Anda di halaman 1dari 37

UNIVERSIDADE DO OESTE DE SANTA CATARINA CAMPUS DE SO MIGUEL DO OESTE REA DAS CINCIAS BIOLGICAS E DA SADE CURSO DE CINCIAS BIOLGICAS

MARCELI KAEFER

DETECO DO CROMOSSOMO Y EM DNA FETAL DO PLASMA MATERNO HUMANO

So Miguel do Oeste 2009

MARCELI KAEFER

DETECO DO CROMOSSOMO Y EM DNA FETAL DO PLASMA MATERNO HUMANO

Trabalho de Concluso de Curso, apresentado ao Curso de Cincias Biolgicas nfase em Biotecnologia, da Universidade do Oeste de Santa Catarina, como requisito parcial para obteno do grau de Bacharel em Cincias Biolgicas.

Orientador: Prof. Dr. Alexis Trott

So Miguel do Oeste 2009

MARCELI KAEFER

DETECO DO CROMOSSOMO Y EM DNA FETAL DO PLASMA MATERNO HUMANO

Trabalho de Concluso de Curso apresentado ao Curso de Cincias Biolgicas nfase em Biotecnologia da Universidade do Oeste de Santa Catarina como requisito parcial para a obteno do grau de Bacharel em Cincias Biolgicas.

Aprovada em

BANCA EXAMINADORA _____________________________________ Prof. Dr. Adriano Dias de Oliveira Universidade do Oeste de Santa Catarina Nota atribuda: _____________________________________ Prof. Dr. Alexis Trott Universidade do Oeste de Santa Catarina Nota atribuda: _____________________________________ Prof. Dr. Gustavo Borba de Miranda Universidade do Oeste de Santa Catarina Nota atribuda:

Dedico este trabalho a meus pais, e ao meu noivo Cristiano, fonte de minha fora. Graas a eles, me tornei capaz de lutar para que meus sonhos e objetivos fossem sempre alcanados.

AGRADECIMENTOS

Agradeo em especial, ao meu orientador Professor Dr. Alexis Trott, pelo apoio na orientao e desenvolvimento deste trabalho, compartilhando seus conhecimentos e suas experincias. A Professora Eliandra M. Rossi, Dbora Oro e Diane Scapin, pelo auxlio durante a realizao do trabalho em laboratrio, e pelas coletas de sangue das gestantes. As gestantes que participaram voluntariamente, colaborando com o desenvolvimento deste estudo. A minha famlia pela ajuda e compreenso em todos os momentos. Meus pais Vunibaldo e Hildigard, e minhas irms Ivete e Janete. Agradeo ao meu noivo Cristiano, pelo carinho e apoio incondicional, e por estar sempre ao meu lado. Aos Professores, por todo conhecimento repassado, e por estarem sempre dispostos a nos ajudar. Aos amigos especiais, que se provaram verdadeiros ao longo destes quatro anos de convivncia. A todos que, de uma forma ou de outra, colaboraram para que este trabalho fosse realizado com xito.

So fteis e cheias de erros as cincias que no nasceram da experimentao, me de todo conhecimento. (Leonardo da Vinci)

RESUMO

A identificao do sexo do beb comumente realizada por tcnicas j consagradas como o ultra-som morfolgico, que geralmente ocorre a partir da 14 semana gestacional. Porm, outra tcnica de sexagem fetal permite a identificao do sexo do beb a partir da 7 semana de gravidez. Isso possvel atravs de tcnicas moleculares que permitem a deteco do cromossomo Y identificando o sexo do feto com poucas semanas de gestao. Para essa anlise necessrio o isolamento do DNA fetal presente no plasma materno, realizvel devido a fatores genticos como a passagem de clulas fetais para o sangue da me. Como no possvel separar o DNA fetal do DNA materno esse diagnstico s possvel se o gentipo do feto e da me for diferente, j que diferem quanto presena do cromossomo Y. Para essa investigao, so utilizados primers que amplificam regies especificas do cromossomo Y, como o caso dos genes SRY e DYS14, atravs da tcnica da Reao em Cadeia da Polimerase (PCR). O objetivo deste trabalho foi estabelecer a tcnica de amplificao do gene SRY, e identificar o sexo fetal pela tcnica da PCR, atravs da identificao do cromossomo Y presente no DNA livre do plasma materno humano em mulheres com gestao a partir de sete semanas. A amplificao foi realizada atravs de PCR usando os primers SRY1 e SRY2 que amplificam uma regio especfica do gene SRY do cromossomo Y. Os produtos da reao foram analisados em gel de agarose 1,5% e visualizados em transluminador UV. No total foram realizados 21 testes, com trs resultados masculinos e 18 femininos, sendo que estes resultados foram comparados com o ultra-som e/ou nascimento, alm de uma prvia anlise com o gene DYS14 em todas as amostras. Os resultados demonstraram que o gene SRY no indicado para identificao do sexo fetal pela anlise de DNA do plasma materno, devido aos resultados insatisfatrios, por ele se apresentar em cpia nica, causando baixo ndice de acerto. Palavras-chave: DNA fetal, Gene SRY, Sexagem Fetal, PCR.

