ABSTRACT

Purpose: To assess WDR36 gene (exon 18) polymorphisms are associated with primary

open angle glaucoma (POAG) in the South Indian population.

Methods: 20 with POAG, including normal tension glaucoma and high tension

glaucoma and 10 control subjects without glaucoma were analyzed for one WDR36

polymorphisms (V714V; a G→C substitution in exon 18) using allele specific primer

PCR and RFLP respectively.

Results: No significant difference was observed regarding the WDR36 genotype

frequencies at exon 18 between the NTG or HTG patients and the control subjects. In

addition, there was no significant difference in the WDR36 allele frequencies at exon 18

between the NTG or HTG patients and the control subjects. V714V mutation in exon 18

was not found in this study.

Conclusion: WDR36 exon 18 polymorphism is a genetic risk factor for POAG however

WDR36 exon 18 polymorphisms were not detected in POAG patients in the South

Indian population. It has been concluded that the WDR36 polymorphism occurs very

rarely in South Indian glaucoma patients. The other genes would have played crucial

role in the development of POAG in South India.

1
 INTRODUCTION

Glaucoma refers to a group of clinically and genetically heterogeneous

ophthalmologic disorders leading to visual impairment and blindness. The characteristic

clinical sign is cupping of the optic nerve head with subsequent retinal nerve fibers loss,

usually associated with elevated intraocular pressure. The disease affects more than 67

million people worldwide (Quigley, 1996).

Epidemiologic studies have repeatedly confirmed that primary open-angle

glaucoma (POAG), the most common adult form of the disease, is one of the main

causes of blindness (8%) in European populations. (Klaver et al., 1998 and Tuck et al.,

2003).

The age of onset of glaucoma manifestation ranges from birth to late adulthood.

Affected individuals are usually asymptomatic until the late stages of disease, when

significant and irreversible optic nerve degeneration has already occurred.(Fechtner et

al., 1994) As glaucoma-related visual loss is preventable in many cases and as the

sensitivity of current diagnostic methods is suboptimal, there is an urgent need to

diagnose glaucoma in its early stages.(Viswanathan et al.,1999 and Ritch, 2000)

Identification of the genes involved in the etiology of glaucoma provides a significant

opportunity for presymptomatic diagnosis, improved prognosis, and better

understanding of the etiology of this blinding condition.

Although many cases are sporadic, POAG shows familial clustering consistent

with autosomal dominant inheritance and incomplete penetrance. Reduced penetrance

and excess of sporadic cases is particularly seen in late-onset forms. Nevertheless, more

than 11 (GLC1A-GLC1M) different POAG loci have been mapped so far.(Sarfarazi et

al 1998, Stoilova et al.,1996, Trifan OC et al., 1998, Wirtz et al.,1999, Wiggs et

al.,2000 and 2004).

2
 During the past decade, two genes have been reported for POAG: myocilin

(MYOC) on chromosome 1, long-arm region q24.3-q25.2, primarily mutated in

juvenile-onset patients,(Stone et al .,1997) and optineurin (OPTN) on chromosome 10,

short-arm region p14-p15, mainly mutated in individuals with normal-tension glaucoma

(NTG).(Rezaie et al., 2002 and Sarfarazi et al., 2003) Although investigators in several

studies have consistently found mutations in MYOC in approximately 3% of cases

including the German population (3.2%),(Michels-Rautenstrauss et al.,2002) mutations

in OPTN seem to be a rather infrequent cause of POAG or NTG.(Weisschuh et al.,

2005 and Wiggs et al.,2003) In a recent study, a new POAG locus was identified on

chromosome 5, region q22.1 (designated as GLC1G). Screening of the WD40-repeat 36

gene (WDR36) in 130 patients with an adult-onset form of glaucoma with high and low

pressure identified mutations in approximately 5% of patients. Both familial and

sporadic cases were affected. (Monemi et al., 2005)

WD40-repeats are stretches of 40 amino acids that contain tryptophan (W) and

aspartic acid (D). WD-repeat–containing proteins comprise a large family found in all

eukaryotes and are implicated in a variety of functions ranging from signal transduction

and transcription regulation to cell cycle control and apoptosis. The underlying common

function of all WD-repeat proteins is coordinating multiprotein complex assemblies,

where the repeating units serve as a rigid scaffold for protein interactions. Based on

sequence similarity, WDR36 was proposed to contain five (Mao M et al., 2004) to eight

(Monemi et al., 2005) WD40 repeats. In addition, WDR36 contains a C-terminal UTP21

domain that is specifically associated with WD40 repeats (Bateman et al., 2002) as well

as sequence stretches that are characteristic for AMP-binding or which exhibit structural

similarity to the C-terminal part of cytochrome cd119.

3
 Expression of WDR36 was shown in human ocular and nonocular tissues as well

as in embryonic and adult mouse tissues.(Monemi et al., 2005) It has been suggested

that WDR36 may be involved in T-cell activation (Mao et al., 2004) and recently, T-

cell-mediated responses have been hypothesized to participate in glaucoma-associated

optic nerve degeneration.(Bakalash et al., 2005) However, the exact physiological

function of the protein and its role in glaucoma pathogenesis remain unclear.

The purpose of this study was to determine the prevalence of WDR36 V714V

sequence variants in a well-characterized group of 20 unrelated South Indian patients

with POAG, NTG, or juvenile open-angle glaucoma (JOAG).

4
 REVIEW OF LITERATURE

Glaucomas are a group of optic neuropathies that, if untreated, can result in total

blindness. The condition is classified according to the etiology (primary versus

secondary), anatomy of the anterior chamber (open angle versus closed angle) and time

of onset (infantile versus juvenile versus adult) (Shields et al., 1996). However, a more

precise classification of this condition may only be possible when all the etiological

factors, including primary defective molecules and other contributing risk factors, are

identified.

Different forms of glaucoma share some common clinical manifestations that

usually include specific abnormal appearance of the optic nerve head, characteristic loss

of the visual field and chronic painless progression. Furthermore, the condition

frequently is associated with increased intraocular pressure (IOP), but this elevation is

neither necessary nor sufficient for onset or progression of the disease (Shields et al.,

1996).

The manifestation of this group of eye conditions could start at birth or may

appear after the age of 80, depending on the type of glaucoma present in an individual.

The pediatric form of glaucoma (Buphthalmos) usually occurs at birth and up to the age

of three, while juvenile-onset glaucoma may appear somewhere between the ages of 3

and 30 (Johnson et al., 1993). The late-onset form of this condition rarely starts before

the age of 40 and is the most prevalent type observed in an everyday glaucoma clinic

(Quigley, 1996). The pediatric and juvenile types of glaucoma are generally rare

conditions and, while the incidence of the primary congenital type varies between 1 in

1250 (Gencik, 1989). and 1 in 10 000 (Francois, 1972) , no comparable estimates are

available for the juvenile-onset type of glaucoma.

