Anda di halaman 1dari 25

GENETICA MOLECULAR 2014 GUIA DE PROBLEMAS

BIBLIOTECAS Y TCNICAS DE HIBRIDACIN PROBLEMA 1 A partir de una biblioteca genmica de T. cruzi construida en csmidos (30.000 pb), se realiz un rastreo para detectar genes de mucinas con una sonda de un gen completo de mucina de mamferos. Se obtuvieron varios clones positivos y se decidi realizar otra biblioteca a partir de uno de los csmidos positivos en fragmentos de tamaos entre 2000-3000pb en el vector pBS. Para esto se eligi hacer una fragmentacin mecnica del csmido. 1. Considerando que las mucinas de mamferos tienen alta homologa con las de T. cruzi en qu condiciones se habr realizado el rastreo de la biblioteca de csmidos? 2. Qu ventajas y desventajas tiene la estrategia elegida para la construccin de la biblioteca en vector pBS? 3. Cmo seleccionara los tamaos de insertos dentro del rango de tamao deseado?. Qu tipo de enzima usara para digerir el vector y cmo preparara los insertos para ligar? 4. Cuntos clones se necesitarn para tener representado todo el csmido al menos una vez? PROBLEMA 2 Con el objetivo de aislar del genoma de A. tumefaciens el gen que codifica la protena X, se realiz un rastreo de una biblioteca genmica de expresin realizada en csmidos. La biblioteca fue construda por digestin parcial del genoma de A. tumefaciens con la enzima de restriccin EcoR1, de modo de obtener fragmentos de aproximadamente 25000pb, que luego fueron ligados al csmido digerido por EcoR1. El rastreo se realiz por hibridizacin con una sonda obtenida por PCR sobre el gen completo de R. meliloti (organismo altamente relacionado con A. tumefaciens). Como resultado del rastreo se identificaron 3 colonias positivas. Los csmidos correspondientes a cada una de estas colonias fueron purificados y digeridos con EcoR1 obtenindose el siguiente patrn de digestin por electroforesis en gel de agarosa:

GM2014 Gua de problemas

La mezcla de digestin (sin distinguir los fragmentos) de cada csmido se clon en un vector de expresin pY y cada uno fue transferido a bacterias mutantes de A. tumefaciens, defectivas en la protena X, para ver si complementan la mutacin. Unicamente se observ complementacin en las mutantes transformadas con los csmidos A y C. 1. Explique los resultados obtenidos. 2. De acuerdo a los resultados, qu fragmento contendra el gen completo? 3. Qu estrategia seguir para clonar el gen completo? PROBLEMA 3 Usted est estudiando las mucinas de Trypanosoma carasii, que forman la cubierta de este parsito unicelular. Las mucinas purificadas de acuerdo a criterios bioqumicos son muy heterogneas, indicando la coexistencia de mltiples mucinas distintas en la superficie (usted sospecha la presencia de al menos 100 protenas distintas expresadas simultneamente). Por otro lado, otro grupo public la secuencia de los primeros 5 genes de mucinas de T. carasii y demostraron que todos ellos tienen una estructura comn, codificando para productos con un segmento N-terminal muy conservado (95% de identidad) de 100 amino cidos y un segmento C-terminal altamente variable (homologas menores al 25% entre cualquier par de genes) de entre 50 y 100 amino cidos. En ese mismo trabajo, sus competidores publican un Southern blot hecho en condiciones de mxima rigurosidad que revela una complejidad genmica altsima para la familia. 1. Dados los antecedentes y el resultados del Southern blot, Cul le parece que habr sido la sonda utilizada en este ensayo? 2. Cmo estimara con la mayor precisin posible el nmero de genes que codifican para la familia de mucinas en este parsito? (usted cuenta con todas las herramientas de biologia molecular, DNA genmico de T. carasii en cantidad ilimitada, anticuerpos contra las mucinas purificadas, una biblioteca de expresin de T. carasii de 3 kpb de inserto promedio y una biblioteca genmica de T. carasii de 20 kpb de tamao de inserto promedio). El genoma de T. carasii consta de 5x106 pb. PROBLEMA 4 En un laboratorio se est intentando aislar un gen humano, que codifica para una protena con una actividad enzimtica de inters. Como informacin previa se conoce la reaccin que cataliza, por lo que contamos con un ensayo para detectar y cuantificar su actividad enzimtica. Tambin se ha purificado la protena humana y se ha avanzado en la caracterizacin molecular de la misma (peso molecular aparente, estructura cuaternaria, presencia y cantidad de puentes disulfuro, etc.) as como en el estudio de algunas de sus propiedades enzimticas (parmetros cinticos, inhibidores especficos, etc.). As mismo, se logr secuenciar el extremo amino terminal: Ala Gly Gly Met Thr Asp Gln Trp His Trp Glu Gly Ile Val Por otro lado, se tiene clonado un gen de ratn que codifica para una protena con la misma actividad enzimtica. De acuerdo a la secuencia proteica deducida a partir de la secuencia de DNA, este gen est muy relacionado con el humano, pues incluye los catorce aminocidos que fueron secuenciados en la protena humana. Este gen se subclon en un vector de expresin, y se obtuvo la protena recombinante en un sistema