ABSTRACT

The identification the sex of the baby is usually performed by techniques already devoted as the ultrasound morphology that usually happen from the 14th week of gestation. However, another technique of sexing fetal allows the identification the sex of the baby from the 7th week of pregnancy. This is possible by molecular techniques that allow the detection of the chromosome Y to identify the sex of the fetus with a few weeks of pregnancy. For this analysis is necessary the isolation of DNA fetal present in maternal plasma, realizable due the genetic factors as the passage of fetal cells into the blood of the mother. As it is not possible to separate the DNA fetal of the DNA maternal that diagnostic only is possible if the genotype of the fetus and the mother is different, since they differ for the presence of chromosome Y. For this investigation, are used primers that amplify specific regions of the Y chromosome, as is the case of gene SRY and DYS14.Through the technique of Polymerase Chain Reaction (PCR). The objective of this study was to establish the technique of amplifying the gene SRY, and identify the sex fetal by PCR, through of the identification of the chromosome Y present in DNA free of the plasma maternal in women with human pregnancy from seven weeks. The amplification was performed by PCR using primers SRY1 and SRY2 that amplify a specific region of the gene SRY on chromosome Y. The reaction products were analyzed on agarose gel 1.5% and visualized in transluminator UV. In all were performed 21 tests, with three results male and 18 female, and those results were compared with ultrasound and/or birth, and a previous analysis of the gene DYS14 in all samples. The results showed that the SRY gene is not indicated for fetal sex identification by DNA analysis from maternal plasma, due to unsatisfactory results, for it is present in single copy, causing low accuracy.

Key words: fetal DNA, Gene SRY, fetal sexing, PCR.

LISTA DE ILUSTRAES

Esquema 1. Etapas da PCR para amplificao do gene SRY........................................................18 Fotografia 1. Visualizao dos resultados em gel de agarose........................................................21

LISTA DE TABELAS

Tabela 1. Primers usados para amplificao do gene SRY...........................................................17 Tabela 2. Comparao entre resultados do sexo fetal usando o gene SRY, DYS14 e ultra-som..19

SUMRIO

1 INTRODUO .........................................................................................................................11 1.1 GENE SRY..............................................................................................................................12 1.2 REAO EM CADEIA DA POLIMERASE PCR .............................................................13 2 OBJETIVOS..............................................................................................................................14 2.1 GERAL....................................................................................................................................14 2.2 ESPECFICOS ........................................................................................................................14 3 MATERIAL E MTODOS......................................................................................................15 3.1 POPULAO DE ESTUDO ..................................................................................................15 3.2 COLETA DAS AMOSTRAS..................................................................................................15 3.3 EXTRAO DE DNA ...........................................................................................................15 3.4 REAO EM CADEIA DA POLIMERASE - PCR..............................................................16 3.7 ANLISE POR ELETROFORESE EM GEL DE AGAROSE ..............................................17 4 RESULTADOS E DISCUSSO ..............................................................................................18 5 CONCLUSO ...........................................................................................................................22 REFERNCIAS ..........................................................................................................................23 APNDICES ................................................................................................................................25 APNDICE A Centrfuga DONNER CD100 3500rpm..........................................................26 APNDICE B Banho-maria CIENTEC. ....................................................................................27 APNDICE C Centrifuga HSIANGTAI 14000rpm. ..............................................................28 APNDICE D Termociclador biocycler mj25...........................................................................29 APNDICE E Cuba eletrofortica .............................................................................................30 APNDICE F Transluminador UV............................................................................................31 APNDICE G Amostras de DNA..............................................................................................32 APNDICE H Amostra de plasma sanguneo ...........................................................................33 ANEXOS ......................................................................................................................................34 ANEXO A - Termo de consentimento ps- informao ...............................................................35 ANEXO B - Sequncia do gene SRY (5- 3)...............................................................................36

