Sequence determination o f the 3' end o f mouse mammary tumor virus R N A

R. Klemenz*, M. Reinhardt & H. Diggelmann**

Swiss Institute for Experimental Cancer Research, 1066 Epalinges, Switzerland

Abstract
70S R N A has been prepared from mouse m a m m a r y t u m o r virus ( M M T V ) produced by the G R t u m o r cell line. After denaturation for 3 min at 60 ~ the RNA was applied to a sucrose gradient and molecules sedimenting between 10-16S were selected and passed over an oligo-dT cellulose column. The poly A containing R N A fraction was used as a template for the synthesis of complementary D N A with reverse transcriptase in the presence of dideoxynucleoside triphosphates. Oligo-nucleotides p(dT)7rG, p(dT)7rA and (p(dT)7rC were tested for their primer activity. Two of the three primers gave readable sequences. This suggests a heterogeneity in the 3' end of the viral RNA, a phenomenon also observed with avian retroviruses. Nucleotides 37-45 from the 3' end are made up of only A's and T's and resemble a Hogness box. This finding could have biological consequences for the transcription of proviral D N A in the unintegrated and integrated state. Instead of the usual A A U A A A sequence present in m R N A ' s close and in front of the site of polyadenylation we find a sequence A G U A A A .

Introduction
Several variants of mouse m a m m a r y t u m o r viruses ( M M T V ) have been isolated from the milk or from m a m m a r y tumors of different inbred strains of mice (for review see 1). These so-called exogenous M M T V ' s are horizo'ntally transmitted and generally cause early m a m m a r y carcinomas, some of which are hormone dependent. In addition integrated M M T V proviral D N A is present in all examined inbred strains of mice (endogenous form of M M T V ) and is transmitted to the offspring as a stable genetic element (2-7). Some of these genetically transmitted endogenous proviral sequences seem to be biologically inactive, while some others seem to be responsible for slowly growing, hormone independent tumors appearing * Present address: Department of Biology, University of California San Diego, La Jolla, CA 92093, USA. ** To whom reprint requests should be addressed.

late in life (8-10). Different M M T V RNA's and endogenous and exogenous proviral D N A ' s have been compared by cross-hybridization studies (4, 11, 12) and by restriction enzyme analysis (13-15) and were shown to be very similar, but not identical. Only sequence analysis of the relevant regions of the various viral genomes will allow to decide if the different biological behaviour can be accounted for by subtle sequence differences within the viral genomes or has to be attributed to other parameters as e.g. the site of integration of viral DNA's or the nature and biological state of the host cell. In the experiments presented in this report we determined the nucleotide sequence of the 3' end of GR-MMTV-RNA.

Materials and methods

M M T V was collected from the culture fluid of

Molec. Biol. Rep. 7, 123-126 (1981). 0301-4851/81/0072 0123 $0.80. 9 Dr W. Junk Publishers, The Hague. Printed in The Netherlands.

