Anda di halaman 1dari 26

1

LAPORAN RESMI
PRAKTIKUM BIOLOGI MOLEKULER
PRAKTIKUM II
ANALISIS GEN DAN HOMOLOGI PROTEIN







Disusun Oleh :
Indra Irfanudin (115010734)
M. Ilzam Haq (115010735)


LABORATORIUM KIMIA FARMASI
FAKULTAS FARMASI
UNIVERSITAS WAHID HASYIM
SEMARANG
2012

2

PERCOBAAN 2
ANALISIS GEN DAN HOMOLOGI PROTEIN

I. TUJUAN
1. Mahasiswa mampu melakukan analisis terhadap ekspresi gen dan dapat
mendeteksi hasil ekspresi gen.
2. Mahasiswa dapat mencari homologi gen penghasil protein tertentu dari
manusia dengan gen beberapa organisme lain.

II. DASAR TEORI
1. Ekspresi Gen
Ekspresi gen adalah proses dimana informasi dari gen yang
digunakan dalam sintesis produk gen fungsional. Produk-produk ini
seringkali protein, tetapi dalam non-protein coding gen seperti gen rRNA
atau gen tRNA, produk adalah RNA fungsional. Proses ekspresi gen
digunakan oleh semua kehidupan yang dikenal - eukariota (termasuk
organisme multisel), prokariota (bakteri dan archaea) dan virus - untuk
menghasilkan mesin makromolekul untuk hidup (http://www.news-
medical.net/health/What-is-Gene-Expression-%28Indonesian%29.aspx,
2012)
Ekspresi gen terdiri dari dua tahap:
a. Transkripsi, proses pembuatan salinan RNA.
b. Translasi, proses sintesis polipeptida yang spesifik di dalam ribosom.
Proses transkripsi DNA menjadi mRNA dan translasi mRNA
menjadi sebuah polipeptida disebut dogma sentral (central dogma).
Dogma sentral berlaku pada prokariot dan eukariot. Namun, pada
eukariot ada tahap tambahan yang terjadi di antara transkripsi dan
3

translasi yang disebut tahap pre-mRNA. Tahap pre-mRNA adalah untuk
menyeleksi mRNA yang akan dikirim keluar nukleus untuk
ditranslasikan di ribosom. Ekson merupakan mRNA yang akan dikirim
keluar nukleus untuk ditranslasikan, sedangkan intron merupakan mRNA
yang akan tetap berada di dalam nukleus karena kemungkinan mRNA
tersebut akan membentuk protein yang tidak fungsional (tidak berguna)
jika ditranslasikan. Intron kemudian akan terurai kembali untuk
membentuk rantai mRNA baru (http://id.wikipedia.org/wiki/Gen, 2012)
Dalam ekspresi gen genetika adalah tingkat yang paling
mendasar di mana genotipe menimbulkan fenotip. Kode genetik adalah
"ditafsirkan" oleh ekspresi gen, dan sifat dari produk ekspresi
menimbulkan fenotipe organisme (http://www.news-
medical.net/health/What-is-Gene-Expression-%28Indonesian%29.aspx,
2012).
2. Homologi Protein
Homologi dipakai di bidang genetika bagi gen yang memiliki
kemiripan urutan (sekuens) basa DNA. Gen-gen yang homolog memiliki
banyak sekuens basa yang mirip, yang bila diekspresikan dapat
menghasilkan protein yang serupa dalam struktur dan fungsinya. Gen-
gen homolog ini, bila berasal dari spesies yang berbeda-beda, akan
membentuk keluarga gen (gene family) atau keluarga-besar gen (gene
superfamily). Apabila variasi sekuens ini menghasilkan protein dengan
fungsi berbeda atau tidak berfungsi, ia akan disebut sebagai alel.
Dari pengertian homologi ini kemudian diturunkan berbagai
istilah yang menggambarkan derajat kemiripan atau kejadian kemiripan
ini.
4