11

INTRODUO

A curiosidade dos futuros pais em saber se o beb ser menino ou menina pode ser amenizada atravs de um mtodo simples e prtico de sexagem fetal pela Reao em Cadeia da Polimerase (PCR). Essa tcnica permite a deteco do cromossomo Y, identificando o sexo do feto com poucas semanas de gestao, antes mesmo dos resultados do ultra-som morfolgico, no qual identificado somente a partir da 14 semana gestacional. Segundo SCHUPP (2001), a determinao precoce do sexo fetal tem grande importncia clnica nos casos de histria familiar de doenas ligadas ao cromossomo X, como hemofilia e distrofia muscular de Duchenne. As tcnicas convencionais como a amniocentese e bipsia de vilo corinico, que permitem essa identificao, so tcnicas invasivas que, segundo Malta et al. (2008), apresentam riscos significativos para o beb, no sendo recomendadas para determinao do sexo fetal. Tcnicas no-invasivas como o ultra-som so amplamente utilizadas e no apresentam risco de perda do feto. A ultra-sonografia tem o potencial de melhorar o prognstico da paciente, mas tambm pode ser deletria ao estimular intervenes mdicas desnecessrias, criando ansiedade, causada por diagnsticos falso-positivos e dando um falso senso de segurana a mulheres com gestaes anormais, que podem perder a oportunidade de realizar outros exames devido a uma ultrasonografia considerada normal (RUMACK et al. 2006). As tcnicas de biologia molecular identificam o sexo do beb atravs da presena de sequncias do cromossomo Y no DNA livre fetal. Isso se deve a fatores genticos como a passagem de clulas fetais para o sangue materno. Essas sequncias so analisadas atravs da Reao em Cadeia da Polimerase (PCR). Em 1997, foi descrito, pela primeira vez, a presena de DNA fetal no plasma e soro maternos por LO et al. (1997). Ironicamente, o plasma um material rotineiramente descartado nas fases iniciais de muitos protocolos de extrao de DNA, e tambm aps a densidade centrifugao, passo utilizado por muitos pesquisadores para o diagnstico pr-natal no invasivo. Esta provavelmente uma das razes pelo qual a presena de DNA fetal em plasma materno no tenha sido explorada anteriormente (LO et al. 1997). Nesse contexto, tcnicas no invasivas de amostragem de clulas fetais tm sido intensamente pesquisadas h muitas dcadas (LEVI et al. 2003). Para a determinao do sexo do beb, necessrio o isolamento do DNA fetal presente no plasma materno. Conforme Levi et al. (2003), esse procedimento fcil, barato e permite o

12

processamento simultneo de muitas amostras, alm da superioridade prtica do DNA fetal plasmtico, que compe 3-4% do DNA total, em relao s preparaes de clulas fetais isoladas do sangue materno, compondo cerca de 1:100.000 clulas maternas. Como no possvel separar o DNA fetal do DNA materno igualmente presente no plasma, o diagnstico do gentipo s possvel quando este for diferente do materno. No caso especfico de sexagem fetal, no h necessidade do conhecimento do gentipo materno, j que obviamente me e filho diferem quanto a presena do cromossomo Y (LEVI et al. 2003). O gene que determina o sexo masculino est presente no cromossomo Y. Portanto, para essa investigao, so utilizados primers (oligonucleotdios iniciadores), que amplificam regies especficas do cromossomo Y, como o caso dos genes SRY e DYS-14. O gentipo masculino ou feminino determinado pela presena ou ausncia do cromossomo Y, respectivamente. Logo, quando houver amplificao do gene SRY e/ou DYS-14, ou seja, presena do cromossomo Y, significa que o beb menino, e quando no houver amplificao, ser menina. Em caso de gmeos idnticos, univitelinos, o resultado valido para ambos os bebs. Para gmeos no idnticos, se o resultado do exame for menino significa que ao menos um deles menino, no sendo possvel determinar se o outro beb um menino ou menina. Se o resultado for menina, indica que ambos os bebs so meninas (KLEIN, 2007).

1.1 GENE SRY

O gene SRY (Sex Determining Region in chromosome Y) o gene determinante do sexo do cromossomo Y, sendo a sua presena o fator fundamental na ativao da diferenciao sexual masculina no embrio. O gene SRY humano est localizado prximo a regio pseudoautossomal do brao curto do cromossomo Y. constitudo por um xon nico e codifica uma protena de 204 aminocidos. A protena SRY possui domnio central de ligao ao DNA denominado HGM Box, homlogo ao ncleo de ligao das protenas nucleares da alta mobilidade (DOMENICE et al. 2002). Como afirmam Domenice et al. (2002), a presena do cromossomo Y reconhecida como fator determinante do desenvolvimento gonadal masculino em humanos desde a dcada de 50, quando se iniciaram estudos sobre alteraes cromossmicas. A identificao do gene SRY,

13

no inicio da dcada de 90, permitiu o esclarecimento de uma importante etapa no processo de determinao da gnada embrionria masculina. Atualmente, o gene mais indicado pela literatura para sexagem fetal atravs de plasma materno o gene DYS-14. Sabe-se que este gene possui mltiplas cpias no cromossomo Y, apresentando-se superior quanto sensibilidade de identificao do cromossomo Y. Enquanto isso, o gene SRY apresenta-se em cpia nica no cromossomo Y, oferecendo maior dificuldade de amplificao.