5
 Although a large number of affected subjects have no previous family history

(Quigley et al., 1997), a significant proportion show a clear familial aggregation with

multiply affected subjects in their respective pedigrees (Raymond, 1997). Whereas the

main mode of inheritance for primary congenital glaucoma is autosomal recessive

(Sarfarazi. et al., 1995), for juvenile and adult-onset glaucoma the more frequently

reported mode of inheritance is autosomal dominant with reduced penetrance (Bennett

et al., 1989). A significant proportion of other ocular conditions associated with

glaucoma are also inherited as autosomal dominant traits (Anderson et al., 1997).

In this article, the molecular genetics of different types of glaucoma will be

reviewed in order to provide some insight into the molecular etiology of two well

studied types of glaucoma, namely, the juvenile-onset primary open angle glaucoma and

the pediatric form of primary congenital glaucoma. A brief summary on the current

status of other types of ocular conditions associated with glaucoma will also be

presented.

PRIMARY OPEN ANGLE GLAUCOMA (POAG)

This is the most common form of this group of eye conditions, usually

accompanied with variable severity and phenotypic expressivity (Shields, et al., 1996).

The clinical manifestation is further complicated with IOP measurements that could

vary from 10 to >50 mm Hg. POAG have been arbitrarily divided into two groups of

juvenile and adult with an overlapping clinical presentation and a sliding scale age of

onset and IOP values (Shields et al., 1996). Although there are some differences

between the rare form of juvenile-onset open angle glaucoma (JOAG) as compared with

the more frequent form of adult-onset chronic open angle glaucoma (COAG), the

clinical diagnosis of both groups are based on the presentation of visual field loss,

6
glaucomatous changes of the optic nerve and optic nerve damage that is usually

accompanied with an increased IOP. Apart from the clear differences in the age of

diagnosis in these two groups of POAG, the condition in juvenile subjects is more

severe, presenting with significantly higher IOPs (i.e., >40-50 mm Hg) that usually does

not respond to drug treatment, and, therefore, lowering of the IOPs through multiple

surgical interventions is a necessity (Johnson et al., 1993 ). In contrast, the late-onset

form has a quite different phenotype, usually with a milder presentation, progressive

development, moderate elevation of IOP and medical treatments often yield a

satisfactory outcome (Jay et al., 1993). The painless progression often leads to a late

diagnosis, when irreversible damage to the optic nerve has already occurred, thus

complicating the prognosis of this type of POAG.

Although there is some controversy about the exact mode of inheritance in these

two groups of eye condition, pedigree structure of the majority of families used in

genetic linkage analysis clearly suggest that inheritance is autosomal dominant with an

incomplete penetrance.

JUVENILE-ONSET PRIMARY OPEN ANGLE GLAUCOMA (JOAG)

A new page in the molecular genetic study of JOAG was opened in early 1993,

when using a single large American family, (Sheffield et al., 1993). localized the first

locus for this type of glaucoma. The locus was mapped to the 1q21-q31 region and

named GLC1A (note: use of GLC1 symbol for all types of POAG has been approved by

the HUGO Nomenclature Committee; the letters A, B, C, etc. will be assigned to each

newly identified locus). After this initial report, the efforts of other investigators from

the US and Europe were focused on testing additional glaucoma families from different

genetic backgrounds.

7
Confirmation of this initial linkage was soon followed in another American JOAG

family Richards, 1994, families with Irish, British and German backgrounds Wiggs et

al., 1994 , two French families (Meyer et al., 1994) and one large Danish family (Graff

et al., 1995).

Morissette et al. reported linkage in a multigeneration French-Canadian family

with 142 members of whom 40 were affected. Based on the age of detection, the authors

divided the glaucoma patients into two groups of JOAG and COAG. In this study, 36

subjects were diagnosed between the ages of 25 and 35 and, therefore, classified as

having JOAG, while four subjects were diagnosed after the age of 40 and considered as

COAG. Six other members were diagnosed with ocular hypertension and several other

asymptomatic obligate carriers were also identified. The authors concluded that the

GLC1A locus is responsible for both juvenile- and adult-onset POAG. A second family

also presented with variable age of onset of POAG linked to the GLC1A locus. Twenty

family members developed glaucoma between 11 and 51 years of age (median 36). A

35 year old healthy female had a severely affected daughter and therefore classified as a

case of incomplete penetrance. Nine more normal family members aged from 14 to 66

had also inherited the affected haplotype.

Clinical features in the affected individuals from all of the families reported so

far were very similar and conformed to the typical form of juvenile-onset primary open

angle glaucoma. Despite the existing variability in the exact age of detection, the

majority of the patients were diagnosed with glaucoma in childhood to early adulthood

(average 18 years). The IOP was typically very high, often in the range of 40-50 mm

Hg. Medical treatment was initially effective, but surgery was required to control the

progress of glaucoma.

8
RECENT DEVELOPMENTS

A number of new mutations in the TIGR gene were presented recently (Annual

Meeting of ARVO, The Association for Research in Vision and Ophthalmology, 1997).

A total of 14 mutations in exon III and a number of new polymorphisms in exon I

and/or 5' end of this gene were reported (Fingert et al., 1997). Additional mutations

were also indicated by other groups in JOAG families from Italy Pirastu et al., 1997,

Germany (Budde et al., 1997, France Brezin et al., 1997) and Canada. We have also

identified a mutation in one family from Edinburgh, Scotland (Stoilova et al., 1997).

The only deletion of 3 bp in exon III was reported in four families from a small southern

Italian village where all individuals carry a common haplotype. This mutation most

likely resulted from a founder effect with a common ancestral mutation (Pirastu et al.,

1997). However, most of the reported sequence changes in the TIGR gene are missense

mutations that are clustered in exon III.

One other interesting patient has been described who is hemizygous for the

GLC1A region (Vollrath et al., 1997). This patient is 24 years of age and has no clinical

evidence of glaucoma. The deletion of DNA markers in this subject included a 10 cM

interval that contained the GLC1A locus. Therefore, it was indicated that the loss of

function of one of the copies of the GLC1A gene (i.e., haploinsufficiency) in this patient

would not be the cause of this type of glaucoma. However, it is still likely that this

patient will develop glaucoma at a later stage of life and that the haploinsufficiency

detected in this subject may still be adequate to cause the phenotype, a phenomena that

has recently been reported for the chromosome 4q-linked Rieger syndrome (Flomen et

al., 1997).

9
 Another interesting piece of evidence is presented in a large French-Canadian

pedigree that has previously been shown to be segregating for the GLC1A locus in

which four subjects born to two affected parents inherited two copies of the affected

GLC1A haplotype from their parents, but all were clinically normal for glaucoma.

