size increases with increasing polymer amount. The increase in the mean size with increasing polymer concentration was attributed to the fact that higher concentration of polymer in the sample leads to increase in viscosity of the dispersed phase, which results in formation of bigger droplets and also, fusion of semi-formed particles and producing an overall increase in the size of the microspheres. Eudragit L,type microspheres and Eudragit S-type microspheres prepared with the same polymer concentration did not show any significant variation in their mean size.
FM5 0 0 0 11 28 45 58 28 12 9 6 3 0
FM6 0 0 3 10 14 26 38 51 25 22 7 4 0
Particle Size Distribution of Formulations FM1 to FM6

80 70 60 50 40 30 20 10 0 0-50 50- 100- 150- 200- 250- 300- 350- 400- 450- 500- 550- 600100 150 200 250 300 350 400 450 500 550 600 650 Particle Size Range
No Of Particles
FM1 FM2 FM3 FM4 FM5 FM6
Figure.4.Particle Size Distribution of Formulations FM1 to FM6
IJRPB 1(6)
www.ijrpb.com
Page 911
SEM Photographs of Microspheres: It shows all microspheres were almost spherical in shape and No aggregation of microspheres had taken place.
Figure.5. Formulation FM1
Figure.6.Formulation FM2
Figure.7. Formulation FM3

Batch Code Diltiazem Hcl FM 1 FM 2 FM3 FM4 FM5 FM6 Table.5. Micromeritic properties of microspheres Bulk Density Carr s Index Hausner s ratio (gm/ml) 0.167 0.01 24.380.16 1.43 0.07 0.2870.01 7.120.13 1.07 0.06 0.3030.02 9.820.17 1.10 0.03 0.3060.01 10.0 0.09 1.11 0.07 0.315 0.03 12.50.21 1.14 0.08 0.3230.02 13.170.19 1.150.05 0.3560.03 14.210.21 1.170.09 Angle of repose () *** 22.920.21 23.96 0.63 24.30 0.55 26.56 0.41 28.29 0.37 29.32 0.45
FM3 was less than formulations FM4 FM6. The Percentage Yield Values and Entrapment Efficiencies of Formulations: Diltiazem highest incorporation efficiency of formulation having hydrochloride loaded microspheres having a fairly drug: polymer ratio 1:2 can be explained through the high yield (76.48 88.94%) were obtained. The fact that the amount of polymer in per unit drug is entrapment efficiencies ranged from 86.11 98.73%. greater than that in other formulations. The incorporation efficiency of formulations, FM1 Table.6. Percentage Yield Values and Entrapment Efficiencies of Formulations
Formulation code FM 1 FM 2 FM3 FM4 FM5 FM6 Percentage Yield (%) 76.48 77.21 77.00 85.07 87.73 88.94 Theoretical Drug Content (%) 46.51 46.51 46.51 30.30 30.30 30.30 Actual Drug Content (%)* S.D. 40.05 0.17 41.32 0.13 42.70 0.15 28.60 0.09 28.96 0.12 29.73 0.08 Entrapment Efficiencies (%)* S.D. 86.11 0.37 88.84 0.28 91.80 0.29 94.38 0.26 95.57 0.39 98.11 0.29
IJRPB 1(6)
www.ijrpb.com
Page 912
Figure.8.Percentage yield values and entrapment efficiencies of formulations
In- vitro release study of the microspheres: The release of Diltiazem hydrochloride from different formulations depended on the type of polymer and the ratio of the polymer in the formulations. The release of Diltiazem hydrochloride from microspheres of Eudragit Ltype was more as compared to Eudragit S-type. This was due to the presence of more functional quaternary ammonium groups (10%) in L-type than S-type (5%).It is also observed that as the amount of polymer in the formulation increased, the drug release decreased. It can be explained on the basis that as the polymer amount increases, the matrix wall of microspheres become thicker. A burst effect of drug release can be observed on
TIME(hrs) Formulation FM1 (DTZ:EL100,1 :1) Formulation FM2 (DTZ :ES100, 1:1) Formulation FM3 (DTZ:EL100: ES100, 1:0.5:0.5)
the various formulations.The burst effect can be attributed to the presence of non-encapsulated drug particles on the surface of the microspheres. The burst effect of drug release also depended upon the drug: polymer ratio. From the figure of release profile, it can be observed that burst effect of drug release is more in formulations having drug: polymer ratio 1:1, while in the formulation having drug: polymer ratio 1:2, burst effect is less. Withdrawn at predetermined time intervals and fresh dissolution media was replaced. The withdrawn samples were analyzed at 237 nm, by UV absorption spectroscopy.
Table.7. Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6
Formulation FM4 (DTZ:EL100, 1:2) Formulation FM5 (DTZ:ES100, 1:2) Formulation FM6 (DTZ: EL100: ERS100, 1:1:1)
0 1 2 3 4 5 6 7 8 9 10 11 12
0 41.63 61.18 74.47 82.37 86.18 88.16 92.33 98.53 99.24 99.28 99.34 99.37
1:1 0 18.95 26.68 33 37.04 39.09 42.16 45.2 49.32 52.96 57.97 61.99 65.03
0 18.07 34.12 46.12 55.14 63.63 70.5 75.9 80.99 85.09 88.56 91.77 93.85
0 23.03 41.58 53.58 60.42 65.55 71.04 77.07 81.72 85.03 87.11 89.2 90.8
1:2 0 15.82 19.66 22.95 25.68 29.42 34.77 38.96 42.74 46.06 49.02 52.23 54.42
0 11.29 17.96 23.26 25.89 30.94 35 39.12 47.28 52.14 58.53 64.95 72.75
IJRPB 1(6)
www.ijrpb.com
Page 913
Figure.13.Cumulative Percent Released Diltiazem hydrochloride from Microspheres FM1 toFM6
CONCLUSION The objective of this study was to develop and evaluate stable microsphere of Diltiazem Hydrochloride, an antihypertensive drug using Polymethacrylates (Eudragit L/S 100) as polymer which deliver the drug and at a control rate for prolonged perod of time. Following conclusion have been drawn from present study: The analytical method used in present study was found to be suitable for the estimation of Diltiazem Hcl in different media, which was indicated by the high regression values obtained in the standard plot. The DSC studies revealed that there was no interaction between Diltiazem Hcl and Eudragit L/S100 used in the formulation of microsphere. The size of microsphere mainly affected by stirring speed, as stirring speed increased the size of microsphere was decreased. The encapsulation efficiency was increased by increase in polymer conc. decreased with increase in drug polymer ratio. SEM studies of the formulation were carried out for the confirmation of shape and surface morphology of microsphere. SEM revealed that microsphere was discrete and spherical in shape with porous outer surface. On the basis of, particle size, drug content, Scanning Electron Microscopy, IR-study, in-vitro release studies FM3 was selected as an optimized formulation. Hence, finally it was concluded that the prepared microspheres be considered as one of the promising formulation technique for deliver the drug and at a control rate for prolonged period of time and hence in management of angina pectoris.
REFERENCES Awadhesh Kumar Maurya, Vishal Gupta, Naveen Gupta and Vishal Shrivastav, Development and evaluation of stable microsphere of Diltiazem hydrochloride, an antihypertensive drug, int. J. of pharm & life sci, 2(2), 2011, 583-589. M Nappinnai, VS Kishore, Formulation and evaluation of microspheres of Diltiazem hydrochloride, Indian journal of pharmaceutics, 69(4), 2007, 511-514 Reddy MN, Shriwaikar AA, Rosin, Formulation and evaluation of Diltiazem hcl microspheres, Indian J Pharm Sci, 62, 2000, 308-10. Utsav C Rathod, Anand K Kumar, K Patel, Dushyant A Shah, Statistical evaluation and optimization of influence of stirring speed and polymer concentration on hollow microspheres of Diltiazem hcl, Scholars Research Library, Der Pharmacia Lettre, 4 (3), 2012, 972-978.
IJRPB 1(6)
www.ijrpb.com
Page 914
Daisy Chella et.al
Formulation and characterization of Methotrexate loaded sodium alginate chitosan Nanoparticles