1.2 REAO EM CADEIA DA POLIMERASE PCR

Em 1977, tcnicas de seqenciamento permitiram a identificao de alteraes especficas na seqncia de DNA e a associao destas com diferentes doenas genticas. Depois disso, o principal marco no desenvolvimento das tcnicas de diagnstico molecular foi a tcnica da reao em cadeia da polimerase (PCR), um mtodo de clonagem in vitro proposto por Kary Mullis em 1987 (MOLINA e TOBO, 2004). A Reao em cadeia da Polimerase (PCR) um mtodo poderoso para a biologia molecular, com inmeras aplicaes como o diagnostico de doenas, deteco de mutaes em genes, elucidao de relaes evolutivas entre espcies, diagnstico pr-natal, entre outros. A tecnologia da PCR bastante empregada por ser de fcil realizao, baixo custo e principalmente por ter alta sensibilidade, possibilitando a deteco de pequenas quantidades de DNA fetal no plasma materno humano. Esse mtodo consiste em fazer milhares de cpias da sequncia de DNA de interesse in vitro, usando elementos bsicos que participam do processo natural de replicao do DNA. Geralmente, uma reao de amplificao contm o DNA com a sequncia alvo a ser amplificada, uma DNA-polimerase termoestvel, dois oligonucleotdeos iniciadores, desoxirribonucleotdeos (dNTPs), tampo de reao e concentrao adequada de MgCl2. Os componentes da reao so misturados e a amostra colocada em um termociclador (aparelho que possibilita o aquecimento e resfriamento rpido das amostras) (ZAHA et al. 2003).

14

OBJETIVOS

2.1 GERAL

Identificar o sexo fetal por amplificao do gene SRY, cromossomo Y, presente no DNA livre do plasma materno humano.

2.2 ESPECFICOS

Estabelecer a tcnica de amplificao do gene SRY, cromossomo Y; Identificar o sexo dos bebs em mulheres com gestao a partir de sete semanas; Comparar os resultados obtidos pelo gene SRY com os resultados previamente obtidos em anlise com o gene DYS-14.

15

MATERIAL E MTODOS

3.1 POPULAO DE ESTUDO

Foram estudadas 21 mulheres grvidas com perodo gestacional entre 9 e 32 semanas. As pacientes interessadas em realizar o estudo assinaram o Termo de Consentimento Livre e Esclarecido (ANEXO A), contendo informaes sobre o teste a ser efetuado. Aps assinar o Termo de Consentimento Livre e Esclarecido, as pacientes eram encaminhadas ao ambulatrio da Universidade do Oeste de Santa Catarina UNOESC, Campus de So Miguel do Oeste, para realizar a coleta das amostras sanguneas, posteriormente enviadas ao Laboratrio de Biologia Molecular da mesma Universidade para realizar a extrao do DNA.

3.2 COLETA DAS AMOSTRAS

Foram coletadas amostras de 5 a 10 mL de sangue perifrico de cada gestante, devidamente identificadas e acondicionadas em tubos de vidro de 5 mL contendo 0,054 mL de EDTA (anti-coagulante sanguneo). Aps a coleta, realizou-se a extrao de DNA do plasma materno.

3.3 EXTRAO DE DNA

A extrao de DNA foi realizada de acordo com o protocolo adaptado da tcnica de LO et al. (1997), apresentando os seguintes passos: Os tubos contendo as amostras sanguneas foram centrifugados a 3500rpm por 20 minutos para separar o plasma; O sobrenadante (plasma) foi retirado e transferido para tubos cnicos de 1,5 mL. O plasma foi submetido ao banho-maria por 20 minutos 90C;

16

Aps o banho-maria, retirou-se o sobrenadante resultante transferindo-os para tubos cnicos de 1,5 mL e realizada nova centrifugao na microcentrfuga a 14000 rpm por 20 minutos, ou at clarear a amostra; Posteriormente, retirou-se o sobrenadante, descartando-se o pellet e armazenando a amostra a -20C.