These patients were aged between 41 and 49 and they have already produced two

clinically affected offspring who have inherited only a single affected haplotype. This

observation indicated that homoallelic complementation of the affected haplotypes is a

likely mechanism to account for these phenotypically normal homozygous affected

carrying haplotype subjects. If these patients do not share the same TIGR mutation with

other branches of the pedigree, a separate mutation in another part of the genome or

mutation in one of the closely located genes within the GLC1A critical region could be

responsible for this observation. This is likely as in the same pedigree, another two

affected subjects (one with low-tension and another with angle-closure glaucoma) were

described neither of whom carry the common affected haplotype. Therefore, this may

indicate that for such a large pedigree, one should expect to see phenocopies for the

glaucoma phenotype, perhaps more than once.

ADULT-ONSET CHRONIC OPEN ANGLE GLAUCOMA (COAG)

The adult-onset chronic open angle glaucoma (COAG) has the highest

prevalence/incidence in Western societies. In these patients angle of the anterior

chamber is normal and the optic nerve undergoes a characteristic atrophy that results in

visual field loss and eventual blindness. Some patients have elevated IOP, but other

confirmed open angle glaucoma patients have a `screening' IOP within the statistically

normal range (Grosskreutz et al .,1994) . For this form of glaucoma, the onset is usually

after the age of 40, but the majority of sufferers exhibit the disease even at later stages

of life, usually after the ages of 50 or 60.

10
 This has had a serious implication for diagnosis and proper treatment. As a

consequence, it has been difficult to determine the exact mode of inheritance for this

type of glaucoma, as the majority of these patients are either isolated cases, or by the

time of first presentation, their parents are deceased and, therefore, no accurate clinical

data or systematic ophthalmic information is available from previous generations.

Therefore, autosomal dominant, autosomal recessive, X-linked and multifactorial modes

of inheritance have been suggested for this condition Netland et al., 1993. However, in

the majority of families that have been systematically studied, the autosomal dominant

mode of inheritance with reduced penetrance has been suggested (Avramopolus et

al.,1996).

PRIMARY CONGENITAL GLAUCOMA (PCG) OR BUPHTHALMOS

Primary congenital or infantile glaucoma (gene symbol, GLC3) is a specific

inherited eye disorder that manifests itself in early childhood, usually within the first

year of life, but may emerge up to the age of 3. The incidence is 1:1250 in the Gypsy

population of Slovakia, 1:2500 in the Middle Eastern Turacli et al., 1992 and between

1:5000 and 1:10 000 in the Western countries. Although the familial forms of this

condition have an autosomal recessive mode of inheritance, some apparent vertical

transmission in some families may be explained by pseudo-dominance (Stoilov et al.,

1997. Association of congenital glaucoma with chromosomal abnormalities of at least

17 different autosomes has also been reported in the literature Schinzel, A. 1984).

Glaucoma in these instances is accompanied by dysmorphic features, multi-system

abnormalities, developmental delay and abnormal results of cytogenetic studies.

Therefore, it is likely that the nature of glaucoma in these subjects is secondary or the

observed association of congenital glaucoma with these chromosomal abnormalities is

coincidental.

11
Furthermore, genetic linkage study of a group of highly informative DNA markers

selected from the reported regions with chromosomal abnormalities did not show any

evidence for existence of a site in a group of families segregating for primary congenital

glaucoma (Akarsu et al., 1996).

POAG AND ITS ASSOCIATED GENES

Association studies have suggested that, in addition to causative genes, there are

at least 16 POAG-associated genes (Chakrabarthi et al., 2007). Most of these genes

have been reported in single studies; a few of them have been investigated in multiple

association studies, the findings of which are inconsistent. POAG-associated genes

include apolipoprotein E (APOE; a potent modifier for POAG), optic atrophy P

(OAP1), tumor protein p53 (TP53), tumor necrosis factor (TNF; reported to be

associated with POAG in Chinese individuals) and cytochrome P450 1B1 (CYP1B1).

CYP1B1 was initially suggested to be a modifier gene for the expression of MYOC in

JOAG patients. However, recent studies have indicated that CYP1B1 may play an

important role in JOAG, with possible monogenic association in French, Indian, and

Spanish patients. Furthermore, mutations in CYP1B1 have been proposed as potential

factors governing severity in POAG patients. CYP1B1 has also been identified as one of

the three genetic loci linked to PCG (Table 1).

12
The other two are GLC3B at chromosome locus 1p36 and GLC3C at chromosome locus

14q24.3-q31.1. Specific genes have not been linked yet to the GLC3B and GLC3C loci.

PCG is a form of glaucoma commonly referred to as infantile or congenital

glaucoma. Although normally rare, it is the most common form of glaucoma in infants,

with more than 80% of cases observed within the first year of life. This disorder is most

likely due to developmental defects in the trabecular meshwork and the anterior

chamber angle. The clinical findings in PCG patients typically include epiphora (watery

eye), photophobia, corneal edema, and buphthalmolos (enlargement of the globe),

which result from increased IOP. In PCG, elevated IOPs can rapidly lead to axonal loss

and permanent loss of vision in untreated individuals. Sixty to eighty percent of cases

involve both eyes, and males are more frequently affected than females (65% versus

35%, respectively). Inheritance is primarily autosomal recessive with variable

penetrance. Ninety percent of cases are sporadic and pseudodominant transmission has

been demonstrated in some families. Prevalence of PCG varies geographically from a

rate of 1:10000 in Western countries to 1:1250 in the Romany population of Slovakia

(Vasiliou and Gonzalez, 2008).

WDR36 Gene

WD40-repeats are stretches of 40 amino acids that contain tryptophan (W) and

aspartic acid (D). WD-repeat–containing proteins comprise a large family found in all

eukaryotes and are implicated in a variety of functions ranging from signal transduction

and transcription regulation to cell cycle control and apoptosis. The underlying common

function of all WD-repeat proteins is coordinating multiprotein complex assemblies,

where the repeating units serve as a rigid scaffold for protein interactions. Based on

sequence similarity, WDR36 was proposed to contain five (Mao et al., 2004) to eight

(Monemi et al., 2005) WD40 repeats.

13
 In addition, WDR36 contains a C-terminal UTP21 domain that is specifically

associated with WD40 repeats(Bateman A et al.,2002) as well as sequence stretches that

are characteristic for AMP-binding or which exhibit structural similarity to the C-

terminal part of cytochrome cd119 Expression of WDR36 was shown in human ocular

and nonocular tissues as well as in embryonic and adult mouse tissues.(Monemi et

al.,2005) It has been suggested that WDR36 may be involved in T-cell activation(Mao

et al.,2004) and recently, T-cell-mediated responses have been hypothesized to

participate in glaucoma-associated optic nerve degeneration.(Bakalash et al .,2005)

However, the exact physiological function of the protein and its role in glaucoma

pathogenesis remain unclear.