GM2014 Gua de problemas

eucariote (clulas COS). Esta protena (recombinante) es 100% activa comparada con la enzima nativa, y anticuerpos monoclonales contra ella permiten inmunoprecipitar la enzima humana. Se ha comenzado a analizar la estructura genmica haciendo un Southern blot con DNA genmico humano, e hibridizando con una sonda heterloga (significa derivada de otra especie) generada a partir del gen murino, se ven diez bandas definidas de tamaos medios a grandes (de 4Kb a ms de 25Kb). Con la informacin de tu Southern blot (que ya habas publicado), otro laboratorio te gan de mano y clon un gen humano, altamente homlogo a la secuencia murina, y, que coincide perfectamente con la secuencia proteica que vos obtuviste. Sin embargo, siguiendo una estrategia correcta, y utilizando el mismo sistema en que se expresa la protena recombinante activa de ratn, se prueba que este gen clonado codifica una protena, pero sin la actividad enzimtica buscada. 1. Cmo explics que el gen humano clonado codifique una protena inactiva (sabiendo que la enzima activa se expresa perfectamente)? Eleg una sola explicacin, que sea coherente con las evidencias. 2. Dise al menos una estrategia que permita aislar el gen humano que codifica la protena con actividad [no entrar en detalles de protocolo, pero s explicar la(s) estrategia(s) completa(s)]. PROBLEMA 5 Usted desea clonar el gen leu A+ (que codifica para una de las protenas de la biosntesis de leucina) de Escherichia coli. En el laboratorio dispone de bacterias Escherichia coli wild type y leu A- (en ambos casos dispone de cepas resistentes y sensibles a la ampicilina), y un plsmido pBluescript KS que confiere resistencia a Ampicilina. Disee un protocolo de clonado del gen leu A+. PROBLEMA 6 La enfermedad humana hereditaria llamada distrofia muscular severa de la niez es causada por la deficiencia de una protena de 50 kDa llamada adhalina. Esta enfermedad es autosmica recesiva, es decir, el gen de la adhalina se encuentra en un autosoma (cromosoma no sexual) y para que se manifieste la enfermedad tienen que estar mutados necesariamente los dos alelos del gen. Se clon primero el cDNA y luego el gen de la adhalina con el fin de estudiar las mutaciones del gen que causan la enfermedad en distintos pacientes. Para clonar el cDNA, rastrearon un banco de cDNA de msculo esqueltico humano (preparado en Escherichia coli, usando un vector carente de promotor de la transcripcin procaritico) por hibridacin con una sonda radioactiva de cDNA de adhalina de conejo previamente aislada por otro grupo (sonda heterloga). Para clonar el gen de adhalina, rastrearon un banco de genes, obtenido a partir de DNA genmico de bazo humano, usando como sonda radioactiva al clon de cDNA de adhalina humana aislado previamente. La figura 1 muestra un Northern blot de RNAs de distintos tejidos humanos normales donde se ve que el mRNA de adhalina es expresado preferencialmente en msculo esqueltico. Las figuras 2 y 3 muestran un Northern blot y un Western blot, respectivamente de msculo esqueltico de un individuo normal y del paciente JH afectado de distrofia muscular severa, donde se ve que el paciente JH tiene cantidades normales de mRNA de adhalina, pero sin embargo la protena est ausente.

GM2014 Gua de problemas

Figura 1

Figura 2

Figura 3

Northern blot
sonda: cDNA adhalina

Northern blot
sonda: cDNA adhalina

Western blot
Ab anti-adhalina

sonda: cDNA actina Ab anti-actina

C: corazn, ME: msc. esqueltico, Pl: placenta, Pul: pulmn, H: hgado, R: rin, Pa: pncreas. 1. Podran haber aislado el clon genmico de adhalina de un banco de DNA genmico humano de glbulos blancos? 2. Si no hubieran tenido a su disposicin ninguna sonda de hibridacin, podran haber usado un anticuerpo anti adhalina humana como herramienta para encontrar el clon de cDNA de adhalina a partir del mismo banco de cDNA mencionado ms arriba? Por qu? 3. Podran haber aislado el clon de cDNA de adhalina de un banco de cDNA de mRNAs de cerebro? 4. Si el banco genmico tiene 200.000 clones diferentes que en su conjunto representan a todo el genoma de un ser humano, y el tamao del genoma haploide humano es de 3x109 pb, Cul es la longitud promedio en pares de bases de los insertos de los clones del banco? 6. Sabiendo que el gen de la adhalina se transcribe exclusivamente en msculo esqueltico, Cul sera el mecanismo molecular de dicha expresin especfica de tejido? 7. Se demostr que los dos alelos del paciente no llevan ninguna mutacin que cree codones stop prematuros (nonsense) y que los mRNAs de adhalina del paciente no tienen ningn impedimento en la traduccin. Sin embargo, se descubre que la mutacin que causa la enfermedad en JH en ambos alelos es el reemplazo de una G por una A que determina la substitucin de la arginina N 98 por una histidina. En base a esto y a los resultados de las figuras 2 y 3, qu hiptesis tiene para explicar la ausencia de adhalina en el enfermo? 8. Qu importancia tiene haber includo una hibridacin con sonda de actina en el Northern y un revelado con anticuerpo anti actina en el Western? 9. Para expresar en E. coli la protena adhalina se clon el cDNA de la adhalina ro abajo del promotor-operador del opern arabinosa de E. coli. Este opern es inducible

GM2014 Gua de problemas

(desreprimible) por el azcar arabinosa y adems est sujeto al mismo tipo de regulacin positiva a que est sujeto el opern lac. Al agregar arabinosa al cultivo de las bacterias transformadas con la construccin p-oara-adhalina no se observ expresin de la protena debido a que se cometi el error de usar un medio de cultivo que contena tambin glucosa, hecho que se revirti al hacer el mismo experimento en un medio sin glucosa Cul es la base molecular que explica estos resultados? PROBLEMA 7 Se piensa que una alteracin en la actividad de cierta enzima humana est asociada a la enfermedad de Perkin-Elmer. El gen que codifica para dicha enzima no ha sido identificado an. Se cuenta con la enzima purificada en buena cantidad, un ensayo de actividad para la misma, y todas las herramientas necesarias de gentica molecular. Describir en forma lo ms desarrollada posible, qu estrategia seguira para determinar efectivamente si existe un ligamiento gentico entre la alteracin de la actividad de la enzima y la enfermedad. PROBLEMA 8 A partir de una biblioteca genmica de P. aeruginosa, se aisl el plsmido pAP1. Este plsmido contiene un fragmento de 20 kb de ADN cromosomal, clonado en el sitio Hind III del vector de amplio rango de hospedador pVK102 (Fig. A). Este plsmido complement la produccin de una protena X en una mutante X- de P. aeruginosa. Para localizar la regin de ADN responsable de dicha complementacin, el plsmido pAP1 fue mutagenizado mediante inserciones del transposon Tn tac 1. Este transposon posee un gen de resistencia a kanamicina (Fig. B). El plsmido pAP1 23 formado por una insercin de Tn tac 1 en el inserto de 20 kb de pAP1 fue digerido completamente con Hind III, Bam HI y hind III + Bam HI y se corri en un gel de agarosa (Fig. C). El tamao de cada banda se encuentra marcado en la figura. 1. Determinar la localizacin de la insercin del transposon en el inserto pAP1, y el sentido de este, justificando su respuesta. 2. Si el transposon se hubiese insertado en el sentido contrario Qu bandas hubiera esperado encontrar en los cortes con Hind III, Bam HI y con Hind III + Bam HI?