S.Daisy Chella Kumari1*, C.B.Tharani 2, N.Narayanan 3, C.Senthil Kumar4
1.College of Pharmacy, Madras Medical College, Chennai,India. 2.Department of Pharmacology, Saveetha Medical College, Chennai,India. 3.Jaya College of Pharmacy, Thiruninravur, Chennai,India. 4.Anna University, BIT Campus, Tiruchirappalli,India. *Corresponding author: E.mail: gefann@ yahoo.co.in, Mobile: 9791173875 ABSTRACT The aim of the present work was to formulate nanoparticles for Methotrexate drug. Methotrexate is an anticancer, disease modifying anti rheumatic drug, and BCS Class III drug having high solubility and low permeability. Nanoparticles were prepared by ionotropic pregelation method using Box Behnen Formula. The concentration of chitosan (X1),concentration of sodium alginate (X2) and concentration of Methotrexate (X3) were chosen as independent variables while particle size, drug entrapment efficiency and percentage drug release at 36th hour, was taken as dependent variables. The dissolution profile of selected formulations was fitted to zero order, first order, Higuchi and Korsemayer Peppas models to ascertain the kinetic modeling of drug release. The prepared formulations were further evaluated for characterization like surface morphology, particle size distribution, zetapotential and drug excipient interaction study by Fourier Transformer Infra Red Spectroscopy, Differential Scanning Calorimetry and X-ray Diffraction. All independent variables were found to significantly influence the particle size, entrapment efficiency and percentage of drug release. The in- vitro drug release profile showed that the suitability of sodium alginate-chitosan loaded nanoparticles in controlled release of methotrexate for prolonged time. Key words: Methotrexate, Sodium alginate, Chitosan, Ionotropic pregelation method. INTRODUCTION The use of natural biopolymers specifically polysaccharides in drug delivery has attracted particular interest due to their desirable biocompatible, biodegradable, hydrophilic and protective properties (Barichello JM, 1999). The interaction between biodegradable cationic and anionic biopolymers leads to the formation of polyionic hydrogels, which have demonstrated favorable characteristics for drug entrapment and delivery (Chella F, 2000). Chitosan and Alginate are two biopolymers that have received much attention and have been shown to maintain their structure and activity and protect them from enzymatic degradation (Madan T, 1997). Moreover, many of these polymers, particularly hydrogels, are naturally hydrophilic, which is advantageous since this property is thought to contribute to longer in vivo circulation time and allow the highest encapsulation of drug (Douglas KL,2005). Chitosan is a natural cationic polysaccharide obtained by the N deacetylation of chitin, a product found in the shells of crustaceans (Mansouri S,2004). Alginate is an anionic polysaccharide consisting of linear copolymers of a-Lguluronate and b-D-mannuronate residues. Alginates which are a group of hemocompatible polymers have not been found to accumulate in any major organs and have shown evidence of in vivo degradation (Mi FL, 2002). In the presence of Calcium ions, ionic interactions between the divalent Calcium ions and the guluronic acid residues cause Alginates to form gels. The properties of CalciumAlginate gel beads make them one of the most widely used carriers for controlled release systems (Fundueanu G, 1999). Coating of these beads with other polymers including Chitosan has been shown to improve their stability during (shelf-life) storage and their half life in biological fluids. AlginateChitosan polyionic complexes form through ionic gelation via interactions between the carboxyl groups of alginate and the amine groups of chitosan. The complex protects the encapsulant, has biocompatible and biodegradable characteristics, and limits the release of encapsulated materials more effectively than either Alginate or Chitosan alone (Yan XL, 2001). A further advantage of this delivery system is its non-toxicity, which permits its administration to be repeated as a therapeutic agent. Therefore, the purpose of this study was to optimize a method for the preparation of Alginate-chitosan nanoparticles by the use of BoxBehnken methodology to design the most appropriate preparation method.
IJRPB 1(6)
www.ijrpb.com
Page 915
Daisy Chella et.al
Rheumatoid arthritis is an autoimmune disease in which inflammation of the cells lining the synovium produces pain, swelling, and progressive erosion of the synovial joints. Methotrexate (MTX), an antiproliferative and immunosuppressive agent, is the drug of choice in the treatment of the disease (SuarezAlmazor ME, 2000). MTX is a folic acid antagonist used alone or in association with other therapeutic agents; however, MTX has an extensive toxicity range, which is the main cause of therapy withdrawal. MTX treatment is discontinued in 8%19% of patients due to adverse reactions that include gastrointestinal, hepatic, renal, pulmonary, and hematological disturbances, and may also affect the central nervous system (Varatharajan N, 2009).Overall, 26% of patients discontinued MTX treatment due to poor response, high toxicity, or both. Thus, in addition to the relatively high toxicity, variability, and unpredictability of the pharmacological action, there are also drawbacks to the use of MTX treatment for rheumatoid arthritis (Derviex T, 2004). Unfortunately, progression of joint destruction cannot be inhibited completely by MTX treatment in most patients with RA. This lack of efficacy is due to the fact that large amounts of the administered MTX are rapidly eliminated by the kidneys, resulting in a short plasma half life and low drug concentration in the targeted tissue. To overcome these disadvantageous and improve the pharmacokinetic properties, recently introduced MTX-ALG-CS as a polyelectrolytic complex nanoparticle has a substantially prolonged half life in the circulation. The nanoparticulate formulation of MTX was optimized using design of experiments by employing response surface methodology. Response surface methodology determines the optimum level of each factor by building a mathematical model. Optimization of particle size and loading efficacy as the responses were carried out by BoxBehnken response surface methodology. MATERIALS AND METHODS The polymer Chitosan (CS) was received as a gift sample from India Sea Foods, Cochin. Sodium alginate (ALG) was purchased from Sigma Aldrich and Pluronic F-68 from S.D fine chemicals. Methotrexate was provided as gift sample by Aptuit Pvt. Ltd., Hyderabad. Pluronic F-68 was purchased from S.D fine chemicals. All other solvents and materials used were of analytical grade. Box- Behnken Formula: Formula combination production was beginning with determination of
maximum and minimum concentration for each component that being used. Combination formula of chitosan, alginate, and MTX concentration was conducted to determine the effect of each component against nanoparticle characteristic. At early stage, each component value was entered, including chitosan 0.02-0.06% (w/v), alginate 0.05-0.10% (w/v), and MTX 0.01-0.07 (w/v) into Box-Behnken program. This whole data concentration was processed using Box-Behnken model with 3 level 3 factorial to gain representative data spread. The analysis resulted 17 formulas as recommended optimum combination, with some formula replication. The relationship between independent variables and the response was calculated by the second order polynomial Equation. (1) Y = o + 1x1 + 2x2 + 3x3 + 12x1x2 + 13x1x3 + 23x2x3 +11x12 + 22x22+ 33x32 (1) where Y was the predicted response; was the model constant; x1, x2 and x3 were independent variables; 1, 2 and 3 are linear coefficients; 12, 13 and 23 are cross-product coefficients; and 11, 22 and 33 are the quadratic coefficients. The quality of fit of the polynomial model equation was expressed by the coefficient of determination R2. Nanoparticle preparation: Nanoparticles of ALG were obtained by counterion induced gelification method (Rajaonarivony M,1993 , Gupta Jitendra ,2011) .Calcium chloride (0.5ml, 18mM), a cross linking agent, was added to 9.5 ml of sodium alginate solution (0.08%w/v) containing MTX under stirring condition. 2 ml of 0.5% w/v of Pluronic F-68 was added. Chitosan solution (2ml, 0.05% w/v) was added followed by sonication at 25 W for 7min and the mixture was kept at room temperature overnight. Drug loaded nanoparticles were recovered by centrifuging at 19,000 rpm for 3045 min and washed thrice with distilled water to obtain the final nanoparticles. Characterization of nanoparticles Transmission Electron Microscopy: The morphological observation of drug-loaded nanoparticles was performed by transmission electron microscopy (TEM) (JEM 1200 EX, Japan), using a negative staining method. A drop of nanoparticle suspension was spread on a 200-mesh copper grid coating and the excess droplets were removed with lter paper. After 5 min, a drop of 4% (w/v) phosphotungstic acid solution was then dropped onto the grids. After being negatively stained and air-dried under room temperature, the samples were subjected to the TEM investigation.
IJRPB 1(6)
www.ijrpb.com
Page 916
Daisy Chella et.al
Measurement of Particle Size: The mean particle size was obtained by Photon correlation spectroscopy (PCS) (3000SH, Malvern Instruments Ltd., UK). The MTX loaded Alg-CS nanoparticle formulations were diluted with de-mineralized filtered water to an appropriate scattering intensity. Data was analyzed by the cumulate method assuming spherical particles. Accordingly, the results are given as the effective diameter and the poly dispersity index (PDI) as a measure for the relative width of the particle size distribution. Measurement of Zeta Potential: The zeta potential value of optimized MTX loaded Alg-CS nanoparticle formulation was measured with the Zetasizer (3000SH, Malvern Instruments Ltd., UK).To determine the zeta potential, optimized formulation was diluted with double-distilled water and placed in an electrophoretic cell. Fourier Transform Infra-Red Spectroscopy (FTIR): MTX-ALG-CS nanoparticles separated from nanoparticulate suspensions were dried by a freeze dryer, and their FTIR transmission spectra were obtained using a FTIR-8300 spectrophotometer (Shimadzu, Japan). A total of 2% (w/w) of sample, with respect to the potassium bromide (KBr; S.D. Fine Chem Ltd., Mumbai, India) disc, was mixed with dry KBr. The mixture was ground into fine powder using an agate mortar before compressing into KBr disc under a hydraulic press at 10,000 psi. Each KBr disc was scanned at 4 mm/s at a resolution of 2 cm over a wave number region of 4004000 cm1. The characteristic peaks were recorded for pure drug and nanoparticle samples. Differential scanning calorimetry: Differential scanning calorimetric (DSC) analysis was used to characterize the thermal behavior of the drug methotrexate, blank and methotrexate loaded nanoparticles. DSC thermograms were obtained using an automatic thermal analyzer system (Pyris 6 DSC, Perkin-Elmer, USA). Temperature calibration was performed using Indium Calibration Reference Standard (transition point: 156.60 C) as a standard. Samples were crimped in standard aluminum pans and heated from 40 to 400 C at a heating rate of 10C/min under constant nitrogen at 30 ml/min. An empty pan, sealed in the same way as the sample, was used as a reference. X-ray Diffraction: The X-ray diffraction (XRD) patterns were determined for the drug methotrexate, blank and methotrexate loaded nanoparticles. Samples were exposed to a monochromatic nickel-filtered copper radiation (45 kV, 40 mA) in a wide-angle X-
ray diffractometer (advanced diffraction system, Sci.008/ntag Inc., USA) with 2angle. Determination of Encapsulation Efficiency: The encapsulation efficiency of nanoparticles was determined by the separation of drug-loaded nanoparticles from the aqueous medium containing non-associated MTX by ultracentrifugation (REMI high speed, cooling centrifuge, REMI Corporation, India) at 18,000 rpm at 4 C for 30 min. The amount of MTX loaded into the nanoparticles was calculated as the difference between the total amount used to prepare the nanoparticles and the amount that was found in the supernatant. The amount of free MTX in the supernatant was measured by spectrophotometer at 305 nm in suitable dilution with 0.1N HCl. The MTX encapsulation efficiency of the nanoparticles was determined in triplicate and calculated as follows: Equation(2) In-vitro release studies: In-vitro release of drug from MTX nanoparticle formulation is determined by dialysis bag method in phosphate buffer saline pH 7.4. The freeze dried MTX nanoparticles (equivalent to 5.0 mg of drug) was taken in a dialysis bag (molecular cut off 12,000, pore size 0.2 m) and placed in 100 ml of dissolution medium which was continuously stirred at 100 rpm at 37C using shaker incubator. Definite aliquots of the dissolution medium were withdrawn at specific time intervals and the same volume of fresh dissolution medium was added to the flask to maintain a sink condition. The samples withdrawn were analyzed for drug content spectrophotometrically at 303 nm. RESULTS AND DISCUSSION TEM Analysis: TEM analysis confirmed that particles with target size and narrower size distributions could be prepared using a ionotropic pregelation method. Fig (1) showed that MTX-NaAlgCS nanoparticles had spherical shape with size ranging 100 nm. This was achieved by adapting the optimized parameters for the preparation of nanoparticles. Particle Size Determination: The particle size of optimized MTX-NaAlg-CS nanoparticle formulation was showed in Figure (2).The mean particle size of the optimised formulation was found to be 188.6 nm and the PDI was found to be 0.265.The low PDI value indicates the uniform particle size distribution which may due to the adoption of optimised formulation parameters.
IJRPB 1(6)
www.ijrpb.com
Page 917
Daisy Chella et.al
Zeta potential: The zeta potentials of about -22.4 mV showed in Figure (3) indicate good stability of formulation. This might be attributed to surfactant which decreases the electrostatic repulsion between the particles and sterically stabilizes the nanoparticles by forming a coat around their surface. FTIR Analysis: The characteristic peaks of MTX was showed (Fig.4a) at 3464 cm1(-NH stretching), 16483.4 cm1 (COOH), 1653 cm1 (CONH) and 853.88 (aromatic stretch). In the spectrum of MTXNaAlg-CS nanoparticles formulation, significant peaks were obtained at 3437 cm1, 1679 cm1, 1639.1 cm1 and 819.49. Because of the presence of polymer, some additional peaks were present. Fig.(4b). This indicates that there is no interaction between the drug and polymers in the formulation. Differential scanning calorimetry: DSC studies were performed to investigate the physical state of the drug in the nanoparticles, because this aspect could influence the in vitro and in vivo release of drug from the system. DSC thermogram of MTX and MTXNaAlg-CS nanoparticles were showed in Fig (5a, 5b) The thermogram of the drug showed a sharp melting peak at 115.82C. MTX-NaAlg-CS nanoparticles did not show the melting peak for the MTX at 115.82C.The endothermic peak of MTX in MTXNaAlg-CS nanoparticles was depressed, broadened and shifted to lower temperature. These thermal characteristics of MTX corroborate with the reference value reported by (Renu Sigh, 2006). These results could indicate that MTX was not in crystalline state, but is in amorphous state after entrapment with the polymer because drug crystals completely dissolve inside the polymer matrix during the scanning of temperatures up to the melting value or because the drug remained dispersed at molecular level inside the solid dispersion after the formation of MTX-NaAlgCS nanoparticles (Adamo, 2010). X-ray diffraction: X-ray diffraction has been used for the study of molecular structure and polymorphism of polymeric nanoparticles (Westesen, 1993 and Bunjes, 1996). XRD pattern of pure MTX, Blank, MTXNaAlg-CS nanoparticles formulation are illustrated in Fig 6. The XRD pattern of pure Methotrexate from 270 2 showed distinctive peaks approximately at 13.7, 14.1, 19.6, 27.8 and 29 degrees obtained were comparable with XRD pattern of crystalline MTX reported in literature (Rama, 2012). Blank nanoparticles do not show any high intensity peak revealing the amorpous nature of the polymer and stabilizer respectively. The characteristic peaks of the
methotrexate was absent in MTX-NaAlg-CS nanoparticle. This indicates that MTX was molecular dispersed in to the polymeric nanoparticles and there could be less or no free drug in crystalline form on the surface of the nanoparticles. From this, it is evident that an XRD signal of encapsulated drug is very difficult to detect, which showed that the drug is dispersed at a molecular level in the polymeric matrix.(Liu,et al., 2006). Drug release and Release Kinetics: The in vitro release pattern of MTX-NaAlg-CS nanoparticle shown the initial burst release followed by the sustained release was observed in optimized formulation (data not shown). During initial hours minimum burst release of the drug from the polymeric nanoparticles was observed followed by prolonged release (68.99%) up to 36 h. The initial burst release may be probably caused by the drug adsorbed on the surface of nanoparticles or precipitation of drug from the nanoparticles. Sustained release was obtained due to slow diffusion of the drug from the polymeric matrix. To determine the release model that best described the drug release, the in vitro release data was substituted in equations of zero order, first order and Higuchi model and the results are noted. Among them the zero order model showed a high R2 value 0.93443, indicating that the release of the drug followed zero order release kinetics.( Fig 7a) To understand the mechanism of drug release, KorsmeyerPeppas equation was applied and it showed a good linearity. The release exponent n was found to be 0.79307. (Fig 7b). According to this model, if the value of n was between >0.43 and <0.85, it indicated that drug release followed anomalous transport (Non-Fickian) (Chouhan and Bajpai, 2009 b) and was controlled by more than one process (the coupling of Fickian diffusion and polymer matrix relaxation). Optimization and validation: The experimental results were fitted into second-order response surface model. The composition of optimized formulation was achieved with 0.05%w/v chitosan, 0.08%w/v of sodium alginate and 0.04%w/v of MTX, which fulfill the requirements of optimization. The optimized formulation has particle size 183.69 nm, entrapment efficiency of about 93.59% and 68.9 % drug release, which were in good agreement with the predicted values. These figures also indicate that the developed models are adequate and predicted results are in good agreement with the measured data.
IJRPB 1(6)
www.ijrpb.com
Page 918
Daisy Chella et.al
Fig 1 : TEM image of MTX-NaAlg-CS nanoparticles
Fig 2: Particle size distribution of optimized MTXNaAlg-CS nanoparticle
Fig 3: Zeta potential of MTX-NaAlg-CS nanoparticle
Fig 4a: FTIR spectra of pure Methotrexate
Fig 4b : FTIR spectra of MTX-NaAlg-CS nanoparticle
Fig 5a : DSC curve of pure methotrexate
Fig 5b: DSC curve of MTX-NaAlg-CS nanoparticle
IJRPB 1(6)
www.ijrpb.com
Page 919
Daisy Chella et.al
Fig 6 : X-ray diffraction pattern of A) Pure Methotrexate B) Blank nanoparticle C) MTX-NaAlg-CS nanoparticle
Fig 7a: Zero order release of MTX-NaAlg-CS nanoparticle
Fig 7b : Korsmeyer-Peppas drug release kinetics of MTX-NaAlg-CS nanoparticle.
IJRPB 1(6)
www.ijrpb.com
Page 920
Daisy Chella et.al
CONCLUSION Methotrexate loaded nanoparticles were prepared by the ionotropic pregelation method. The FTIR, DSC, XRD pattern study did not detect any crystalline drug material in the freshly prepared freeze dried nanoparticles. The application of factorial design gave a statistically systematic approach for the formulation of nanoparticles with desired particle size, high entrapment efficiency and % drug release. Concentration of Drug , Polymers were found to influence the particle size, Entrapment efficiency and % drug release of MTX loaded NaAlg-CS nanoparticles. The release was found to follow with non-Fickian diffusion mechanism for optimized batch. These results indicate that MTX loaded NaAlg-CS nanoparticles could be effective in controlled drug release for a prolonged period would serve the purpose for long term treatment of Rheumatoid Arthritis. ACKNOWLEDGEMENT The authors are thankful to Aptuit Pvt.Ltd, Hyderabad for providing gift sample of Methotrexate and India sea food , Cochin for Chitosan.
REFERENCES Adamo F, Cristina C, Giancarlo C, Antonio MR, Bimodal release of Olanzapine from lipid Microspheres, J Pharm Sci. 99, 2010, 4251-4260. Barichello JM, Morishita M, Takayama K, Nagai T, Encapsulation of hydrophilic and lipophilic drugs in PLGA nanoparticle by the nano-precipitation method, Drug Dev Ind Pharm, 25,1999, 471. Bunjes H, Lipid nanoparticles for the delivery of poorly water soluble drugs, J Pharm Pharmacol, 62, 1996, 1637 1645. Chellat F, Tabrizian M , Dumitriu S , Chornet E, Magny P, Rivard CH, et al. In vitro and in vivo biocompatibility of chitosanxanthan polyionic complex, J Biomed Mat Res, 51,2000,107113. Chouhan, R., Bajpai, A.K, An in vitro release study of 5fluoro-uracil from swellable poly-(2-hydroxyethyl methacrylate) (PHEMA) nanoparticles, J Mater Sci Mater. Med. 20, 2009b, 11031114. Dervieux T, Furst D, Lein DO, Polyglutamation of methotrexate with common polymorphisms in reduced folate carrier, aminoimidazole carboxamide ribonucleotide transformylase, and thymidylate synthase are associated with methotrexate effects in rheumatoid arthritis, Arthritis Rheum ,50(9), 2004, 27662774.
Douglas KL,Tabrizian M, Effect of experimental parameters on the formation of alginatechitosan nanoparticles and evaluation of their potential application as DNA carrier, J Biomat Sci, Polymer Edition, 1, 2005, 4356. Fundueanu G, Nastruzzi C, Carpov A, Desbrieres J, Rinaudo M, Physico-chemical characterization of Caalginate microparticles produced with different methods. Biomaterials, 20,1999, 1427. Gupta Jitendra, Prabakaran L, Gupta Reena, Govind Mohan, Nanoparticle formulation using counter-ion induced gellification Technique: In-vitro Chloramphenicol release, Int J Pharm Pharm Sci , 3 (3), 2011, 66-70. Madan T, Munshi N, De TK, Maitra A, Sarma PU, Aggarwal SS, Biodegradable nanoparticles as a sustained release system for the antigens/allergens of Aspergillus fumigates, Preparation and characterization, Int J Pharm, 159, 1997,135. Mansouri S, Lavigne P, Corsi K , Benderdour M, Beaumont E , Fernandes JC ,ChitosanDNA nanoparticles as non-viral vectors in gene therapy: Strategies to improve transfection efficacy, Eur J Phar Biopharm, 57,2004, 12. Mi FL , Sung W, Shyu SS, Drug release from chitosan alginate complex beads reinforced by a naturally occurring cross-linking agent, Carbohydr Polym, 48, 2002, 61. Rajaonarivony M, Vouthier C, Couarrze G, Puisieux F, Couvreur P, Development of a new drug carrier made from alginate, J Pharm Sci, 82, 1993, 912917. Rama B, Shantha A, Optimization of Methotrexate Transdermal Patches: Effect of variables on In-Vitro, Ex Vivo permeation and Flux, Int J Pharm Sci Lett ,2 (2),2012, 53-59. Renu Singh Dhanikula, Patrice Hildgen, Influence of molecular architecture of polyether-co- Polyester dendrimers on the encapsulation and release of Methotrexate, Biomaterials, 28, 2007, 3140-3152. Suarez-Almazor ME, Belseck E, Shea B, Wells G, Tugwell P. Methotrexate for rheumatoid arthritis, Cochrane Database Syst Rev, 2, 2000, CD000957. Varatharajan N, Lim IG, Ananda coomarasamy A, Methotrexate: long-term safety and efficacy in an Australian consultant rheumatology practice, Intern Med J, 39(4), 2009, 228236. Yan XL , Khor E, Lim LY, Chitosanalginate films prepared with chitosans of different molecular weights. J Biomed Mat Res, 58, 2001, 358.
IJRPB 1(6)
www.ijrpb.com
Page 921
Dinesh et.al
Strategies in Dendritic architecture for drug delivery An over review