WDR36 Mutation Pattern in different populations with POAG

Chinese Patients with POAG:

Nineteen sequence alterations including V714V Sequence Variant were

identified, and eight of them were novel including two novel nonsynonymous SNPs

(L240V and I713V). Except the common I264V polymorphism, no other previously

reported disease-causing or disease-susceptibility mutations were found. The novel

I713V mutation was observed in three (3.7%) patients with HTG. One intronic SNP,

IVS5+30C>T (rs10038177), showed significantly higher frequency of minor allele T in

HTG patients (16.5%) than in controls (1.3%; Odds ratio [OR]=15.0, p=7.9 x 10(-7),

Bonferroni corrected p=1.5 x 10(-5)). Haplotype GTA, which is composed of

rs13153937, rs10038177, and rs11241095, was significantly associated with HTG

(OR=22.5, p=0.002, Bonferroni corrected p=0.013). Neither the individual SNPs nor

haplotypes of WDR36 were associated with NTG or JOAG (Bonferroni corrected

p>0.05).

14
 Findings in this study suggest WDR36 to be associated with sporadic HTG but

not with NTG or JOAG. Our results also suggest a different mutation pattern of WDR36

in the Chinese population from other ethnic populations (Fan et al., 2009).

Japanese Patients with POAG:

Twenty sequence alterations including V714V Sequence Variant were

identified: 10 have already been reported (p.I264V, c.1494+90C>T, c.1494+143A>G,

c.1609+89G>A, c.1775+89C>A, c.1965-30A>G, p.V714V, c.2170+217C>T, p.V727V,

and c.2518+60G>C) and 10 were novel (p.D179D, p.Q270Q, p.M283R, c.898+63C>G,

c.1074+20C>T, p.G459G, c.1884+26C>G, p.S664L, p.S664S, and p.P744P). One

nonsynonymous amino acid change in exon 17, p.S664L, was identified in a patient

with HTG. The frequency of the p.I264V variant was significantly higher in the HTG

group than in the control group (p=0.01), but the frequency in the NTG group was not

significantly different from the control group (p=0.12). The frequency of the c.1965-

30A>G variant was also significantly higher in the HTG group than in the control group

(p=0.03), but the frequency in the NTG group was not significantly different from the

control group (p=0.06). CONCLUSIONS: One nonsynonymous variant, p.S664L, and

the association of the allelic variants (p.I264V and c.1965-30A>G) in WDR36 and their

prevalence in unrelated Japanese patients with HTG suggest that they are probably

involved in the pathogenesis of HTG (Miyazawa et al., 2007).

German Population with POAG:

A total of 44 WDR36 allelic variants including V714V Sequence Variant were

detected, including 14 nonsynonymous amino acid alterations, of which 7 are novel

(P31T, Y97C, D126N, T403A, H411Y, H411L, and P487R) and 7 have been reported

(L25P, D33E, A163V, H212P, A449T, D658G and I264V).

15
Of these 14 variants, 6 were classified as polymorphisms as they were detected in

patients and control individuals at similar frequencies. Eight variants present in 15

patients (3.7%) but only 1 control individual (0.2%) were defined as putative disease-

causing variants (P = 0.0005). Within this patient group, 12 (80%) presented with high

and 3 (20%) with low intraocular pressure. Disease severity and age of onset showed a

broad range.

The occurrence of several rare putative disease-causing variants in patients with

glaucoma suggests that WDR36 may be a minor disease-causing gene in glaucoma, at

least in the German population. The large variability in WDR36, though, requires

functional validation of these variants, once its function is characterized (Pasutto F et

al., 2008).

American population with POAG:

Thirty-two WDR36 sequence variants including V714V Sequence Variant were

found in this population of patients with POAG. Nonsynonymous single-nucleotide

polymorphisms (SNPs), including those previously described as "disease-causing" and

"disease susceptibility," were found in 17% of POAG patients and 4% of control

subjects. Although the distribution of WDR36 variants in the pedigrees did not show

consistent segregation with the disease, the WDR36 sequence variants were found more

frequently in patients with more severe disease. The results of this study suggest that

abnormalities in WDR36 alone are not sufficient to cause POAG. The association of

WDR36 sequence variants with more severe disease in affected individuals suggests that

defects in the WDR36 gene can contribute to POAG and that WDR36 may be a

glaucoma modifier gene (Hauser et al., 2006).

16
Australian Population with POAG:

To investigate in Australian patients with glaucoma and normal controls the

prevalence and associated phenotype of the WDR36 D658G mutation, which has

previously been suggested to be a disease-causing mutation in pedigrees with primary

open-angle glaucoma (POAG). Case-control study. Two hundred forty-nine individuals

with POAG and 217 age-matched control subjects were recruited through the Glaucoma

Inheritance Study in Tasmania, Australia. Genomic DNA was amplified by polymerase

chain reaction by intronic primers. The presence of the D658G variant was detected by

BglI restriction enzyme digestion. The D658G variant was identified in four POAG

cases (1.6%) and four control subjects (1.8%) (chi(2) = 0.04, P = .84). No control

subject with the variant had a family history of glaucoma. The WDR36 D658G is a

neutral variant in the Australian population. Further populations should be carefully

assessed for this variant before concluding that WDR36 is a glaucoma gene (Hewitt AW

et al., 2006).

17
 MATERIALS AND METHODS

All the chemicals and enzymes used were of analytical grade and the plastic

wares were procured from reputed vendors like Fermentas, SRL, Hi-media, Sigma

Chemicals co. and Tarsons.

4.1 Blood sample collection:

Blood samples were collected from Karaikudi, Madurai and Kovilpatti eye

hospitals by ophthalmologists. The patients were asked to complete an interview

administered questionnaire. The questionnaire contains a) the personal details, b)

precise information of the individuals (patient) disease.

After obtaining the informed consents, 2 mL of blood was obtained from the

glaucoma patients along with control samples.

Institutional Ethical Committee (IEC) of Alagappa University has given

necessary clearance for carrying out this project work.

4.2 Isolation of DNA:

DNA isolation from blood samples were performed using standard protocol

(Jeffrey’s and Morton, 1987).

4.3 Reagents required:

4.3.1 a) 1X SSC

0.15 M NaCl - 0.44 g

15 mM Tri Sodium Citrate (pH 7.0) - 0.29 g

Mix both the solutions and make it for 50 mL with distilled water. The solution is

then autoclaved and then stored at room temperature (RT).

4.3.2 b) 0.2 M Sodium Acetate

Dissolve 1.36 g of sodium acetate and make it for 50 mL with distilled water.

The solution is then autoclaved and then stored at RT.

18
4.3.3 c) 10% Sodium Dodecyl Sulphate (SDS)

2.5 g of SDS was dissolved in 25 mL of autoclaved distilled water and stored in

autoclaved reagent bottles at RT.

4.3.4 d) Equilibrated Phenol : Chloroform : Isoamylalcohol (25 : 24 : 1) (v/v/v) 4°C

Phenol, Chloroform and Isoamylalcohol are mixed together just before the

isolation process in a 50 mL centrifuge tube. The mixtured is stored at 4°C.