124 GR-cells, a mouse m a m m a r y t u m o r cell line obtained from K. Yamamoto. G R - M M T V R N A was essentially purified as described previously (7). 70S viral RNA was first obtained by sucrose gradient sedimentation of total viral RNA. The 70S R N A was heated for 3 min at 60 oC and reapplied to a sucrose gradient. RNA sedimenting between 10S16S was pooled, precipitated with ethanol and passed over an oligo-(dT) cellulose column. Polyadenylated R N A was eluted and used as a template for the synthesis of complementary DNA. As primers for the reverse transcriptase reaction we used the commercially available oligonucleotides p(dT)7rG, p(dT)7rA and p(dT)7rC from P.L. Biochemicals. The synthesis of radioactive c D N A was performed in the presence of dideoxynucleoside triphosphates as described by Sanger et al. (16) and using reverse transcriptase, as a polymerase. A reaction mixture generally contained 50 ng of template RNA, 30 ng of one of the primers, 2.5 units of reverse transcriptase, 3 #Ci of one 32p_ deoxynucleoside triphosphate (400 Ci/mmole), unlabelled deoxynucleoside triphosphates at 5-10 #M and dideoxynucleoside triphosphates at 3-10 # M final concentration. The ratio of ddXTP's and d X T P ' s was adjusted for each pair of triphosphates and varied according to the desired length of the c D N A fragments. Actinomycin D (50/~g/ml) was added to the reaction mixture to prevent the synthe.sis of double stranded cDNA. The c D N A molecules terminated by the four dideoxynucleoside triphosphates were separated by electrophoresis in 0.5 m m thin polyacrylamide sequencing gels of 40 cm length. the viral RNA, while the third primer led to the synthesis of e D N A fragments initiated at multiple sites. The two sequencing ladders obtained with p(dT)7rA and p(dT)7rG were clearly related and displaced by three nucleotides. This result can be most easily explained by a heterogeneity in the 3' end of the viral RNA preparation used for these experiments. Such a heterogeneity has first been described for the 3' end of avian myeloblastosis virus RNA (17). This phenomenon could reflect a heterogeneity in the viral genome population or could be created during the transcription or processing of viral RNA coming from a unique genome. We did not follow up this question any further. Using three different concentrations of dideoxynucleoside triphosphates, 80 nucleotides of sequence could be determined and nucleotides G, C and T were readable over twicethis length. However the fragments terminated with d d A T P resolved into sharp bands only up to 70-80 bases and then started to smear. The reason for this behaviour was unclear. To determine the last few nucleotides of the viral RNA at the 3' end, e D N A synthesis was performed using p(dT)7rA as primer in the presence of each of the possible radioactive deoxynucleoside triphosphates and each dideoxynucleoside triphosphate at rather high concentration to accumulate short chains. Kinase labelled primer was used as a size marker on the gel. The shortest possible fragment of e D N A that was detected was labelled with 32p_ d G T P and terminated with d d T T P (see Fig. 1). This fragment migrated as decanucleotide. All other radioactive deoxynucleoside triphosphates led to the synthesis of longer fragments. Figure I shows the result of the sequencing experiments. Several interesting features can be recognized: - Nucleotides -37 to -45 are made up of only T's and A's and resemble the sequence T A T A A A T A which is generally found as such or in some varied form to precede transcription initiation sites by about'25 nucleotides. This site found at the 3' end of the viral R N A is duplicated during reserve transcription and is therefore present on both sides of the integrated viral genome (Fig. 2) within the large terminal repeat (LTR, see arrows in Fig. 2). The presence of a potential p r o m o t o r site in the righthand L T R opens the possibility for a transcript starting with 130-150 nucleotides of viral sequences and extending into host cell sequences. It is ex-

Results

When the three oligonucleotides p(dT)7rG, p(dT)7rA p(dT)7rC were tested for their priming activity with poly A containing 3' viral R N A fragments as template it became clear that p(dT)7rA and p(dT)7rG both resulted in c D N A products with readable sequences, while the counts incorporated in the presence of p(dT)7rC were spread out over the whole length of the track of the sequencing gel without a visible ladder of fragments. It seemed therefore that with two primers e D N A synthesis started at unique sites, considering the nature of the primers, most likely at the 3'end of

125
-70 -60 -50 -40 -30 -20 -10

RNA ~',, A C U G U U A U G U A A A U G U U A U G U A A A C A U A A U A U A A A A G A G U G C U G A U U U U U U G A G U A A A U U G A A C A G A U A A A A A A A A A '

,I

,RNA ~'

CDNA 3~'TAGGTT~AGAATACATTTACGAATACATTTGGTATTATATTTT~TCACGACTAAAAAACT~ATTTGAA~GTTGTCGTG~TTTTTT~ CDNA 5 '

VIRAL DNA

51,,, ATCCAAGT T'TGTA~ AA GCTTATGTAAACCATAATATAAAAGAGTGCTGATTTTTTGAGTAAACTTGCAACAGCACT,,,3 j INTEGRATED

3~TAGG~TCA~AATA~A~TA~GAATA~ATTTGG~AT~ATATTT~CT~ACGACTAAAAAACTCAT~TGAA~G~G~GTGA~'5~

-70

-60

a IT
-50 40
w AT-RICH SEQUENCE

-30

-20

-i0

POSSIBLE TRANSCRIPTS

Fig. 1. Nucleotide sequence of the 3' end of GR-M MTV viral RNA. The two top lines show the cDNA sequence determined and the viral RNA sequence deduced from it. The bottom two lines show the corresponding region on the double stranded DNA.

pected t h a t such t r a n s c r i p t s c o u l d be detected using as r a d i o a c t i v e p r o b e so-called s t r o n g stop viral D N A c o m p l e m e n t a r y to the 5 ' ~ 1 3 0 n u c l e o t i d e s o f the viral R N A . E x p e r i m e n t s to detect such transcripts will be a t t e m p t e d . N u c l e o t i d e s -15 to -20 are m a d e up of the sequence A G U A A A , a v a r i a t i o n of the usual sequence A A U A A A which generally precedes the sites o f p o l y a d e n y l a t i o n (18) b y a b o u t 20 nucleotides. A n o t h e r v a r i a t i o n of this sequence A U U A A A
-

has recently been f o u n d in the m o u s e p a n c r e a t i c a l p h a - a m y l a s e m R N A (19). W i t h i n the sequence p r e s e n t e d in F i g u r e l term i n a t i o n c o d o n s are present in all r e a d i n g frames, In one r e a d i n g f r a m e h o w e v e r the nucleotides - 7 9 to - 4 7 are o p e n for the synthesis o f a p e p t i d e o f at least l l a m i n o acids. Since no sequence inform a t i o n is available further u p s t r e a m on the m R N A , it is n o t clear if this o l i g o p e p t i d e c o r r e s p o n d s to the C - t e r m i n a l end of a larger h y p o t h e t i c a l peptide.

