Anda di halaman 1dari 25
GANGGUAN SOMATOFORM M. Faisal Idrus
GANGGUAN SOMATOFORM
M. Faisal Idrus
DEFINISI Psikosomatik Keadaan Psikologik yang berkontribusi untuk berkembangnya suatu penyakit fisik Diagnosis
DEFINISI
Psikosomatik
Keadaan Psikologik yang berkontribusi untuk
berkembangnya suatu penyakit fisik
Diagnosis Mental karakteristik dengan disabilitas medis
yang tidak dapat dijelaskan
Somatization
Manifestasi gejala fisik dari distres psikologik
Gejala primer dari gangguan somatoform dan gangguan
buatan
DEFINISI Gangguan Somatoform Pasien menderita gejala-gejala fisik sebagai akibat dari stres psikologik. Gangguan
DEFINISI
Gangguan Somatoform
Pasien menderita gejala-gejala fisik sebagai
akibat dari stres psikologik.
Gangguan Buatan (Factitious)
Pasien sendiri membuat luka sebagai akibat
stres psikologik untuk mendapatkan pengobatan
pada bagian luar
Sifat dasar Gangguan Somatoform GambaranGambaranGambaranGambaran UmumUmumUmumUmum GambaranGambaranGambaranGambaran
Sifat dasar Gangguan
Somatoform
GambaranGambaranGambaranGambaran UmumUmumUmumUmum
GambaranGambaranGambaranGambaran UmumUmumUmumUmum
BagianBagianBagianBagian daridaridaridari keluhankeluhan-keluhankeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
BagianBagianBagianBagian daridaridaridari keluhankeluhan-keluhankeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
MemperlihatkanMemperlihatkanMemperlihatkanMemperlihatkan kondisikondisikondisikondisi medismedismedismedis
MemperlihatkanMemperlihatkanMemperlihatkanMemperlihatkan kondisikondisikondisikondisi medismedismedismedis
TidakTidakTidakTidak dapatdapatdapatdapat diidentifikasidiidentifikasidiidentifikasidiidentifikasi penyebabpenyebabpenyebabpenyebab medisnyamedisnyamedisnyamedisnya
TidakTidakTidakTidak dapatdapatdapatdapat diidentifikasidiidentifikasidiidentifikasidiidentifikasi penyebabpenyebabpenyebabpenyebab medisnyamedisnyamedisnyamedisnya
PatologiPatologiPatologiPatologi mengenaimengenaimengenaimengenai
PatologiPatologiPatologiPatologi mengenaimengenaimengenaimengenai
– –
PenampilanPenampilanPenampilanPenampilan fisikfisikfisikfisik
PenampilanPenampilanPenampilanPenampilan fisikfisikfisikfisik
– –
FungsiFungsiFungsiFungsi daridaridaridari tubuhtubuhtubuhtubuh merekamerekamerekamereka
FungsiFungsiFungsiFungsi daridaridaridari tubuhtubuhtubuhtubuh merekamerekamerekamereka
Gangguan Somatoform LimaLimaLimaLima macammacammacammacam gangguangangguangangguangangguan
Gangguan Somatoform
LimaLimaLimaLima macammacammacammacam gangguangangguangangguangangguan somatoformsomatoformsomatoformsomatoform
LimaLimaLimaLima macammacammacammacam gangguangangguangangguangangguan somatoformsomatoformsomatoformsomatoform
HHiHHiipoipopokpokkondriasiskondriasisondriasisondriasis
HHiHHiipoipopokpokkondriasiskondriasisondriasisondriasis
GangguanGangguanGangguanGangguan SomatiSomatisasiSomatiSomatisasisasisasi
GangguanGangguanGangguanGangguan SomatiSomatisasiSomatiSomatisasisasisasi
GangguanGangguanGangguanGangguan KKKKonversionversionversionversi
GangguanGangguanGangguanGangguan KKKKonversionversionversionversi
GangguanGangguanGangguanGangguan NyeriNyeriNyeriNyeri SomatoformSomatoformSomatoformSomatoform
GangguanGangguanGangguanGangguan NyeriNyeriNyeriNyeri SomatoformSomatoformSomatoformSomatoform
GangguanGangguanGangguanGangguan BodyBodyBodyBody DysmorphicDysmorphicDysmorphicDysmorphic