4.3.5 e) Chloroform : Isoamylalcohol (24 : 1) (V/V) 4°C

Chloroform and Isoamylalcohol are mixed together just prior to the process in a

50 mL centrifuge tube. The mixture is stored at 4°C.

4.3.6 f) Ethyl Alcohol (Absolute)

This was commercially purchased from Tedia co. And stored in the refrigerator.

4.3.7 g) 70% Ethanol

Absolute ethyl alcohol - 70 mL

Autoclaved distilled water - 30 mL

4.4 Methodology:
2 mL of peripheral venous blood was collected from the bronchial vein at the

elbow joint, using a disposable syringe (Dispovan). The blood was transferred to a

sterile 2 mL vaccutainer tube that coated with Na2 EDTA. The tube was inverted for a

few times and stored at 4°C till further processing.

100μL of blood sample was taken. Double volume of 1XSSC was added and

centrifuge at 5000 rpm for 5 minutes. Decanted the supernatant and suspend the pellet

with double the volume of 0.2M sodium acetate .15 μL of 10%SDS was also added. 1

mL of PCI was added and gently mixed the solution. Centrifuged at 10,000 rpm for 10

minutes. Supernatant was collected and 500 μL of Chloroform: isoamylalcohol (24:1)

was added. Centrifuged at 10,000 rpm for 10 minutes.

19
After centrifugation, aqueous phase was collected and 500 μL of absolute ethanol was

added. Centrifuged at 10,000 rpm for 10 minutes.

Supernatant was removed and 500 μl of 70% ethanol was added. Centrifuged at

10,000 rpm for 10 minutes. Decanted the supernatant and pellet was air-dried. 30 μL of

nuclease free milli Q water was used for dissolving the DNA and stored at-200C.

4.5 Agarose gel electrophoresis of DNA samples:

The 0.7% agarose gel was seen to be appropriate for electrophoresis of human

genomic DNA.

4.6 Reagents required:

4.6.1 a) 10 X Tris-Borate EDTA (TBE buffer)

Tris base - 108 g
Boric acid - 55 g
0.5 M EDTA - 40 mL (7.444 g/L)
Dissolve the above and make up to final volume to 500 mL with distilled water.

The pH was adjusted to 8.3. The solution was autoclaved and stored at RT.

4.6.2 b) 6 X gel loading buffer

0.25% bromopehnol blue

0.25 % xylene cyanol
40% (w/v) sucrose in water

Dissolve the above contents and make upto 15 mL with autoclaved distilled
water and stored at 4°C.

4.6.3 c) Ethidium bromide (10 mg / mL) (w/v)

Ethidium bromide - 10 mg
Autoclaved distilled water - 1 mL

4.7 Methodology:

20
 0.80 g of agarose was weighed and added to 80 mL of 1 X TBE buffer. The

mixture was boiled in Microwave oven to get uniform solution. The gel platform was

sealed using cellophane tape and comb was placed in the appropriate slot. The boiled

molten agarose was brought down to room temperature and poured into the sealed

platform with the comb. The gel was left undisturbed to polymerise for about 30

minutes.

After the gel was set, the comb was carefully removed. The cellophane tape at

ends was removed and the gel was placed in the electrophoresis tank that contains 1X

TBE buffer. Caution should be taken such that the gel was completely immerged.

5 μL of the DNA sample along with 2 μL of loading dye was loaded into each

well. Electrophoresis was carried out at 50 volts for 2 hours. Then the gel was stained in

the EtBr solution for 10 minutes and then destained for another 10 minutes in distilled

water. The gel was viewed under an UV trans-illuminator, ( UVitec, Lark innovative

Inc) and the pictured was captured with the help of gel documentation unit.

4.8 Polymerase Chain Reaction (PCR) of Exon 3 region:

PCR was carried out to amplify a region in the Exon 3 of the human CYP1B1

gene, in which the polymorphism (Arg368His, G-A change) is present. The primers

ordered based on the study done by (Kumar et al., 2007).

4.9 Reagents Required:

4.9.1 a) Primers

The primers were obtained in the lyophilized form from Ocimum Synthesis. Details of

the primers are given in the table.

Details of the primers designed.

21
 Primer Primer GC
S.No Primer Sequence Tm
Name Length %
1. WDRF 5’- 26 mer 34% 58.5°C
TTCAAGATTGTAGAGTGTTTCTC
TGA-3’
2. WDRR 5’- 21 mer 47% 57.9°C
TGCAGCCTTGTAGACTGTTCA-3’
* 10 pmol of each primer was used

4.9.2 b) Working dNTP mix

dNTP was supplied in 10 mM concentration. It was stored at -20°C. Final working

concentration of 0.25 mM was used for a single reaction set up.

4.9.3 c) MgCl2

MgCl2 was supplied in 25 mM concentration. It was stored at -20°C. This was

diluted so as to get a final concentration of 2 mM in the PCR reaction mixture.

4.9.4 d) Taq polymerase

Taq polymerase was obtained at a concentration of 1 U/µL and was stored at -20°C.

4.10 Methodology:

The mixing of different PCR reagents was carried out in a sterile condition and on

ice. Total reaction volume was set to 20 µL for each reaction. The PCR components

were added to the PCR tube in a stepwise manner. The various components and their

respective volumes are represented below in the following table

4.10.1. PCR Reaction

Ingredients Stock Working Stock Amount Taken

22
Sterile milli Q water 11.5 µL
PCR Buffer 10 X 1X 2.0 µL
dNTPs 10 mM 0.25 mM 0.5 µL
MgCl2 25 mM 2 mM 2.0 µL
WDRF 100 Pico Moles 10 Pico Moles 1.0 µL
WDRR 100 Pico Moles 10 Pico Moles 1.0 µL
Taq DNA polymerase 10 U/10 µL 1 U/ 1µL 1.0 µL
Template ~50 ng 1.0 µL

The typical amplification cycle is represented below.

1. Initial Denaturation : 95° C for 3 minutes

2. Denaturation : 95° C for 30 seconds

3. Annealing : 57° C for 30 seconds 30 cycles

4. Extension : 72° C for 60 seconds

5. Final Extension : 72° C for 5 minutes

6. Holding Temperature : 4° C

The annealing temperature was standardized to 57° C.

4.11 Agarose Gel Electrophoresis:

After each PCR reaction the products were checked by electrophoresis on a 2%

agarose gel. 1.6 g of agarose was melted in 80 mL of 1x TBE buffer. 3 µL of the

reaction products were loaded with 2 µL of loading dye to check for the amplification.

4.12 RFLP analysis:

Genotyping was performed by RFLP (Restriction Fragment Length Polymorphism)

analysis. PCR amplicons were digested with Hin1II restriction enzyme. In homozygous

normal, Hin1II enzyme recognize 5' C A T G 3‘ site and produce fragment (478 bp).

In heterozygous mutant, Hin1II produce three fragments (167 bp, 165 bp and 146 bp).

