Anda di halaman 1dari 18

Perubahan kode DNA

Mutasi adalah perubahan pada


DNA. Dapat sebagai sederhana
sebagai perubahan basa tunggal (A
sampai C) atau separah menghapus
seluruh bagian dari DNA.
Halaman-halaman berikutnya
memberikan informasi tentang
berbagai jenis mutasi pada gen dan
bagaimana mereka mempengaruhi
protein yang mereka kode untuk.
Mutasi spontan
Terjadi secara alami, bukan sebagai
akibat dari agen tertentu (s)
Kesalahan replikasi atau modifikasi dasar
sebagai akibat dari bahan kimia alami
hadir dalam sel (oksigen, asam, dll)
Mutasi Induced
Mutasi yang dihasilkan dari pengaruh
faktor asing
Sinar-X, sinar UV, bahan kimia tidak
berasal dari seluler
Somatik vs kuman-line
Autosomal vs X-linked
Autosomal resesif
Fenotip umumnya tidak diamati generasi
pertama
Kecuali jika terjadi haploinsufisiensi
Diamati dengan gen yang mengkode
faktor transkripsi
Autosomal dominan
Disajikan oleh generasi pertama
X-linked dinyatakan dalam keadaan
hemizygous (laki-laki pada manusia)
Mutasi titik
Melibatkan nukleotida / basa tunggal
Pergantian, penghapusan atau
penambahan / penyisipan Sertakan
mutasi missense, omong kosong
mutasi dan mutasi diam
Berdasarkan efek pada protein setelah
terjemahan menggunakan kode genetik
Transisi vs transversi
Mutasi frameshift
Mengubah membaca frame coding urutan
protein
Contoh missense dan efek
frameshift
Hilangnya fungsi mutasi
Menghilangkan fungsi produk gen
Juga disebut mutasi nol atau KO gen
Gain fungsi mutasi
Berikan produk gen fungsi baru
Umumnya alel dominan
Dapat memberikan protein fungsi baru
atau menyebabkan efek regulasi untuk
mengekspresikan protein lama saat baru
atau dalam kondisi baru Efek gizi atau
biokimia
Auxotrophs Mikroba
Anemia sel sabit Manusia atau hemofilia
Pengelompokan catatan tidak selalu
eksklusif
Beberapa mutasi dapat jatuh ke dalam
lebih dari satu kelompok
Mutasi Perilaku
Perilaku kawin
Mutasi peraturan
Operator operon E. coli lac / promotor
wilayah
Mutasi Lethal
Hilangnya fungsi penting
Mutasi Bersyarat
Suhu mutasi sensitif
Kondisi membatasi Permisif vs
Mutasi netral
Umumnya terjadi pada bagian non-gen
dari genom dan tidak berpengaruh
pada produk gen / fungsi, tidak dipilih
untuk atau melawan
Mutasi yang diukur dalam dua cara:
0
.
Tingkat mutasi = probabilitas jenis tertentu
dari mutasi per satuan waktu (atau
generasi).
0
.
Frekuensi mutasi = berapa kali mutasi
tertentu terjadi pada populasi sel atau
individu.
Apa saja jenis mutasi
Memahami bagaimana setiap jenis
efek protein
Dapat mengidentifikasi mutasi yang
berbeda dari contoh-contoh dan
memprediksi efeknya pada protein
Jenis Mutasi
Mutasi tunggal Basis
Titik
Mutasi diam
Missense
Omong kosong
Frameshift
Tambahan
Penghapusan
Kromosom Mutasi
Inversi
Penghapusan
Pemindahan
Sebuah titik mutasi adalah
perubahan tunggal dalam urutan
nukleotida DNA. Perubahan ini terjadi
ketika 1 dasar diganti untuk basis
yang berbeda.
Nama lain untuk mutasi titik
adalah substitusi basa tunggal
Gambar di atas menunjukkan 5
kodon terakhir dari wildtype atau
mRNA normal. Dalam protein
normal empat asam amino terakhir
terpenuhi hionine, lys ine, phe
nolalanine, gly cine. Sebuah titik
mutasi adalah perubahan basa
tunggal.
Menemukan dasar yang mengubah &
menggunakan grafik kodon mRNA
untuk melihat bagaimana
efek protein. (Klik pada gambar di bawah ini
untuk memeriksa jawaban Anda)
?
mRNA kodon grafik
Dalam contoh ini, asam amino tidak
berubah. Jika Anda melihat grafik
kodon mRNA Anda akan melihat
bahwa dasar-3 sering tidak
berpengaruh pada asam amino. Hal ini
disebabkan teori goyangan.
Mutasi yang tidak berpengaruh
pada urutan asam amino yang disebut
mutasi diam
Dalam contoh di bawah ini, mutasi
masih mutasi titik karena hanya 1
basis dipertukarkan untuk yang lain.
Menemukan dasar yang
mengubah & menggunakan grafik
kodon mRNA untuk melihat
bagaimana efek protein. (Klik untuk
memeriksa jawaban Anda)
?
mRNA kodon grafik
Ketika mutasi terjadi dalam 1 atau 2
huruf di kodon selalu mengubah asam
amino.
Jenis mutasi disebut missense.
Meskipun hanya 1 asam amino
berubah, berkali-kali ini secara
drastis efek cara lipatan protein dan
bekerja.
Penyakit ini diwariskan, anemia sel
sabit, adalah contoh dari jenis mutasi.
Kembali
