RESEArCH ArTICLE

For reprint orders, please contact: reprints@futuremedicine.com

Human embryonic stem cell-derived neural crest cells capable of expressing markers of osteochondral or meningealchoroid plexus differentiation
Aims: The transcriptome and fate potential of three diverse human embryonic stem cell-derived clonal embryonic progenitor cell lines with markers of cephalic neural crest are compared when differentiated in the presence of combinations of TGFb3, BMP4, SCF and HyStemC matrices. Materials &methods: The cell lines E69 and T42 were compared with MEL2, using gene expression microarrays, immunocytochemistry and ELISA. Results: In the undifferentiated progenitor state, each line displayed unique markers of cranial neural crest including TFAP2A and CD24 ; however, none expressed distal HOX genes including HOXA2 or HOXB2, or the mesenchymal stem cell marker CD74. The lines also showed diverse responses when differentiated in the presence of exogenous BMP4, BMP4 and TGFb3, SCF, and SCF and TGFb3. The clones E69 and T42 showed a profound capacity for expression of endochondral ossication markers when differentiated in the presence of BMP4 and TGFb3, choroid plexus markers in the presence of BMP4 alone, and leptomeningeal markers when differentiated in SCF without TGFb3. Conclusion: The clones E69 and T42 may represent a scalable source of primitive cranial neural crest cells useful in the study of cranial embryology, and potentially cell-based therapy.
KEYWORDS: adipocyte n APOD n bone n cartilage n choroid plexus n clonal embryonic progenitor cells n craniofacial n CYP26B1 n embryonic stem cells n meninges n neural crest n PTGDS n TTR

Human pluripotent stem (hPS) cells such as human embryonic stem (hES) and induced pluripotent stem cells possess the capacity to cascade through all somatic cell lineages during differentiation [1]. hPS cells therefore offer new possibilities for modeling human development invitro, as well as a means of manufacturing rare and valuable cell types useful in regenerative medicine. However, clinical-grade cellular formulations will likely require standards of purity and identity exceeding those observed in most published differentiation protocols. The majority of published manufacturing methods intended to generate clinical-grade cells entail the steps of: scale up of the undifferentiated hPS cells; differentiation under a defined protocol to generate an enriched population of the desired cell type; and a purification process (commonly utilizing affinity methods). However, the thousand-fold complexity of cell types emerging from hES cell cultures [2], the inherent variability introduced in each of the multiple differentiation fate decisions made by the cells in the process, and the current inability to identify the majority of cell types contaminating the formulations makes the manufacture of hPS cell-derived therapeutics challenging. An alternative to this heterogeneous differentiation method is the expansion of clonal embryonic progenitor (EP) cell types. We previously reported
10.2217/RME.13.86 2014 Future Medicine Ltd

that >140diverse human EP (hEP) cell types are capable of extensive clonal expansion when utilizing diverse culture conditions [3]. The cells are designated embryonic progenitors to reflect the fact that they typically display patterns of gene expression corresponding to early development, can be extensively passaged invitro, then have the potential to respond to various cues to terminally differentiate into adult cell types. Like hPS cells, hEP cells may not represent naturally occurring stem cells, but instead, like hPS cells, may represent progenitors that display a developmental stasis while showing proliferative capacity in certain culture conditions. Unlike adult-derived stem cells such as bone marrow mesenchymal stem cells (MSCs), which currently lack rigorous clonal data demonstrating differentiated fates beyond hypertrophic chondrocytes, adipocytes, fibroblasts, and perhaps reticular and osteoblast cells, clonal hEPs could be a strategy for obtaining scalable progenitors with greater diversity and site specificity. We previously reported that screening of 100diverse hEP lines for chondrogenic potential in the presence of TGFb3 in micromass (MM) culture identified seven lines capable of induction of COL2A1 and associated osteochondral markers [4]. Here we describe two novel neural crest clones that did not induce COL2A1 in
Regen. Med. (2014) 9 (1), 5366

Hal Sternberg1, Jianjie Jiang1, Pamela Sim1, Jennifer Kidd1, Jeffrey Janus1, Ariel Rinon2, Ron Edgar2, Alina Shitrit2, David Larocca3, Karen B Chapman4, Francois Binette5 &Michael D West*1
BioTime, Inc., 1301 Harbor Bay, Parkway, Alameda, CA 94502, USA 2 LifeMap Sciences, Tel Aviv, Israel 3 Mandala Biosciences, La Jolla, CA,USA 4 OncoCyte Corporation, Alameda, CA,USA 5 OrthoCyte Corporation, Alameda, CA,USA *Author for correspondence: Tel.: +1 510 521 3390 ext. 303 Fax:+1 510 521 3389 mwest@biotimemail.com
1

ISSN 1746-0751

53

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

the presence of TGFb3 in the previous study, but when differentiated in an expanded combination of differentiation factors, show markers for osteo chondral, choroid plexus, as well as leptomeningeal differentiation.

Materials &methods Cell lines &growth factors The hEP cell clones E69 (cat. no. ES-101, BioTime, CA, USA), T42 (cat. no. ES-210, BioTime) and MEL2 (cat. no. ES-268, BioTime) were derived as previously described [3]. T42 and MEL2 were derived from the hES cell line H9 (NIH registered as WA09). The line E69 was derived from the hES cell line ACT03 (MA03). The hEP cell lines were routinely cultured in corresponding ESpan medium as recommended by the manufacturer (BioTime). The cells when maintained in the undifferentiated state were cultured at 37C in a humidified atmosphere of 10% CO2 and 5% O2 on gelatinized culture vessels. The relatively high concentration of CO2 provided physiological pH in relatively low concentrations of O2. The hEP cell lines were serially passaged as previously described, while confluence was carefully prevented for more than 2days to prevent differentiation while in the progenitor state. When assaying gene expression of the undifferentiated progenitors, cells were synchronized in quiescence by growing to confluence, then were switched to medium containing only 10% of the normal serum concentration and held for 5days to induce quiescence. TGFb3 was obtained from Lonza (NJ, USA, cat. no. PT-4124) or R&D Systems (MN, USA, cat. no. 243-B3-010). BMP4 was obtained from HumanZyme (IL, USA). SCF was obtained from R&D Systems (cat. no. 255-SC-010).
MM-induced differentiation Cells were cultured in the undifferentiated state, and upon confluence detached with 0.25% w/v trypsin/EDTA (Invitrogen, CA, USA), which was diluted 1:3 with phosphate-buffered saline (PBS; Ca, Mg free). The trypsin was deactivated upon the addition of growth medium, cells were counted, spun at 150g for 5min, supernatant removed and cells resuspended at a cell density of 2.0107cells/ml in their respective growth medium. Twenty-five or more MM aliquots (200,000cells/10l aliquot) were seeded onto Corning tissue culture-treated polystyrene plates or dishes (Corning, MA, USA). The seeded MMs were placed in a humidified incubator at 37C with 5% O2 and 10% CO2 for 2h for attachment. The growth medium for each respective cell line
54
Regen. Med. (2014) 9 (1)