Figura A

Figura B

GM2014 Gua de problemas

Figura C

PCR PROBLEMA 9 En la retina del ojo de los humanos existen dos tipos de clulas: los bastones y los conos. Los bastones expresan especficamente una protena llamada rodopsina, la cual posibilita la visin en general. Con respecto a los conos existen tres tipos celulares diferentes: los conos "azules", los "rojos" y los "verdes", expresando especfica y exclusivamente cada uno de estos las protenas conocidas como pigmentos visuales "azul", "rojo" y "verde", respectivamente. Estos pigmentos son capaces de captar luz de los colores indicados por su nombre y el funcionamiento en conjunto de los tres tipos de conos da por resultado la visin policromtica. El gen del pigmento azul (gen A) se encuentra localizado en el cromosoma humano n 7. En cambio, los genes de los pigmentos rojo (gen R) y verde (gen V) se encuentran uno al lado del otro (o sea, en tandem) en el cromosoma sexual X (figura 1), no habiendo contraparte en el cromosoma Y. Porcin del cromosoma X

Figura 1 Cada uno de estos dos genes tiene su propio promotor y regin regulatoria de la transcripcin, y se transcribe de manera especfica, es decir, el gen R slo en conos "rojos" y el gen V slo en conos "verdes". Los genes R y V tienen secuencias nucleotdicas muy similares (98% de similitud), a tal punto que muchos sitios para enzimas de restriccin se encuentran conservados en ambos genes. La figura 2 muestra una estructura ms detallada de ambos genes.

GM2014 Gua de problemas

Figura 2 Desde 1779 se conoce el carcter hereditario de la alteracin en la visin en colores en humanos. Varones que tengan delecionado el gen R no ven el rojo y varones que tengan delecionado el gen V no ven el verde. 1. Dibujar las bandas de hibridacin que obtendra en un Southern blot de ADN genmico cortado simultneamente con las enzimas de restriccin EcoR1 (E) y BamH1 (B), obtenido de sangre de los siguientes individuos: varn R+V+: tiene los dos genes sanos y enteros. varn R+V-: tiene delecionado el gen V. varn R-V+: tiene delecionado el gen R. varn R-V-: tiene delecionados ambos genes. Se utiliz como sonda a un clon de ADNc que contiene slo los exones 1 y 2 del gen V. Esta sonda reconoce ambos, an en condiciones de alta rigurosidad. 2. Es el experimento anterior til para determinar los genotipos de las cuatro personas? 3. Dibujar las bandas de Southern que hubiera obtenido de los mismos pacientes si en lugar de usa la sonda indicada se hubiera usado como sonda slo el exn 5. Hubiera sido ste anlisis tan informativo como el de la pregunta 1? Justifique. 4. Una manera ms rpida de efectuar el anlisis de los cuatro individuos es haciendo una PCR con primers especficos para el gen V, que aparean en sus exones 4 y 5 segn se ve en la figura 3. Estos primers no aparean con las secuencias de los exones 4 y 5 del gen R.

Figura 3

GM2014 Gua de problemas

Diga si detecta o no productos de PCR y de qu tamao para cada uno de los cuatro individuos, habiendo usado como molde ADN genmico obtenido de sangre. 5. Qu productos de PCR y de qu tamao habra obtenido en cada uno de los individuos si hubiera usado como molde ADNc total obtenido de retina? 6. Con cul de las dos hebras (codificante o no codificante) se aparea el primer izquierdo? Y el derecho? 7. La delecin en la regin del cromosoma X marcada como LCR en la figura 1 provoca una fuerte disminucin de la transcripcin de ambos genes R y V. Qu funcin le atribuira a la regin LCR? Qu motivos de secuencia aminoacdica esperara encontrar en las protenas que se unan a la regin LCR? Justifique. 8. Qu colores percibirn los humanos R-V- y los humanos que tienen delecionado el LCR? PROBLEMA 10 1. Mencione una causa que haga necesaria una PCR anidada (nested) para repetir una amplificacin. Conviene realizar la segunda amplificacin con los mismos primers que la primera? Justifique. 2. Puede realizar una PCR amplificando tres regiones diferentes del molde utilizando simultneamente tres juegos diferentes de primers especficos, en el mismo tubo de reaccin? Si fuese posible, qu caracterstica deben tener los productos de amplificacin para que el resultado sea de fcil anlisis? 3. Si quiero construir una biblioteca genmica de una planta en la cual la extraccin del ADN genmico, por problemas que desconozco, es de bajo rendimiento, es conveniente realizar primero una PCR para amplificar el material? 4. Toda genoteca de expresin debe ser construida a partir de mRNAs? Especifique. 5. Qu es la contaminacin por producto final en la PCR? 7. Acabo de realizar un Southern blot, y me doy cuenta (tarde!) que hice la electroforesis y la transferencia sin antes cortar con la enzima de restriccin que haba elegido. De todos modos decido continuar con la hibridizacin. Qu resultado obtendr? Qu informacin me puede dar? PROBLEMA 11 1. Analizar el siguiente protocolo de PCR MEZCLA DE REACCIN DNA genmico humano (100ng/ul) primer 1 (sense) (100ng/ul) primer 2 (antisense) (100ng/ul) Buffer 10X dNTPs (1mM) DNA Pol (5U/ul) H2O TOTAL l 1 1 1 5 5 0.5 36.5 50

Buffer 10X: Tris.HCl pH 8 250mM, KCl 500mM Primer 1: 5' GGACTGTGAAGGCCCGTGCCCG 3' Primer 2: 5' GGGATCCGAGACGCTCCCCAGA 3' RECORDAR: TmC = 2C x (A+T) + 4C x (G+C)