Pandurangan Dinesh Kumar*1, Palanirajan Vijayaraj Kumar2, Govindaraj Saravanan3 1.Department of Biotechnology, Acharya Nagarjuna University, Guntur - 522510, Andhra Pradesh, India. 2. Faculty of Pharmaceutical Sciences, UCSI (University College Sadaya International) University, Jalan Menara Gading, 56000-Cheras, Kuala Lumpur, Malaysia. 3.Bapatla College of Pharmacy, Bapatla - 522 101, Guntur (Dt), Andhra Pradesh, India. E-mail: dineshclbaid@yahoo.co.in, dineshclbaid@gmail.com, Mobile: 99666 39425 ABSTRACT Dendrimers represent a novel class of structurally controlled macromolecules derived from a braches upon branches structural motif. These consist of highly branched moieties that radiate from a central core and synthesizes through a stepwise repetitive reaction sequence. In the field of pharmaceutical nanotechnology and medicinal chemistry dendrimers play a vital role based on the structural advantage such as size, shape, surface and interior chemistry flexibility and topology. Dendrimers have emerged as highly gifted drug delivery molecule because of their exceptional structure and properties. Solubility enhancement is an important aspect of dendrimers and this is a synergy with site specific drug delivery. Solubilisations of hydrophobic drug molecule are easily achieved by the dendrimers because they were entrapped in hydrophobic channels. Extracellular matrix of tissue particularly vascular tissue it contains a high concentration of negatively charged glycosaminoglycans which are involved in regulation of cell motility cell proliferation in the regulation of enzyme activity. Extra cellular matrix can be used as a substrate for binding and retention of drug delivered intra vascularly. Recently dendrimers have caused an explosion in biomedical science and created interest in the discovery of the drugs by virtue of their therapeutic value. The dendrimer polymer suggest that they are promising drugs wound healing ,bone mineralization cartilage formation, tissue repairing topical treatment for AIDS to prevent HIV transmission. It also acts as an anti prion, anti Alzheimer, anti coagulants, anti dots, anti inflammatory and anti cancer agents. Key Words: Dendrimer, Nano-composites, Dendrimer conjugation, Dendrimer applications. INTRODUCTION Dendrimer the name comes from the Greek evpov/dendron meaning tree synonymous terms are arborols and cascade molecule (Buhleirier et al., 1978). Dendrimers are repeatedly branched molecules that are characterized by structural perfection. This is based on the evolution of both symmetry and polydispersity the field of dendritic molecule can roughly be divided into 1. Low molecular weight 2. Molecular weight species The first category includes dendrimers and dendrons and the second includes dendronized polymers hyper branched polymers and brush polymers (called as bottle brushes) tailored forms and function ever realized outside of nature. Structurally dendrimers posses 3 distinct parts 1. A core 2. Branching units 3. Branches It is usually produced in an interactive sequence of reaction steps, in each added lerative lead to a higher generation material. The size of dendrimer can be described as a function of generation (Gn where n is 0, 0.5, 1.0, and 1.5) G is number of repetition cycles. The molecular weight of the dendrimer nearly doubles with each additional generation (Tomalia et al., 2005). Furthermore, terminal groups can be modified to obtain both hydrophilic or lipophilic function for the desired biological and drug delivery application (Bai et al., 2006). Following properties of dendrimer made them ideal molecule for drug delivery applications (Tomalia et al., 2007): a. Nanoscale sizes that have similar dimensions to significant bio-building blocks, b. Numbers of terminal surface groups (Z) appropriate for bioconjugation of drugs, signalling groups, targeting moieties or biocompatibility groups. c. Functional groups on the surfaces were designed to augment or resist trans-cellular, epithelial cell or vascular permeability. d. An interior void space was used to encapsulate drug molecule, metals, or imaging moieties and also reduces the drug toxicity and facilitates controlled release. e. Positive biocompatibility patterns that are coupled with lower generation anionic or neutral polar terminal surface groups. f. Low-immunogenicity with modified dendrimer surfaces by small functional groups or polyethylene glycol (PEG). Dendrimers a nano particle based drug delivery system have numerous applications in many fields such as supramolecular chemistry or hostguest chemistry (Elemans et al., 2002 and AlJamal et al., 2005), electrochemistry (Credi et al.,
IJRPB 1(6)
www.ijrpb.com
Page 922
Dinesh et.al
2004), and photochemistry (Momotake et al., 2004), nanoparticle synthesis (Wu et al., 2006, Love et al., 2006 and Yan et al., 2006), pollution management (Xu et al., 2005, Diallo et al., 2005 and Arkas et al., 2006), dye decolorization (Cheng et al., 2005 and Cheng et al., 2005), preparation of monomolecular membranes (Karthaus et al., 1996, Sayed-Sweet et al., 1997 and Vladimir, 1998), curing of epoxy resins (Cheng et al., 2007), catalysis (Lee et al., 1994, Fujita et al., 1995, Bhyrappa et al., 1996 and Mak et al., 19970, drug delivery (Patri et al., 2002, Aulenta et al., 2003, DEmanuele et al., 2004, Svenson et al., 2005 and Florence et al., 2005), and gene transfection (Dufes et al., 2005, Kim et al., 2006 and Bayele et al., 2006). In recent, dendrimers usage in drug delivery had attain great development and different types of dendritic macromolecules have been synthesized and investigated as a carrier for drug delivery (Patri et al., 2002), gene delivery (Schatzlein et al., 2005), targeting (Patri et al., 2005), solubilization (Gupta et al., 2006), diagnosis (Wiener et al., 1994), chemical catalysis (Wu et al., 2006) and as multivalent ligand for interesting biological applications (Heldt et al., 2004 and Svenson and Tomalia, 2005).This review article intends to provide the reader with a glimpse into the synthesis, types and important applications of dendrimers. SYNTHESIS OF DENDRIMERS The first synthetic procedure towards well defined branched structures was reported by Vogels in 1978, who named this procedure a cascade synthesis .In the early 1980s, Denkewalter patented the synthesis of L-lysrine-based dendrimers (Denkewalter et al., 1981). The first dendritic structures that were exhaustively investigated and that received widespread attention were Tomalias PAMAM (polyamidoamine) dendrimers (Tomalia et al., 1990) and newkomes arborol systems (Newkome et al., 1985). In the synthesis of dendrimers, monomers lead to a mono disperse polymer, tree like generational structure. There are 2 methods of dendrimer synthesis they are, 1. Divergent synthesis 2. Convergent synthesis Divergent synthesis: The dendrimer is prepared from the core as the starting point and built up generation by generation. In the divergent reaction because of the incomplete reaction by end group will create structural defects which further prevent formation of next generation. Divergent name is derived from the manner in which dendrimer grows outward from the core. The higher generations of divergently constructed dendrimers always contain certain structural defects. To prevent side reaction
and to force reactions to completion a large excess of reagent is required. Convergent synthesis: The convergent synthesis starts from the surface and ends up at the core, where the dendrimer segments (dendron) are coupled together. Two of these end tips are attached to a branched monomer to form a dendron and the process is repeated until a desired size is reached. To the core molecule the interconnected branches are attached. To synthesize dendrimers is difficult because a repeated reaction which consists of many steps is needed to protect the active site even in both methods. That why these are obstacles to the synthesis of large quantities of dendrimers (Hawker et al., 1990). Other alternative preparation methods have been developed that aim to reduce the number of synthetic and purification steps and increase yields, such as the double-stage convergent growth approach (Labbe et al., 1996 and Ihre et al., 1998), double-exponential dendrimer growth approach (Kawaguchi et al., 1995), and orthogonal coupling (Zeng et al., 1996). TYPES OF DENDRIMERS Now days, dendrimers with different designed functionalities have become objects of particular academic and practical interest because of their unique superbranched structural, symmetrical shapes, good monodispersity and peripheral functionalities,. Here, some of the dendrimers having different functionalities are briey described. PAMAM dendrimer: The PAMAM (polyamidoamine) dendrimers are synthesized up to generation 10 (G10) by the divergent method starting from ammonia or ethylene diamine initiation cone reagents (fig. 1). They are constructed using a reiterative sequence consisting of a double Michael addition of methyl acrylate to a primary amino group followed by amidation of the resulting carbomethoxy intermediate with a large excess of ethylene diamine. Many surface modied PAMAM dendrimers are non-immunogenic, high water solubility and modified terminal-arms amine functional groups for binding various targeting or guest molecules. PAMAM dendrimers generally display concentration-dependent toxicity and haemolysis. PAMAM dendrimers with their amide backbones undergo hydrolytically degradation at physiological temperatures only on harsh conditions (Lee et al., 2005). The internal cavities of PAMAM dendrimers with tertiary amines and amide linkages can host metals or guest molecules to produce a unique functional architecture. PAMAM dendrimers are the most extensively reported moiety for almost all existing applications of dendrimers.
IJRPB 1(6)
www.ijrpb.com
Page 923
Dinesh et.al
Fig. 1: PAMAM dendrimers