GangguanGangguanGangguanGangguan BodyBodyBodyBody DysmorphicDysmorphicDysmorphicDysmorphic
Gangguan Hipokondriasis DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
Gangguan Hipokondriasis
DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
BerakarBerakarBerakarBerakar daridaridaridari masamasamasamasa lalulalulalulalu
BerakarBerakarBerakarBerakar daridaridaridari masamasamasamasa lalulalulalulalu
KeluhanKeluhan-KeluhanKeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
KeluhanKeluhan-KeluhanKeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui penyebabpenyebabpenyebabpenyebab medisnyamedisnyamedisnyamedisnya
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui penyebabpenyebabpenyebabpenyebab medisnyamedisnyamedisnyamedisnya
KecemasanKecemasanKecemasanKecemasan beratberatberatberat //// ketakutanketakutanketakutanketakutan mengenaimengenaimengenaimengenai
KecemasanKecemasanKecemasanKecemasan beratberatberatberat //// ketakutanketakutanketakutanketakutan mengenaimengenaimengenaimengenai
kemungkinankemungkinankemungkinankemungkinan mempunyaimempunyaimempunyaimempunyai penyakitpenyakitpenyakitpenyakit seriusseriusseriusserius
kemungkinankemungkinankemungkinankemungkinan mempunyaimempunyaimempunyaimempunyai penyakitpenyakitpenyakitpenyakit seriusseriusseriusserius
TidakTidakTidakTidak dapatdapatdapatdapat didididi tolongtolongtolongtolong untukuntukuntukuntuk menentramkanmenentramkanmenentramkanmenentramkan
TidakTidakTidakTidak dapatdapatdapatdapat didididi tolongtolongtolongtolong untukuntukuntukuntuk menentramkanmenentramkanmenentramkanmenentramkan
hatinyahatinyahatinyahatinya
hatinyahatinyahatinyahatinya
Gangguan Hipokondriasis Deskripsi klinik Deskripsi klinik ProblemProblemProblemProblem utamautamautamautama
Gangguan Hipokondriasis
Deskripsi klinik
Deskripsi klinik
ProblemProblemProblemProblem utamautamautamautama adalahadalahadalahadalah anxietasanxietasanxietasanxietas
ProblemProblemProblemProblem utamautamautamautama adalahadalahadalahadalah anxietasanxietasanxietasanxietas
PreokupasiPreokupasiPreokupasiPreokupasi dengandengandengandengan gejalagejalagejalagejala----gejalagejalagejalagejala fisikfisikfisikfisik
PreokupasiPreokupasiPreokupasiPreokupasi dengandengandengandengan gejalagejalagejalagejala----gejalagejalagejalagejala fisikfisikfisikfisik
MisinterpretaMisinterpretasiMisinterpretaMisinterpretasisisi terhadapterhadapterhadapterhadap gejalagejala-gejalagejala--gejala-gejalagejalagejala
MisinterpretaMisinterpretasiMisinterpretaMisinterpretasisisi terhadapterhadapterhadapterhadap gejalagejala-gejalagejala--gejala-gejalagejalagejala
MeyakiniMeyakiniMeyakiniMeyakini sakitsakitsakitsakit keraskeraskeraskeras
MeyakiniMeyakiniMeyakiniMeyakini sakitsakitsakitsakit keraskeraskeraskeras
BanyakBanyakBanyakBanyak kunjungankunjungankunjungankunjungan dandandandan testestestes medismedismedismedis
BanyakBanyakBanyakBanyak kunjungankunjungankunjungankunjungan dandandandan testestestes medismedismedismedis
Gangguan Hipokondriasis FaktaFaktaFaktaFakta dandandandan StatistikStatistikStatistikStatistik FaktaFaktaFaktaFakta
Gangguan Hipokondriasis
FaktaFaktaFaktaFakta dandandandan StatistikStatistikStatistikStatistik
FaktaFaktaFaktaFakta dandandandan StatistikStatistikStatistikStatistik
11%11%%% sampaisampaisampaisampai 1414%1414%%% MedicalMedicalMedicalMedical PatientsPatientsPatientsPatients