HOST DNA

LTR
INTEGRATED MMTV DNA

LTR
HOST DNA 3'~5'

~ 5'

POTENTIAL VIRAL-HOST TRANSCRIPT

C:1
51

~.

3~

v RNA c D N A in vitro initiated

I--} .
5'

3"~ 3'

rn R N A

tokb 4.4kb

.... -- m RNA
S'

Fig. 2. Schematic diagram of the integrated M MTV genome. The position of the AT-rich sequence close to potential initiation sites for transcription is marked with an arrow, The known viral transcripts are shown as solid lines (20).

126 Recently we were able to compare the sequence presented here with the DNA sequence of the corresponding region on the LTR of C3H MMTV (John Majors, personal communication). The two viruses show almost complete homology within the sequence reported. It is particularly noteworthy that J. Majors also found A G T A A A instead of the normal sequence AATAAA preceding the site of polyadenylation. ]'his sequence might be characteristic for MMTV mRNA. Since this work has been completed we have cloned circular unintegrated G R - M M T V DNA in bacteriophage lambda and we are currently pursuing the sequencing studies on cloned DNA fragments. The sequence of the viral RNA determined here will help us to align the sequence obtained from the cloned DNA.
2. Varmus, H. E., Bishop, J. M., Nowinski, R. C. & Sarkar, N. H., 1972. Nature (London) New Biol. 238: 189-191. 3. Parks, W. P. & Scolnick, E. M., 1973. Virology 55:163 173. 4. Michalides, R. & Schlom, J., 1975. Proc. Natl. Acad. Sci. U.S.A. 72: 4635-4639. 5. Morris, V. L., Medeiros, E., Ringold, G. M., Bishop, J. M. & Varmus, H. E., 1977. J. Mol. Biol. 114:73 91. 6. Cohen, J. C. & Varmus, H. E., 1979. Nature (London) 278: 418-423. 7. Groner, B. & Hynes, N., 1980. J. Virol. 33: 1013-1025. 8. Bentvelzen, P., 1974. Biochim. Biophys. Acta 355:236 259. 9. Nandi, S. & McGrath, C. M., 1973. Adv. Cancer Res. 17: 353-414. I0. Moore, D. H., 1975. In: F. F. Becker (ed.): Cancer, a comprehensive treatise Vol. 2, Plenum Publishing Corp., New York, pp. 131 167. 11. Friedrich, R., Morris, V. L., Goodman, H. M., Bishop, J. M. and Varmus, H. E., 1976. Virology 72: 330-340. 12. Ringold, G. M., Blair, P. B., Bishop, J. M. & Varmus, H. E,, 1976. Virology 70: 550-553. 13. Shank, P. R., Cohen, J. C., Varmus, H. E., Yamamoto, K. R. & Ringold, G. M., 1978. Proc. Nat. Acad. Sci. U.S.A. 75: 2112-2116. 14. Cohen, J. C., Shank, P. R., Morris, V. L., Cardiff, R. & Varmus, H. E., 1979. Cell 16: 333-345. 15. Cohen, J. C., Majors, J. E. & Varmus, H. E., 1979. J. Virol. 32: 483-496. 16. Sanger, F., Nicklen, S. & Coulson, A. R., 1977. Proc. Natl. Acad. Sci U.S.A. 74:5463 5467. 17. Stoll, E., Billeter, M. A., Palmenberg, A. & Weissmann, C., 1977. Cell 12: 57-72. 18. Proudfoot, N. & Brownlee, G. G., 1976. Nature 263: 211-214. 19. Hagenbiichle, O., Bovey, R. & Young, R. A., 1980. Cell 21: 179-187. 20. Groner, B., Hynes, N. E. & Diggelmann H., 1979. J. Virol. 30:417-420.

Acknowledgements
We thank J. Beard for the avian myeloblastosis virus reverse transcriptase. We are very grateful to John Majors for making his sequencing data of C 3 H - M M T V - D N A available to us. This work was supported by grant 3.273-078 SR from the Swiss National Science Foundation.

References
1. Bentvelzen, P. & Hilgers, J., 1980. In: G. Klein (ed.) Viral Oncology, Raven Press, New York, pp. 311-356.