PPI dendrimers: PPI (polypropyleneimines) dendrimers (fig. 2) were created by Meijer at DSM of the Netherlands (DeBrabander-vandenBerg et al., 1993). PPI dendrimers up to generation 5 are synthesized by the divergent method starting from 1, 4. diamino butane. They grow by a reiterative sequence consisting of (A) a double Michael addition of acryloritrile to the primary amino groups followed by (B) Hydrogenation under pressure in the presence of Raney cobalt. Today, these PPI dendrimers are synthesized in large quantities by DSM and are commercially available. DSM uses its own designation to describe its dendrimers, where the core is diaminobutane, dendrindictes the interior dendritic branch cell; and n is the number of end groups.
different types, each type designed to perform a function necessary to a smart therapeutic nanodevice (Betley et al., 2002). The Michigan Nanotechnology Institute for Medicine and Biological Sciences (MNIMBS) are developing a tecto dendrimers which are used to perform the functions like diseased cell recognition, drug delivery, diagnosis of disease state, reporting location and outcome of therapy. The future planning was to produce a smart therapeutic nanodevice for the diseased cell like a cancer cell or a cell infected with a virus. Chiral dendrimers: In chiral dendrimers the construction of core was based on different constitution but with similar chemical branches. Asymmetric catalysis and chiral molecular recognition are the main applications of chiral, nonracemic dendrimers (Ritzn and Frejd, 1999). PAMAMOS dendrimers: PAMAMOS (poly amidoamine-organosilicon) are radially layered, inverted unimolecular micelles that consist of hydrophilic, nucleophilic polyamidoamine (PAMAM) interiors and hydrophobic organosilicon (OS) exteriors. These are exclusively useful for the preparation of honeycomb like networks with nanoscopic PAMAM and OS domains (Dvornic et al., 2000). Hybrid dendrimers: Hybrid dendrimers are combination of dendritic and linear polymers in hybrid block or graft copolymer forms. The small dendrimer segment coupled to multiple reactive chain ends provides an opportunity to use them as surface active agents, compatibilizers or adhesives, e.g. hybrid dendritic linear polymers (Jain and Khopade, 2001). Peptide dendrimers: Peptide dendrimers are defined as dendrimer containing peptides on the surface of the dendrimer frame work with amino acids as a branching (or) core unit. Peptide dendrimers with their peptide molecule had excellent compatibility in biological and therapeutical levels make them a potential candidate for various drug delivery systems. The main applications of the peptide dendrimers includes cancer, antimicrobials, antiviral, central nervous system, analgesia, asthma, allergy, Ca+2 metabolism, magnetic resonance imaging (MRI), magnetic resonance angiography (MRA), uorogenic imaging and serodiagnosis (Bruckdorfer et al., 2004 and Crespo et al., 2005). Glycodendrimers: Dendrimers that incorporate carbohydrates into their structures are termed as glycodendrimers. Glycodendrimers are three types (i) carbohydrate-coated; (ii) carbohydrate centered; and (iii) fully carbohydrate-based. Glycodendrimers have been used to study the proteincarbohydrate
Fig. 2: PPI dendrimers Liquid crystalline dendrimers: These are mesogenic (liquid crystalline) monomers e.g. mesogen functionalized carbosilane dendrimers. Functionalization of end group of carbosilane dendrimers with 36 mesogenic units, attached through a C-5 spacer, leads to liquid crystalline dendrimers that form broad smetic A phase in the temperature range of 17130C (Lorenz et al., 1996). Boiko et al.,. had synthesized first photosensitive liquid crystalline dendrimer with terminal cinnamoyl groups (Boiko et al., 1996). They have confirmed the structure and purity of this LC dendrimer by 1H NMR and GPC methods. Dendrimers under UV irradiation, can undergo E-Z isomerisation of the cinnamoyl groups and [2 + 2] photocycloaddition leading to the formation of a three-dimensional network. Tecto dendrimers: Tecto-dendrimers are composed of a core dendrimer, which may or may not contain the therapeutic agent, surrounded by dendrimers of
IJRPB 1(6)
www.ijrpb.com
Page 924
Dinesh et.al
interactions that are in many intercellular recognition events. The main applications of glycodendrimers are study of proteincarbohydrate interactions, incorporation into analytical devices, gel formulation, MRI contrast agents, and gene delivery systems (Colinger, 2002 and Turnbull and Stoddart, 2002). APPLICATIONS OF DENDRIMERS Dendrimers have attracted the most attention as potential drug delivery scaffolds due to their unique characteristics. Dendrimers have narrow polydispersity; nanometer size range of dendrimers can allow easier passage across biological barriers. Dendrimers can be used to deliver drugs either by encapsulating the drug in the dendrimer interior void spaces or by conjugation to surface functionalities. All these properties make dendrimers as suitable carrier for drug delivery. Dendrimers in transdermal drug delivery: Now days dendrimers had key role for the improvement transdermal drug delivery system. In transdermal dosages drug delivery is difficult because of the hydrophobic nature and inefficient cell entry. Highly water soluble dendrimer are designed which improve the drug solubility, plasma circulation, and entry to cells make efficiently delivery drug from transdermal formulation. Non-steroidal anti-inflammatory drug (NSAIDs) used for acute and chronic rheumatoid and osteoarthritis are limited there clinical usage by adverse events such as dyspepsia, gastrointestinal bleeding and renal side effects when give orally. Transdermal formulation will overcome adverse events and also provide good therapeutic blood level maintains for longer time. But poor rate of transcutaneous delivery pulls down transdermal delivery system. Drug permeation through the skin was enhanced by PAMAM dendrimer complex with NSAIDs (Ketoprofen, Diflunisal) as skin penetration enhancers. Permeation studies on rat skin were carried out for ketoprofen and diflunisal drug. High permeation was achieved by drug dendrimer complex (ketoprofen 3.4times and diflunisal 3.2times) when compared to drug. Antinociception effect of ketoprofen shows that dendrimer complex reduced writhing for period 1-8hr but drug reduced writhing up to 4-6hr. In another study indomethacin and PAMAM dendrimer investigated (Chauhan et al., 2003). In-vitro and in-vivo studies were carried out
for PAMAM dendrimer complex. In-vivo pharmacokinetic and pharmacodynamic studies in Wistar rats showed that significant higher concentration and effective concentration could be maintain for 24h in blood by G4 dendrimer indomethacin transdermal formulation. Various transdermal penetration enhancers based on chemical and physical approach were carried out chemical penetration enhancers such as sulfoxide, oxazolidionesis, fatty acids essential oil, pyrrllidoions, terpenes and terpenoirds were used. Inotophoresis, electrophoresis, ultrasound, gel and patch are physical penetrates which used to exchange absorption of drug (Pathan and Setty, 2009, Santander-Ortega et al., 2010 and Shembale et al., 2012). Recently Zhao et al., conjugated PEGylated PAMAM dendrimers for transdermal delivery of bioactive molecules delivery of bioactive by pretreatment or co treatment technique using different vehicle lime water, chloroform isopropyal myristal chloroform water mixture and octanal water mixture emulsion. Further he reviewed the three different mechanisms which use to deliver the bioactives (Sun et al., 2012). In another study Welowie et al., used that PAMAM dendrimers to conjugate 8-methoy psiralae (a photo sentizier for puva therapy). Here solubility of 8-methoxypsiralane PAMAM conjugate increased. Moreover in another study solubility of riboflavin was enhanced with increase in generation of PAMAM dendrimers. Moreover diffusion of riboflavin in pig ear skin was enhancing with increase in generation (Borowska et al., 2010). Moghmin et al., show that furful permeation enhances through rat skin model using pamam dendrimers (G5) in water vehicle by pretreatment (Moghimi et al., 2010). Yang et al., reported that smaller G2 pamam dendrimers penetrate the skin layers more efficiently than the larger ones (G4). Increased skin absorption and retention were produced by G2 dendrimeric olic acid conjugates because of their increase in partition coefficient. Here permeation across skin layers is directly based on the size, surface charge and hydrophobicity of PAMAM dendrimers (Yang et al., 2012).
IJRPB 1(6)
www.ijrpb.com
Page 925
Dinesh et.al
Fig. 3: Schematic representation of the internalization mode of PAMAM dendrimers with different surface attachments (Yang et al., 2012). In transdermal applications nanoparticles (polysacchird and dendrimers) are used to increase the potential of transdermal drug delivery system. Permal and co had extensive research work on dendrimer application in transdermal system they reveal that physico chemical properties of dendrimers play a vital role in delivery of drug by increase the penetration (Venuganti et al., 2009). Therefore data suggested that dendrimer drug complex make transdermal delivery system was effective and might be a safe and efficacy method for treating different diseases (Cheng et al., 2007). Dendrimers in oral drug delivery: Traditional Oral drug-delivery system has been the dominant route for many years because of its signicant advantages. A major challenge for drugs is the possibility of oral delivery, but main drawback was the limited drug transport across the intestitinal epithelium due to their large size relative to the tight epithelial barrier of the gastrointestinal tract. Duncans and his research group showed that macromolecules of 3nm diameters could penetrate through the rats intestinal membranes, which allows G2.5-G3.5-PAMAM dendrimers to transport across the intestine (Duncan and Izzo, 2005). Moreover the acidic nature of the GI-tract enzymes and stomach can affect the drug and the nanocarrier. DEmanuele group investigated effect of dendrimer generation and conjugation on the cytotoxicity, permeation and transport mechanism of surfacemodied cationic G3-PAMAM propranolol dendrimer conjugation across Caco-2 cell monolayers (DEmanuele et al., 2004). They suggested that the route of propranolol transport was initially transcellular, while the conjugate was able to bypass the P-gp efflux transporter, and they arrived as the same inference as above concerning the penetration pathway of the intestinal membrane. Najlah investigated transepithelial permeability of naproxen, a low solubility drug (Najlah et al., 2007). Stability studies of G0 PAMAM conjugates in 50% liver homogenate was compared to that in 80% human plasma showed the lactate ester linker gave prodrug of elevated stability in plasma with sluggish hydrolysis in liver homogenate. So, these conjugations exhibit potential nanocarriers for the enrichment of oral bioavailability. The Cheng and Xu group, reviewed that a PAMAM dendrimer complex of the anti-inflammatory drug ketoprofen sustained antinoninceptive activity (inhibit rate > 50%) until 8 h of oral administration to Kunming mice, whereas this activity was absent with the free drug after 3 h (Na et al., 2006). Increase in permeability and cellular uptake was produced by G4- PAMAM 7-ethyl-10-hydroxycamphtothecin complexation with respect to free 7-ethyl-10hydroxycamphtothecin. They reported that complex has the potential to improve the oral bioavailability of drug. Lin et al., carried out study on effects of PAMAM dendrimer in intestinal absorption of poorly absorble drug such as 5(6)- carboxyfluorsin isothicynate dextran, calctitonin and insulin in rat (Lin et al., 2011). Drug carboxylorescin and calcitonin showed increase in absorption in rats small intestine for 0.5%w/v G2 PAMAM dendrimer complex. But fluorescine isothiocynate dextran and insulin had not produced any desirable effects. Moreover absorption in small intestine is mainly base on molecular weight of drug ie the molecular weight of drug increase absorption of drug decreases. Recently Kolhatkar et al., explored oral delivery of SN 38 (a potent topisomers I inhibtor) and active metabolize of irinotecan hydrochloride (cpt-11) was improved by conjugation with G4 PAMAM dendrimer.10 fold increase in caco3 cell monolayer and 100 fold increase in cellular uptake