11%11%%% sampaisampaisampaisampai 1414%1414%%% MedicalMedicalMedicalMedical PatientsPatientsPatientsPatients
RatioRatioRatioRatio samasamasamasama ((pria((priapriapria dandandandan wanitawanita)wanitawanita)))
RatioRatioRatioRatio samasamasamasama ((pria((priapriapria dandandandan wanitawanita)wanitawanita)))
MMMMungkinungkinungkinungkin terjaditerjaditerjaditerjadi setiapsetiapsetiapsetiap waktuwaktuwaktuwaktu
MMMMungkinungkinungkinungkin terjaditerjaditerjaditerjadi setiapsetiapsetiapsetiap waktuwaktuwaktuwaktu
KeyakinanKeyakinanKeyakinanKeyakinan sakitsakitsakitsakit beratberatberatberat
KeyakinanKeyakinanKeyakinanKeyakinan sakitsakitsakitsakit beratberatberatberat
Banyak kunjungan dan tes medis
Banyak kunjungan dan tes medis
Gangguan Hipokondriasis EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
Gangguan Hipokondriasis
EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
GangguanGangguanGangguanGangguan KKognitiKKognitiognitifognitifff //// PerPersPerPerssepsepepsiepsisisi
GangguanGangguanGangguanGangguan KKognitiKKognitiognitifognitifff //// PerPersPerPerssepsepepsiepsisisi
PenyakitPenyakitPenyakitPenyakit lebihlebihlebihlebih banyakbanyakbanyakbanyak dalamdalamdalamdalam keluargakeluargakeluargakeluarga
PenyakitPenyakitPenyakitPenyakit lebihlebihlebihlebih banyakbanyakbanyakbanyak dalamdalamdalamdalam keluargakeluargakeluargakeluarga
PenyakitPenyakitPenyakitPenyakit lebihlebihlebihlebih banyakbanyakbanyakbanyak berkaitanberkaitanberkaitanberkaitan dengandengandengandengan
PenyakitPenyakitPenyakitPenyakit lebihlebihlebihlebih banyakbanyakbanyakbanyak berkaitanberkaitanberkaitanberkaitan dengandengandengandengan
keluargakeluargakeluargakeluarga
keluargakeluargakeluargakeluarga
PerhatianPerhatianPerhatianPerhatian berlebihanberlebihanberlebihanberlebihan padapadapadapada “Perilaku“Perilaku“Perilaku“Perilaku Sakit”Sakit”Sakit”Sakit”
PerhatianPerhatianPerhatianPerhatian berlebihanberlebihanberlebihanberlebihan padapadapadapada “Perilaku“Perilaku“Perilaku“Perilaku Sakit”Sakit”Sakit”Sakit”
Gangguan Hipokondriasis TerapiTerapiTerapiTerapi PsPsikPsPsikikologiikologiologikologikkk TerapiTerapiTerapiTerapi
Gangguan Hipokondriasis
TerapiTerapiTerapiTerapi PsPsikPsPsikikologiikologiologikologikkk
TerapiTerapiTerapiTerapi PsPsikPsPsikikologiikologiologikologikkk
memodifikasimemodifikasimemodifikasimemodifikasi persepsipersepsipersepsipersepsi penyakitpenyakitpenyakitpenyakit
memodifikasimemodifikasimemodifikasimemodifikasi persepsipersepsipersepsipersepsi penyakitpenyakitpenyakitpenyakit
membangkitkanmembangkitkanmembangkitkanmembangkitkan sensasisensasi-sensasisensasi--sensasi-sensasisensasisensasi
membangkitkanmembangkitkanmembangkitkanmembangkitkan sensasisensasi-sensasisensasi--sensasi-sensasisensasisensasi
secarasecarasecarasecara fisikfisikfisikfisik
secarasecarasecarasecara fisikfisikfisikfisik
MemberikanMemberikanMemberikanMemberikan penjaminanpenjaminanpenjaminanpenjaminan yangyangyangyang
MemberikanMemberikanMemberikanMemberikan penjaminanpenjaminanpenjaminanpenjaminan yangyangyangyang
“Sesuai”“Sesuai”“Sesuai”“Sesuai”
“Sesuai”“Sesuai”“Sesuai”“Sesuai”
RisetRisetRisetRiset yangyangyangyang lebihlebihlebihlebih besarbesarbesarbesar dibutuhkandibutuhkan!dibutuhkandibutuhkan!!!
RisetRisetRisetRiset yangyangyangyang lebihlebihlebihlebih besarbesarbesarbesar dibutuhkandibutuhkan!dibutuhkandibutuhkan!!!