GM2014 Gua de problemas

Ambos primers son perfectamente homlogos a las secuencias complementarias especficas del templado. CICLADO * 1 X 5min 93C * 30 X {30seg 93C ; 2min 72C} * 1 X 5min 72C 2. Indicar si faltan o sobran componentes y/o pasos (Organizar el anlisis y la respuesta de acuerdo a las dos partes del protocolo: MEZCLA DE REACCION y CICLADO). Sealar claramente cules son los errores y explicar en detalle cmo se corrigen. 3. Analizar los siguientes oligonucletidos sintticos: 5' GTGACGTTTTTCGTTGCA 3' 5' AACTTCGTGCAACGAAAA 3' Encuentra algn problema para que sean usados juntos como primers en una reaccin de PCR? PROBLEMA 12 Se desarroll un mtodo para determinar el sexo de embriones bovinos, basado en polimorfismos de longitud de fragmentos de restriccin (RFLPs). El polimorfismo elegido existe entre los genes ZFX y ZFY, presentes en los cromosomas X e Y respectivamente. El mtodo que se eligi para realizar el sexado, visualizando el RFLP fue una PCR, utilizando para ello oligonucletidos diseados sobre las secuencias, ya conocidas de ZFX y ZFY. Figura 1

Se realizaron las reacciones de PCR que se detallan a continuacin, usando en todas la misma mezcla de reaccin (reaccin 1) con los agregados y tratamientos indicados. Los productos de cada reaccin se resolvieron en un gel de agarosa 2%. En la Fig. 2 se muestra un esquema del resultado obtenido. Las PCR sobre material embrionario se realizaron sobre el ADN presente en las 4 a 10 clulas que pueden recuperarse en una biopsia de la zona pelcida de un embrin bovino de 7 das. (de 5 a 20 pg.) Reacciones 1- Mezcla de reaccin (MR): 300 ng de cada oligo (P1, P2, P3, P4) , 0,2 mM dNTP, buffer de reaccin 1X y 2 U Taq polimerasa.

GM2014 Gua de problemas

2 - MR + 500 ng ADN bovino de hembra adulta. Oligos P2 + P3. Producto digerido con la enzima PstI. 3 - MR + 500 ng ADN bovino de macho adulto. Oligos P2 + P3. Producto digerido con la enzima PstI. 4 - MR + Medio utilizado para las biopsias de los embriones. Oligos P1, P2, P3, P4. 5 - MR + ADN embrin A. Oligos P1, P4. 6 - dem 5 con oligos P2, P3. 7 - MR + 5 ul de reaccion 5. Oligos P2, P3. Digerido con PstI. 8 - MR + ADN embrin B. Oligos P1, P4. 9 - dem 8 con oligos P2, P3. 10 - MR + 5 ul de reaccion 8. Oligos P2, P3. Digerido con PstI. 11 - MR + ADN embrin C. Oligos P1, P4. 12 - dem 11 con oligos P2, P3. 13 - MR + 5 ul de reaccion 11. Oligos P2, P3. Digerido con PstI. 14 - MR + 500 ng ADN bovino de hembra adulta. Oligos P1 + P4. 15 - MR + 500 ng ADN bovino de macho adulto. Oligos P1 + P4. Figura 2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

A la izquierda se muestra un marcador de peso molecular con los siguientes tamaos: 404, 365, 279 y 86 pb. PREGUNTAS: 1. Qu otro mtodo podra haberse utilizado, en lugar de la PCR, para visualizar el RFLP? Por qu no lo utilizaron? 2. Si compararas las secuencias de ZFX y ZFY, esperaras encontrar diferencias en la secuencia adicionales a la que causa el RFLP? 3. Para que este mtodo de sexado sea adecuado, qu caracterstica tiene que tener el RFLP respecto de los individuos de la especie? 4. Explicar los resultados de cada reaccin y determinar de que sexo son los embriones A, B y C. 5. Cul ser la fuente ms probable de contaminacin con ADN forneo en estos ensayos de sexado? Cmo lo comprobaras? 6. Era necesario, en las calles 7, 10 y 13, realizar una segunda amplificacin con los oligos P2 y P3 en vez de usar nuevamente los oligos P1 y P4? PROBLEMA 13

GM2014 Gua de problemas

10

Se desea clonar el gen de la succinato deshidrogenasa (SDH) de Trypanosoma cruzi. En el laboratorio se dispone del gen homlogo de Trypanosoma carassii, de 600 pb, completamente secuenciado. Decide hacer una sonda por PCR, sobre el gen completo utilizando dos oligonucletidos de las regiones 5y 3del gen, que incluyen la Met inicial (P1) y el codn de stop (P2). En el panel 1 se muestra el Southern blot, lavado en condiciones de mxima rigurosidad de ADN genmico de T.cruzi digeridos por diferentes enzimas. Panel 1 PstI

EcoRI AccI

A la izquierda se muestra un marcador de peso molecular con los siguientes tamaos: 10, 3 y 0.8 kpb. En vista de los resultados, y aprovechando el hecho de que los tripanosomas no poseen intrones, decide intentar el clonado del gen de la SDH mediante una PCR sobre ADN genmico total de T.cruzi utilizando los mismos oligonucletidos utilizados para sintetizar la sonda. Adems se utiliz un tercer oligonucletido (P3), que hibridiza dentro de la regin C-terminal, en orientacin sense. Se utilizaron las siguientes condiciones de ciclado: 5 min 93C; (30 seg 93C, 30 seg 60C, 30 seg 72C)x35;10 min 72C Todos los oligonucletidos tienen un Tm de 65C. Reacciones Molde P1 P2 P3 1 + + + 2 + + + 3 + + +

En el panel 2 se muestran los resultados de las PCRs en un gel de agarosa teido por Bromuro de etidio y en el panel 3 el mismo gel transferido e hibridizado en la sonda de SDH utilizada en el panel 1. Panel 2 Panel 3

GM2014 Gua de problemas

11

1. Justifique los resultados obtenidos. 2. Si la estrategia seguida no hubiese sido exitosa, proponga una estrategia alternativa para el clonado del gen completo de la SDH de T.cruzi. PROBLEMA 14 Usted dispone de un clon parcial de la porina, un antgeno de superficie de Vibrio cholera (aislamiento clnico A2K), que consiste en las 500 pb del extremo 5 del gen. Este clon contiene el ATG propio del gen y, por comparacin con porinas de organismos relacionados usted dedujo que le faltan las 500 pb del extremo 3del gen para tenerlo completo. Usted adems tiene dos primers (P1 y P2) que le permiten amplificar todo el fragmento codificante que posee. En el laboratorio se dispone de una biblioteca genmica de Vibrio cholera (aislamiento clnico Arg2) en el csmido pXX cuyo tamao de inserto promedio es de 50 kpb. Por lo tanto, usted decide usar esta biblioteca para obtener el gen de la porina completo. 1. Cuntos clones rastreara como mnimo? (el contenido genmico total de Vibrio cholera es de 107 pb) 2. Explique brevemente cmo sintetizara y purificara la sonda. 3. Indique las condiciones en que hara la hibridizacin. Del rastreo de la biblioteca usted obtuvo un nico clon positivo, el cual decide analizar por restriccin con las enzimas indicadas en la figura (ninguna de ellas corta dentro de su fragmento del aislamiento clnico A2K, por supuesto), transferir el gel y hacer un ensayo de Southern blot con la misma sonda usada para el rastreo de la genoteca.