3.4 REAO EM CADEIA DA POLIMERASE - PCR

Para preparao da soluo Master para PCR foi necessrio a utilizao de enzima Taq polimerase, soluo tampo (contendo MgCl2), dNTP, DMSO, primers (SRY1 e SRY2), gua ultra-pura para PCR (Tabela 2) e DNA de interesse das gestantes. Foram utilizados tambm, DNA do sexo masculino para o controle positivo e DNA do sexo feminino para o controle negativo. Para amplificao do gene SRY foram utilizados primers especficos (Tabela 1) que amplificam um fragmento de 270 pares de bases da sequncia cpia nica e especfica do cromossomo Y (ANEXO B), atravs da tcnica da PCR.

Tabela 1. Primers usados para amplificao do gene SRY. Gene SRY Primers e sequncia SRY 1 SRY 2 5' CAGTGTGAAACGGGAGAAAACAGT 3' 5- CTTCCGACGAGGTCGATACTTATA - 3

Fonte: KIM et al. (2006)

Aps a preparao do Mix para PCR, os tubos cnicos contendo os reagentes e a sequncia alvo a ser amplificada, foram levados ao termociclador para a amplificao do gene SRY, cromossomo Y. Foram realizados 45 ciclos de amplificao, conforme o esquema 1.

17

94C 5 min

94C 1 min Anelamento 53C 1 min Extenso 72C 1 min 72C 5 min

Extenso Final 4C 1 etapa 2 etapa 45 ciclos 3 etapa 4 etapa

Esquema 1. Etapas da PCR para amplificao do gene SRY. Fonte: a autora (2009).

Aps a amplificao atravs da PCR, os tubos cnicos contendo as amostras amplificadas foram armazenados a -20C at o momento da anlise. Em seguida, realizou-se a anlise do produto das reaes por eletroforese horizontal em gel de agarose, e visualizados em transluminador.

3.7 ANLISE POR ELETROFORESE EM GEL DE AGAROSE

O produto das reaes de amplificao foi analisado por eletroforese em gel de agarose concentrado 1,5%, corado por brometo de etdio, um composto fluorescente, que se integra aos nucleotdeos do DNA, permitindo a visualizao dos fragmentos em transluminador UV. Como marcador de tamanho molecular, foi usado marcador de 100 pares de base.

18

RESULTADOS E DISCUSSO

Os exames de sexo fetal do plasma do sangue perifrico das 21 gestantes, analisados pelo gene SRY, foram avaliados previamente utilizando o gene DYS-14 primers Y5/Y6, sendo que 11 foram confirmados pelo ultra-som, apresentando cinco fetos do sexo masculino e seis do sexo feminino. A anlise com o gene DYS-14, apresentou 10 resultados masculinos e 11 femininos (Tabela 3).

Tabela 2. Comparao entre resultados do sexo fetal usando o gene SRY, DYS-14 e ultra-som. Cd. Gestante
MS01 MS02 MS03 MS04 MS05 MS06 MS07 MS08 MS09 MS10 MS11 MS12 MS13 MS14 MS15 MS16 MS17 MS18 MS19 MS20 MS21

Perodo gestacional (semanas)


16 17 31 15 11 15 23 27 10 15 25 16 28 09 14 09 20 11 32 09 16

SRY
Fem Fem Masc Fem Fem Fem Masc Fem Fem Masc Fem Fem Fem Fem Fem Fem Fem Fem Fem Fem Fem

Sexo fetal DYS-14


Fem Fem Masc Fem Fem Fem Masc Fem Masc Masc Masc Masc Masc Masc Masc Fem Fem Fem Fem Fem Masc

Ultra-som
Fem Fem Masc Fem Fem x Masc Fem x Masc Masc x x x x x x x Fem x Masc

Fonte: a autora (2009).

Os resultados obtidos com SRY totalizam 66,6% de acerto, comparando com os resultados obtidos com DYS-14. Dos 10 masculinos para DYS-14, apenas trs foram

19

confirmados por SRY, obtendo 30% de acerto. Portanto, 66,6% se devem principalmente aos resultados femininos. Todos os sete resultados errados, comparando SRY com DYS-14 (visto que estes foram confirmados com ultra-som) so falsos femininos para SRY, ou seja, este gene no recomendado para determinao do sexo fetal, pois vrios resultados masculinos no amplificaram com SRY. At o momento, dos 11 resultados confirmados por ultra-som, nove foram corretamente diagnosticados pelo SRY, sendo que os dois errados so falsos femininos. Nestes casos, o PCR apontou ausncia de amplificao (= sexo feminino), o qual se verificou gravidez do sexo masculino. Novamente, apresentando baixo nvel de confiana para sexagem com SRY. Sabe-se que a concentrao de DNA fetal no plasma materno aumenta conforme aumenta a idade gestacional, aumentando a confiabilidade dos resultados. No estudo de Levi et al. (2003), de 212 amostras coletadas, apenas trs tiveram resultado errado, todas coletadas de gestantes com menos de oito semanas. Todos os outros obtiveram 100% de acerto em idade gestacional acima de oito semanas. Entretanto, observamos que o perodo gestacional no apresentou influncia nos resultados do SRY, como nos casos MS11 e MS13 (Tabela 3) com 25 e 28 semanas, respectivamente, o SRY no foi capaz de amplificar o cromossomo Y, sendo que no caso da amostra MS10 com 15 semanas de gestao, essa amplificao foi possvel. Os resultados do PCR foram analisados em gel de agarose, sendo possvel visualizar uma banda com tamanho aproximado de 270pb, indicando menino. (fotografia 1).