In homozygous mutant, Hin1II will produce three fragments (167 bp, 165 bp and 146

bp).

4.13 RFLP Reaction condition

23
 Hin1II was obtained from MBI Fermentas in the concentration of 10 U/ µL. Stored at

-20 °C.

10 X buffer – Diluted to 1 X in the reaction mixture.

The digestion reaction is represented as follows

Ingredients Stock Working Amount

concentration concentration Taken
Sterile milli Q water 0.8 µL
Tango Buffer 10 X 1X 1.0 µL
Hin1II restriction 10 U/ µL 2U 0.2 µL
enzyme
PCR Products 8.0 µL

The reaction volume was set up to 10 µL and the mixture was incubated at 65° C for 4

hours.

4.14 Agarose Gel for Analysis of the Digested Amplicons

The digested amplicons were analyzed by electrophoresis on a 2% agarose gel.

2.4 g of agarose was melted in 80 mL of 1 X TBE buffer. 8 µL of the digested samples

were mixed with 2 µL of loading dye which is sufficient for the analysis of digestion.

The digested DNA sample in the gel was viewed under UV trans-illuminator and

photographed.

RESULT

Glaucoma is a term used to refer to a heterogeneous group of optic neuropathies

that cause a progressive loss of vision. WDR36 was the recent glaucoma gene

discovered. It plays a very important role in the pathogenesis of autosomal dominant

juvenile glaucoma and is involved in a small but significant subset of adult onset

24
POAG. This study conceived for the detection of WDR36 mutation (V714V) in the

coding exon 18, among south Indian glaucoma patients. The patient group comprised

of 20 unrelated with POAG patients ranged in the age from 40- 84 years at the time of

this study. There were 10 unrelated individuals with out any evidence of glaucoma as a

control group also recruited for the study.

Genomic DNA was isolated from the patients and the control groups. An aliquot

of genomic DNA was loaded on a 0.8% agarose gel prestained with Ethidium Bromide.

PCR was carried out to amplify the coding region of exon 18 of WDR36 gene, which

amplifies the 478bp amplicon, which was confirmed on 2% agarose gel.

All the PCR products of patients as well as the controls were subjected to digest

with the Hin1II enzyme. Digested products were analyzed on a 2 % agarose gel to find

the presence of hetero/ homozygous nature. The gain of Hin1II restriction site cleaves in

to 167 bp 165 bp and 146 bp PCR products were as the loss of restriction site remains

intact of 478 bp.

In this study the 20 patients and normal controls were digested with Hin1II

enzyme remains intact, thus concludes that no sequence changes in the coding region of

exon 18 of WDR36 was found in 20 unrelated glaucoma patients and 10 normal control

subjects.

This indicates that the prevalence of V714V mutation is less in south Indian

glaucoma patients, and concludes the inconsistency of the V714V with other ethnic

groups. The allelic frequency of this sequence change did not differ significantly

between the western POAG populations.

The allelic and genotype frequency result of V714V of WDR36 is not significant

in POAG patients hail from the south Tamilnadu.

25
 DISCUSSION

To understand the distribution of WDR36 V714V mutation in JOAG

patients with normal controls were analyzed by PCR-RFLP.V714V mutation that have

been identified in patients with adult onset POAG was detected as a significant

pathological mutation in other ethnic population. The V714V coding region falls on

exon 18 of WDR36 gene plays an important role in POAG – the study was carried out to

26
detect the particular mutation. PCR-RFLP is the simple and easiest method to identify

the known mutation or previously reported mutations.

In this study Hin1II restriction enzyme was used to digest the 478 bp

PCR product of exon 18 of WDR36. The gain of the site indicates 254bp and 224 bp

products on 1 % agarose gel, however the loss of site remain intact of the 20 POAG

patients analyzed with PCR-RFLP none showed presence of V714V mutation of

WDR36 gene.

This concludes that the mutation would have occurred in other exons of

WDR36 or other genes that includes OPTN and MYOC contrarily the presence of

V714V mutation is not a predominant in POAG of south Indian population. In

conclusion V714V mutation of WDR36 gene is not a causative mutation for the POAG

in South Indian population.

REFERENCES

Akarsu,A.N., Turacli,M.E., Aktan,G.S., Hossain,A., Barsoum-Homsy,M., Chevrette,L.,

Sayli,B.S. and Sarfarazi,M. (1996) Exclusion of primary congenital glaucoma
from two candidate regions of chromosome arm 6p and chromosome 11. Am. J.
Med. Genet., 61, 290-292.

27
Anderson,J., Pralea,A., Del Bono,E.A., Haines,J.L., Gorin,M.B., Schuman,J.S.,
Mattox,C.G. and Wiggs,J.L. (1997) A gene responsible for the pigment
dispersion syndrome maps to chromosome 7q35-q36. Arch. Ophthalmol., 115,
384-388.

Avramopolus,D., Kitsos,G., Economou-Petersen,E., Grigoriadou,M., Vassilopoulos,D.,

Papageorgiou,C., Psilas,K. and Petersen,M.B. (1996) Exclusion of one pedigree
affected by adult onset primary open angle glaucoma from linkage to the
juvenile glaucoma locus on chromosome 1q21-q31. J. Med. Genet., 3, 1043-
1044.

Bakalash S, Shlomo GB, Aloni E, et al. T-cell-based vaccination for morphological and
functional neuroprotection in a rat model of chronically elevated intraocular
pressure. J Mol Med. 2005;83:904–916.

Bateman A, Birney E, Cerruti L, et al. The Pfam protein families database. Nucleic
Acids Res. 2002;30:276–280.

Bennett,S.R., Alward,W.L. and Folberg,R. (1989) An autosomal dominant form of low

tension glaucoma. Am. J. Ophthalmol., 108, 238-244.

Brezin,A.P., Adam,M.F., Dascotte,J.C., Rouland,J.F., Valtot,F., Copin,B., De

Dinechin,S., Belmoudel,A., Gomez,L., Bach,J.F and Garchon,H.J. (1997)
Phenotypic diversity in a very large family with GLC1A linked glaucoma.
Invest. Ophthalmol. Vis. Sci., 38, abs #4336.

Budde,W.M., Madrin,C.Y., Rautenstrauss,K., Opelz,C., Thoma,K., Kammler,K.,

Timmermann,V., Van Broeckhoven,C., Naumann,G.O.H., Pheiffer,R.A. and
Rautenstrauss,B. (1997) Phenotype-genotype correlation of a german family
with juvenile open-angle glaucoma by segregation analysis on chromosome 1q.
Invest. Ophthalmol. Vis. Sci., 38, abs #2688.

Crick,R.P., Vogel,R., Newson,R.B., Shipley,M.J., Blackmore,H., Palmer,A. and

Bulpitt,C.J. (1989) The visual field in chronic simple glaucoma and ocular
hypertension; its character, progress relationship to the level of intraocular
pressure and response to treatment. Eye, 3, 536-546.