was added. The following morning, the medium was aspirated, cells were rinsed with PBS (Ca and Mg free), which was replaced with FactorContaining Differentiation medium as per the manufacturers instructions (differentiation kit ES-K210; BioTime). Factor-containing differentiation medium consisted of BioTime factor-free medium plus TGFb3 or other TGFb family members as described herein. Briefly, sterile lyophilized TGFb3 was reconstituted with the addition of sterile 4mM HCl containing 1mg/ml bovine serum albumin to prepare a 2000 stock solution with a concentration of 20g/ml. The stock solution was stored after aliquoting at -80C. Factor- containing differentiation medium (10 g/ml TGFb3) was prepared just before use by the addition of 1.0l of stock TGFb3 for each 2ml of factor-free differentiation. Cells were maintained in a humidified incubator at 37C with 5% O2 and 10% CO2 in factor-containing differentiation medium, which was replaced with freshly prepared medium every 23days. At the designated time points, RNA was extracted using Qiagen RNeasy Kits (cat. no. 74104, Qiagen, CA, USA) according to the manufacturers instructions. RNA yield was maximized using QIAshredders (cat. no. 79654, Qiagen) to homogenize samples following the lysis of the MMs with RLT buffer before RNA extraction. Differentiation in HyStem4D bead arrays HyStemC (BioTime) was prepared according to the manufacturers instructions. The HystemC kit consists of three reagents that need to be reconstituted in degassed deionized water. Briefly, the HyStem component (thiol-modified hyaluronan, 10mg) was dissolved in 1ml to prepare a 1% w/v solution, the Gelin-S component (thiol-modified gelatin, 10mg) was also dissolved in 1ml water to prepare a 1% w/v solution, and a polyethylene glycol diacrylate (PEGDA, 10mg) crosslinker was dissolved in 0.5 ml to prepare a 2% w/v solution. Then, 1ml HyStem was mixed with 1ml Gelin-S just before use. Pelleted cells were resuspended in the HyStem:Gelin-S (1:1 v/v) mix, followed by the addition of the crosslinker PEGDA, to yield a final cell suspension concentration of 2.0107cells/ml. The cell suspension was aliquoted at 25l/bead into sixwell plates (Corning 3516) after partial gelation (typically five beads per well). Differentiation medium was added to each well following complete gelation (2040min). Plates were placed in a humidified incubator at 37C with ambient O2 and 10% CO2, and the cells were fed fresh differentiation
future science group

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

medium three-times weekly. The hydrogel constructs are either fixed for immunohistochemical ana lysis, or lysed using RLT (Qiagen), for total RNA to analyze transcript expression (using quantitative real-time PCR (qRTPCR) and/or whole genome microarray), at the desired time points. ELISA The concentration of transthyretin protein in conditioned medium was determined by ELISA. E69, T42 and MEL2 cells were cultured for 14days in MM culture in the presence of 10ng/ml BMP4 (50MMs at 200,000 cells each in 10cm dishes, with 20ml serum-free differentiation medium). After 3days, conditioned medium was removed, and concentrated using Amicon spin concentrators (cat. no. UFC901024, Millipore Corp., CA, USA). Concentrates were assayed in duplicate at three dilutions (100, 200, and 400 for both T42 and E69; and 50, 100 and 200 for MEL2) using an Abcam transthyretin ELISA kits (cat. no. ab108895, Abcam, MA, USA). The concentration (ng/ml) of transthyretin in the conditioned medium was calculated upon taking into account the fold concentration in Amicon concentrators. Immunouorescent detection ofKRT17 EP cells grown under quiescence-inducing culture conditions were washed three times with PBS and fixed in 4% paraformaldehyde for 20min at room temperature (RT). Fixed cells were washed three times in PBS, permeabilized and blocked by incubation in a blocking buffer (10% normal donkey serum and 0.1% TritonX-100 in PBS) overnight at 4C. The cells were incubated for 1h at RT with primary rabbit anti-KRT17monoclonal antibody EP1623 (ab109725, Abcam) at a dilution of 1:100 in 0.5 blocking buffer. Next they were washed three times with PBS, and incubated for 1h at RT with Alexa Fluor568 donkey antirabbit IgG antibody (Invitrogen, A10042) at a 1:1000 dilution in PBS. Control cells were stained under identical conditions except that total rabbit IgG (011101, Southern Biotech, AL, USA) was used as the primary antibody (30g/ml). Cells were counterstained with DAPI at 0.1mg/ml for 15min at RT. Gene expression analysis Total RNA was extracted directly from cells using Qiagen RNeasy Mini Kits according to the manufacturers instructions. RNA concentrations were obtained using a Beckman DU530 (Beckman
future science group

Coulter, CA, USA) or NanoDrop (DE, USA) spectrophotometer, and RNA integrity was determined by denaturing agarose gel electrophoresis or by an Agilent 2100 bioanalyzer (Agilent, CA, USA). Whole-genome expression ana lysis was performed using Illumina HumanHT-12 v4 BeadArrays (Illumina, CA, USA), and RNA expression levels for certain genes were verified by qRTPCR. For the Illumina BeadArrays, total RNA was linearly amplified and biotin-labeled using Illumina TotalPrep kits (Life Technologies, CA, USA). The cRNA quality was controlled using an Agilent 2100 Bioanalyzer, and was hybridized to Illumina BeadChips, processed, and read by a BeadStation array reader according to the manufacturers instructions. Values under 130 relative fluorescence units were considered as nonspecific background signal. Data analysis for clustering Raw microarray data of the cell clones was normalized with the R beadarray library [5]. One probe was selected for each gene by using the default parameters of collapse Rows function from the weighted correlation network ana lysis (WGCNA) library [6]. For each cell culture sample, the differential expression values were calculated against a wide selection of EP cell clones. Genes that were upregulated by more than twofold in at least one specific cell line in comparison with the progenitor reference were used in clustering. The dendrogram was created using hierarchical cluster ana lysis using average agglomeration method. qRTPCR analysis Samples for assessment were prepared in standard Optical 96-well reaction plates (Applied Biosystems, CA, USA, PN 4306737). They consisted of 30ng of RNA equivalent of cDNA, 0.8M per gene-specific custom oligonucleotide primer set (Invitrogen), and ultrapure distilled water (cat. no. 10977015, Invitrogen), which was diluted 1:1 with 12.5l of Power SYBR Green PCR Master Mix (cat. no. 4367659, Applied Biosystems) incorporating AmpliTaq Gold DNA polymerase for a total reaction volume of 25l. An Applied Biosystems 7500 Real-Time PCR System employing SDS2.0.5 software was used to run qRTPCR. Amplification conditions were set at 50C for 2min (stage1), 95C for 10min (stage2), 40cycles of 95C for 15s then 60C for 1min (stage3), with a dissociation stage (stage4) at 95C for 15s, 60C for 1min, and 95C for 15s. Cycle threshold (Ct) values for the amplicons of genes COL2A1, COL10A1, ACAN and CTRAC1
www.futuremedicine.com