IJRPB 1(6)
www.ijrpb.com
Page 926
Dinesh et.al
by SN-38 and G4 PAMAM dendrimer than plain drug (Kolhatkar et al., 2008) . Dendrimers in targeted drug delivery: Targeted drug delivery system had fetched great importance in the pharmaceutical field mainly because it create wide scope in utilization of existing drug and reduced in draw backs. In treatment of cancer and tumour existing drug molecules are ineffective because of the cytotoxicity nature. The main reason for cytotoxicity is low molecule weight and high pharmacokinetic volume of distribution, quick elimination, so high dose of drug is required for the desired therapeutic effect which ultimately leads to high toxicity and unwanted harmful effects, moreover when these drug administered alone will develop high resistance and lack of specification will produce toxicity effect on the other healthy cells. Further these chemopathetic drugs had poor solubility and low bioavailability. Moreover these drug formulations are formulated with toxic solvents to produce effect dosage forms. Above mentioned problems are overcome by the usage dendrimers as a carrier for delivery the drug in targeted manner. Dendrimers are able to produced specific targeting of drug to cells and thereby improving efficacy minimising side effects. Various research works are carried to prove that dendrimers can able to deliver the drug to the targeted tissue in controlled manner. Cisplatine was conjugate with pamam dendrimer by Malik et al (Malik et al., 2000). The conjugate shows increased solubility, reduced toxicity and EPR properties. It was observed that this formulation showed superior activity over cisplatin when injected into mice bearing B16F10 tumor cells. Doxorubicin is complexed with 2-3-bis (hydro methyl) proxamic acid dendrimers and characterise for in-vitro and in-vivo studies. The complexation of drug with dendrimer mainly by covalently bond through hydrazone linkage to high molecule weight 3-arm polyethylene oxide, exhibits reduced cytotoxicity in-vitro. But in-vivo studied shows minimum accumulation in vital organs and increase half life for conjugate drug compared to free drug. Jesus and group had concluded that dendrimer formulation increase half life of the drug and there reduced the amount of drug administered (De Jesus et al., 2002). The in-vivo characterize in the mice of dendrimer conjugate should increased solubility, reduced toxicity and EPR properties when compared with free drug. Dendrimer conjugate of Cisplatine produced superior activity in targeted manner when compared with free drug. Poly amide amine dendrimers was conjugated with 1-bromoacetyl-5flurouracil to produce dendrimer 5Fu-conjugates.
Zhou et.al demonstrated that release of the drug from the dendrimer was base on generation and further indicates that dendrimer are promising drug for targeted drug delivery (Zhuo et al., 1999). Dendrimer conjugates showed good elimination compared with drug in in-vitro studies carried out in the mice by Lee group. Doxurubin model drug was conjugated with polyester based dendrimer. Dendrimer-PEO-doxorubine conjugate inhibit the growth of C-26 tumor which was implanted subcutaneously in mice (Lee et al., 2006). Anti-cancer drugs 5-Flurouracil was conjugated with pamam dendrimer to measure its activity through blood level studies in the mice. Dendrimer formulation had increase drug loading capacity and stability with reduction hemolytic toxicity (Bhadre et.al 2003). In another study by Asthan in 2005 had confirmed that pamam dendrimer had increase residence time, good stability and increase the half life of drug. They perform in-vivo studies in rat with flurbiprofan loaded pamam dendrimer conjugates which reveals that drug release from dendrimer is rapid in initial and slow release in latter stage (Asthana et al., 2005). In the same year imaging and targeting of tumor cells by using pamam dendrimer was carried out by the choi groups. They formulated pamam dendrimer conjugated with folic acid as targeted drug fluorescein isothiocyanate as imaging agent by oligonucleotides linkage. They conform that dendrimers can be used as imagine and drug targeting simultaneously (Choi et al., 2005). The galactose linked PPI dendrimer was conjugated with primaquine phosphate and subjected for in-vivo testing to find out accumulation in the rat liver. Galactose linked PPI dendrimer with primaque phosphate showed less accumulation in the liver which compared the free drug and uncoated PPI dendrimer. These results had showed that coating of PPI dendrimer can improve the effective delivery of drug and reduced toxicity there by increasing the stability (Bhadra et al., 2005). Kukowska-Lattalo et al synthesis the dendrimers conjugated with folic acid and methotrexate. An in-vivo study in mice was carried out to conclude that dendrimer conjugated are more effective then free drug. In confocal microscopic image showed consider numbers of cells are targeted by dendrimeric conjugate and this results where further confirmed by analysis of isolated tumour cells (Kukowska-Latallo et al., 2005). Doxorubicin was taken as model drug and conjugated with 6th generation cationic poly-Llysine dendrimers. The dendrimer conjugate had a increase penetration and delay in growth of prostate 3D multicellular tumor spheroids (MTS) compared
IJRPB 1(6)
www.ijrpb.com
Page 927
Dinesh et.al
with free drug (Khuloud et al., 2013). Xiangyang Shi et al., had synthesis conjugate of pamam dendrimer with anti cancer drug 2-methoxyestradiol. The dendrimer conjugated release drug in sustained manner and specifically targeted the cancer cells in MTT assay. This study makes dendrimer as one of the novel carrier for anticancer drug (Yin et al., 2011). Umesh Gupta et al., explore potential delivery activity PPI dendrimer and folated conjugated PPI dendrimer. Doxorubine was used as model drug. The folate conjugated PPI shows faster drug release in acidic environment and high cell uptake in MCFT cancer cell line compared with PPI dendrimer. So it had been conclude that folic acid conjugated PPI dendrimer are better carrier agents (Gupta et al., 2010). Garcia-vallejo et al., synthesis pamam dendrimer conjugated with leb. The
characterisation of dendrimer conjugated showed enhanced binding, optimal internalisation, increase lysosomal delivery, increase antigen presentation and cytokine response. It had been conclude that dendrimer can be used for targeting peptide antigen cancer immunotherapy, auto immunity and infectious disease (Garca-Vallejo et al., 2013). Pamam dendrimer of generation 5th was conjugated with N-acetylgalactosamine via peptide and thiourea linkage. Hepatic cell line studies showed that dendrimer conjugated had increase cellular uptake by ASGPR mediated endocytosis. Moreover increase in concentration of dendrimer produced more effective cell targeting. The dendrimer conjugated produced Michaelis menten kinetics. It had concluded that dendrimer conjugate are effectively used as targeted carrier for hepatic targeting (Scott et al., 2011).
Fig. 4: A schematic drawing showing the composition of a drug-loaded G5-NAcGal conjugate binding to the ASGPR expressed on the surface of hepatic cancer cells (e.g. HepG2), which triggers receptor-mediated endocytosis of these G5-NAcGal conjugates followed by endosomal escape and release of the therapeutic cargo into the cytoplasm while the ASGPR recycles back to the cell surface (Scott et al., 2011).
Anupama et al., synthesized 4.0 G PAMAM dendrimer and conjugated with Gallic acid [GA] for cancer targeted drug delivery system (Anupama et al., 2011). The Cytotoxicity study in MCF-7 cell line showed dendrimer conjugates had showed increase activity on cells. Dendrimers in gene delivery: Gene therapy is one novel approach to cure the chronic disease. In this therapy the defective gene which is responsible for the over expression or under expression corrected. The gene therapy is mainly based on vector used because it will decide the success of gene therapy. Dendrimers are ideal vector in the gene delivery. Dendrimer are more stable, monodispersity, generation, modification in terminal and size of the dendrimer are controlled. Above mention properties made the dendrimer as one the vital carrier for the gene delivery.
Pamam starburst dendrimers were complexed with DNA through ethidium bromide. As the generation of the dendrimers increase the DNA regions also increase (Kukowska-Latallo et al., 2000). Kukowska-catallo et al synthesised G9 pamam dendrimer pCF1CAT plasmid complex. Intravenous administration of dendrimer complex in rat show high level of expressions in lung tissues. In another study a cyclodextrin surfaced G5 pamam dendrimer conjugate were produced by Kihara et al (Kihara et al., 2003). High level transgene expression was reported in intravenous administration in rat. In the same manner Wade et al developed manner coated pamam dendrimers as new transgene vector (Wada et al., 2005). In vitro studies should that mannose coated dendrimer conjugates showed high transfection dendrimer. Mamede et al., used 111In-oligo/G4100 and 111In-oligo/G4-bt-
IJRPB 1(6)
www.ijrpb.com
Page 928
Dinesh et.al
Av100 as gene transfer vectors and in vivo biodistribution evaluation showed more accumulation in kidney and lung when compare to liver (Mamede et al., 2004). Furthers authors summarized that the positively charged DNA/dendrimer complexes condensed to form complexes of several nanometres and resulted in uptake by lung tissues. A study by Schatzlein et al., showed surface treatment of PPI dendrimers with methylated quaternary amines improved the DNA complexation and decreased cytotoxicity (Schatzlein et al., 2005). PPI dendrimers of various generation acts as transfection agents and target gene efficiently expressed in the liver were studied by Dufes and groups (Dufes et al., 2005). They demonstrated that intravenous administration of a gene medicine and G3 PPI dendrimer complex could result in intratumoural transgene expression and regression of the established tumours in all animals. Arginine peptide dendrimer of 5th and 6th generation was developed by Zhongwei group. Further characterization of dendrimer conjugates showed high transfection and high biosafety compared branched polyetherimide (PEI) on all cells in breast tumor models (Kui et al., 2012). Another study by Bing and co synthesized -cyclodextrin complexed PAMAM dendrimer with human neuroblastoma SH-SY5Y cells. Dendrimer conjugates showed low cytotoxicity and high transgene activity compared with PAMAM (G 4)/pDNA complex (Bing et al., 2013). A comparative study was carried out by Ajay and co between PAMAM G4 dendrimers and the surface modified dendrimers was conducted in HEK 293T, GM7373 and NCI H157G cell lines in gene transfer (Ajay et al., 2010). Effect of excess of ornithine (100M) on transfection efficiency of the ornithine-conjugated PAMAMG4 dendrimers was investigated in separate experiment. Transfection efficiency of PAMAMG4-ORN60 dendrimer complex was slightly higher in cancer cells (NCI H157G) as compared to HEK 293T cells. Transfection efficiency of the PAMAMG4-ORN60 dendrimers decreased in presence of excess of ornithine while there was no effect on the parent PAMAMG4 dendrimers. Jose et al., produced conjugates of plasmid DNA and PAMAM dendrimer G5 for gene delivery (Jose et al., 2010). Further characterization of dendrimer conjugates showed high efficiency in the gene expression. Kui et al., synthesis different generations of dendritic poly(L-lysine) vectors for in vitro gene transfection (Kui et al., 2011). The higher generations tended to produce the greater positive potentials, indicating a stronger potency of the