Gangguan Somatisasi DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik DeskripsiDeskripsiDeskripsiDeskripsi
Gangguan Somatisasi
DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik
DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik
SindromaSindromaSindromaSindroma Briquet’sBriquet’sBriquet’sBriquet’s
SindromaSindromaSindromaSindroma Briquet’sBriquet’sBriquet’sBriquet’s
BanyakBanyakBanyakBanyak keluhankeluhan-keluhankeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
BanyakBanyakBanyakBanyak keluhankeluhan-keluhankeluhan--keluhan-keluhankeluhankeluhan fisikfisikfisikfisik
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui penyebabpenyebabpenyebabpenyebab medismedismedismedis
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui penyebabpenyebabpenyebabpenyebab medismedismedismedis
SedikitSedikitSedikitSedikit perhatianperhatianperhatianperhatian mengenaimengenaimengenaimengenai gejalagejalagejalagejala
SedikitSedikitSedikitSedikit perhatianperhatianperhatianperhatian mengenaimengenaimengenaimengenai gejalagejalagejalagejala
LaLaLaLa BelleBelleBelleBelle IndifferenceIndifferenceIndifferenceIndifference
LaLaLaLa BelleBelleBelleBelle IndifferenceIndifferenceIndifferenceIndifference
HidupHidupHidupHidup berputasberputasberputasberputas sekitarsekitarsekitarsekitar gejalagejalagejalagejala
HidupHidupHidupHidup berputasberputasberputasberputas sekitarsekitarsekitarsekitar gejalagejalagejalagejala
Gangguan Somatisasi FaFakFaFakktkttataaa dandandandan StatistiStatistikStatistiStatistikkk FaFakFaFakktkttataaa
Gangguan Somatisasi
FaFakFaFakktkttataaa dandandandan StatistiStatistikStatistiStatistikkk
FaFakFaFakktkttataaa dandandandan StatistiStatistikStatistiStatistikkk
SangatSangatSangatSangat jarangjarangjarangjarang
SangatSangatSangatSangat jarangjarangjarangjarang
kirakira-kirakira--kira-kirakirakira 44.44
kirakira-kirakira--kira-kirakirakira 44.44
4.44%4%%%
4.44%4%%%
daridaridaridari PopulaPopulasiPopulaPopulasisisi
daridaridaridari PopulaPopulasiPopulaPopulasisisi
OnsetOnsetOnsetOnset padapadapadapada remajaremajaremajaremaja
OnsetOnsetOnsetOnset padapadapadapada remajaremajaremajaremaja
WanitaWanitaWanitaWanita >>>> priapriapriapria
WanitaWanitaWanitaWanita >>>> priapriapriapria
SeringSeringSeringSering padapadapadapada keadaankeadaankeadaankeadaan kronikkronikkronikkronik
SeringSeringSeringSering padapadapadapada keadaankeadaankeadaankeadaan kronikkronikkronikkronik
Gangguan Somatisasi PenyebabPenyebabPenyebabPenyebab PenyebabPenyebabPenyebabPenyebab
Gangguan Somatisasi
PenyebabPenyebabPenyebabPenyebab
PenyebabPenyebabPenyebabPenyebab
BerhubunganBerhubunganBerhubunganBerhubungan dengandengandengandengan keluargakeluargakeluargakeluarga
BerhubunganBerhubunganBerhubunganBerhubungan dengandengandengandengan keluargakeluargakeluargakeluarga
BerhubunganBerhubunganBerhubunganBerhubungan dengandengandengandengan kepribadiankepribadiankepribadiankepribadian antisosialantisosialantisosialantisosial
BerhubunganBerhubunganBerhubunganBerhubungan dengandengandengandengan kepribadiankepribadiankepribadiankepribadian antisosialantisosialantisosialantisosial
KelKelKelKeleeeemmmmaaaahanhanhanhan perilakuperilakuerilakuerilaku inhibisiinhibisiinhibisiinhibisi
KelKelKelKeleeeemmmmaaaahanhanhanhan pp
perilakuperilakuerilakuerilaku inhibisiinhibisiinhibisiinhibisi
pp
– –
– –
KekuatanKekuatanKekuatanKekuatan perilakuperilakuperilakuperilaku aktivasiaktivasiaktivasiaktivasi
KekuatanKekuatanKekuatanKekuatan perilakuperilakuperilakuperilaku aktivasiaktivasiaktivasiaktivasi
– –