55

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

were normalized to the average Ct value of three housekeeping genes (GAPDH, RPS10 and GUSB) and the normalized gene expression was then calculated relative to that of early passage kneenormal human articular chondrocytes (NHACs) (Lonza). Gene expression for the gene TTR across samples was analyzed from the average Ct value of the amplification product, which was normalized using the average Ct value of GAPDH. Primers used included: ACAN (NM_013227.2) f. TGAGTCCTCA AGCCTCCTGT, r. CCTC TGTCTCCTTGCAGGTC (185 bp); COL2A1 (NM_001844.4) f. TGGCCTG AG ACAGC ATG A, r. AGTGTTG GG AGCC AG AT TG (373bp); COL10A1 (NM_000493.3) f. GGG CCTC AATGGACCC ACCG, r. CTGGGC C T T TGGCCTGCC T T (150 bp); CRTAC1 (NM_018058.4) f. ATCCGTAGAG AGC AC GGAGA, r. GGACTCTCCATGGGACAAGA (144bp); GAPDH (NM_002046.3) f. GG C C TC C A AG GAG TA AGAC C, r. AGG G G TC TAC ATG GC A AC TG (147 bp); GUSB (NM_000181.2) f. AAACGAT TGC AGGGT TTCAC, r. CTCTCGTCGGTGACTGTTCA (171bp); TTR (NM_000371.3) f. TGC A G AGGTGGTATTC ACAGC, r. GGTGGA A TAGGAGTAGGGGC (85 bp); and KRT17 (NM_000422.2) f. TCCTGCAGGC TGGG ATCT, r. GGTGGCTGTG AGG ATC TTGT (333bp).

and associated clinical trials are underway testing the matrix as a device for the therapeutic delivery of anchorage-dependent cells, novel discoveries made with these cell/matrix combinations invitro may be expected to have a greater probability of a similar performance when the same cell/matrix formulation is used invivo. Since BMP4 alone or in combination with TGFb3 is known to be an important differentiation factor in neural crest differentiation [9], we initially examined the effects of these factors on two EP cell clones designated E69 and T42that expressed cranial neural crest markers and that were previously reported to be negative for COL2A1 expression when differentiated in MM conditions in the presence of TGFb3 alone [4]. Comparison of gene expression in the undifferentiated cell clones designated E69, T42 &MEL2 As shown in FIGURE 1, all three cell clones displayed a mesenchymal morphology with subtle cell line-specific differences in shape and growth (F IGURE 1A1C). The previously reported clone MEL2 was chosen as a control as it shared with E69 and T42 cells a lack of HOX gene expression and like E69 and T42 cells expressed markers of cephalic neural crest. The clones E69 and T42 along with MEL2 were expanded invitro and then rendered quiescent at confluence for 5days in the presence of relatively low levels of serum to synchronize the cells and thereby minimize cell cycle artifacts in the gene expression analysis. Isolated RNA for the three cell types were then analyzed by gene expression microarray analysis using human HT-12 v4 microarrays and the LifeMap Discovery (LMD), a database [101] that correlates the unique molecular markers with those appearing during normal development invivo [2]. As shown in FIGURE 2 & SUPPLEMENTaRY TaBLE 1 (see online at www.futuremedicine.com/doi/ suppl/10.2217/RME.13.86), sheet 12, the three clones shared the cranial neural crest markers TFAP2A [10] and CD24 [11], and lacked distal HOX gene expression including HOXA2 and HOXB2. The clone E69 (passages ranging from 14 to 22) expressed KRT17, TRIM4 and ZIC2 while T42 (passages ranging from 17 to 20) expressed TRIML2 , EPDR1, ZIC2 and lower but detectable levels of KRT17. ZIC2 is naturally expressed during neural crest, cranio facial and axial skeleton development [12]. As shown in LMD, ZIC2 is expressed in somitic dermo myotome, sclerotome, maxillary, mandibular and limb bud mesenchyme [102,103]. The relative levels of KRT17 transcript in E69 and
future science group

Results We previously reported that when 100 diverse hES-derived clonal hEP cell lines were differentiated in MM conditions in the presence of TGFb3, dexamethasone, and insulintransferrinselenium medium for 14days, seven of the lines showed evidence of chondrogenic differentiation as measured by the upregulation of chondrocyte-specific markers such as the transcript for COL2A1. These seven clonal progenitors designated 4D20.8, 7PEND24, 7SMOO32, E15, MEL2, SK11, and SM30 showed diverse site- specific homeobox gene expression and diverse differentiation responses to a panel of combinations of TGFb family members [7]. Since the screening of randomly cloned populations of hES-derived progenitors in diverse differentiation conditions appeared to reveal novel and valuable cell fates for the cells, we undertook a large-scale screening of the cells in the presence of diverse growth factors. We differentiated the cells in HyStem4D bead arrays, a condition that in our hands leads to improved uniformity and reproducibility of the differentiation [8]. In addition, since clinical-grade HyStemC is available
56
Regen. Med. (2014) 9 (1)

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

Figure1. Phase contrast images of the human embryonic progenitor cell lines E69, T42 and MEL2. (A) E69 (passage 13); (B)T42 (passage 14); and (C) MEL2 (passage 14) are shown in an undifferentiated state in log growth conditions. Scale bars: 100m.

T42 were confirmed by qRTPCR and protein by immunocytochemistry (FIGURE3). MEL2 cells (passages1819) expressed HAND2 (expressed in branchial arch mesenchyme and, as shown in LMD, expressed in cranial and cardiac neural crest cells) [104106]. MEL2 also expressed the retinoid metabolizing enzyme ALDH1A2 , which has been shown in the LMD to be expressed selectively in the maxillary and mandibular processes [107,108]. Additional markers of undifferentiated MEL2 cells were CRABP1 and DLX5. Comparative gene expression in EP clones E69, T42 &MEL2 when differentiated in the presence of TGFb3 &BMP4 We next compared the clones E69 (passage14), T42 (passage17) and MEL2 (passage23) when differentiated for 14days in HyStem4D bead arrays. HyStemC is a biocompatible hydrogel comprised of thiolated hyaluronan and gelatin. The crosslinker utilized was PEGDA. The cells were mixed with reconstituted HyStemC components, then 25l beads were incubated in differentiation medium supplemented with diverse growth factors, a protocol referred to as HyStem4D bead arrays [8]. The differentiation medium was supplemented with 10ng/ml BMP4 and 10ng/ml TGFb3, RNA was isolated after 14days and analyzed by Illumina gene expression microarrays. Mean relative fluorescence unit values were calculated (SUPPLEMENTaRY TaBLE1, sheet3) and compared with the mean values of the cells in the original progenitor state. As shown in FIGURE4 &SUPPLEMENTaRY TaBLE1, sheet4, differentiation in HyStemC for 14days in the presence of a combination of BMP4 and TGFb3 resulted in a marked induction of osteochondral gene expression. The clones E69 and T42 upregulated COL2A1 expression (38,675- and 87,955-fold higher expression compared with cultured NHACs, respectively) as determined by qRTPCR (SUPPLEMENTaRY TaBLE2, sheet1), while MEL2 induced COL2A1 at a
future science group