Kromosom yang homolog adalah kromosom yang berpasangan
(sinapsis) pada waktu proses meiosis (pada profase I) terjadi.
Pemasangan ini terjadi akibat kedua kromosom tersebut memiliki
kesamaan (tetapi tidak identik) pada urutan basanya
(http://id.wikipedia.org/wiki/Homologi_%28biologi%29, 2012).
Metode prediksi struktur protein yang ada saat ini dapat
dikategorikan kedalam dua kelompok, yaitu metode pemodelan protein
komperatif dan metode pemodelan de novo. Pemodelan protein
komperatif meramalkan suatu protein berdasarkan struktur protein yang
lain telah diketahui salah satu penerapan metode ini adalah pemodelan
homologi yaitu prediksi struktur tersier berdasarkan atas kesamaan
struktur primer protein.
Pemodelan homologi didasarkan atas teori bahwa dua protein
yang homolog memiliki struktur yang sangat mirip satu sama lain. Pada
metode ini struktur suatu protein disebut dengan protein target yang
diketahui dan memiliki kemiripan. Sekuens dengan protein target, selain
itu pemodelan komparatif adalah protein threading yang didasarkan atas
kemiripan struktur tanpa kemiripan sekuens primer, latar belakang
protein threading adalah bahwa struktur protein lebih dikonservasi
daripada sekuens protein selama evolusi.
Dalam pendekatan de novo atau abinito struktur primer di
tentukan dari sekuens primernya tanpa membandingkan dengan struktur
protein lain. Terdapat banyak kemungkinan misalnya dengan menirukan
proses pelipatan (folding) protein dari sekuens primer menjadi struktur
tersier misalnya dengan simulasi dinamika molekuler atau dengan
optimasi global fungsi energi protein. Prosedur-prosedur ini cenderung
membutuhkan proses komputasi yang intens sehingga saat ini hanya
5

digunakan dalam menentukkan struktur protein-protein kecil
(http://kuhascexpress.blogspot.com/2010/12/prediksi-struktur-
protein.html, 2012)
3. Estrogen Receptor 1
Reseptor estrogen mengacu pada sekelompok reseptor yang
diaktifkan oleh 17-estradiol hormon (estrogen). Dua jenis reseptor
estrogen yang ada: ER, yang merupakan anggota keluarga reseptor
hormon nuklir intraseluler, dan estrogen G protein-coupled reseptor
GPR30 (GPER), yang merupakan reseptor protein G-coupled. Artikel ini
merujuk ke ER reseptor hormon nuklir.
Fungsi utama dari reseptor estrogen sebagai faktor transkripsi
DNA-mengikat yang mengatur ekspresi gen. Namun, reseptor estrogen
memiliki fungsi tambahan independen dari mengikat DNA.
Kedua reseptor estrogen secara luas dinyatakan dalam jenis
jaringan yang berbeda, namun ada beberapa perbedaan penting dalam
pola ekspresi mereka:
a. ER ditemukan dalam endometrium, sel-sel kanker payudara, sel
stroma ovarium, dan hipotalamus Pada laki-laki, protein ER
ditemukan dalam epitel duktus eferen.
b. Ekspresi protein ER telah didokumentasikan dalam ginjal, otak,
tulang, jantung, paru-paru, mukosa usus, prostat, dan sel endotel.
Seluruh ERs dianggap akan reseptor sitoplasmik di negara
unliganded mereka, tetapi penelitian visualisasi telah menunjukkan
bahwa sebagian kecil dari seluruh ERs berada dalam inti. The "ER"
transkrip primer menimbulkan varian alternatif disambung beberapa
fungsi yang tidak diketahui.
6