20

10

Fotografia 1: Reao da PCR para fragmentos do cromossomo Y a partir de DNA isolado de plasma materno humano. Visualizao dos produtos da PCR para fragmentos de 270pb do gene SRY em gel de agarose 1,5% corado com brometo de etdio. Apenas as amostras 4, 7 e 9 apresentam uma banda amplificada indicando sexo masculino. Fonte: a autora (2009).

De acordo com a fotografia 1, pode-se observar que a flecha em sentido horizontal indica o controle positivo de 270pb. As flechas verticais mostram haver amplificao nas amostras de nmero 4, 7 e 9, indicando gravidez do sexo masculino, correspondente as amostras MS03, MS07 e MS10, respectivamente (Tabela 3). As outras amostras que no apresentam fragmento amplificado indicam resultados femininos, sendo que se verificou sexo masculino por anlise de DYS-14, confirmadas por ultra-som. O motivo pelo qual no se detectou o fragmento do cromossomo Y pelo SRY no plasma das sete gestantes que apresentavam fetos do sexo masculino ainda desconhecido. Uma possibilidade devida o fato de que esse gene se apresenta em cpia nica no cromossomo Y, dificultando sua amplificao. Esse fato foi demonstrado por Klintschar e colaboradores (2006), onde constataram que o gene DYS14 pode estar repetido at 60 vezes no cromossomo Y, o que o torna superior em relao ao locus cpia nica do gene SRY, em termos de sensibilidade.

21

Em um estudo de comparao entre ambos o genes DYS14 e SRY, Picchiassi et al (2008), comprovaram que DYS14 obteve eficincia de 97,9% e SRY 80%, concluindo que o gene DYS14 se mostra mais sensvel na amplificao do cromossomo Y. Martinhago e colaboradores (2006) tambm demonstraram alto ndice de acerto nos resultados obtidos com o gene DYS14, apresentando 97,2% quando o exame foi realizado a partir da 7 semana de gestao, aumentando a confiabilidade conforme aumenta a idade gestacional. Entretanto, muitos trabalhos ressaltam que esse mtodo de sexagem fetal ainda precisa ser bastante aprimorado para permitir seu uso rotineiro, diminuindo as chances de falsopositivo. Alm de satisfazer a curiosidade dos pais, o diagnstico pr-natal do sexo fetal abre caminhos para inmeros mtodos no invasivos para deteco de aneuploidias fetais, diminuindo os riscos de perda do feto com tcnicas invasivas.

22

CONCLUSO

Os resultados aqui obtidos demonstram que a tcnica de amplificao, usando o gene SRY, no foi eficiente na identificao do sexo fetal atravs do plasma materno, confirmando a baixa sensibilidade deste gene na deteco do cromossomo Y, como descrito na literatura. Dessa forma, se estabeleceu que o gene SRY no apresenta um bom ndice de confiabilidade para determinao do sexo fetal, provavelmente por se apresentar em cpia nica no cromossomo Y, quando comparados com DYS-14, por este se apresentar em mltiplas cpias.