much lower level (154-fold over cultured NHACs (SUPPLEMENTaRY FIGURE1&SUPPLEMENTaRY TaBLE2, sheet1). In addition, replicate microarray ana lysis of E69 and T42 showed an induction of ACAN and COL10A1 (also confirmed by qRTPCR), and the osteochondral markers EPYC , COMP, and SPP1, as determined solely by microarray analysis (FIGURE4). The previously characterized EP clones 4D20.8, 7PEND24, 7SMOO32, E15, SK11, and SM30 showed variable expression of chondrogenic versus osteogenic markers depending on the combinations of BMP used, but rarely levels of osteogenic markers comparable to MSCs. The line MEL2 was previously reported to show relatively high levels of osteogenic markers but low levels of COL2A1. However, E69 and T42 cells differentiated in HyStemC with BMP4 and TGFb3 showed relatively strong expression of the osteogenic markers SCIN and ALPL (SUPPLEMENTaRY TaBLE1), simultaneously with relatively high expression of COL2A1. The expression of tissue-nonspecific ALPL is frequently associated with mineralization [13]. Additional markers of osteogenesis expressed by the differentiated E69, T42 and MEL2 cells, as determined by microarray ana lysis, included BMP2 with only MEL2 cells expressing the calvarial marker GPC3 [14]. Comparison of differentiated fates of the clonal EP cell lines E69, T42 &MEL2 in HyStemC with BMP4 The clones E69 (passage14), T42 (passage17) and MEL2 (passage23) were then incubated for 14days in HyStem4D bead arrays in the presence of 10ng/ml of BMP4, insulintransferrinselenium and dexamethasone but in the absence of TGFb3. As shown in FIGURE5&SUPPLEMENTaRY TaBLE1, sheets56, the clones E69 and T42 upregulated the relatively rarely expressed transcript TTR as well as KIT upon differentiation, while upregulation of the expression of these genes was not detectable in the clone MEL2. The TTR gene encodes transthyretin, an abundant protein in the
www.futuremedicine.com

57

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

6000 5000 4000

RFUs

KRT17

900 800 700 600

RFUs

TRIML2

7000 6000 5000

RFUs

DLX5

3000 2000 1000 0

500 400 300 200 100

4000 3000 2000 1000 0

E69

T42 TFAP2A

MEL2

E69

T42 EPDR1

MEL2

E69

T42 ALDH1A2

MEL2

1400 1200 1000 800 600 400 200 0

800 700 600 500

RFUs

1200 1000 800

RFUs

RFUs

400 300 200 100

600 400 200 0

E69

T42 TRIM4

MEL2

0 2000 1800

E69

T42 ZIC2

MEL2

E69

T42 HAND2

MEL2

1200 1000 800

RFUs

1000 900 800 700 600

RFUs

1600 1400 1200

RFUs

600 400 200 0

1000 800 600 400 200

500 400 300 200 100

E69

T42

MEL2

E69

T42

MEL2

E69

T42

MEL2

Figure2. Microarray-based ana lysis of unique gene expression markers in the clonal human embryonic progenitor cell lines E69, T42 and MEL2. Expression of the genes KRT17, TRIML2, DLX5, TFAP2A, EPDR1, ALDH1A2, TRIM4, ZIC2 and HAND2 are shown as RFUs in the clones E69 (passages ranging from 14 to 22, n=5), T42 (passages ranging 1720, n=7) and MEL2 (passages ranging from 18 to 19, n=4) cultured in the undifferentiated state and for 5days in quiescence-inducing conditions. Data are displayed as mean values of two or more biological replicates. Error bars represent standard deviation. RFU values <130 were considered to be background signal. RFU: Relative uorescence unit.

58

Regen. Med. (2014) 9 (1)

future science group

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

cerebrospinal fluid (CSF), transporting thyroid hormones, retinol, and potentially b-amyloid oligomers [1517]. The expression of TTR in the E69 (passage14) and T42 (passage17) clones in the presence of HyStemC and BMP4 was confirmed by qRTPCR, with T42 expressing the highest levels of the transcript (FIGURE6&SUPPLEMENTaRY TaBLE2, sheet1) and no transcript detectable in MEL2 (passage23). To determine whether transthyretin was also expressed on a protein level, 3day serumfree conditioned medium was collected from par allel cultures of E69 (passage16), T42 (passage17) and MEL2 (passage19) in MM conditions with BMP4, and analyzed by ELISA for the presence of soluble secreted protein. As shown in FIGURE6 &SUPPLEMENTaRY TaBLE2 , sheet2, the T42 line expressed the highest levels of secreted protein, reaching approximately 8.9ng/ml at 3days, E69 reached approximately 0.7ng/ml, while no transthyretin was detectable in the media of cultured MEL2 cells. TTR is reported to be expressed relatively rarely invivo in tissues such as the retina, liver, and choroid plexus of the brain. We therefore examined RNA from >130 diverse cultured somatic cell types and observed TTR expression in cells from only these tissues (SUPPLEMENTaRY TaBLE1, sheet8). Specifically, cultured hES-derived retinal pigment epithelial (RPE) cells expressed high levels of TTR , while we did not observe TTR expression in undifferentiated hES cells or human iris pigment epithelial cells. We also observed TTR expression

in primary cultures of human choroid plexus epithelium and human choroid plexus-derived stromal cells, but did not observe expression in cultured human choroid plexus vascular endothelial cells. Lastly, we observed TTR expression in primary hepatocytes, but not hepatic sinusoidal endothelial or stellate cells (SUPPLEMENTaRY TaBLE1, sheet 8). Since neither E69 or T42 cells, differentiated in BMP4 in either HyStem or MM conditions, expressed the numerous common markers of RPE cells such as TYRP1 or TYR, or markers of hepatocytes such as FOXA2 or FGG, we conclude that the gene expression pattern of differentiated E69 and T42 cells corresponds more closely to choroid plexus-related cells than to either RPE cells or hepatocytes. Effects of HyStemC matrix &SCF on E69 &T42 differentiation HyStemC is composed of crosslinked gelatin and hyaluronic acid, each component capable of binding or otherwise modifying the activity of many basic growth factors. Therefore, it is reasonable to question how the differentiation of E69 and T42 cells may be influenced by HyStemC versus MM conditions. We therefore examined the differentiation of the clones E69 and T42 in MM conditions wherein 10l aliquots at 2.0107cells/ml growth medium were allowed to settle and attach, with subsequent incubation in the same differentiation medium as used previously in the HyStem4D bead arrays.