En la figura se muestra la autoradiografa del Southern blot. Encima de cada calle se indica la enzima de restriccin utilizada para digerir el csmido positivo y a la izquierda se indican (en kpb) los marcadores. En base a estos resultados usted decidi subclonar la banda reactiva de la digestin con HaeII en el vector pUC19. La reaccin de ligacin fue un xito (usted hizo todos los controles apropiados), tom 2 clones de la placa de

GM2014 Gua de problemas

12

ligacin (vector + ligasa + inserto) y los analiz por PCR (utilizando los primers P1 y P2) y Southern blot, utilizando la misma sonda que la usada para el rastreo de la genoteca.

En la figura del Southern blot los signos + y - indican digestin o no con la enzima HaeII. En la figura de la PCR se indica encima de cada calle el molde usado en la reaccin. 4. Explique los resultados obtenidos. 5. Proponga una estrategia alternativa para clonar el gen completo de la porina Vibrio cholera.

SUBCLONADO PROBLEMA 15 Se realiz un rastreo sobre una genoteca de expresin del parsito T. cruzi utilizando un anticuerpo especfico para la enzima trypanotion reductasa. La genoteca est construida en el vector gt13 que produce una fusin C-terminal con el gen de la -galactosidasa. Se obtuvo un positivo (al cual se lo llam clon TR), que se quiere subclonar en un vector de expresin. gt13
BRAZO IZQ. (20000 PB)
agt cgc gcc ccc aaa gtg tgc ggt acc ccc gaa ttc KpnI EcoRI

INSERTO (2000 PB)

BRAZO DER. (25000 PB)

--------------------------------- aag ctt act gga tcc tca tgg tgc gct tgcta HindIII BamHI

En el laboratorio dispone de la serie de vectores de expresin pCAR-1, 2 y 3 cuyos sitios mltiples de clonado son los siguientes. pCAR-1 ccc gtg gac cca cca acc gaa ttc aatggc cta gga tcc aat taa tga
EcoRI HaeIII BamHI

pCAR-2 ccc gtg gac cca cca acc aga att caa tgg cct agg atc caa tta atg a
EcoRI HaeIII BamHI

pCAR-3 ccc gtg gac cca cca acc aag aat tca atg gcc tag gat cca att aat g a
EcoRI HaeIII BamHI

GM2014 Gua de problemas

13

Este vector tiene 4.000 pb y produce una fusin C-terminal con el gen de una protena que se une a quitina. En todos los mapas, los codones indicados como tripletes sealan el marco correcto de lectura para lograr la fusin. 1. Se ha decidido clonar utilizando los sitios EcoRI y BamHI Por qu? 2. A partir de los mapas dados Cul de los tres vectores usara y por qu? Los resultados de la ligacin, una vez preparados inserto y vector de acuerdo a lo visto en el laboratorio, fueron los siguientes: Vector vector + inserto inserto 20 ufc 22 ufc 0 ufc

De acuerdo a estos resultados se decide realizar un mapeo de restriccin sobre el clon TR y el vector de subclonado pCAR.Los productos de digestin corridos en un gel de agarosa y revelados por BrEt se indican en la figura. Kpb 23 641.8 1 2 3 4 5 6

1- pCAR BamHI 2- pCAR EcoRI 3- pCAR BamHI/EcoRI 4- TR BamHI 5- TR EcoRI 6- TR BamHI/EcoRI Por otro lado, se amplific el inserto del clon TR por PCR utilizando los oligonucletidos O1 ubicado a 50 bases ro arriba del sitio KpnI y O2 ubicado a 50 bases ro abajo del sitio BamHI, ambos en el vector gt13. Se obtuvo el producto de amplificacin esperado de 2100 pb al cual se subclon en vector T (un vector linealizado con una T protruyente, en sus extremos 5', que permite el clonado directo de productos de PCR con la enzima Taq ADN polimerasa). 3. Por qu no se secuencia directamente en el fago gt13? 4. En base a todos los resultados observados, explique cul es la causa por la cual no se logr subclonar en el vector pCAR en los sitios EcoRI y BamHI. Proponer al menos una alternativa para el subclonado.

PROBLEMA 16

GM2014 Gua de problemas

14

Un joven becario recibi de un amigo el gen que codifica para la glutamato deshidrogenasa de Plasmodium vivax clonada en el plsmido pUC 19 (3000 pb) y un anticuerpo policlonal especfico contra esta enzima. Ahora quiere clonar este gen en un vector de expresin (pGEX, 5000pb, cuyas enzimas del polylinker, de 5a 3son BamHI, EcoRI, PstI, PrxI, ApaI, HindIII) para estudiar bioqumicamente a esta enzima. La persona que le mand el plsmido le provey tan slo del mapa de restriccin que se indica abajo y la indicacin de que el sitio EcoRI est en la fase del pGEX-1:

Los sitios de corte para estas enzimas son los siguientes: ApaI: C^XCGXG EcoRI: 5G^AATTC 3 SalI: 5G^TCGAC 3 PrxI: 5T^AATTA 3 HindIII: 5A^GATCT 3 EcoSI: 5 AXT^AXT 3 Este joven becario decidi intentar el subclonado utilizando las enzimas EcoRI y PrxI, y para ello digiri el pGEX-1 con ambas enzimas, lo fosfatase y procedi a ligarlo con el inserto del clon proveniente del plsmido pUC19 purificado de gel de agarosa. Obtuvo 200 colonias en la placa de ligacin (vector + ligasa + inserto) y slo 10 en la de control de religacin del vector (vector + ligasa). 1. Qu otros controles de ligacin hubiese agregado usted? 2. Porqu decidi fosfatasear el vector si lo digiri previamente con dos enzimas distintas? Entusiasmado con los resultados de la ligacin, decidi picar slo 5 colonias recombinantes y 1 del control de religacin y analizarlas por PCR y restriccin. Para la PCR utiliz los oligonucletidos pGEX sense y pGEX antisense que hibridizan en el 5y 3, respectivamente, del polylinker de pGEX-1. Los resultados de la PCR y el anlisis por restriccin de esos mismos clones se indican en el gel debajo (el clon indicado como negativo corresponde a la colonia picada del control de religacin).