Jenis terakhir dari mutasi titik
disebut omong kosong.
Menemukan dasar yang
mengubah & menggunakan grafik
kodon mRNA untuk melihat
bagaimana efek protein. (Klik untuk
memeriksa jawaban Anda)
mRNA kodon grafik
?
?
?
?
Jenis terakhir dari mutasi titik disebut
omong kosong karena menempatkan
penghentian (kodon stop) pada awal,
sehingga memotong urutan asam
amino (protein) pendek.
Hal ini akan mengubah struktur
protein dan kemungkinan besar akan
mencegah protein dari melakukan
tugasnya sama sekali.
Kembali
0. Tentukan mRNA dan urutan asam
amino untuk untai DNA normal.
1. Tentukan mRNA dan asam amino
urutan untuk untai mutasi DNA.
2. Bandingkan helai bermutasi ke helai
normal.
3. Identifikasi jenis mutasi yang telah
terjadi.
ATGTTGGCTTTACGGATTTTGA
TACAACCGAAATGCCTAAAACT <- kode untuk
protein (template) mRNA =
Urutan Protein =
Perhatikan bahwa urutan DNA di atas
adalah standed ganda, tetapi hanya untai
bawah disalin ke mRNA
Klik di sini untuk memeriksa jawaban
Anda
ATGTTGGCTTTACGGATTTTGA
TACAACCGAAATGCCTAAAACT <- kode
untuk protein (template)
mRNA =
AUGUUGGCUUUACGGAUUUUGA Urutan
Protein = bertemu-leu-leu-ala-argile-leu
|.
Perhatikan bahwa urutan DNA di atas
adalah standed ganda, tetapi hanya untai
bawah disalin ke mRNA
ATGTTGGCCTTACGGATTTTGA
TACAACCGGAATGCCTAAAACT <- kode
untuk protein (template) mRNA =
Urutan Protein =
Bandingkan urutan DNA ini
dengan DNA normal.
Tampilkan di mana perubahan
terjadi.
Apa jenis mutasi disebut?
Apakah perubahan ini menyebabkan
urutan polipeptida berubah?
Kemungkinan konsekuensi bagi organisme
=
DNA normal:
ATGTTGGCTTTACGGATTTTGA
TACAACCGAAATGCCTAAAACT
ATGTTGGCCTTACGGATTTTGA
TACAACCG G AATGCCTAAAACT <- kode
untuk protein (template)
mRNA = AUGUUGGC C UUACGGAUUUUGA
Urutan Protein = bertemu-leu-leu-
alaarg-ile-leu |.
Bandingkan urutan DNA ini
dengan DNA normal.
Tampilkan di mana perubahan terjadi.
Dalam merah di atas
Apa jenis mutasi disebut Titik mutasi:?
Diam
Apakah perubahan ini menyebabkan
urutan polipeptida berubah? Tidak
Kemungkinan konsekuensi bagi
organisme = Tidak ada
Mutasi frameshift menyebabkan
frame pembacaan kodon bergeser. Hal
ini disebabkan oleh penambahan atau
penghapusan satu atau lebih
nukleotida.
Ketika ini terjadi pada gen, biasanya
hasilnya adalah suatu perubahan
drastis pada struktur protein bahwa
protein tidak dapat bekerja sama
sekali.
Contoh dari kerangka baca bergeser
yang terjadi dari penghapusan dapat
dilihat dalam kalimat di bawah ini:
Kalimat asli: kucing gemuk makan tikus
wee.
Bingkai pergeseran mutasi: Lemak ca
sebuah menebang eer tet at.
Pada contoh kalimat, satu huruf
dihapus dan ini bergeser semua huruf
setelah titik itu.
Hal ini menghasilkan protein
missense yang mungkin tidak akan
mampu untuk melipat dengan
benar.
Selama dua contoh pada halaman
berikut menentukan sebagai berikut:
Penambahan atau penghapusan
Gunakan grafik mRNA untuk melihat
bagaimana urutan asam amino
dipengaruhi
Memprediksi apakah perubahan tidak
akan berpengaruh, efek yang kecil, atau
pengaruh besar pada struktur protein
dan kemampuan untuk melakukan
tugasnya.
(Klik untuk memeriksa jawaban Anda)
mRNA kodon grafik
?
?
?
# 1
# 2
?
?
?
?
# 1: Penghapusan menyebabkan
missense . efek utama
# 2: Penambahan menyebabkan omong
kosong . Pengaruh besar
Penting untuk dicatat bahwa ini hanya contoh.
Kedua jenis mutasi frameshift dapat menyebabkan
salah satu missense atau omong kosong. Kedua hal
ini kemungkinan besar akan memiliki pengaruh
besar pada kedua struktur protein dan
kemampuannya untuk melakukan tugasnya.
mRNA kodon grafik
# 1
# 2
Mutasi kromosom adalah karena
perubahan besar dalam DNA.
Kalimat di bawah ini adalah contoh
dari mutasi kromosom.
Mengidentifikasi mana dari 3 jenis
itu.
Asli: The kucing gemuk makan tikus
wee.
Mutasi: The lemak tar eew eht eta tac.
(Klik untuk jawaban)
Inversi
Dalam semua kasus yang kita
melihat, mutasi dilakukan protein itu
sendiri. Namun, ada banyak jenis
mutasi yang tidak mengubah protein
itu sendiri tetapi perubahan di mana
dan berapa banyak protein dibuat.
Jenis sel yang membuat protein
Terlalu banyak atau terlalu sedikit
protein dibuat
Ketika protein dibuat
dibuat pada waktu yang salah
1
2
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
32
33