complexes to interact with negatively charged cell membranes. Dendrimer conjugates of 5th generation showed good biocompatibility and higher efficiency transfection compared with other generation dendrimer complex. Based on these results, we concluded that dendrimers were one of promising gene vectors which might be able to deliver gene into liver, spleen, lung, kidney, and even the tumor at therapeutic levels. Dendrimers in pulmonary drug delivery: Bai and groups investigated Enoxaparin PAMAM dendrimers complex for pulmonary drug delivery (Bai et al., 2006). In this research enoxparinPAMAM dendrimer complex were formulated and evaluated for the drug enachment. The dendrimer formulation was administered into lungs of anaesthetized rats and drug absorption was observed by measuring plasma anti-factor Xa activity, and by observing prevention efficacy of deep vein thrombosis in a rodent model. Bioavailability of enoxaparin was increased to 40% in G2 and G3 PAMAM dendrimers which are positively charged. They reported that positively charged dendrimers are suitable carrier for pulmonary delivery of Enoxaparin. Seabrook and coworkers described the boosting effect with intranasal dendrimeric A1-15 (16 copies of A1-15 on a lysine tree) but not A115 peptide affording immune response following a single injection of A1-40/42 in heterozygous APPtg mice (Seabrook et al., 2006). Inapagolla et al., carried study on in-vivo efficacy of methylprednisolon conjugate G4 PAMAM dendrimers showed good lung anti inflammation potency (Inapagolla et al., 2010). Further methylprednisolon-G4-PAMAM dendrimers conjugate at the dose of 5mg/kg improved the airway delivery in pulmonary inflammatory model based on a 11 fold enchament of eosinophil lung accumulation following five daily inhalation exposure of sensitized mice to allergen and albumin. Here allergen induced inflammation reduced by drug loaded dendrimer conjugate was mainly base on improved drug residence time in the lung. Dong et al., carried out invivo pulmonary absorption on for G0-G3 PAMAM dendrimers conjugates of insulin and calction. Here absorption of insulin and calction was increased by PAMAM dendrimers conjugates. Moreover absorption rate was increased as generation of PAMAM increases (Dong et al., 2010). To target regional lung deposition dendrimers emerged has very powerful carries in nano size. Review paper by carvalho et al., and choi
IJRPB 1(6)
www.ijrpb.com
Page 929
Dinesh et.al
et al., has explained the important and influence of particle size, charge, and coating on lung deposition (Carvalho et al., 2011 and Choi et al., 2010). Dendrimers did posses characteristic to emerge as nanocarrier for delivery bioactives through inhalation route. CONCLUSION The application of dendrimers to drug delivery system has experienced rapid growth. Dendrimers are expected to play key role in pharmaceutical field as drug carriers. Dendrimers role in the biomedical applications is widely expanded. The supramolecular properties of the dendrimers made them major agent to delivery drugs and other function. As per reviewed in this article dendrimers are widely used in encapsulation various drugs and to deliver the drug to the targeted site. More over high level of controllable features of dendrimers such as size, shape, branching length and surface modifications make them an ideal drug carrier. Further dendrimers offer generation number and terminal groups and the chance to introduce two or more functional group types at the periphery are mammoth advantages of dendrimers over polymers. Few drawbacks like toxicity, localization, biodistribution and costly synthesis step pull them down. In spite of above drawbacks, several dendrimers have already been commercialized, and some are in clinical trials. To make dendrimers commercial successful tool for drug delivery more research work has to be done on cost effective synthesis, toxicity reduction and drug conjugation. As reviewed in this article dendrimer moiety hold great promise and potential tool for drug delivery system. REFERENCE Ajay K, Venkata KY, Gareth ED, Strychar KB, Srinath P, Enhanced gene transfection efficiency by polyamidoamine (PAMAM) dendrimers modified with ornithine residues, Int J Pharm, 392, 2010, 294303. Al-Jamal KT, Ramaswamy C, Florence AT, Supramolecular structures from dendrons and dendrimers, Adv Drug Deliv Rev, 57, 2005, 2238 2270. Anupama S, Surya PG, Arun KG, Surface modified dendrimers: Synthesis and characterization for cancer targeted drug delivery, Bioorganic & Medicinal Chemistry, 19, 2011, 33413346. Arkas M, Allabashi R, Tsiourvas D, Mattausch EM, Perfler R, Organic/Inorganic Hybrid Filters Based on Dendritic and Cyclodextrin Nanosponges for the Removal of Organic Pollutants from Water, Environ Sci Technol, 40, 2006, 2771 2777.
Asthana A, Chauhan AS, Diwan PV, Jain NK, Poly(amidoamine) (pamam) dendritic nanostructures for controlled site specific delivery of acidic anti-inflammatory active ingredient, AAPS Pharm Sci Tech, 6, 2005, E536E542. Aulenta F, Hayes W, Rannard S, Dendrimers: A new class of nanoscopic containers and delivery devices, Eur Polym J, 39, 2003, 17411771. Bai S, Thomas C, Rawat A, Ahsan F, Recent progress in dendrimer-based nanocarriers, Crit Rev Ther Drug Carrier Syst, 23, 2006, 437495. Bai S, Thomas C, Rawat A, Ahsan F, Recent progress in dendrimer-based nanocarriers, Crit Rev Ther Drug Carrier Syst, 23, 2006, 437495. Bayele HK, Ramaswamy C, Wilderspin AF, Srai KS, Toth I, Florence AT, Protein transduction by lipidic peptide dendrimers, J Pharm Sci, 95, 2006, 12271237. Betley TA, Hessler JA, Mecke A, Banaszak Holl, MM, Orr BG, Uppuluri S, Tomalia, DA, Baker JR, Tapping mode atomic force microscopy investigation of poly(amidoamine) coreshell tecto(dendrimers) using carbon nanoprobes, Langmuir, 18, 2002, 31273133. Bhadra D, Bhadra S, Jain S, Jain NK, A PEGylated dendritic nanoparticulate carrier of fluorouracil, Int J Pharm, 257, 2003,111124. Bhadra D, Yadav AK, Bhadra S, Jain NK, Glycodendrimeric nanoparticulate carriers of primaquine phosphate for liver targeting, Int J Pharm, 295, 2005, 221-233. Bhyrappa P, Young JK, Moore JS, Suslick KS, Dendrimer-metalloporphyrins: Synthesis and catalysis, J Am Chem Soc, 118, 1996, 57085711. Bing L, Jun JD, Fang Y, Ning Y, Wei L, Jian RY, Shu Xiang Pu, Long CX, Cong G, Li MZ, Efficient gene transfection in the neurotypic cells by starshaped polymer consisting of -cyclodextrin core and poly(amidoamine) dendron arms, Carbohydrate Polymers, 94, 2013, 185192. Boiko N, Zhu X, Bobrovsky A, Shibaev V, First photosensitive liquid crystalline dendrimer: synthesis, phase behavior, and photochemical properties, Chem Mater, 13, 1996, 14471452. Borowska K, Laskowska B, Magon AM, Pyda M, Wolowiec S, PAMAM dendrimers as solubilizers and hosts for 8-methoxypsoralene enabling transdermal diffusion guest, Int J Pharm, 398, 2010, 185189. Bruckdorfer T, Marder O, Albericio F, From production of peptides in milligram amounts for
IJRPB 1(6)
www.ijrpb.com
Page 930
Dinesh et.al
research to multi-tons quantities for drugs of the future, Curr Pharm Biotechnol, 5, 2004, 2943. Buhleirier E, Wehner W, Vogtle F, Cascade and non-skid chain like synthesis of molecule cavity topologies, Synthesis, 2, 1978, 155-158. Carvalho TC, Peters JI, Ill ROW, Influence of particle size on regional lung deposition what evidence is there?, Int J Pharm, 406, 2011, 110. Chauhan AS, Sridevi S, Chalasani KB, Jain AK, Jain SK, Jain NK, Diwan PV, Dendrimer-mediated transdermal delivery: enhanced bioavailability of indomethacin, J Control Release, 90, 2003, 335 343. Chen W, Turro NJ, Tomalia DA, Using ethidium bromide to probe the interactions between DNA and dendrimers, Langmuir, 16, 2000, 15-19. Cheng Y, Man N, Xu T, Fu R, Wang X, Wang X, Wen L, Transdermal delivery of nonsteroidal antiinflammatory drugs mediated by polyamidoamine (PAMAM) dendrimers, J Pharm Sci, 96, 2007, 595 602. Cheng YY, Chen DZ, Fu RQ, He PS, Behavior of polyamidoamine dendrimers as curing agents in bisphenol a epoxy resin systems, Polym Int, 54, 2005, 495499. Cheng YY, Xu TW, Fu RQ, Polyamidoamine dendrimers used as solubility enhancers of ketoprofen, Eur J Med Chem, 40, 2005, 13901393. Cheng YY, Xu TW, He PS, Polyamidoamine (PAMAM) dendrimers as curing agents: The optimum PAMAM concentration selected by dynamic torsional vibration method and thermogravimetric analyses, J Appl Polym Sci, 103, 2007, 1430 1434. Choi HS, Ashitate Y, Lee JH, Kim SH, Matsui A, Insin N, Bawendi MG, Semmler-Behnke M, Frangioni J, Tsuda A, Rapid translocation of Nanoparticles from lung airspaces to the body, Nat Biotechnol, 28, 2010, 13001304. Choi Y, Thomas T, Kotlyar A, Islam MT, Baker JR, Synthesis and functional Evaluation of DNAassembled polyamidoamine dendrimer clusters for cancer cell-specific targeting, Chem Biol, 12, 2005, 3543. Colinger M, Biological applications of dendrimers, Curr Opin Chem Biol, 6, 2002, 742748. Credi A, Ribera BF, Venturi M, From supramolecular electrochemistry to molecular-level devices, Electrochim Acta, 49, 2004, 38653872.
Crespo L, Sanclimens G, Pons M, Giralt E, Royo M, Albericio F, Peptide and amide bond-containing dendrimers, Chem Rev, 105, 2005, 16631681. DEmanuele A, Jevprasesphant R, Penny J, Attwood D, The use of a dendrimerpropranolol prodrug to bypass efflux transporters and enhance oral bioavailability, J Control Release, 95, 2004, 447 453. DEmanuele A, Jevprasesphant R, Penny J, Attwood D, The use of a dendrimerpropranolol prodrug to bypass efflux transporters and enhance oral bioavailability, J Control Release, 95, 2004, 447 453. De Jesus OLP, Ihre HR, Gagne L, Frechet JMJ, Szoka FC, Polyester dendritic systems for drug delivery applications: In vitro and in vivo evaluation, Bioconjug Chem, 13, 2002, 453461. DeBrabander-VandenBerg EMM, Meijer EW, Poly(propyleneimine) Dendrimers: Large scale synthesis by hetereogeneously catalyzed hydrogenations. Angew Chem Int Ed Engl, 32, 1993, 13081311. Denkewalter RG, Kolc J, Lukasavage WJ, Macromolecular highly branched homogeneous compound based on lysine units, Untied states patent, US Patent 4289872, 1981. Diallo MS, Christie S, Swaminathan P, Johnson JH, Goddard WA, Dendrimer enhanced ultrafiltration. Recovery of Cu(II) from aqueous solutions using PAMAM dendrimers with ethylene diamine core and terminal NH2 groups, Environ Sci Technol, 39, 2005, 13661377. Dong Z, Katsumi H, Sakane T, Yamamoto A, Effects of polyamidoamine (PAMAM) dendrimers on the nasal absorption of poorly absorbable drugs in rats, Int J Pharm, 30, 2010, 244252. Dufes C, Keith WN, Bilsland A, Proutski I, Uchegbu IF, Schatzlein AG, Synthetic anticancer gene medicine exploits intrinsic antitumor activity of cationic vector to cure established tumors, Cancer Res, 65, 2005, 80798084. Dufes C, Uchegbu IF, Schatzlein AG, Dendrimers in gene delivery, Adv Drug Deliv Rev, 57, 2005, 21772202. Duncan R, Izzo L, Dendrimer biocompatibility and toxicity, Adv Drug Deliv Rev, 57, 2005, 22152237. Dvornic PR, De-Leuze-Jallouli AM, Owen MJ, Perz SV, Radially layered poly(amidoamineorganosilicon) dendrimers, Macromolecules, 33, 2000, 5366. Elemans JAAW, Boerakker MJ, Holder SJ, Rowan AE, Cho W-D, Percec V, Nolte RJM,
IJRPB 1(6)
www.ijrpb.com
Page 931
Dinesh et.al