GM2014 Gua de problemas

15

En la figura se muestra el gel de agarosa teido por BrEt. Los marcadores (en pb) se indican a la izquierda. 3. Qu controles adicionales hubiese agregado a la PCR? 4. Analice los resultados para cada uno de los clones, explique la situacin en cada caso e indique con cul de los clones proseguira el trabajo. 5. En base a sus deducciones, qu cree que hubiese ocurrido si no fosfataseaba el vector antes de ponerlo a ligar? 6. Sugiera una estrategia alternativa de subclonado en pGEX-1 para optimizar los resultados. 7. Cmo podra confirmar la expresin correcta de la glutamato deshidrogenasa? PROBLEMA 17 Se dispone de un clon en el vector pVAN conteniendo el gen anti-freezing de un raro sapo ucraniano. El esquema del clon es el siguiente:

GM2014 Gua de problemas

16

pVAN ________________________________________________________________ | | | | EcoRI HindIII BamHI AvaI ______ 50 pb _________________________________________ 2500 pb

Se sabe que el ATG (codn de iniciacin de la traduccin) de este gen se encuentra localizado entre los sitios HindIII y BamHI y que el gen completo medira unas 500 pb pero no se conoce la orientacin de este gen dentro del clon. Lo que se hizo fueron dos reacciones independientes de restriccin sobre este clon, la primera con las enzimas BamHI + EcoRI y la segunda con las enzimas HindIII + AvaI. Ambos fragmentos se purificaron de gel de agarosa y se subclonaron en el vector pTT, cuyo polilinker se indica debajo:

Utilizando el oligonucletido pTT sense, que primea 20 pb ro arriba del 5 del polylinker de pTT, se hicieron reacciones de secuenciacin sobre ambos clones, llamados pTT BE y pTT HA, respectivamente. Las secuencias obtenidas se indican debajo (ambas en sentido 5-3): Reaccin sobre el clon pTT BE: TAAAGCTTGGATCCAATTGATAAATGAAACACCGGCTCAATTTTCCCGAA GATAAGCTTAAAGCGGCGT Reaccin sobre el clon pTT HA: TAAAGCTTATCTTCGGGAAAATTGAGCCGGTGTTTCATTTATCAATTGGAT CCGGGTATCAACAA 1. Indique la orientacin del gen en el clon del vector pVAN original y la secuencia codificante del gen anti-freezing que obtuvo de este experimento. 2. Indique una estrategia de subclonado de este gen al vector de expresin pQUIT (que da un producto de fusin con una protena de unin a quitina) cuyo polylinker consta de las enzimas 5- BamHI-HindIII-EcoNI-EcoRI-AvaIPstI-3. 3. Indique las caractersticas generales que debera reunir un vector de expresin bacteriano del tipo pQUIT. NOTA: Sitios de reconocimiento para las enzimas mencionadas HindIII: AAGCTT BamHI: GGATCC EcoRI: GAATTC

GM2014 Gua de problemas

17

AvaI: CXCGXG PstI: CTGCAG Codon iniciacin de la traduccin: ATG. Codones de finalizacin de la traduccin: TAA, TGA, TAG. PROBLEMA 18 Obtuve el gen que codifica para una protena de inters, a partir del rastreo de una genoteca de expresin en el vector gt11. Ahora para continuar con la manipulacin de este fragmento tengo que subclonarlo en los plsmidos pUC18 y pGEX-1. Por qu? Mapa del inserto en gt11:

Disear el protocolo completo para subclonar el fragmento de inters desde el fago gt11 a los dos plsmidos (con la figura que se incluye y usando los manuales y protocolos que se les proporcionan).

Polilinker pUC18

GM2014 Gua de problemas

18

PROBLEMA 19 El plsmido p7000 de 3.000pb contiene un origen de replicacin bacteriano y un gen de resistencia a ampicilina. Adems posee el plsmido pUC19 conteniendo un fragmento de ADN clonado en el sitio EcoRI de su polylinker de 200pb, que codifica para el gen de resistencia a tetraciclina (indicado con una flecha negra en el grfico). Su jefe quiere que usted obtenga un plsmido de resistencia a ambos antibiticos. Los mapas de restriccin de ambos plsmidos son los siguientes:

Los sitios de restriccin para las enzimas indicadas son: StuI: 5AGG^CCT 3 SalI: 5G^TCGAC 3 PvuII: 5CAG^CTG 3 EcoRI: 5G^AATTC 3 Usted decide realizar el clonado utilizando el sitio EcoRI. Explique brevemente el protocolo de pasos a seguir. Cuando aisla clones supuestamente recombinantes, usted decide analizarlos por restriccin, utilizando las enzimas EcoRI y SalI, obteniendo los siguientes resultados:

GM2014 Gua de problemas

19

1. Explique a que se debe el polimorfismo de los clones obtenidos. Tiene este resultado alguna relevancia para sus experimentos? 2. Cmo podra hacer un clonado direccionado? PROBLEMA 20 Se quiere clonar un fragmento de ADN que contiene un gen de inters en el vector pVer en el sitio Sma1. En la figura se muestran los sitios de corte en el fragmento a clonar y en el vector. Indique los pasos a seguir para el subclonado, es decir: 1. Con qu enzimas cortara el inserto para subclonarlo? 2. Cmo preparara el vector? 3. Cmo hara para poder ligar el inserto en el vector? 4. Cmo hara para saber la orientacin del inserto?