KeuntunganKeuntunganKeuntunganKeuntungan jangkajangkajangkajangka pendekpendekpendekpendek
KeuntunganKeuntunganKeuntunganKeuntungan jangkajangkajangkajangka pendekpendekpendekpendek
Gangguan Somatisasi TerapiTerapiTerapiTerapi TerapiTerapiTerapiTerapi SukarSukarSukarSukar
Gangguan Somatisasi
TerapiTerapiTerapiTerapi
TerapiTerapiTerapiTerapi
SukarSukarSukarSukar diterapiditerapiditerapiditerapi
SukarSukarSukarSukar diterapiditerapiditerapiditerapi
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui terapinyaterapinyaterapinyaterapinya
TidakTidakTidakTidak diketahuidiketahuidiketahuidiketahui terapinyaterapinyaterapinyaterapinya
KunjunganKunjunganKunjunganKunjungan medismedismedismedis
KunjunganKunjunganKunjunganKunjungan medismedismedismedis
yyyy yyyy
angangangang luasluasluasluas
angangangang luasluasluasluas
TTerapiTTerapierapierapi dipusatkandipusatkandipusatkandipusatkan padapadapadapada
TTerapiTTerapierapierapi dipusatkandipusatkandipusatkandipusatkan padapadapadapada
– –
PPePPeenguranganengurangannguranganngurangan kunjungankunjungankunjungankunjungan medismedismedismedis
PPePPeenguranganengurangannguranganngurangan kunjungankunjungankunjungankunjungan medismedismedismedis
– –
PenguranganPenguranganPenguranganPengurangan keuntungankeuntungankeuntungankeuntungan sekundersekundersekundersekunder
PenguranganPenguranganPenguranganPengurangan keuntungankeuntungankeuntungankeuntungan sekundersekundersekundersekunder
Gangguan Konversi DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik DeskripsiDeskripsiDeskripsiDeskripsi
Gangguan Konversi
DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik
DeskripsiDeskripsiDeskripsiDeskripsi KlinikKlinikKlinikKlinik
MalfungsiMalfungsiMalfungsiMalfungsi FisikFisikFisikFisik
MalfungsiMalfungsiMalfungsiMalfungsi FisikFisikFisikFisik
– –
LLLLumpuhumpuhumpuhumpuh (paralysis)(paralysis)(paralysis)(paralysis) kebutaankebutaankebutaankebutaan AphoniaAphoniaAphoniaAphonia
LLLLumpuhumpuhumpuhumpuh (paralysis)(paralysis)(paralysis)(paralysis) kebutaankebutaankebutaankebutaan AphoniaAphoniaAphoniaAphonia
,,,,
,,,,
,,,,
,,,,
– –
MutismMutism,MutismMutism,,, kehilangankehilangankehilangankehilangan sensasisensasisensasisensasi sentuhansentuhansentuhansentuhan
MutismMutism,MutismMutism,,, kehilangankehilangankehilangankehilangan sensasisensasisensasisensasi sentuhansentuhansentuhansentuhan
TidakTidakTidakTidak patologikpatologikpatologikpatologik organikorganikorganikorganik
TidakTidakTidakTidak patologikpatologikpatologikpatologik organikorganikorganikorganik
TerlihatTerlihatTerlihatTerlihat sepertisepertisepertiseperti penyakitpenyakitpenyakitpenyakit neurologikneurologikneurologikneurologik
TerlihatTerlihatTerlihatTerlihat sepertisepertisepertiseperti penyakitpenyakitpenyakitpenyakit neurologikneurologikneurologikneurologik
DipopulerkanDipopulerkanDipopulerkanDipopulerkan oleholeholeholeh FreuFreuFreuFreudddd
DipopulerkanDipopulerkanDipopulerkanDipopulerkan oleholeholeholeh FreuFreuFreuFreudddd
Gangguan Konversi KondisiKondisi-KondisiKondisi--kondisi-kondisikondisikondisi yangyangyangyang
Gangguan Konversi
KondisiKondisi-KondisiKondisi--kondisi-kondisikondisikondisi yangyangyangyang terkaitterkaitterkaitterkait
KondisiKondisi-KondisiKondisi--kondisi-kondisikondisikondisi yangyangyangyang terkaitterkaitterkaitterkait
MalingeringMalingeringMalingeringMalingering atauatauatauatau seseuatuseseuatuseseuatuseseuatu yangyangyangyang lainlain?lainlain???
MalingeringMalingeringMalingeringMalingering atauatauatauatau seseuatuseseuatuseseuatuseseuatu yangyangyangyang lainlain?lainlain???