Supramolecular chemistry and self-assembly special feature: Plastic- and liquid-crystalline architectures from dendritic receptor molecules, PNAS, 99, 2002, 50935098. Florence AT, Preface Dendrimers: A versatile targeting platform, Adv Drug Deliv Rev, 57, 2005, 21042105. Fujita M, Oguro D, Miyazawa M, Oka H, Yamaguchi K, Ogura K, Self-assembly of ten molecules into nanometre-sized organic host frameworks, Nature, 378, 1995, 469471. Garca-Vallejo JJ, Ambrosini A, Overbeek A, van Riel H, Bloem K, Unger WWJ, Chiodo F, Bolscher JG, Nazmi K, Kalay H, van Kooyk Y, Multivalent glycopeptide dendrimers for the targeted delivery of antigens to dendritic cells, Mol Immunol, 53, 2013, 387-397. Gupta U, Agashe HB, Asthana A, Jain NK, Dendrimers: Novel Polymeric Nanoarchitecture for Solubility Enhancement, Bio macromolecules, 7, 2006, 649-658. Gupta U, Dwivedi SK, Bid HK, Konwar R, Jain NK, Ligand anchored dendrimers based nanoconstructs for effective targeting to cancer cells, Int J Pharm, 393, 2010, 185196. Hawker CJ, Frchet JMJ, Preparation of polymers with controlled molecular architecture. A new convergent approach to dendritic macromolecules, J Am Chem Soc, 112, 1990, 76387647. Heldt JM, Durand NF, Salmain M, Vessieres A, Jaouen G, Prepration and charactyerization of poly(amidoamine) dendrimers functionalized with a rhenium carbonyl complex and PEG as new IR probes for carbonyl metallo immunoassay, J Organometallic chem, 689, 2004, 4775-4782. Ihre H, Hult A, Frchet JMJ, Gitsov I, Double-stage convergent approach for the synthesis of functionalized dendritic aliphatic polyesters based on 2,2-bis(hydroxymethyl)propionic acid, Macromolecules, 31, 1998, 40614068. Inapagolla R, Guru BR, Kurtoglu YE, Gao X, LiehLai M, Bassett DJP, Kannan RM, In vivo efficacy of dendrimer-methylprednisolone conjugate formation for the treatment of lung inflammation, Int J Pharm, 339, 2010, 140147. Jain NK, Khopade AJ, Dendrimers as potential delivery systems for bioactives. in: Jain, N.K. (Ed.), Advances in controlled and novel drug delivery. New Delhi: CBS Publishers & Distributors; 2001, p. 361380. Jose LS, Hugo O, Deepti P, Joao R, Ana PP, Pedro LG, Helena T, Functionalization of
poly(amidoamine) dendrimers with hydrophobic chains for improved gene delivery in mesenchymal stem cells, J Control Release, 144, 2010, 5564. Karthaus O, Ijoro K, Shimomura M, Hellmann J, Irie M, Monomolecular layers of diarylethenecontaining dendrimers, Langmuir, 12, 1996, 6714 6716. Kawaguchi T, Walker KL, Wilkins CL, Moore JS, Double exponential dendrimer growth, J Am Chem Soc, 117, 1995, 21592165. Khuloud TA, Wafa TA, Julie TW, Wang, Noelia R, Joanna B, David G, Mire Z, Kostas K, Cationic poly-L-lysine dendrimer complexes doxorubicin and delays tumor growth in vitro and in vivo, ACS Nano, 7, 2013, 1905-1917. Kihara F, Arima H, Tsutsumi T, Hirayama F, Uekama K, In vitro and in vivo gene transfer by an optimized -cyclodextrin conjugate with polyamidoamine dendrimer, Bioconjug Chem, 14, 2003, 342350. Kim J, Choi J, Nam K, Lee M, Park J, Lee J, Enhanced transfection of primary cortical cultures using arginine-grafted PAMAM dendrimer, PAMAM-Arg, J Control Release, 114, 2006, 110 117. Kolhatkar RB, Swaan P, Ghandehari H, Potential oral delivery of 7-ethyl-10- hydroxy-camptothecin (SN-38) using poly(amidoamine) dendrimers, Pharm Res, 25, 2008, 17231729. Kui L, Caixia L, Gang W, Yu N, Bin H, Yao W, Zhongwei G, Peptide dendrimers as efficient and biocompatible gene delivery vectors: Synthesis and in vitro characterization, J Control Release, 155, 2011,7787. Kui L, Caixia L, Li L, Wenchuan S, Gang W, Zhongwei G, Arginine functionalized peptide dendrimers as potential gene delivery vehicles, Biomaterials, 33, 2012, 4917-4927. Kukowska-Latallo JF, Candido KA, Cao Z, Nigavekar SS, Majoros IJ, Thomas TP, Balogh LP, Khan MK, Baker JR, Nanoparticle targeting of anticancer drug improves therapeutic response in animal model of human epithelial cancer, Cancer Res, 65, 2005, 53185324. Kukowska-Latallo JF, Raczka E, Quintana A, Chen C, Rymaszewski M, Baker JR, Intravascular and endobronchial DNA delivery to murine lung tissue using a novel, nonviral vector, Hum Gene Ther, 11, 2000, 13851395. Labbe G, Forier B, Dehaen W, A fast double-stage convergent synthesis of dendritic polyethers, Chem Commun, 18, 1996, 21432144.
IJRPB 1(6)
www.ijrpb.com
Page 932
Dinesh et.al
Lee CC, MacKay JA, Frchet JMJ, Szoka FC, Designing dendrimers for biological applications, Nat Biotechnol, 23, 2005, 1517-1526. Lee CC, Gillies ER, Fox ME, Guillaudeu SJ, Frchet JM, Dy EE, Szoka FC, A single dose of doxorubicin-functionalized bow-tie dendrimer cures mice bearing C-26 colon carcinomas, Proc Natl Acad Sci, 103, 2006, 16649-16654. Lee JJ, Ford WT, Reactivity of organic anions promoted by a quaternary ammonium ion dendrimer, Macromolecules, 27, 1994, 46324634. Lin Y, Fujimari T, Kawaguchi N, Tsujimoto Y, Nishimi M, Dong Z, Katsumi H, Sakane T, Yamamoto A, Polyamidoamine dendrimers as novel potential absorption enhancers for improving the small intestinal absorption of poorly absorbable drugs in rats, J Control Release, 149, 2011, 2128. Lorenz K, Holter D, Stuhn B, Mulhaupt R, Frey H, Amesogen-functionized carbosilane dendrimer: A dendritic liquid crystalline polymer, Adv Mater, 8, 1996, 414416. Love CS, Ashworth I, Brennan C, Chechik V, Smith DK, Dendron-protected Au nanoparticles Effect of dendritic structure on chemical stability, J Colloid Interface Sci, 302, 2006, 178186. Mak CC, Cow HF, Dendritic catalysts: Reactivity and mechanism of the dendritic bis(oxazoline) metal co12281230mplex catalyzed Diels- Alder reaction, Macromolecules, 30, 1997, 12281230. Malik N, Wiwattanapatapee R, Klopsch R, Lorenz K, Frey H, Weener JW, Meijer EW, Paulus W, Duncan R, Dendrimers: relationship between structure and biocompatibility in vitro, and preliminary studies on the biodistribution of 125Ilabelled polyamidoamine dendrimers in vivo, J Control Release, 65, 2000, 133148. Mamede M, Saga T, Ishimori T, Higashi T, Sato N, Kobayashi H, Brechbiel MW, Konishi J, Hepatocyte targeting of 111In-labeled oligo-DNA with avidin or avidin-dendrimer complex, J Control Release, 95, 2004, 133-141. Moghimi HR, Varshochian R, Kobarfard F, Erfan M, Reduction of percutaneous absorption of toxic chemicals by dendrimers, Cutan Ocul Toxicol, 29, 2010, 3440. Momotake A, Arai T, Photochemistry and photophysics of stilbene dendrimers and related compounds, J Photochem Photobiol C Photochem Rev, 5, 2004, 125. Na M, Yiyun C, Tongwen X, Yang D, Xiaomin W, Zhenwei L, et al., Dendrimers as potential drug carriers, Part II: Prolonged delivery of ketoprofen
by in vitro and in vivo studies, Eur J Med Chem, 41, 2006, 670674. Najlah M, Freeman S, Attwood D, DEmanuele A, In vitro evaluation of dendrimer prodrug for oral drug delivery, Int J Pharm, 336, 2007, 183190. Newkome GR, Yao Z, Baker GR, Gupta VK. Micelles, Part 1. Cascade molecules: A new approach to micelles. A [27]-arborol, J Org Chem, 50, 1985, 20032004. Pathan IB, Setty CM, Chemical penetration enhancers for transdermal drug delivery systems, Trop J Pharm Res, 8, 2009, 173179. Patri AK, kukowska lotallo JF, Baker JR, Targeted drug delivery with dendrimers comparison of the release kinetics of covalently conjugated drug and non covalent drug inclusion complex, Adv Drug Del Rev, 57, 2005, 2203-2214. Patri AK, Majoros IJ, Baker J, Dendritic polymer macromolecular carriers for drug delivery, Curr Opin Chem Biol, 6, 2002, 466471. Ritzn A, Frejd T, Synthesis of a chiral dendrimer based on polyfunctional amino acids, Chem Commun, 2, 1999, 207208. Santander-Ortega MJ, Stauner T, Loretz B, OrtegaVinuesa JL, Bastos-Gonzalez D, Wenz G, Schaefer UF, Lehr CM, Nanoparticles made from novel starch derivatives for transdermal drug delivery, J Control Release, 141, 2010, 8592. Sayed-Sweet Y, Hedstrand DM, Spinder R, Tomalia DA, Hydrophobically modified poly(amidoamine) (PAMAM) dendrimers: Their properties at the air water interface and use as nanoscopic container molecules, J Mater Chem, 7, 1997, 11991205. Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C, Chim YT, Roberts CJ, Davies MC, Munro A, Gray AI, Uchegbu IF, Preferential liver gene expression with polypropylenimine dendrimers, J Control Release, 101, 2005, 247-258. Schatzlein AG, Zinselmeyer BH, Elouzi A, Dufes C, Chim YT, Roberts CJ, Davies MC, Munro A, Gray AI, Uchegbu IF, Preferential liver gene expression with polypropylenimine dendrimers, J Control Release, 101, 2005, 247-258. Scott HM, Venkatesh T, Maxim VC, Donna SS, William DE, Mohamed EH El-Sayed, Nacetylgalactosamine-functionalized dendrimers as hepatic cancer cell-targeted carriers, Biomaterials, 32, 2011, 4118-4129. Seabrook TJ, Jiang L, Thomas K, Lemere CA, Boosting with intranasal dendrimeric A115 but not A115 peptide leads to an effective immune response following a single injection of A140/42
IJRPB 1(6)
www.ijrpb.com
Page 933
Dinesh et.al
in APP-tg mice, J Neuroinflammation, 3, 2006, 1 10. Shembale AI, Borole DK, Lohiya RT, Useful permeation enhancers for transdermal drug delivery: A review, Int J Pharm Res Dev, 2, 2012, 16. Sun M, Fan A, Wang Z, Zhao Y, Dendrimermediated drug delivery to the skin, Soft Matter, 8, 2012, 43014305. Svenson S, Tomalia DA, Dendrimers in biomedical applications reflection on the field, Adv Drug Deli Rev, 57, 2005, 2106 -2129. Tomalia DA, Birth of a new macromolecular architecture:dendrimers as quantized building blocks for nanoscale synthetic polymer chemistry, Prog Polym Sci, 30, 2005, 294324. Tomalia DA, Naylor AM, Goddard III WA, Starburst Dendrimers: Molecular-level control of size, shape, surface chemistry, topology and flexibility from atoms to macroscopic matter, Angew Chem Int Ed Engl, 29, 1990, 138-175. Tomalia DA, Reyna LA, Svenson S, Dendrimers as multi-purpose nanodevices for oncology drug delivery and diagnostic imaging, Biochem Soc Trans, 35, 2007, 6167. Turnbull WB, Stoddart JF, Design and synthesis of glycodendrimers, Rev Mol Biotechnol, 90, 2002, 231255. Venuganti VVK, Perumal OP, Poly(amidoamine) dendrimers as skin penetration enhancers: influence of charge, generation and concentration, J Pharm Sci, 98, 2009, 23452356. Vladimir VT, Dendritic macromolecules interfaces, Adv Mater, 10, 1998, 253257. at
catalyst for the Suzuki miyaura reaction and hydrogenation, Org Lett, 3(8), 2006, 3605-3608. Xu Y, Zhao D, Removal of copper from contaminated soil by use of poly(amidoamine) dendrimers, Environ Sci Technol, 39, 2005, 2369 2375. Yan S, Zhou Z, Zhang F, Yang S, Yang L, Yu X, Effect of anionic PAMAM with amido groups starburst dendrimers on the crystallization of Ca10(PO4)6(OH)2 by hydrothermal method, Mater Chem Phys, 99, 2006, 164169. Yang Y, Sunoqrot S, Stowell C, Ji J, Lee CW, Kim JW, Khan SA, Hong S, Effect of size, surface charge and hydrophobicity of poly(amidoamine) dendrimers on their skin penetration, Biomacromelecules, 13, 2012, 21542162. Yin W, Rui G, Xueyan C, Mingwu S, Xiangyang S, Encapsulation of 2-methoxyestradiol within multifunctional poly(amidoamine) dendrimers for targeted cancer therapy, Biomaterials, 32, 2011, 3322-3329. Zeng F, Zimmerman SC, Rapid synthesis of dendrimers by an orthogonal coupling strategy, J Am Chem Soc, 118, 1996, 53265327. Zhuo RX, Du B, Lu ZR, In vitro release of 5fluorouracil with cyclic core dendritic polymer, J Control Release, 57, 1999, 249-257.
Wada K, Arima H, Tsutsumi T, Hirayama F, Uekama K, Enhancing effects of galactosylated dendrimer--cyclodextrin conjugates on gene transfer efficiency, Biol Pharm Bull, 28, 2005, 500 505. Wiener EC, Brechbiel MW, Brothers H, Magin RL, Gansow OA, Tomalia DA, Lauterbur PC, Dendrimer based metal chelates: A new class of magnetic resonance imaging contrast agents, Magn Reson Med, 31, 1994, 1-8. Wu H, Liu Z, Wang X, Zhao B, Zhang J, Li C, Preparation of hollow capsule-stabilized gold Nanoparticles through the encapsulation of the dendrimer, J Colloid Interface Sci, 302, 2006, 142 148. Wu L, Li BL, Haung YY, Zhou HF, He YM, Fan QH, Phosphine dendrimer stabilized palladium Nanoparticles, a highly active and recyclable
IJRPB 1(6)
www.ijrpb.com
Page 934