1.0000 0.9000
Expression relative to GAPDH

KRT17

0.8000 0.7000 0.6000 0.5000 0.4000 0.3000 0.2000 0.1000 0.0000 E69 T42 MEL2

Figure3. KRT17 expression in the human embryonic progenitor cell clones E69, T42 and MEL2 cultured in the undifferentiated state. (A) Mean KRT17 expression relative to GAPDH measured by quantitative real-time PCR in the undifferentiated, 5-day quiescent cell clones E69, T42 and MEL2. Error bars represent standard deviation. (BD)Immunouorescent detection of KRT17 in E69, T42 and MEL2 cells cultured in an undifferentiated state using rabbit anti-KRT17 antibody and Alexa Fluor568-conjugated goat anti-rabbit antibody. (EG) E69, T42 and MEL2 cells cultured in an undifferentiated state and stained with control preimmune rabbit IgG polyclonal antiserum and Alexa Fluor568-conjugated goat anti-rabbit antibody. Cell nuclei were stained using DAPI.

future science group

www.futuremedicine.com

59

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

30000 25000

COL2A1

4000 3500 3000 RFUs

COL10A1

600 500 RFUs 400 300 200 100 0 E69 ctrl

ACAN

20000 RFUs 15000 10000 5000 0 E69 ctrl

2500 2000 1500 1000 500

E69 BMP4 and TGF3

T42 BMP4 and TGF3

MEL2 BMP4 and TGF3

E69 BMP4 and TGF3

T42 BMP4 and TGF3

MEL2 BMP4 and TGF3

E69 BMP4 and TGF3

T42 BMP4 and TGF3

12000 10000 RFUs 8000

EPYC

6000 5000 4000 RFUs

COMP

6000 5000 4000 RFUs 3000 2000 1000 0

SPP1

6000 4000 2000 0 E69 BMP4 and TGF3 T42 BMP4 and TGF3 MEL2 BMP4 and TGF3 E69 ctrl T42 ctrl MEL2 ctrl

3000 2000 1000 0 E69 ctrl T42 ctrl E69 BMP4 and TGF3 T42 BMP4 and TGF3 MEL2 BMP4 and TGF3 MEL2 ctrl

E69 ctrl

T42 ctrl

E69 BMP4 and TGF3

T42 BMP4 and TGF3

Figure4. Microarray-based gene expression ana lysis of E69, T42 and MEL2 differentiated in HyStem4D bead arrays in BMP4 and TGFb3. The mean relative expression of COL2A1, COL10A1, ACAN, EPYC, COMP and SPP1 are shown in control conditions and 14days of differentiation of E69 (passage 14, n=2), T42 (passage 17, n=2) and MEL2 (passages ranging from 23 to 26, n=2) in 10ng/ml BMP4 and 10ng/ml TGFb3. Data are displayed as mean values of two or more biological replicates. Error bars represent standard deviation. RFU values <130 were considered to be background signal. Ctrl: Control; RFU: Relative uorescence unit.

As shown in FIGURE 7 & SUPPLEMENTaRY TaBLE 1, sheet6, the clones E69 and T42, when differentiated in HyStemC in the presence of BMP4 alone, showed relatively high levels of the adipocyte markers FABP4 and CD36 , and relatively lower levels of TTR compared with the cells differentiated under MM conditions. In addition to expressing higher levels of TTR , cells differentiated in MM conditions with BMP4 showed
60
Regen. Med. (2014) 9 (1)

increased induction of KIT (the receptor for c-kit ligand, also known as SCF), a known marker of choroid plexus cells, in particular, the choroid plexus epithelium. To examine whether activation of KIT affected E69 and T42 cell differentiation, we differentiated E69 and T42 cells for 14days in 10ng/ml SCF alone or SCF and BMP4, with each condition performed in both MM and HyStem4D
future science group

MEL2 BMP4 and TGF3

MEL2 ctrl

MEL2 BMP4 and TGF3

0 E69 ctrl

T42 ctrl

MEL2 ctrl

T42 ctrl

MEL2 ctrl

T42 ctrl

MEL2 ctrl

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

bead arrays. As shown in FIGURE7 &SUPPLEMENTaRY TaBLE1, sheet7, culture of the cells in SCF alone resulted in a marked induction of the lepto meningeal markers PTGDS and ISLR in both E69 and T42 in both MM and HyStem4D bead arrays. PTGDS encodes a glutathioneindependent PGD synthase converting PGH2 to PGD2 in the brain where it is also known as b-trace, the second most abundant protein of the CSF after albumin. In humans, it appears to be expressed at its highest levels in the arachnoid barrier cells, followed by arachnoid trabecular and pia cells, but is not expressed in the dura mater [18,19]. T42 appeared to differ from E69 cells in that it induced a higher amount of SLC6A1 and APOD when differentiated in the presence of SCF without BMP4. The combination of BMP4 and SCF led to an outcome similar to BMP4 and TGFb3, namely TTR-expressing cells (FIGURE7 & SUPPLEMENTaRY TaBLE1, sheet7). As before, HyStemC in these conditions led to a higher expression of the adipocyte markers FABP4 and CD36. It has been reported that cultured mammalian neural crest cells express low-affinity NGFR [4]. However, we did not detect NGFR in E69, T42 or MEL2 in any differentiation condition by microarray ana lysis.

exhibited markers of ossification with low expression of COL2A1. When all three cell clones were
30000 COL2A1 TTR KIT 25000

20000

RFUs

15000

10000

5000

Discussion We previously reported that combinatorial cloning of hES-derived progenitor cell lines is capable of generating a diversity of >140 distinguishable cell types by non-negative matrix factorization. When 100of these were screened in MM conditions in the presence of TGFb3, only seven lines upregulated COL2A1 expression. In this study, we expanded this screening to include two candidate TFAP2A+, CD24+ cranial neural crest cells designated E69 and T42that previously failed to show osteochondral differentiation in TGFb3 and MM conditions. The clones E69 and T42 were differentiated in parallel with the line MEL2, which also expressed similar cranial neural crest markers to E69 and T42, but unlike them did undergo osteochondral differentiation in TGFb3 and MM conditions. Neither E69, T42 or MEL2 expressed markers of bone marrow MSCs such as CD74, a marker reported to distinguish MSCs from other fibroblastic cell types (SUPPLEMENTaRY TaBLE1) [20]. An examination of gene expression during differentiation of the three clones in HyStem4D bead arrays cultured in the presence of BMP4 and TGFb3 showed that both E69 and T42 robustly upregulated markers of endochondral ossification (COL2A1 and ALPL), while MEL2
future science group

0
E69 HyStem BMP4 E69 HyStem BMP4 and TGF3 T42 HyStem BMP4 and TGF3 MEL2 HyStem BMP4 and TGF3 T42 HyStem BMP4 MEL2 HyStem BMP4 MEL2 MM BMP4 MEL2 ctrl E69 MM BMP4 T42 MM BMP4 E69 ctrl T42 ctrl

Figure5. Microarray-based gene expression ana lysis of E69, T42 and MEL2 differentiated in HyStem4D bead arrays and MM in BMP4 and TGFb3. Therelative expressions of COL2A1, TTR and KIT are shown in: control conditions; 14days of differentiation of E69 (passage 14, n=2), T42 (passage 17, n=2) and MEL2 (passages ranging from 23 to 26, n=2) in 10ng/ml BMP4 and 10ng/ml TGFb3 in HyStem4D bead arrays; 14days of differentiation of E69 (passage 14, n=2), T42 (passage 17, n=2) and MEL2 (passages ranging from 23 to 26, n=2) in 10ng/ml BMP4 in HyStem4D bead arrays; and 14days of differentiation of E69 (passages ranging from 15 to 22, n=5), T42 (passages ranging from 17 to 20, n=5) and MEL2 (passage 19, n=2) in 10ng/ml BMP4 in MM conditions. Data are displayed as mean values of two or more biological replicates. Error bars represent standard deviation. RFU values <130 were considered to be background signal. Ctrl: Control; MM: Micromass; RFU: Relative uorescence unit.