Ada dua bentuk yang berbeda dari reseptor estrogen, biasanya
disebut sebagai dan , masing-masing dikodekan oleh gen terpisah
(ESR1 dan ESR2, masing-masing). Hormon-reseptor estrogen yang
diaktifkan bentuk dimer, dan, karena dua bentuk yang coexpressed di
banyak jenis sel, reseptor dapat membentuk ER () atau ER ()
homodimers atau ER () heterodimer. Estrogen reseptor alfa dan beta
menunjukkan homologi urutan signifikan secara keseluruhan, dan kedua
terdiri dari lima domain (http://en.wikipedia.org/wiki/Estrogen_receptor,
2012).
Reseptor estrogen 1 mengkodekan reseptor estrogen, suatu
ligan-faktor transkripsi yang diaktifkan terdiri dari beberapa domain
penting untuk mengikat hormon, mengikat DNA, dan aktivasi transkripsi.
Protein melokalisasi ke inti di mana ia mungkin membentuk homodimer
atau heterodimer dengan reseptor estrogen 2. Estrogen dan reseptornya
sangat penting untuk perkembangan seksual dan fungsi reproduksi, tetapi
juga memainkan peran dalam jaringan lain seperti tulang. Reseptor
estrogen juga terlibat dalam proses patologis termasuk kanker payudara,
kanker endometrium, dan osteoporosis. Alternatif splicing transkrip hasil
dalam beberapa varian, yang berbeda dalam UTRs 5 mereka dan
menggunakan promotor berbeda
(http://www.ncbi.nlm.nih.gov/gene/2099, 2012).
4. KCNE1-like (KSNE1L)
KCNE1-seperti juga dikenal sebagai KCNE1L adalah protein
yang pada manusia dikodekan oleh gen KCNE1L
(http://en.wikipedia.org/wiki/KCNE1L, 2012).
Tegangan-gated kalium (Kv) saluran mewakili kelas paling
kompleks dari tegangan-gated ion channel dari sudut pandang fungsional
7

dan struktural. Berbagai fungsi mereka termasuk rilis neurotransmiter
yang mengatur, denyut jantung, sekresi insulin, rangsangan saraf,
transportasi elektrolit epitel, kontraksi otot polos, dan volume sel. Gen ini
mengkode protein membran yang memiliki kemiripan urutan dengan
produk gen KCNE1, anggota saluran kalium, tegangan-gated, ISK-terkait
subfamili. Gen ini intronless dihapus dalam sindrom gen AMME
berdekatan dan mungkin terlibat dalam kelainan jantung dan neurologis
ditemukan dalam gen sindrom AMME berdekatan
(http://www.ncbi.nlm.nih.gov/gene/23630, 2012).


















8



III. CARA KERJA
1. Analisis Ekspresi Gen
Buka situs NCBI (www.ncbi.nlm.nih.gov).

Isi kotak search nucleotide for dengan nama gen (kode gen) yang akan
dianalisis (NM_012282).

Pilih gen yang akan dianalisis.

Copy sekuens dalam region CDS.

Buka situs NCBI lagi kemudian klik ORF Finder (buka situs
www.ncbi.nlm,nih.gov/gorf/gorf.html)

Masukkan sekuens CDS yang telah dicopy ke kolom FASTA Format-V.

Klik OrfFind, akan muncul 6 frame.


Klik frame tersebut satu persatu maka akan muncul sekuen asam amino
hasil transkripsi dari CDS yang telah dimasuki tadi. Carilah frame mana
yang merupakan sekuens gen pengkode protein target dengan
mencocokkam sekuen asam amino yang didapat dengan sekuen asam
amino pada tampilan awal identitas gen.

9



2. Homologi protein
Buka situs NCBI (www.ncbi.nlm.nih.gov).

Isi kotak search nucleotide for dengan nama gen (kode gen) yang akan
dianalisis (NM_000125 dan NM_012282).

Tentukan gen yang akan dianalisis homologi proteinnya, copy kode
proteinnya.

Buka situs NCBI lagi, masukkan kode protein pada kotak search protein,
KLIK.

Copy sekuens asam aminonya.

Klik menu BLAST, paste sekuens asam amino pada kotak QUERY untuk
mencari homologinya.

Tekan BLAST.