BbeI

BstxI

EcoRI HindIII

HindIII: 5 protuyente BstxI: 3 protuyente SmaI: romo BbeI: 3 protuyente

GM2014 Gua de problemas

20

PROBLEMA 21 Se pretende subclonar un fragmento de 600 pb liberado por la enzima EcoRI, en el vector pUC19 (AmpR, permite el rastreo por prdida de actividad -galactosidasa). El fragmento se purific mediante corrida en gel de agarosa y se largaron las siguientes reacciones de ligacin en un volumen final de 10 litros:
Reaccin Inserto pUC19 / EcoRI PUC19 / EcoRI / CIP Buffer ligasa 10X ATP 100mM pUC19 100pg Agua Ligasa 1 1 1 1 1 5 1 2 1 1 1 1 5 1 3 1 1 1 6 1 4 1 1 1 6 1 5 1 1 1 6 1 6 1 1 1 6 7 1 1 7 -

CIP: fosfatasa alcalina. Con las reacciones de ligacin se transformaron bacterias E. Coli competentes que se plaquearon sobre medio LB conteniendo Amp, IPTG y X-Gal. Se las dej crecer una noche a 37C y se analizaron las colonias obtenidas.
Reaccin 1 2 3 4 5 6 7 colonias azules 2900 100 100 3200 100 100 5000 colonias blancas 26 650 0 5 0 0 0

1. Explique brevemente para qu se realiz cada reaccin y los resultados obtenidos y en cual de ellas espera encontrar la construccin deseada. 2. Qu ensayos utilizara para comprobar que ha obtenido la construccin deseada? 3. Sabiendo que se plaqueron en todos los casos 5 ul del volumen total de recuperacin (1 ml), calcule la eficiencia de transformacin. PROBLEMA 22 Un experimentado investigador se encuentra realizando una serie de construcciones. Todas consisten en la insercin de un fragmento de ADN obtenido por digestin de un plsmido con BamH I (G/GATCC) y Bgl II (A/GATCT), purificado luego de un gel de agarosa, en un vector digerido con las mismas enzimas y con sus fosfatos 5 terminales eliminados por tratamiento con fosfatasa alcalina. En cada caso se trata de una preparacin de vector diferente. Durante unos das se dedic a ligar y transformar, y finalmente se sent a analizar sus resultados. La tabla muestra las colonias observadas en las placas en las que se rastrillaron las bacterias transformadas con las distintas ligaciones.

GM2014 Gua de problemas

21

1. Era necesario el tratamiento con fosfatasa alcalina de los vectores?


1 Sin ligasa A B C D E F 2 1 300 2 2 0 2 Con ligasa 4 6 305 310 3 0 3 Inserto:vector (1:1) 8 95 320 330 1 1 4 Inserto:vector (3:1) 50 44 350 380 2 3 5 Inserto:vector (9:1) 97 6 390 420 0 7 6 0,1 ng vector sin cortar 52 47 45 61 50 6

Luego de mirar los resultados, se dio cuenta que algunos subclonados haban andado mejor que otros. Decidi tratar de aprovechar estas placas al mximo y, en paralelo, mejorar las ligaciones que haban tenido problemas. 2. La siguiente es una lista de las seis decisiones que tom respecto de cada una de las ligaciones. Asigne una de estas decisiones a una y solo una de las ligaciones. No repita opciones, lealas todas antes de empezar. A. Transferir las placas 3, 4 y 5 a nitrocelulosa e hibridarlas con el inserto marcado radioactivamente. B. Picar 10 colonias de la placa 3 (inserto 1X) y analizar la presencia del inserto cortando con enzimas de restriccin. C. Idem 1. D. Picar todas las colonias de las placas 3, 4 y 5 y analizar la presencia del inserto cortando con enzimas de restriccin. E. Descartar las placas y empezar de nuevo. F. Picar 10 colonias de la placa 5 y analizar la presencia del inserto cortando con enzimas de restriccin. 3. En el caso del anlisis con enzimas de restriccin de los posibles recombinantes, utilizara usted Bgl II y BamH I? Con los resultados de dos de las ligaciones se mostr conforme (Cuales son?), pero con los otros decidi hacer nuevos intentos modificando algn aspecto del protocolo. 4. Asigne una de las siguientes modificaciones a una de las cuatro ligaciones a mejorar. No repita opciones, lalas todas antes de empezar. A. Transformar lo que qued de la primera ligacin en bacterias competentes de alta eficiencia. B. Tratar nuevamente al vector con fosfatasa alcalina, esta vez usando mayor cantidad de enzima. C. Preparar un nuevo vector, digiriendo un DNA ms puro con ambas enzimas en cantidad y tiempos controlados y tratando luego con fosfatasa alcalina. D. Realizar una nueva ligacin usando ms ligasa.

GM2014 Gua de problemas

22

PROBLEMA 23 En los ensayos de ligacin para el subclonado de un gen (500 pb) se probaron dos vectores (3.000 pb). Tanto inserto como vector fueron digeridos con la misma enzima de restriccin y las preparaciones de vector fueron tratadas con fosfatasa alcalina. De las transformaciones se obtuvieron los siguientes resultados:
Inserto 16 ng 10 ng 3 ng 10 ng Vector 1 20 ng 20 ng 20 ng 20 ng 1ng sin cortar Transformantes 1 100 30 10 0 5 200 Vector 2 20 ng 20 ng 20 ng 20 ng 1 ng sin cortar Transformantes 2 400 320 250 0 280 150

1. Qu relaciones molares de Inserto:Vector se usaron? 2. Que problema presentaron las preparaciones del vector 1 y 2? Qu control falta para saber qu fue lo que anduvo mal? Cul de las transformaciones usara para continuar con el subclonado? 3. Teniendo en cuenta que se plaqueo una quinta parte de cada transformacin, calcule la eficiencia de transformacin con cada uno de los vectores. PROBLEMA 24 Usted est intentando clonar una pequea protena de unin a RNA de Trypanosoma cruzi que estara involucrada en la regulacin de la expresin gnica. Luego de un intenso trabajo de rastreo de una biblioteca y subclonado logr aislar un pequeo fragmento genmico conteniendo aparentemente la secuencia completa codificante para la protena buscada (cuyo tamao es de 78 pb incluyendo el codn de inicio y stop). Usted tiene clonado el fragmento genmico en el vector pSPLIII en los sitios HindIII y XhoI. Para confirmar la identidad de su protena, y que clon la secuencia completa decide secuenciar el inserto. Una vez que logr confimar la identidad de su protena decidi subclonarla en el vector de expresin pVAC II para obtener su protena recombinante y hacer ensayos de unin a RNA. Este vector expresa protenas como fusin carboxilo terminal con GST para facilitar su purificacin. El polilinker o Sitio de Clonado Mltiple (SCM) de dicho vector se muestra en la figura.