www.futuremedicine.com

61

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

0.1200

12.00

0.1000
Expression relative to GAPDH

10.00

0.0800

Concentration (ng/ml)

8.00

0.0600

6.00

0.0400

4.00

0.0200

2.00

0.0000 E69 T42 MEL2

0.00 E69 T42 MEL2

Figure6. Mean relative levels of expression of TTR in cells as determined by quantitative real-time PCR and ELISA. (A) RNA from the human embryonic progenitor cell clones E69, T42 and MEL2 differentiated for 14days in HyStem4D bead arrays in the presence of 10ng/ml BMP4 was analyzed by quantitative real-time PCR for the TTR transcript. (B) Three-day serum-free conditioned medium from 14day HyStem4D bead arrays was analyzed by ELISA to quantitate the concentration of transthyretin. Error bars represent standard deviation.

differentiated in HyStemC with BMP4 alone, no detectable COL2A1 expression ocurred in E69 and T42, but instead, the cells markedly upregulated TTR , a marker of the choroid plexus, retinal pigment epithelium, and hepatocytes. Since neither E69 or T42 expressed other markers of hepatocytes or RPE such as FGG or BEST1, respectively, we conclude that E69 and T42 likely correlate more closely with neural crest cells capable of participating in the formation of the choroid plexus as opposed to RPE or hepatocytes. These results are also consistent with the report that hES cells differentiated en masse in the presence of BMP4 leads to cells with markers of choroid plexus epithelial cells [21]. The choroid plexus is normally thought to be formed from contributions from two germ layers; epithelial cells derived directly from the neuroepithelium; and stromal cells from the cephalic neural crest [22]. The expression of KRT17 in the undifferentiated E69 and T42 clones suggests that they may be capable of generating choroid plexus epithelial cells despite the mesenchymal morphology of the cells cultured invitro [23]. However, the expression of the cranial neural crest marker TFAP2A may suggest that the cells correspond more closely with the stromal components of the choroid plexus. Further study will be required to accurately determine what cells of
62
Regen. Med. (2014) 9 (1)

the choroid plexus invivo the TTR+ differentiated progeny of E69 and T42 correspond to, as well as the normality and functionality of the cells. Since BMP4 induced the expression of KIT in both E69 and T42, we examined the effects of SCF in combination with BMP4 on the differentiation of the cells. Interestingly, TGFb3 appears to have a dominant effect over BMP4 in determining an osteochondral fate to E69 and T42, while BMP4 appears to have a dominant effect over SCF in determining a choroid plexus fate. Only in the presence of SCF alone in either HyStemC or MM conditions, did we observe the marked upregulation of leptomeningeal markers such as ISLR , PTGDS , SLC6A1 and APOD. While ISLR and PTGDS are relatively constitutively expressed in developing murine leptomeninges, the genes SLC6A1 and APOD are expressed at higher levels in the mesen chyme of the choroid plexus, menix primitiva, or mesenchyme associated with the mesencephalic flexure [24]. Interestingly, the clone E69 expressed relatively lower levels of SLC6A1 and APOD, perhaps indicative of T42 representing cells of a differing anatomical location in the developing human. In addition, both E69 and T42 expressed relatively high levels of CYP26B1 in conditions paralleling TTR expression, while differentiation in SCF alone led to a loss of TTR signal, as well as a loss of CYP26B1 expression.
future science group

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

The localized expression of CYP26B1 and TTR in the developing mouse embryo may aid in the identification of the clones E69 and T42. The retinoid-metabolizing protein CYP26B1 plays an important role in metabolizing and putatively inactivating the morphogen retinoid acid. In the region of the midbrain/hindbrain flexure, its expression begins at approximately E8.0 in the mouse [25] corresponding to approximately human embryonic day 1719. Therefore, this may suggest that the clones E69 and T42 are in a developmental stasis corresponding to approximately human embryonic day 1719, although additional molecular markers will need to be identified to clarify the embryonic stage of development of these cells when propagated in the undifferentiated state. The differentiation of the meninges and choroid plexus from mesodermal and ectodermal progenitors leads to the separation of the CNS from the rest of the body, as well as likely playing a role in directing neuronal differentiation and axon guidance. Mesen ce phalic and metencephalic meninges are believed to be derived from paraxial mesoderm [22]. Telencephalic meninges
E69 HyStem BMP4 and TGF3

from mesencephalic neural crest. The twin origins of meninges is similar to the twin origins of the craniad axial skeleton where the spinal vertebrae and occipital bones are derived from paraxial mesoderm, and the remaining bones and cartilage of the cranium are of neural crest origin (LMD). Assuming the neural crest origin of E69 and T42, it is logical to conclude that the osteochondral fate of the cells when differentiated in the presence of BMP4 and TGFb3therefore represents neurocranial endochondral ossification. The primitive markers expressed by these cells, including their differentiation into cells with markers of developing meninges, may provide a model of both normal meningeal development as well as meningiomas, the latter being thought to derive from primitive lepto meningeal precursors [26]. In particular, while the role of Nf2gene inactivation has been firmly established in the etiology of meningiomas, the precise timing of the effects of the inactivation with cell differentiation remains to be more fully defined. The use of these cell types in invitro Nf2 inactivation and oncogenesis may therefore facilitate these studies.
T42 HyStem BMP4 and TGF3 MEL2 HyStem BMP4 and TGF3

HyStem SCF and BMP4

HyStem SCF and BMP4

MM SCF and BMP4

MM SCF and BMP4

Color range HyStem BMP4

HyStem BMP4

HyStem BMP4

HyStem SCF

HyStem SCF

MM BMP4

MM BMP4

MM SCF

MM SCF

0 100.2 9644 RFUs

Ctrl

Ctrl

COL2A COL9A2 COL11A2 CHAD COMP AGC1 EPYC ANGPTL5 ANGPTL7 COL10A1 SCIN ALPL IBSP TTR CLDN1 KIT ISLR PTGDS SLC6A1 APOD FABP4 CD36

Ctrl

Chondrocyte

Osteogenic Choroid plexus Leptomeninges Adipocyte

Figure7. Heat map of osteochondral, meningeal, adipose, and choroid plexus markers in E69, T42 and MEL2 cells cultured in diverse differentiation conditions. RFU values of select markers of osteochondral, meningeal, adipose and choroid plexus differentiation obtained by microarray ana lysis are displayed. E69, T42 and MEL2 cells were differentiated for 14days in either HyStem4D bead arrays or MM conditions in the presence of added growth factors shown. Color key shows associated ranges of RFU values. Ctrl: Control; MM: Micromass; RFU: Relative uorescence unit.

future science group

www.futuremedicine.com

63

RESEArCH ArTICLE

Sternberg, Jiang, Sim et al.