– –
LaLaLaLa BelleBelleBelleBelle IndifferenceIndifferenceIndifferenceIndifference
LaLaLaLa BelleBelleBelleBelle IndifferenceIndifferenceIndifferenceIndifference
– –
PrePrePrePresipitasisipitasisipitasisipitasi oleholeholeholeh penandapenandapenandapenanda stresstresstresstres
PrePrePrePresipitasisipitasisipitasisipitasi oleholeholeholeh penandapenandapenandapenanda stresstresstresstres
– –
DapatDapatDapatDapat berfungsiberfungsiberfungsiberfungsi secarasecarasecarasecara normalnormalnormalnormal
DapatDapatDapatDapat berfungsiberfungsiberfungsiberfungsi secarasecarasecarasecara normalnormalnormalnormal
GangguanGangguanGangguanGangguan BuatanBuatanBuatanBuatan ((Factitious((FactitiousFactitiousFactitious DisordersDisorders)DisordersDisorders)))
GangguanGangguanGangguanGangguan BuatanBuatanBuatanBuatan ((Factitious((FactitiousFactitiousFactitious DisordersDisorders)DisordersDisorders)))
Munchausen’sMunchausen’sMunchausen’sMunchausen’s SyndromeSyndromeSyndromeSyndrome oleholeholeholeh ProxyProxyProxyProxy
Munchausen’sMunchausen’sMunchausen’sMunchausen’s SyndromeSyndromeSyndromeSyndrome oleholeholeholeh ProxyProxyProxyProxy
– –
Gangguan Konversi FaFaktaFaFaktaktakta dandandandan StatistiStatistikStatistiStatistikkk FaFaktaFaFaktaktakta
Gangguan Konversi
FaFaktaFaFaktaktakta dandandandan StatistiStatistikStatistiStatistikkk
FaFaktaFaFaktaktakta dandandandan StatistiStatistikStatistiStatistikkk
RelatiRelatifRelatiRelatifff jarangjarangjarangjarang
RelatiRelatifRelatiRelatifff jarangjarangjarangjarang
WanitaWanitaWanitaWanita >>>> priapriapriapria
WanitaWanitaWanitaWanita >>>> priapriapriapria
OnsetOnsetOnsetOnsetOnsetOnsetOnsetOnset sekitarsekitarsekitarsekitarsekitarsekitarsekitarsekitar masamasamasamasamasamasamasamasa remajaremajaremajaremajaremajaremajaremajaremaja
Gangguan Konversi EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
Gangguan Konversi
EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
EtiologiEtiologiEtiologiEtiologi //// PenyebabPenyebabPenyebabPenyebab
PengalamanPengalamanPengalamanPengalaman TraumaTraumaTraumaTrauma
PengalamanPengalamanPengalamanPengalaman TraumaTraumaTraumaTrauma
menjadimenjadimenjadimenjadi sakitsakitsakitsakit dapatdapatdapatdapat diterimaditerimaditerimaditerima
menjadimenjadimenjadimenjadi sakitsakitsakitsakit dapatdapatdapatdapat diterimaditerimaditerimaditerima
GejalaGejalaGejalaGejala----gejalagejalagejalagejala pelarianpelarianpelarianpelarian daridaridaridari efekefekefekefek traumatraumatraumatrauma
GejalaGejalaGejalaGejala----gejalagejalagejalagejala pelarianpelarianpelarianpelarian daridaridaridari efekefekefekefek traumatraumatraumatrauma
ApaApaApaApa yangyangyangyang mempengaruhimempengaruhimempengaruhimempengaruhi pemilihanpemilihanpemilihanpemilihan gejalagejala?gejalagejala???
ApaApaApaApa yangyangyangyang mempengaruhimempengaruhimempengaruhimempengaruhi pemilihanpemilihanpemilihanpemilihan gejalagejala?gejalagejala???
Gangguan Konversi TTerapiTTerapierapierapi TTerapiTTerapierapierapi MenunjukkanMenunjukkanMenunjukkanMenunjukkan
Gangguan Konversi
TTerapiTTerapierapierapi
TTerapiTTerapierapierapi
MenunjukkanMenunjukkanMenunjukkanMenunjukkan peristiwaperistiwaperistiwaperistiwa ttraumatittraumatiraumatikraumatikkk
MenunjukkanMenunjukkanMenunjukkanMenunjukkan peristiwaperistiwaperistiwaperistiwa ttraumatittraumatiraumatikraumatikkk
HilangkanHilangkanHilangkanHilangkan sumbersumbersumbersumber keuntungankeuntungankeuntungankeuntungan
HilangkanHilangkanHilangkanHilangkan sumbersumbersumbersumber keuntungankeuntungankeuntungankeuntungan
sekundersesesekunderunderunder kk kk dd dd
sekundersesesekunderunderunder