28
Fan BJ, Wang DY, Cheng CY, Ko WC, Lam SC, Pang CP, Different WDR36 mutation
pattern in Chinese patients with primary open-angle glaucoma. Mol Vis.
2009;15:646-53. Epub 2009 Apr 3.

Fechtner RD, Weinreb RN. Mechanisms of optic nerve damage in primary open angle
glaucoma. Surv Ophthalmol. 1994;39:23–42.

Fingert,J.H., Alward,W.L., Sunden,S., Nishimura,D., Nystuen,A., Nichols,B.E.,

Mackey,D.A., Ritch,R., Kalenak,J.W., Craven,E.R., Beck,G.E., Streb,L.M.,
Sheffield,V.C. and Stone,E.M. (1997) Identification of the gene causing 1q-
linked juvenile onset primary open angle glaucoma (GLC1A) and evidence for
its involvement in adult primary open angle glaucoma. Invest. Ophthalmol. Vis.
Sci., 38, abs #4333.

Flomen,R.H., Vatcheva,R., Gorman,P.A., Baptista,P.R., Groet,J., Barisic,I., Ligutic,I.

and Nizetic,D. (1997) Rieger syndrome can be caused by haploinsufficiency of
RIEG, but also by chromosome breaks at a distance of 70 kbp from this gene.
Eur. Soc. Hum. Genet. Meeting, May 17-20, abs #121.

Francois,J. (1972) Congenital glaucoma and its inheritance. Ophthalmologica, 181, 61-
73.

Gencik,A. (1989) Epidemiology and genetics of primary congenital glaucoma in

Slovakia: description of a form of primary congenital glaucoma in gypsies with
autosomal dominant inheritance and complete penetrance. Dev. Ophthalmol., 16,
76-115.

Graff,C., Urbak,S.F., Jerndal,T. and Wadelius,C. (1995) Confirmation of linkage to

1q21-31 in a Danish autosomal dominant juvenile-onset glaucoma family and
evidence of genetic heterogeneity. Hum. Genet., 96, 285-289.

Grosskreutz,C. and Netland,P.A. (1994) Low tension glaucoma. Int. Ophthalmo. Clin.,
34, 173-185.

Hauser MA, Allingham RR, Linkroum K, Wang J, LaRocque-Abramson K, Figueiredo

D, Santiago-Turla C, del Bono EA, Haines JL, Pericak-Vance MA, Wiggs JL.

29
 Distribution of WDR36 DNA sequence variants in patients with primary open-
angle glaucoma.Invest Ophthalmol Vis Sci. 2006 Jun;47(6):2542-6.

Hewitt AW, Dimasi DP, Mackey DA, Craig JE.A Glaucoma Case-control Study of the
WDR36 Gene D658G sequence variant. Am J Ophthalmol. 2006
Aug;142(2):324-5.

Hitchings,R.A. (1992) Low tension glaucoma-its place in modern glaucoma practice.

Br. J. Ophthalmol., 76, 494-496.

Jay,J.L. and Murdoch,J.R. (1993) The rate of visual field loss in untreated primary open
angle glaucoma. Br. J. Ophthalmol., 77, 176-178.

Johnson,A.T., Drack,A.V., Kwitek,A.E., Cannon,R.L., Stone,E.M. and Alward,W.L.M.

(1993) Clinical features and linkage analysis of a family with autosomal
dominant juvenile glaucoma.Ophthalmology, 100, 524-529.

Kitsos,G., Cote,G. and Psilas,K. (1988) An example of dominant heredity in the

transmission of primary open-angle glaucoma in a northwestern region of
Greece. J. Fr. Ophtalmol. 11, 859-864.

Klaver CC, Wolfs RC, Vingerling JR, Hofman A, de Jong PT. Age-specific prevalence
and causes of blindness and visual impairment in an older population: The
Rotterdam Study. Arch Ophthalmol. 1998;116:653–658

Mao M, Biery MC, Kobayashi SV, et al. T lymphocyte activation gene identification by
coregulated expression on DNA microarrays. Genomics. 2004;83:989–999.

Meyer,A., Valtot,F., Bechetoille,A., Rouland,J.F., Dascotte,J.C., Ferec,C., Bach,J.,

Chaventre,A. and Garchon,H. (1994) Linkage between juvenile glaucoma and
chromosome 1q in two French families. Comp. Rend. Acad. Sci (Paris), 317,
565-570.

Michels-Rautenstrauss K, Mardin C, Wakili N, et al. Novel mutations in the

MYOC/GLC1A gene in a large group of glaucoma patients. Hum Mutat.
2002;20:479–480

30
Miyazawa A, Fuse N, Mengkegale M, Ryu M, Seimiya M, Wada Y, Nishida K
,Association between primary open-angle glaucoma and WDR36 DNA sequence
variants in Japanese. Mol Vis. 2007 Oct 9;13:1912-9.

Monemi S, Spaeth G, DaSilva A, et al. Identification of a novel adult-onset primary

open-angle glaucoma (POAG) gene on 5q22.1. Hum Mol Genet. 2005;14:725–
733.

Morissette,J., Cote,G., Anctil,J.L., Plante,M., Amyot,M., Heon,E., Trope,G.E.,

Weissenbach,J. and Raymond,V. (1995) A common gene for juvenile and adult
onset primary open-angle glaucomas confined on chromosome 1q. Am. J. Hum.
Genet., 56, 1431-1442.

Netland,P.A., Wiggs,J.L. and Dreyer,E.B. (1993) Inheritance of glaucoma and genetic

counseling of glaucoma patients. Int. Ophthalmol. Clin., 33, 101-120.

Pasutto F, Mardin CY, Michels-Rautenstrauss K, Weber BH, Sticht H, Chavarria-Soley

G, Rautenstrauss B, Kruse F, Reis A. Profiling of WDR36 missense variants in
German patients with glaucoma. Invest Ophthalmol Vis Sci. 2008
Jan;49(1):270-4.

Pirastu,M., Loi,A., De Gioia,P., Spinelli,P., Anguis,A., Nizolla,F., Alberti,G.,

Gandolfi,S., Ghillotti,G. and Fossasrello,M. (1997) Clinical and genetic
heterogeneity of autosomal dominant open angle glaucoma (ADOAG) in Italy.
Invest. Ophthalmol. Vis. Sci., 38, abs #2680.

Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol.

1996;80:389–393.

Quigley,H.A. (1996) The number of people with glaucoma worldwide. Br. J.

Ophthalmol., 80, 389-393.

Quigley,H.A. and Vitale,S. (1997) Models of open angle glaucoma prevalence and
incidence in the United States. Invest. Ophthalmol. Vis. Sci., 38, 83-91.

Raymond,V. (1997) Molecular genetics of Glaucomas: mapping of the first five `GLC'
loci. Am. J. Hum. Genet., 60, 272-277.