0.8

Relative correlation

0.6

0.4 MEL2

T42

0.2 MEL2 HyStem BMP4 and TGF3 MEL2 HyStem BMP4

E69

E69 HyStem BMP4

E69 HyStem SCF

E69 HyStem BMP4 and TGF3

E69 HyStem BMP4 and SCF

T42 HyStem BMP4 and TGF3

E69 MM BMP4 and SCF

0.0

T42 HyStem BMP4

T42 MM BMP4

Intramembranous ossification

Endochondral ossification

Choroid plexus

E69 MM BMP4

Meninges

Figure8. Dendrogram of global gene expression of E69, T42 and MEL2. Global RNA transcripts from the clones E69, T42 and MEL2 in the differentiated states cluster as discrete fates correlating with markers of osteochondral, choroid plexus and leptomeningeal cells. The y-axis label represents the distance measure between two clusters where samples that are highly correlated will have a correlation value close to 1 (distance value close to zero). MM: Micromass.

We hypothesize that the EP cell clones E69 and T42 may represent primitive embryonic neural crest mesenchyme with the potential to differentiate into leptomeninges of the upper medulla, adjacent bone of the neurocranium, or choroid plexus of the fourth ventricle. Further definition of the molecular markers distinguishing these cell types will aid in identifying pluripotent stem cell-derived cells, such as clonal EPs, as diverse progenitors of cells of the developing head and face. These cells and the associated molecular markers are now included in LMD [101], a database designed to navigate the complexities of cell phenotypes in normal human development. As shown in FIGURE8, E69 and T42 share similar fates when cultured in BMP4 in the presence or absence of TGFb3 and analyzed by a clustering algorithm of the entire probe set of the Illumina
64
Regen. Med. (2014) 9 (1)

microarray. They clustered in a similar manner when cultured in SCF in the absence of BMP4, but in the latter case, with leptomeningeal markers.

Conclusion To our knowledge, this is the first report of clonal EPs with markers of neural crest capable of expressing markers of both osteochondral and meningealchoroid plexus differentiation. The clonality and scalability of these lines may facilitate process development for the manufacture of reproducible cultures for research in embryo logy and drug discovery [27], including research in the molecular origins of meningiomas from primitive neural crest progenitors, orthopedic and neurological applications in regenerative medicine such as Alzheimers disease [16,17], as well as for the
future science group

T42 HyStem SCF

T42 MM SCF

E69 MM SCF

Clonal human embryonic stem cell-derived neural crest

RESEArCH ArTICLE

invitro manufacture of CSF components such as transthyretin and b-trace. In addition, the cells may provide a novel means of delivering diverse therapeutic proteins into the CSF for therapeutic effect in a number of metabolic or degenerative diseases of the CNS.

Future perspective There is an increasing recognition of the intrinsic challenges in manufacturing purified and identified clinical-grade therapeutics from hPS cells. While hPS cells offer, in principle, a scalable source for the manufacture of many rare and valuable cell types, and there exist many reports of associated differentiation protocols, methods of obtaining a reproducible product with the requisite purity required for clinical use are rarely reported. In addition, in many cases it would be useful to generate purified populations of differentiated cells with site-specific homeobox gene expression, since these genes are often implicated in the responsiveness of progenitors to growth factors and sometimes not-so-subtle differences in function. One potential solution to this bottleneck is the clonal expansion of EPs downstream of hPS cells. Such scalable populations of cells would be predicted to have lineage-specific
Executive summary

multipotency, as opposed to pluripotency, and therefore a simpler path to the differentiated product. The establishment of clonally purified progenitors of cranial meningeal, neurocranial, and choroid plexus cell types could allow reproducible experiments on a uniform population of cells, thereby facilitating research in bloodbrain barrier physiology, embryology, and potentially in therapeutic applications.
Financial & competing interests disclosure
This study was funded by BioTime, Inc. and OrthoCyte Corporation. The authors have no other relevant afliations or nancial involvement with any organization or entity with a nancial interest in or nancial conict with the subject matter or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.

Ethical conduct of research

The authors state that they have obtained appropriate institutional review board approval or have followed the principles outlined in the Declaration of Helsinki for all human or animal experimental investigations. In addition, for investigations involving human subjects, informed consent has been obtained from the participants involved.

Comparison of gene expression in the undifferentiated cell clones designated E69, T42 & MEL2 The human embryonic stem cell-derived human embryonic progenitor cell clones E69, T42 and MEL2 show a mesenchymal morphology when cultured invitro and share the embryonic neural crest markers TFAP2A and CD24. The clone MEL2 uniquely expressed the differential gene expression markers DLX5, ALDH1A2 and HAND2. The clones E69 and T42 expressed ZIC2 and KRT17 unlike MEL2, while E69 and T42 differed in that E69 alone was DYNLT3+ and TRIM4 + , while T42 alone was TRIML2+ and EPDR1+. Differential KRT17 expression on a protein level in the clone E69 was readily conrmed by immunocytochemistry. The mesenchymal stem cell marker CD74 was not expressed in either E69, T42 or MEL2. Comparative gene expression when differentiated in HyStem-C hydrogels in the presence of BMP4 &TGF b3 When E69, T42 and MEL2 were differentiated in HyStem4D bead arrays in differentiation media supplemented with TGFb3 and BMP4, all three lines markedly upregulated the expression of one or more of the osteochondral markers COL2A1, COL9A2, COL10A1, ACAN orCOMP. Unlike MEL2, which was previously identied as a candidate progenitor capable of intramembranous ossication, the clones E69 and T42 displayed markers of robust endochondral ossication with E69 showing an average of >30,000-fold and T42 showing >80,000-fold higher transcript for COL2A1 compared with cultured normal human articular chondrocytes. Like MEL2, the clones E69 and T42 showed marked upregulation of osteogenesis markers such as ALPL, IBSP and COL10A1 when differentiated in the presence of TGFb3 and BMP4. Comparison of differentiated fates of the clonal embryonic progenitor cell lines E69, T42 &MEL2 in HyStem-C with BMP4 When cultured in HyStem4D bead arrays in the presence of BMP4 without added TGFb3, E69 and T42 cells but not MEL2 cells markedly upregulated the expression of the choroid plexus markers TTR and KIT. Transthyretin was detectable in 72h conditioned medium of BMP4-differentiated E69 and T42, but not MEL2. Effects of HyStem-C matrix &SCF on E69 & T42 differentiation The culture of E69 and T42 cells in the presence of differentiation media supplemented with SCF but not TGFb3 led to an upregulation of leptomeningeal markers PTGDS and ISLR, with T42 markedly upregulating SLC6A1. The culture of E69 and T42 in HyStemC, as apposed to micromass conditions, also induced the adipocyte markers FABP4 and CD36 in numerous conditions tested.

future science group

www.futuremedicine.com

65

RESEArCH ArTICLE
References
1

Sternberg, Jiang, Sim et al.