Ijrpb Vol 1 Issue 6

Diunggah oleh

Informasi Dokumen

Deskripsi Asli:

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Ijrpb Vol 1 Issue 6

Diunggah oleh

Hak Cipta:

Format Tersedia

Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print)

Editorial Advisory Board

Dr. J.Balasubramanium, M. Pharm., Ph D.

Dr. V.Prabhakar Reddy, M. Pharm., Ph D.

Dr.P.Ram Reddy, M. Pharm., Ph D.

INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY Instructions to Authors

815-818 819-821 822-827

893-897 898-900 901-907

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker

November December 2013

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Name F3 B3 FIP (F1c+F2) BIP (B1+B2c)

November December 2013

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Mohd Asif et.al

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Table.2.Comparative dissolution profile testing in 0.1N Hcl

Figure.2.Comparative dissolution profile of five brands in ph 5.5

November December 2013

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

Figure.3.Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer

Figure.4.Comparative Dissolution Profile In Ph 6.8 Phosphate Buffer

Figure.5. Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer

Figure.6.Comparative Dissolution Profile In Ph 6.8 Phosphate Buffer

Figure.7. Dissolution profile by in situ ph change method

November December 2013

Page776 773 Page

Indian Journal of Research in Pharmacy and Biotechnology

ISSN: 2321-5674(Print) ISSN: 2320 3471(Online)

November December 2013