Lakukan analisis lebih lanjut mengenai homologi protein terhadap
sekuens asam amino yang dimasukkan tadi, yaitu pada organisme lain
selain Homo sapiens, perhatikan scorenya.

10



IV. ANALISIS DATA
1. Analisis Ekspresi Gen
Kode Gen : NM_000075.2
Nama Gen : Homo sapiens cyclin-dependent kinase 4
CDS : 288 - 1139
Panjang : 690 base pair
Hasil ORF Finder
Frame ORF
Asam
Amino
Panjang
Start
Kodon
Stop
Kodon
+1 1 229 690 7 ATG 1 TGA
+2 1 38 117 1 ATG 1 TGA
+2 1 40 123 2 ATG 1 TGA
-1 1 36 111 2 ATG 1 TAA
-2 1 97 293 1 ATG 1 TAA


ORF Finder (Open Reading
Frame Finder)
PubMed Entrez BLAST OMIM Taxonomy Structure
Anonymous












Frame

from

to Length
+1 163 .. 851 690
-2 1 .. 293 293
+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111



11



a. Frame +1
b.










Length: 229 aa
c. 163 atggacgtctgtgccacatcccgaactgaccgggagatcaaggta
d. M D V C A T S R T D R E I K V
e. 208 accctggtgtttgagcatgtagaccaggacctaaggacatatctg
f. T L V F E H V D Q D L R T Y L
g. 253 gacaaggcacccccaccaggcttgccagccgaaacgatcaaggat
h. D K A P P P G L P A E T I K D
i. 298 ctgatgcgccagtttctaagaggcctagatttccttcatgccaat
j. L M R Q F L R G L D F L H A N
k. 343 tgcatcgttcaccgagatctgaagccagagaacattctggtgaca
l. C I V H R D L K P E N I L V T
m. 388 agtggtggaacagtcaagctggctgactttggcctggccagaatc
n. S G G T V K L A D F G L A R I
o. 433 tacagctaccagatggcacttacacccgtggttgttacactctgg
p. Y S Y Q M A L T P V V V T L W
q. 478 taccgagctcccgaagttcttctgcagtccacatatgcaacacct
r. Y R A P E V L L Q S T Y A T P
s. 523 gtggacatgtggagtgttggctgtatctttgcagagatgtttcgt
t. V D M W S V G C I F A E M F R
u. 568 cgaaagcctctcttctgtggaaactctgaagccgaccagttgggc
v. R K P L F C G N S E A D Q L G
w. 613 aaaatctttgacctgattgggctgcctccagaggatgactggcct
x. K I F D L I G L P P E D D W P
y. 658 cgagatgtatccctgccccgtggagcctttccccccagagggccc
z. R D V S L P R G A F P P R G P
aa. 703
cgcccagtgcagtcggtggtacctgagatggaggagtcgggagca
bb. R P V Q S V V P E M E E S G
A
cc. 748
cagctgctgctggaaatgctgacttttaacccacacaagcgaatc
dd. Q L L L E M L T F N P H K R
I
ee. 793
tctgcctttcgagctctgcagcactcttatctacataaggatgaa
ff. S A F R A L Q H S Y L H K D
E
gg. 838 ggtaatccggagtga 852
hh. G N P E *
Frame from to Length
+1 163 .. 851 690
-2 1 .. 293 293
12

+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111

b) Frame +2
c)










Length: 38 aa
d) 512
atgcaacacctgtggacatgtggagtgttggctgtatctttgcag
e) M Q H L W T C G V L A V S L Q
f) 557
agatgtttcgtcgaaagcctctcttctgtggaaactctgaagccg
g) R C F V E S L S S V E T L K P
h) 602 accagttgggcaaaatctttgacctga 628
i) T S W A K S L T *
Frame from to Length
+1 163 .. 851 690
-2 1 .. 293 293
+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111



c) frame +2
d)