31
Rezaie T, Child A, Hitchings R, et al. Adult-onset primary open-angle glaucoma caused
by mutations in optineurin. Science. 2002;295:1077–1079.

Richards,J.E., Lichter,P.R., Boehnke,M., Uro,J.L.A., Torrez,D., Wong,D. and

Johnson,A.T. (1994) Mapping of a gene for autosomal dominant juvenile-onset
open-angle glaucoma to chromosome 1q. Am. J. Hum. Genet., 54, 62-70.

Richards,J.E., Lichter,P.R., Herman,S., Hauser,E.R., Hou,Y.C., Johnson,A.T. and

Boehnke,M. (1996) Probable exclusion of GLC1A as a candidate gene in a
family with middle-age-onset primary open-angle glaucoma. Ophthalmology,
103, 1035-1040.

Ritch R. Neuroprotection: is it already applicable to glaucoma therapy?. Curr Opin

Ophthalmol. 2000;11:78–84.

Sarfarazi M, Child A, Stoilova D, et al. Localization of the fourth locus (GLC1E) for
adult-onset primary open-angle glaucoma to the 10p15–p14 region. Am J Hum
Genet. 1998;62:641–652.

Sarfarazi M, Rezaie T. Optineurin in primary open angle glaucoma. Ophthalmol Clin

North Am. 2003;16:529–541.

Sarfarazi,M., Akarsu,A.N., Hossain,A., Turacli,M.E., Aktan,S.G., Barsoum-Homsy,M.,

Chevrette,L. and Sayli,B.S. (1995) Assignment of a locus (GLC3A) for primary
congenital glaucoma (Buphthalmos) to 2p21 and evidence for genetic
heterogeneity. Genomics, 30, 171-177.

Schinzel, A. (1984) Catalogue of Unbalanced Chromosomal Abberations in Man.

Degruyter, Berlin.

Sheffield,V.C., Stone,E.M., Alward,W.L.M., Drack,A.V., Johnson,A.T., Streb,L.M. and

Nichols,B.E. (1993) Genetic linkage of familial open-angle glaucoma to
chromosome 1q21-q31. Nature Genet., 4, 47-50.

Shields,M., Ritch,R. and Krupin,T. (1996) Classification of the glaucomas. In Ritch,R.,

Shields,B.M. and Krupin,T. (eds) The Glaucomas. Mosby, St Louis, Vol 2, pp.
717-725.

32
Sommer,A., Tielsch,J.M., Katz,J., Quigley,H.J., Gottsch,J.D., Javitt,J. and Singh,K.
(1991) Relationship between intraocular pressure and primary open angle
glaucoma among white and black Americans. Arch. Ophthalmol., 109, 1090-
1095.

Stoilov,I., Akarsu,A.N. and Sarfarazi,M. (1997) Identification of three truncating

mutations in cytochrome P450 1B1 (CYP1B1) as the principal cause of primary
congenital glaucoma (buphthalmos) families linked to the GLC3A locus on
2p21. Hum. Mol. Genet., 6, 641-647.

Stoilova D, Child A, Trifan OC, Crick RP, Coakes RL, Sarfarazi M. Localization of a
locus (GLC1B) for adult-onset primary open angle glaucoma to the 2cen-q13
region. Genomics. 1996;36:142–150.

Stoilova,D., Child,A., Brice,G., Crick,R.P., Fleck,B.W. and Sarfarazi,M. (1997)

Identification of a new TIGR mutation in a family with juvenile-onset primary
open angle glaucoma. Ophthalmic Genetics, in press.

Stoilova,D., Child,A., Trifan,O.C., Crick,R.P., Coakes,R.L. and Sarfarazi,M. (1996)

Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma
to the 2cen-q13 region. Genomics, 36 142-150.

Stone EM, Fingert JH, Alward WL, et al. Identification of a gene that causes primary
open angle glaucoma. Science. 1997;275:668–670.

Trifan OC, Traboulsi EI, Stoilova D, et al. A third locus (GLC1D) for adult-onset
primary open-angle glaucoma maps to the 8q23 region. Am J Ophthalmol.
1998;126:17–28.

Tuck MW, Crick RP. The projected increase in glaucoma due to an ageing population.
Ophthalmic Physiol Opt. 2003;23:175–179.

Tuck,M.W. and Crick,R.P. (1992) Optometrists referral criteria for suspected glaucoma.
Health Trends, 24, 153-157

Turacli,M.E., Aktan,S.G., Sayli,B.S. and Akarsu,A.N. (1992) Therapeutical and

genetical aspects of congenital glaucomas. Int. Ophthalmol., 16, 359-362.

33
Viswanathan AC, McNaught AI, Poinoosawmy D, et al. Severity and stability of
glaucoma: patient perception compared with objective measurement. Arch
Ophthalmol. 1999;117:450–454

Vogel,R., Crick,R.P., Newson,R.B., Shipley,M., Blackmore,H. and Bulpitt,C.J. (1990)

Association between intraocular pressure and loss of visual field in chronic
simple glaucoma. Br. J. Ophthalmol., 74, 3-6.

Vollrath,D., Kerns,J., Reardon,M.S. and Wiggs,J.L. (1997) Genetic and clinical

evaluation of a patient hemizygous for GLC1A locus. Invest. Ophthalmol. Vis.
Sci., 38, abs #2683.

Weisschuh N, Neumann D, Wolf C, Wissinger B, Gramer E. Prevalence of myocilin

and optineurin sequence variants in German normal tension glaucoma patients.
Mol Vis. 2005;11:284–287.

Wiggs JL, Allingham RR, Hossain A, et al. Genome-wide scan for adult onset primary
open angle glaucoma. Hum Mol Genet. 2000;9:1109–1117.

Wiggs JL, Auguste J, Allingham RR, et al. Lack of association of mutations in

optineurin with disease in patients with adult-onset primary open-angle
glaucoma. Arch Ophthalmol. 2003;121:1181–1183.

Wiggs JL, Lynch S, Ynagi G, et al. A genomewide scan identifies novel early-onset
primary open-angle glaucoma loci on 9q22 and 20p12. Am J Hum Genet.
2004;74:1314–1320

Wiggs,J.L., Haines,J.L., Paglinauan,C., Fine,A., Sporn,C. and Lou,D. (1994) Genetic

linkage of autosomal dominant juvenile glaucoma to 1q21-q31 in three affected
pedigrees. Genomics, 21, 99-303.

Wirtz MK, Samples JR, Rust K, et al. GLC1F, a new primary open-angle glaucoma
locus, maps to 7q35–q36. Arch Ophthalmol. 1999;117:237–241.

Wirtz,M.K., Samples,J.R., Kramer,P.L., Rust,K., Topinka,J.R., Yount,J., Koler,R.D.

and Acott,T.S. (1997) Mapping a gene for adult-onset primary open angle
glaucoma to chromosome 3q. Am. J. Hum. Genet., 60, 296-304.

34
35