13 Hellingman CA, Koevoet W, van Osch

24 Sanchez D, Ganfornina MD, Martinez S.

Thomson JA, Itskovitz-Eldor J, Shapiro SS etal. Embryonic stem cell lines derived from human blastocysts. Science 282(5391), 11451147 (1998). Edgar R, Mazor Y, Rinon A etal. LifeMap Discovery: theembryonic development, stem cells, and regenerative medicine research portal. PLoS ONE 8(7), e66629 (2013). West MD, Sargent RG, Long J etal. The ACTCellerate initiative: large-scale combinatorial cloning of novel human embryonic stem cell derivatives. Regen. Med. 3(3), 287308 (2008). Sternberg H, Murai JT, Erickson IE etal. Ahuman embryonic stem cell-derived clonal progenitor cell line with chondrogenic potential and markers of craniofacial mesenchyme. Regen. Med. 7(4), 481501 (2012). Dunning MJ, Smith ML, Ritchie ME, Tavare S. beadarray: R classes and methods for Illumina bead-based data. Bioinformatics 23(16), 21832184 (2007). Miller JA, Cai C, Langfelder P etal. Strategies for aggregating gene expression data: thecollapseRows R function. BMC Bioinformatics 12, 322 (2011). Sternberg H, Kidd J, Murai JT etal. Seven diverse human embryonic stem cell-derived chondrogenic clonal embryonic progenitor cell lines display site-specific cell fates. Regen. Med. 8(2), 125144 (2013). Sternberg H, Janus J, West M. Defining cell-matrix combination products in the era of pluripotency. Biomatter 3(1), e24496 (2013). Christiansen JH, Coles EG, Wilkinson DG. Molecular control of neural crest formation, migration and differentiation. Curr. Opin. Cell Biol. 12(6), 719724 (2000). Maxson RE Jr. Combined deficiencies of Msx1 and Msx2 cause impaired patterning and survival of the cranial neural crest. Development 132(22), 49374950 (2005).

GJ.Can one generate stable hyaline cartilage from adult mesenchymal stem cells? A developmental approach. J.Tissue Eng. Regen. Med. 6(10), e1e11 (2012).
14 Dwivedi PP, Grose RH, Filmus J etal.

Expression pattern of the lipocalin apolipoprotein D during mouse embryogenesis. Mech. Dev. 110(12), 225229 (2002).
25 MacLean G, Abu-Abed S, Dolle P, Tahayato

Regulation of bone morphogenetic protein signalling and cranial osteogenesis by Gpc1 and Gpc3. Bone 55(2), 367376 (2013).
15 Yang DT, Joshi G, Cho PY, Johnson JA,

Murphy RM. Transthyretin as both a sensor and a scavenger of beta-amyloid oligomers. Biochemistry 52(17), 28492861 (2013).
16 Buxbaum JN, Ye Z, Reixach N etal.

A, Chambon P, Petkovich M. Cloning of a novel retinoic-acid metabolizing cytochrome P450, Cyp26B1, and comparative expression ana lysis with Cyp26A1 during early murine development. Mech. Dev. 107(12), 195201 (2001).
26 Kalamarides M, Stemmer-Rachamimov AO,

Transthyretin protects Alzheimers mice from the behavioral and biochemical effects of Abeta toxicity. Proc. Natl Acad. Sci. USA 105(7), 26812686 (2008).
17 Han SH, Jung ES, Sohn JH etal. Human

Niwa-Kawakita M etal. Identification of a progenitor cell of origin capable of generating diverse meningioma histological subtypes. Oncogene 30(20), 23332344 (2011).
27 Dragunow M. Meningeal and choroid plexus

serum transthyretin levels correlate inversely with Alzheimers disease. J.Alzheimers Dis. 25(1), 7784 (2011).
18 Urade Y, Kitahama K, Ohishi H, Kaneko T,

cellsnovel drug targets for CNS disorders. Brain Res. 1501, 3255 (2013).

Websites
101 LifeMap Discovery.

Mizuno N, Hayaishi O. Dominant expression of mRNA for prostaglandinD synthase in leptomeninges, choroid plexus, and oligodendrocytes of the adult rat brain. Proc. Natl Acad. Sci. USA 90(19), 90709074 (1993).
19 Yamashima T, Sakuda K, Tohma Y etal.

http://discovery.lifemapsc.com
102 LifeMap Discovery. Cervical

Dermomyotome Cells. http://discovery.lifemapsc.com/in-vivodevelopment/somite/cervicaldermomyotome/cervical-dermomyotome-cells

103 LifeMap Discovery. Prechondrocytic

ProstaglandinD synthase (beta-trace) in human arachnoid and meningioma cells: roles as a cell marker or in cerebrospinal fluid absorption, tumorigenesis, and calcification process. J.Neurosci. 17(7), 23762382 (1997).
20 Ishii M, Koike C, Igarashi A etal. Molecular

Mesenchymal Cells. http://discovery.lifemapsc.com/in-vivodevelopment/somite/lumbar-spinous-processof-vertebrae/prechondrocytic-mesenchymalcells

104 LifeMap Discovery. Prechordal

markers distinguish bone marrow mesenchymal stem cells from fibroblasts. Biochem. Biophys. Res. Commun. 332(1), 297303 (2005).
21 Watanabe M, Kang YJ, Davies LM etal.

Mesenchyme. http://discovery.lifemapsc.com/in-vivodevelopment/head-mesenchyme/prechordalmesenchyme
105 LifeMap Discovery. Cranial Neural

10 Ishii M, Han J, Yen HY, Sucov HM, Chai Y,

BMP4 sufficiency to induce choroid plexus epithelial fate from embryonic stem cell-derived neuroepithelial progenitors. J.Neurosci. 32(45), 1593415945 (2012).
22 Catala M. Embryonic and fetal development

CrestCells. http://discovery.lifemapsc.com/in-vivodevelopment/head-mesenchyme/branchialarch-1/cranial-neural-crest-cells
106 LifeMap Discovery. Cardiac Neural

11 Pruszak J, Ludwig W, Blak A, Alavian K,

Isacson O. CD15, CD24, and CD29 define a surface biomarker code for neural lineage differentiation of stem cells. Stem Cells 27(12), 29282940 (2009).
12 Elms P, Siggers P, Napper D, Greenfield A,

of structures associated with the cerebrospinal fluid in man and other species. PartI: theventricular system, meninges and choroid plexuses. Arch. Anat. Cytol. Pathol. 46(3), 153169 (1998).
23 McGowan KM, Coulombe PA. Onset of

CrestCells. http://discovery.lifemapsc.com/in-vivodevelopment/neural-crest/cardiac-neuralcrest/cardiac-neural-crest-cells
107 LifeMap Discovery. Maxillary Process.

Arkell R. Zic2 is required for neural crest formation and hindbrain patterning during mouse development. Dev. Biol. 264(2), 391406 (2003).

keratin17 expression coincides with the definition of major epithelial lineages during skin development. J.Cell Biol. 143(2), 469486 (1998).

http://discovery.lifemapsc.com/in-vivodevelopment/bone/maxillary-process
108 LifeMap Discovery. Mandibular Process.

http://discovery.lifemapsc.com/in-vivodevelopment/bone/mandibular-process

66

Regen. Med. (2014) 9 (1)

future science group