Length: 40 aa
13

e) 647
atgactggcctcgagatgtatccctgccccgtggagcctttcccc
f) M T G L E M Y P C P V E P F P
g) 692
ccagagggccccgcccagtgcagtcggtggtacctgagatggagg
h) P E G P A Q C S R W Y L R W R
i) 737 agtcgggagcacagctgctgctggaaatgctga 769
j) S R E H S C C W K C *
Frame from to Length
+1 163 .. 851 690
-2 1 .. 293 293
+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111



d) Frame -1
e)










Length: 36 aa
f) 225 atgctcaaacaccagggttaccttgatctcccggtcagttcggga
g) M L K H Q G Y L D L P V S S G
h) 180 tgtggcacagacgtccatcagccggacaacattgggatgctcaaa
i) C G T D V H Q P D N I G M L K
j) 135 agcctccagtcgcctcagtaa 115
k) S L Q S P Q *
Frame from to Length
+1 163 .. 851 690
-2 1 .. 293 293
+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111





14



e) Frame -2
f)










Length: 97 aa
g) 293 ttgatcgtttcggctggcaagcctggtgggggtgccttgtccaga
h) L I V S A G K P G G G A L S R
i) 248 tatgtccttaggtcctggtctacatgctcaaacaccagggttacc
j) Y V L R S W S T C S N T R V T
k) 203 ttgatctcccggtcagttcgggatgtggcacagacgtccatcagc
l) L I S R S V R D V A Q T S I S
m) 158 cggacaacattgggatgctcaaaagcctccagtcgcctcagtaaa
n) R T T L G C S K A S S R L S K
o) 113 gccacctcacgaactgtgctgatgggaaggcctcctccacctcct
p) A T S R T V L M G R P P P P P
q) 68 cctccattggggactctcacactcttgagggccacaaagtggcca
r) P P L G T L T L L R A T K W P
s) 23 ctgtggggatcacgggccttgta 1
t) L W G S R A L
Frame from to Length
+1 163 .. 851 690
-2 1 .. 293 293
+2 647 .. 769 123
+2 512 .. 628 117
-1 115 .. 225 111

Frame yang merupakan sekuen pengkode protein target yaitu frame
+1.






15



2. Homologi Protein
a. Homo sapiens Estrogen Receptor Isoform 1
Kode mRNA : NM_000125
Kode Protein : NP_000116.2
Nama Protein : Homo sapiens estrogen receptor isoform 1
No. Kode Spesies Score bit
1. NP_000116.2 Homo sapiens 1241
2. NP_001158059.1 Papio Anubis 1225
3. NP_001001443.1 Bos Taurus 1146
4. NP_001019402.1 Felis catus 1127
5. NP_999385.1 Sus scrofa 1122
6. NP_001075241.1 Equus caballus 1094
7. NP_031982.1 Mus musculus 1092
8. NP_036821.1 Rattus norveqiucus 1064
9. NP_990514.1 Gallus gallus 977
10. NP_001070169.1 Taeniopygia guttata 969
11. NP_0010883084.2 Xenopus laevis 845
12. NP_988866.1 Xenopus (Silurana) tropicalis 766
Homologi :
Protein ini homolog dengan protein pada Papio anubis, dilihat
dari kedekatan nilai score bit.

16





b. Potassium voltage-gated channel subfamily E member 1-like
protein [Homo sapiens]
Kode mRNA : NM_012282
Kode Protein : NP_036414
17

Nama Protein : Potassium voltage-gated channel subfamily
E member 1-like protein [Homo sapiens]
No. Kode Spesies Score bit
1. NP_0336414.1 Homo sapiens 286
2. NP_001071343.1 Bos Taurus 218
3. NP_001094473.1 Rattus novergicus 196
4. NP_067462.1 Mus musculus 186
5. NP_001082344.1 Zenopus laevis 86,7
6. NP_065599.1 Mus musculus 47,8
7. NP_071571.1 Rattus novergicus 47,8
8. NP_005463.1 Homo sapiens 47,8
9. NP_999258.1 Sus scrofa 46,6
10. NP_001082346.1 Xenopus laevis 43,1
11. NP_001009206.1 Felis catus 36,2
12. NP_001103292.1 Oryctolagus cuniculus 36,2
13. NP_037105.1 Rattus novergicus 35
14. NP_999330.1 Sus scrofa 35
15. NP_032450.1 Mus musculus 35
16. NP_001071445.1 Bos Taurus 34,7
17. NP_000210.2 Homo sapiens 34,7

Homologi :
Protein ini homolog dengan protein pada Bos taurus, dilihat dari
kedekatan nilai score bit.