TidakTidakTidakTidak ditetapkanditetapkanditetapkanditetapkan pengobatanpengobatanpengobatanpengobatan terbaikterbaikterbaikterbaik
TidakTidakTidakTidak ditetapkanditetapkanditetapkanditetapkan pengobatanpengobatanpengobatanpengobatan terbaikterbaikterbaikterbaik
Gangguan Nyeri Somatoform DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
Gangguan Nyeri Somatoform
DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
DesDeskDesDeskkripkripripsiripsisisi kklinikkliniliniklinikkk
NyeriNyeriNyeriNyeri yangyangyangyang nyatanyatanyatanyata
NyeriNyeriNyeriNyeri yangyangyangyang nyatanyatanyatanyata
NyeriNyeriNyeriNyeri mungkinmungkinmungkinmungkin mempunyaimempunyaimempunyaimempunyai sebabsebabsebabsebab organikorganikorganikorganik
NyeriNyeriNyeriNyeri mungkinmungkinmungkinmungkin mempunyaimempunyaimempunyaimempunyai sebabsebabsebabsebab organikorganikorganikorganik
FaFakFaFakktorktortortor PsPsikPsPsikikologiikologiologikologikkk mempertahankanmempertahankanmempertahankanmempertahankan nyerinyerinyerinyeri
FaFakFaFakktorktortortor PsPsikPsPsikikologiikologiologikologikkk mempertahankanmempertahankanmempertahankanmempertahankan nyerinyerinyerinyeri
DapatDapatDapatDapat melemahkanmelemahkanmelemahkanmelemahkan
DapatDapatDapatDapat melemahkanmelemahkanmelemahkanmelemahkan
Gangguan Body Dysmorphic DesDeskDesDeskkripkripripsiripsisisi KKliniKKliniliniklinikkk
Gangguan Body Dysmorphic
DesDeskDesDeskkripkripripsiripsisisi KKliniKKliniliniklinikkk
DesDeskDesDeskkripkripripsiripsisisi KKliniKKliniliniklinikkk
PreoPreokPreoPreokkupakupaupasiupasisisi dengandengandengandengan penampilanpenampilanpenampilanpenampilan
PreoPreokPreoPreokkupakupaupasiupasisisi dengandengandengandengan penampilanpenampilanpenampilanpenampilan
– MembayangkanMembayangkanMembayangkanMembayangkan cacatcacatcacatcacat
MembayangkanMembayangkanMembayangkanMembayangkan cacatcacatcacatcacat
““Membayangkan““MembayangkanMembayangkan”Membayangkan””” kejelekkankejelekkankejelekkankejelekkan
““Membayangkan““MembayangkanMembayangkan”Membayangkan””” kejelekkankejelekkankejelekkankejelekkan
BanyakBanyakBanyakBanyak bercerminbercerminbercerminbercermin ((Fi((FiFiksasiFiksasiksasiksasi atauatauatauatau
BanyakBanyakBanyakBanyak bercerminbercerminbercerminbercermin ((Fi((FiFiksasiFiksasiksasiksasi atauatauatauatau
PenghindaranPenghindaran)PenghindaranPenghindaran)))
PenghindaranPenghindaran)PenghindaranPenghindaran)))
ideideideide –––– ideideideide rujukanrujukanrujukanrujukan ((Ideas((IdeasIdeasIdeas ofofofof ReferenceReference)ReferenceReference)))
ideideideide –––– ideideideide rujukanrujukanrujukanrujukan ((Ideas((IdeasIdeasIdeas ofofofof ReferenceReference)ReferenceReference)))
IdeIdeIdeIde dandandandan kecenderungankecenderungankecenderungankecenderungan bunuhbunuhbunuhbunuh diridiridiridiri
IdeIdeIdeIde dandandandan kecenderungankecenderungankecenderungankecenderungan bunuhbunuhbunuhbunuh diridiridiridiri
Gangguan Body Dysmorphic LokasiLokasiLokasiLokasi cacatcacatcacatcacat yangyangyangyang LokasiLokasiLokasiLokasi
Gangguan Body Dysmorphic
LokasiLokasiLokasiLokasi cacatcacatcacatcacat yangyangyangyang
LokasiLokasiLokasiLokasi cacatcacatcacatcacat yangyangyangyang
palingpalingpalingpaling seringseringseringsering
palingpalingpalingpaling seringseringseringsering
KulitKulitKulitKulit
KulitKulitKulitKulit
MataMataMataMata
MataMataMataMata
KepalaKepalaKepalaKepala //// MukaMukaMukaMuka
KepalaKepalaKepalaKepala //// MukaMukaMukaMuka
BibirBibirBibirBibir
BibirBibirBibirBibir
Gangguan Body Dysmorphic FFaktaFFaktaaktaakta dandandandan StatistiStatistikStatistiStatistikkk FFaktaFFaktaaktaakta
Gangguan Body Dysmorphic