23

REFERNCIAS

DOMENICE, S.; COSTA, EMF.; CORRA, RV.; MENDONA, BB. Determinao e Diferenciao Sexual. Arq Bras Endocrinol Metab. So Paulo, p. 433-443, Ago. 2002. INNIS, Michael A. et al. PCR Protocols: A Guide to Methods and Aplications. California: Academic Press, 1990. 482 p. KLEIN, Ana Paula. Sexagem fetal por anlise de DNA do plasma materno humano. 27 f. Trabalho de Concluso de Curso (Cincias Biolgicas) Universidade do Oeste de Santa Catarina, So Miguel do Oeste, 2008. KIM, HR; SHIN, JH; JUNG, WY; LEE, JN. Identification of Y-chromosome by Molecular analysis in Patients with Turner Syndrome. Korean J Lab Med. 2006; 26: 131-6. KLINTSCHAR M, et al. Fetal microchimerism in Hashimotos thyroiditis: a quantitative approach. European Journal of Endocrinology, 2006, v. 154, p. 237-241. LEVI, Jos Eduardo; WENDEL Silvano; TAKAOKA Deise Tihe. Determinao pr-natal do sexo fetal por meio da anlise de DNA no plasma materno. Revista Brasileira de Ginecologia e Obstetrcia, Rio de Janeiro: Rev & Med, 2003, v. 25, n. 9, p. 687 90. LO, YM et al. Prenatal sex determination by DNA amplification from maternal peripheral blood. The Lancet, Londres: Lancet Publications, 1989, v. 2, p. 1363-65 LO, YM; PATEL, P; SAMPIETRO, M; GILLMER, MDG; FLEMING, KA; WAINSCOAT, JS. Detection of single-copy fetal DNA sequence from maternal blood. The Lancet, Londres: Lancet Publications, 1990, v.335, p. 1463-4. LO, YM; CORBETTA, N; CHAMBERLAIN, PF; RAI, V; SARGENT, IL; REDMAN, CWG; WAINSCOAT, JSW. Presence of fetal DNA in maternal plasma and serum. The Lancet, Londres: Lancet Publications, 1997, v. 350 (9076), p. 485-7. MALTA, FSV; TORRES, PORB; FERREIRA, ACS & PARDINI, VC. Determinao do sexo do feto atravs de uma nova tcnica no invasiva baseada em PCR. RBAC, Minas Gerais. 2008, v. 40, p. 203-204.

24

MARTINHAGO, CD.; OLIVEIRA, RM.; CANAS, MCT.; VAGNINI, LD.; OLIVEIRA, JBA.; PETERSEN, CG.; FRANCO JUNIOR, JG.. Determinao precoce do sexo fatal pela anlise do DNA no plasma materno. Revista Brasileira de Ginecologia e Obstetrcia, Rio de Janeiro: Rev & Med, 2006, v. 28, n. 3, p. 190-4. PICCHIASSI, E.; COATA, G.; FANETTI, A.; CENTRA, M.; PENNACCHI, L.; DI RENZO, GC.. The best approach for early prediction of fetal gender by using free DNA from maternal plasma. Prenat. Diagn.., 2008, v. 28 (6), p. 525-30. RUMACK, CM; WILSON, SR; CHARBONEAU, JW. Tratado de ultra-sonografia diagnstica. 3 ed. So Paulo: Elsevier, 2006, v. 2, p. 2080. SCHUPP, TR; BRIZOT ML; TOYAMA J; SATO, L; WATANABE, L; MIYADAHIRA, S; ZUGAIB, M. Identificao Ultra-sonogrfica do Sexo Fetal entre a 11 e a 14 Semana de Gestao. RBGO. So Paulo, p. 247-251, 2001. STEELE, Mark W.; BREG JUNIOR, W. Roy. Chomossome analysis human amniotic-fluid cells. The Lancet, Londres: Lancet Publications , 1966, v.1(7434), p. 383-5. WALKNOWSKA, J; CONTE, FA; GRUMBACH, MM. Practical and theoretical implications of fetal-maternal lymphocyte transfer. The Lancet, Londres: Lancet Publications, 1969, v.1(7606), p.1119-22. ZAHA, A. et al. Biologia molecular bsica. 3 ed. Porto Alegre: Mercado aberto, 2003. p. 424.

25

APNDICES

26

APNDICE A Centrfuga DONNER CD100 3500rpm

Fotografia 1. Centrifuga usada na etapa de extrao de DNA. Fonte: a autora (2009).

27

APNDICE B Banho-maria CIENTEC.

Fotografia 2. Banho-maria utilizado na etapa de extrao de DNA Fonte: a autora (2009).

28

APNDICE C Micro centrfuga HSIANGTAI 14000rpm.

Fotografia 3. Micro centrfuga usada no processo de extrao de DNA. Fonte: a autora (2009).

29

APNDICE D Termociclador biocycler mj25

Fotografia 4. Termociclador utilizado para amplificao de DNA. Fonte: a autora (2009).

30

APNDICE E Cuba eletrofortica

Fotografia 5. Cuba de eletroforese usada no estudo. Fonte: a autora (2009).

31

APNDICE F Transluminador UV

Fotografia 6. Transluminador UV para visualizao dos fragmentos de DNA. Fonte: a autora (2009).

32

APNDICE G Amostras de DNA

Fotografia 7. Amostra de DNA amplificado gene SRY. Fonte: a autora (2009).

33

APNDICE H Amostra de plasma sanguneo

Fotografia 8. Amostra de plasma sanguneo obtido aps centrifugao do sangue. Fonte: a autora (2009).