18








c. Klasifikasi Ilmiah
1) Homo sapiens
19


(http://id.wikipedia.org/wiki/Manusia, 2012)
2) Papio anubis

(http://en.wikipedia.org/wiki/Olive_baboon, 2012)



3) Bos taurus

(http://id.wikipedia.org/wiki/Sapi, 2012)
20

4) Felis catus

(http://en.wikipedia.org/wiki/Cat, 2012)
5) Sus scrofa

(http://id.wikipedia.org/wiki/Babi_hutan, 2012)



6) Equus caballus

(http://en.wikipedia.org/wiki/Horse, 2012)
7) Mus musculus
21


(http://en.wikipedia.org/wiki/House_mouse, 2012)
8) Rattus norvegicus

(http://en.wikipedia.org/wiki/Brown_rat, 2012)

9) Gallus gallus

(http://id.wikipedia.org/wiki/Ayam_hutan, 2012)
22

10) Taeniopygia guttata


(http://commons.wikimedia.org/wiki/Taeniopygia_guttata,2012)
11) Xenopus laevis

(http://en.wikipedia.org/wiki/African_clawed_frog, 2012)




12) Xenopus (Silurana) tropicalis

(http://en.wikipedia.org/wiki/Western_clawed_frog, 2012)
23

13) Oryctolagus cuniculus

(http://en.wikipedia.org/wiki/European_Rabbit, 2012)

V. PEMBAHASAN
Pada praktikum ini dilakukan analisis ekspresi gen dan homologi
protein. Analisis ekspresi gen dilakukan pada gen dengan kode NM_000075.2
yaitu gen cyclin-dependent pada homo sapiens. Sekuens yang digunakan
yaitu pada daerah origin CDS pada pasangan basa 288-1139. Pasangan basa
tersebut dicopy, kemudian di-pastekan pada Orf finder sehingga didapatkan 5
frame.
1. Frame +1 mempunyai 7 start kodon dan 1 stop kodon. Frame ini
mempunyai panjang 690 pasangan basa dan 229 asam amino. Pada
frame ini terdapat lebih dari satu start kodon, hal ini karena dalam setiap
rantai asam amino mungkin terdapat lebih dari satu metionin, sehingga
pada frame ini terdapat lebih dari 1 start kodon, dimana start kodon
tersebut akan ditranslasikan menjadi metionin.
2. Pada frame +2 mempunyai panjang 117 pasangan basa dan 38 asam
amino. Frame ini mempunyai satu start kodon dan satu stop kodon.
3. Frame +2 mempunyai panjang 123 pasangan basa dan 40 asam amino,
pada frame ini terdapat 2 start kodon dan 1 stop kodon,
24

4. Frame -1 mempunyai panjang 111 pasangan basa dan 36 asam amino,
pada frame ini terdapat 2 start kodon dan 1 stop kodon
5. Frame -2 mempunyai panjang 293 pasangan basa dan 97 asam amino.
Pada frame ini terdapat satu start kodon dan satu stop kodon.

Untuk mendapatkan sekuen gen pengkode protein target, masing-
masing frame dicocokkan sekuens asam amino yang didapat pada frame
dengan sekuens asam amino pada identitas awal gen. Dari kelima frame
tersebut, kesamaan sekuens asam amino dengan sekuens asam amino pada
identitas awal gen didapatkan pada frame +1, sehingga frame +1 merupakan
sekuen pengkode protein target.