FFaktaFFaktaaktaakta dandandandan StatistiStatistikStatistiStatistikkk
FFaktaFFaktaaktaakta dandandandan StatistiStatistikStatistiStatistikkk
MahasiswaMahasiswaMahasiswaMahasiswa
MahasiswaMahasiswaMahasiswaMahasiswa
– 7070%7070%%% dilaporkandilaporkandilaporkandilaporkan tidaktidaktidaktidak memuaskanmemuaskanmemuaskanmemuaskan
7070%7070%%% dilaporkandilaporkandilaporkandilaporkan tidaktidaktidaktidak memuaskanmemuaskanmemuaskanmemuaskan
– 28282828%%%% memenuhimemenuhimemenuhimemenuhi kriteriakriteriakriteriakriteria diagnostikdiagnostikdiagnostikdiagnostik “Body“Body“Body“Body
28282828%%%% memenuhimemenuhimemenuhimemenuhi kriteriakriteriakriteriakriteria diagnostikdiagnostikdiagnostikdiagnostik “Body“Body“Body“Body
Dysmorphic”Dysmorphic”Dysmorphic”Dysmorphic”
Dysmorphic”Dysmorphic”Dysmorphic”Dysmorphic”
BanyakBanyakBanyakBanyak konsulkonsulkonsulkonsul kemkemkemkem dokterdokterdokterdokter bedahbedahbedahbedah plastikplastikplastikplastik
BanyakBanyakBanyakBanyak konsulkonsulkonsulkonsul kemkemkemkem dokterdokterdokterdokter bedahbedahbedahbedah plastikplastikplastikplastik
WanitaWanitaWanitaWanita ==== PriaPriaPriaPria
WanitaWanitaWanitaWanita ==== PriaPriaPriaPria
OnsetOnsetOnsetOnset akhirakhirakhirakhir masamasamasamasa remajaremajaremajaremaja
OnsetOnsetOnsetOnset akhirakhirakhirakhir masamasamasamasa remajaremajaremajaremaja
Gangguan Body Dysmorphic ApakahApakahApakahApakah BedahBedahBedahBedah PlastikPlastikPlastikPlastik
Gangguan Body Dysmorphic
ApakahApakahApakahApakah BedahBedahBedahBedah PlastikPlastikPlastikPlastik SolusinyaSolusinya?SolusinyaSolusinya???
ApakahApakahApakahApakah BedahBedahBedahBedah PlastikPlastikPlastikPlastik SolusinyaSolusinya?SolusinyaSolusinya???
SungguhSungguhSungguhSungguh PopularPopularPopularPopular tetapitetapitetapitetapi mahalmahalmahalmahal
SungguhSungguhSungguhSungguh PopularPopularPopularPopular tetapitetapitetapitetapi mahalmahalmahalmahal
KebanyakanKebanyakanKebanyakanKebanyakan kecewakecewakecewakecewa dengandengandengandengan hasilnyahasilnyahasilnyahasilnya
KebanyakanKebanyakanKebanyakanKebanyakan kecewakecewakecewakecewa dengandengandengandengan hasilnyahasilnyahasilnyahasilnya
BEFOREBEFOREBEFOREBEFOREBEFOREBEFOREBEFOREBEFORE
AFTERAFTERAFTERAFTERAFTERAFTERAFTERAFTER
Gangguan Body Dysmorphic EtiologiEtiologiEtiologiEtiologi dandandandan TerapiTerapiTerapiTerapi
Gangguan Body Dysmorphic
EtiologiEtiologiEtiologiEtiologi dandandandan TerapiTerapiTerapiTerapi
EtiologiEtiologiEtiologiEtiologi dandandandan TerapiTerapiTerapiTerapi
SedikitSedikitSedikitSedikit yangyangyangyang diketahuidiketahuidiketahuidiketahui
SedikitSedikitSedikitSedikit yangyangyangyang diketahuidiketahuidiketahuidiketahui
TerjadiTerjadiTerjadiTerjadi bersamabersamabersamabersama dengandengandengandengan OCDOCDOCDOCD
TerjadiTerjadiTerjadiTerjadi bersamabersamabersamabersama dengandengandengandengan OCDOCDOCDOCD
– PikiranPikiranPikiranPikiran----pikiranpikiranpikiranpikiran yangyangyangyang mengganggumengganggumengganggumengganggu dandandandan
PikiranPikiranPikiranPikiran----pikiranpikiranpikiranpikiran yangyangyangyang mengganggumengganggumengganggumengganggu dandandandan
paksaanpaksaanpaksaanpaksaan untukuntukuntukuntuk mengecekmengecekmengecekmengecek penampilannya.penampilannya.penampilannya.penampilannya.
paksaanpaksaanpaksaanpaksaan untukuntukuntukuntuk mengecekmengecekmengecekmengecek penampilannya.penampilannya.penampilannya.penampilannya.
PajananPajananPajananPajanan ++++ ResponsResponsResponsRespons PPencegahanPPencegahanencegahanencegahan
PajananPajananPajananPajanan ++++ ResponsResponsResponsRespons PPencegahanPPencegahanencegahanencegahan