1. Disee y describa detalladamente una estrategia para clonar la secuencia completa de su protena en el vector de expresin pVAC II. 2. Qu elementos debe tener necesariamente un vector de expresin en organismos procariotas?

GM2014 Gua de problemas

23

PROTENAS PROBLEMA 25 La protena X es codificada por un nico gen en el mosquito, que tiene 15 Kb de longitud y slo se expresa en msculo y en cerebro. En el msculo produce un ARNm de 3 Kb de longitud, en tanto que en cerebro da un ARNm de 2.7 Kb. El ARNm de msculo se traduce en un polipptido de 750 aminocidos. La protena X de msculo corre como una nica banda de 220 KDa en peso molecular en geles de poliacrilamida con SDS sin previo tratamiento con mercaptoetanol. Cuando la misma protena es tratada con mercaptoetanol da una nica banda en el gel de 110 KDa, El ARNm de cerebro se traduce en un polipptido de 650 aminocidos. La protena X de msculo corre como una nica banda de 71.5 KDa en geles con SDS, tanto sin como con tratamiento previo con mercaptoetanol. Otros datos: El peso molecular promedio de cada aminocido es 110 Da. En ninguno de los dos tejidos la protena sufre protelisis post-traduccional. 1. Cmo explica la diferencia entre el tamao del gen y el de sus mensajeros? 2. Cmo explica la diferencia de tamao entre el ARNm de msculo y el de cerebro? 3. Cul es la longitud de las regiones 5y 3 no codificantes del ARNm de msculo? Y la del ARNm de cerebro? 4. Cul de las dos protena podra estar glicosilada y dnde? Justifique. PROBLEMA 26 Con motivo de encarar el screening de una genoteca de expresin, se desea fabricar anticuerpos policlonales contra una protena cuyo gen se desea clonar. Conociendo el peso molecular aparente (estimado usando una columna de filtracin molecular), decido hacer una electroforesis preparativa en gel de poliacrilamida bajo condiciones desnaturalizantes (SDS-PAGE). Siembro una purificacin parcial de la protena, y luego de una buena resolucin, corto el gel en la regin correspondiente al tamao de la protena. Con esto inmunizo animales. Plantee los riesgos asociados a esta estrategia que podran hacer fracasar el objetivo final (encontrar y clonar el gen buscado). PROBLEMA 27 En clulas vegetales, la disponibilidad de la cab (protena que se une a la clorofila) es clave para el proceso de fotosntesis. La protena cab est codificada por un gen cuya expresin es exclusiva de tejidos verdes y est regulada por la luz solar, a nivel de transcripcin. Se clon el promotor ms la regin regulatoria del gen cab y se lo fusion ro arriba del ADNc de la luciferasa. La construccin Prom. cab-ADNc luciferasa fue introducida en tejidos embrionarios de plantas de tabaco, las cuales dieron lugar, despus de un tiempo, a plantas transgnicas que contenan una sola copia del transgn en todas sus clulas. Al rociar las plantas transgnicas con el sustrato de la luciferasa, llamada luciferina, stas emitieron luz (o sea, fueron luminiscentes) en determinados momentos del da. Tal emisin de luz fue medida en hojas intactas a distintas horas, comenzando a las 6 de la maana (figura 1). Para confirmar a nivel molecular los resultados logrados, se extrajo ADN, ARN y protenas totales a partir de hojas de una planta transgnica a las mismas horas en que se

GM2014 Gua de problemas

24

realiz el ensayo de luminiscencia, para realizar experimentos de Southern blot, Northern blot y Western blot que se muestran a continuacin (figuras 2, 3 y 4).

1. Podra afirmar que la luciferasa es monomrica? Por qu? 2. Qu porcentaje aproximado de cada molcula del ARNm maduro de la luciferasa es codificante? (dato: 1 a = 110 Da). 3. Qu tipo de resultado esperara de un Southern como el de la figura 2 si se usa como sonda el promotor del gen de la luciferasa? 4. Usando como sonda en el mismo Southern al promotor del gen cab se obtienen dos bandas de hibridacin, una de 5 y otra de 8 kb. Por qu? 5. Qu tipo de resultado (presencia o ausencia de banda/s, variacin a lo largo del da) esperara de un Northern de hoja de planta transgnica si usara como sonda: a. el promotor del gen cab. b. un exn de 300 pb de largo, del gen de la luciferasa? 6. Qu puede concluir del ritmo temporal de la expresin del gen cab en hojas de tabaco salvaje (no transgnico)? 7. En estos experimentos, el DNAc de luciferasa es utilizado como gen reportero ya que la actividad de su producto es fcil de medir. La enzima luciferasa, al tener una vida media corta de slo 5 min, es apropiada como enzima indicadora en los experimentos de luminiscencia y Western. Es correcto este razonamiento? Qu resultados de Northern y Western se habran obtenido si en lugar del DNAc de luciferasa se hubiera utilizado el DNAc de otra protena reportera cuyo RNAm tuviera la misma vida media que la del RNAm de luciferasa, pero la protena tuviera una vida media de 10 horas? Nota: vida media de una poblacin de molculas es el tiempo en que se degrada el 50% de las mismas. 8. Se alteraran los resultados de luminiscencia (fig.1) y Western (fig.4) si antes de efectuar los respectivos experimentos las hojas fueran calentadas a 80C? 9. Qu resultados de los experimentos anteriores (figs. 1, 2, 3 y 4) se alteraran (y de qu manera?) si el material vegetal proviniera de la raz de una planta transgnica en lugar de la hoja? 10. Qu resultados de los experimentos anteriores se alteraran (y de qu manera?) si el cDNA de la luciferasa usado como parte del transgn hubiera sufrido una mutacin consistente en la insercin de un nucletido extra entre el primer y el segundo codn?

GM2014 Gua de problemas

25