34

ANEXOS

35

ANEXO A - Termo de consentimento ps- informao

O presente projeto de pesquisa, intitulado DETECO DO CROMOSSOMO Y EM DNA FETAL DO PLASMA MATERNO HUMANO, tem como objetivo avaliar um novo mtodo de determinao do sexo fetal pela anlise de DNA obtido do plasma materno. Para a participao no estudo, uma amostra de sangue perifrico (de 5 a 10 ml) ser colhida para posterior extrao de DNA. Os riscos e desconfortos causados pela coleta de sangue so semelhantes aos envolvidos na coleta realizada para exames laboratoriais de rotina. O material colhido ser utilizado nica e exclusivamente para fins do projeto de pesquisa, sendo garantido o sigilo das informaes obtidas. Fica garantido, tambm, a paciente ou familiares, o acesso a estas informaes a qualquer momento. Pesquisador responsvel pelo projeto: Dr. Alexis Trott (telefone: 49 3631-1042). Pelo presente, declaro que fui informado, de forma clara e detalhada, sobre o Projeto de Pesquisa em questo. Fui igualmente informado da garantia de receber resposta a qualquer pergunta ou esclarecimento a qualquer dvida relacionada pesquisa, da liberdade de no participar do estudo, da segurana do sigilo e o carter confidencial das informaes.

Nome da paciente: _________________________________________________ Nome do responsvel legal: __________________________________________ Assinatura do responsvel legal: ______________________________________ Assinatura do pesquisador:______ ____________________________________ Data: / /2009 Cdigo:

36

ANEXO B - Sequncia do gene SRY (5

3)

AGTGTAGCTTAACACTTCACTGAAACTGTTTTGAGTTCTTAGGTCATATTTTTTTTTCTC TAAACGAAACAATTACTTTTCTAAAAGTCAAATGTTAGCCATCCTAGAAGTTGGGCATAA AATACTTGTAAGTATATGCTAATATTCTGATACTTAATGCCTGTGAAAAATGTGTATAGA ATTTTCAATTTTTAAATAGAAGTGAAGAAAAAGCGATAATAATTACTATAAATTCAATAT GCAGTTATGTATGTATGTGTGTGGTTAAGACAATTAGGTTCTCATTAAGCTTTGTTTTTT TAAAGATAACATACACATATATTGATAATGATAAACAATTCATATAGCTTTTTGTGTCCT CTCGTTTTGTGACATAAAAGGTCAATGAAAAAATTGGCGATTAAGTCAAATTCGCATTTT TCAGGACAGCAGTAGAGCAGTCAGGGAGGCAGATCAGCAGGGCAAGTAGTCAACGTTACT GAATTACCATGTTTTGCTTGAGAATGAATACATTGTCAGGGTACTAGGGGGTAGGCTGGT TGGGCGGGGTTGAGGGGGTGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAAC GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG TTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTC CGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACG GGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATC GTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCA GAGATCAGCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCA TTCTTCCAGGAGGCACAGAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAG TATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAATTGCAGTTTGCTTCCCGCAGAT CCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGT ACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCA GCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGG GTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCA CTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCA TTTCAGTTTTACTGGTATTTCATTTTAAACTTAATTTCAAGACAAGTTGTGTCAACACGA TTAACATGCAAAGAAATAAGACATCCAGAAGTGAGCCTGCCTATGTTTGTGGCCGTCAGA GTACTAACTTGATACAAACGGACACTGTGGCTTACTTTAAATGCTCTAATGAGAAACACA CTTGAAAATTGTACCAAAAAAAATCACACTTCTATATGCAGCGTGTTAAGCAGTCCTCTC TAGACCGTGTATTCATTGGTCTTTCAGCTACTTTGTACGTGTCTATAAATTGCAGGTAAC TAAGGAATGGATATGTAAGCAGGATCAAACTTGTTTCTTTCTCTCCCCTTCACGCTGTGG AAAAAACCAGTTTTACCTCCACTTGCAATTCAGTTCCTTTACTCCATATAAATCCAAACG GTTGACATTTCCTTTCAACTAGTTATAAAATGCCTCTGGTAAAACAAAATATTTAATTCC TTGTCATTTTTGTATCTCTATGAAACTTATCATTTTGCCTTTCTTCTGAAAACTATCTTT TAAAATGGCAATCTACTTGTTTCCATGGCCTATTAACTTTTAAGCCTGTGGAATGAAAAA TACAG

Primers: SRY 1 SRY 2 5 CAGTGTGAAACGGGAGAAAACAGT 3 5 CTTCCGACGAGGTCGATACTTATA 3

As seqncias representadas em vermelho indicam as regies de anelamento dos primers SRY1 e SRY2, para a amplificao gnica especfica do gene SRY.