Pencarian homologi protein dilakukan pada dua gen, yaitu gen
dengan kode NM_000125 dan NM_000075.2.
1. NM_000125 mengekspresikan protein dengan kode NP_000116.2
(Homo sapiens estrogen receptor isoform 1). Dari percobaan didapatkan
bahwa protein tersebut homolog dengan protein pada Papio anubis
(Olive baboon),
2. NM_000075.2 mengekspresikan protein dengan kode NP_000066.1
(Homo sapiens cyclin-dependent kinase 4). Dari percobaan didapatkan
bahwa protein ini homolog dengan protein pada synthetic construct.
Homologi protein adalah kemiripan struktus protein, pada praktikum
ini dilihat kemiripan struktur protein tertentu pada manusia dengan protein
pada organisme lain. Homologi protein dilihat dari maxsimal score yang
paling mendekati dengan maximal score pada manusia.
Uji homologi protein ini sangat berguna pada manusia dan dapat
digunakan untuk menggantikan protein secara eksogen apabila dalam tubuh
25

manusia gagal mengahsilkan protein endogen. Misalnya pada penderita
diabetes yang mengalami kerusakan sel dimana produksi insulin endogen
menurun dan kebutuhan insulin tidak tercukupi, sehingga membutuhkan
insulin eksogen. Dengan homologi protein maka dapat dicari insulin pada
organisme lain yang mempunyai kemiripan sangat tinggi dengan insulin pada
manusia, yang kemudian dapat digunakan sebagai terapi insulin eksogen.



VI. KESIMPULAN
1. Frame +1 merupakan sekuen pengkode protein target pada gen Homo
sapiens cyclin-dependent kinase 4
2. Protein Homo sapiens estrogen receptor isoform 1 homolog dengan
protein Papio anubis estrogen receptor isoform 1.
3. Protein Homo sapiens cyclin-dependent kinase 4 homolog dengan
protein synthetic construct cyclin-dependent kinase 4











26

VII. DAFTAR PUSTAKA

http://www.news-medical.net/health/What-is-Gene-Expression%28Indonesian%
29.aspx, diakses pada tanggal 2 Desember 2012
http://id.wikipedia.org/wiki/Gen, diakses pada tanggal 2 Desember 2012
http://id.wikipedia.org/wiki/Homologi_%28biologi%29, diakses pada tanggal 2
Desember 2012
http://kuhascexpress.blogspot.com/2010/12/prediksi-struktur-protein.html,
diakses pada tanggal 2 Desember 2012
http://en.wikipedia.org/wiki/Estrogen_receptor, diakses pada tanggal 2 Desember
2012
http://www.ncbi.nlm.nih.gov/gene/2099, diakses pada tanggal 2 Desember 2012.
http://en.wikipedia.org/wiki/KCNE1L, diakses pada tanggal 2 Desember 2012.
http://www.ncbi.nlm.nih.gov/gene/23630, diakses pada tanggal 2 Desember 2012.
http://id.wikipedia.org/wiki/Manusia, diakses pada tanggal 2 Desember 2012
http://en.wikipedia.org/wiki/Olive_baboon, diakses pada tanggal 2 Desember
2012.
http://id.wikipedia.org/wiki/Sapi, diakses pada tanggal 2 Desember 2012.
http://en.wikipedia.org/wiki/Cat, diakses pada tanggal 2 Desember 2012.
http://id.wikipedia.org/wiki/Babi_hutan, diakses pada tanggal 2 Desember 2012.
http://en.wikipedia.org/wiki/Horse, diakses pada tanggal 2 Desember 2012.
http://en.wikipedia.org/wiki/House_mouse, diakses pada tanggal 2 Desember
2012.
http://en.wikipedia.org/wiki/Brown_rat, diakses pada tanggal 2 Desember 2012.
http://id.wikipedia.org/wiki/Ayam_hutan, diakses pada tanggal 2 Desember 2012.
http://en.wikipedia.org/wiki/African_clawed_frog, diakses pada tanggal 9 Januari
2012.