0 penilaian0% menganggap dokumen ini bermanfaat (0 suara)
16 tayangan26 halaman
1) A new startup company called ClearDetections was founded in December 2011 in Wageningen, Netherlands to offer molecular diagnostic kits for identification and detection of nematodes.
2) Current nematode identification methods are inaccurate, labor-intensive, and not scalable. ClearDetections has developed a proprietary nematode DNA database and quantitative PCR (qPCR) tests that provide highly accurate nematode identification that is less labor-intensive, up-scalable, and more cost-effective.
3) ClearDetections' diagnostic kits include DNA extraction materials, qPCR primers for target and control nematodes, positive and negative control DNA, and a simple protocol. Their approach provides objective, robust,
1) A new startup company called ClearDetections was founded in December 2011 in Wageningen, Netherlands to offer molecular diagnostic kits for identification and detection of nematodes.
2) Current nematode identification methods are inaccurate, labor-intensive, and not scalable. ClearDetections has developed a proprietary nematode DNA database and quantitative PCR (qPCR) tests that provide highly accurate nematode identification that is less labor-intensive, up-scalable, and more cost-effective.
3) ClearDetections' diagnostic kits include DNA extraction materials, qPCR primers for target and control nematodes, positive and negative control DNA, and a simple protocol. Their approach provides objective, robust,
1) A new startup company called ClearDetections was founded in December 2011 in Wageningen, Netherlands to offer molecular diagnostic kits for identification and detection of nematodes.
2) Current nematode identification methods are inaccurate, labor-intensive, and not scalable. ClearDetections has developed a proprietary nematode DNA database and quantitative PCR (qPCR) tests that provide highly accurate nematode identification that is less labor-intensive, up-scalable, and more cost-effective.
3) ClearDetections' diagnostic kits include DNA extraction materials, qPCR primers for target and control nematodes, positive and negative control DNA, and a simple protocol. Their approach provides objective, robust,
Renske Landeweert & Hans Helder QBOL-EPPO meeting Haarlem May 2012 New start up company: Joined initiative of Wageningen University & BLGG AgroXpertus Founded December 2011 Based in Wageningen (NL) Offering molecular diagnostics to agricultural labs Nematodes cause US$ 80 billion damage annually Phasing out of pesticides Durable alternatives depend on accurate diagnostics Problem Nematodes are numerous & speciose, but possess few informative morphological characters Picture from Greg Tylka (Iowa State University) Problem (continued) Agricultural (inspection) laboratories need analyses: More accurate Less labour intensive Up-scalable More cost effective Current situation dr. Hans Helder Laboratory of Nematology, Wageningen University Sven van den Elsen, Paul Mooyman, Martijn Holterman Solution Single worm classical identification & digital high resolution pictures Building a database that links morphological and molecular data DNA extraction DNA amplification cloning into vector DNA sequencing Nematode DNA database Nematode DNA wallpaper GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGGCCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTGAGGTG Cl 1129+1626+1627 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG Cl 1109+1622+1743 GTGGTAAACTTCATCTAAGACCTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACATTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG clone1586+1587+1588 GTGGTAAACTTCATCTAAGACTCAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTGAGGTG clone1589+1590+1591 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG clone1592+1593+1594 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG clone1595+1596+159 GTGGTAAACTTCATCTAAGACTCAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGATAGAGTTAAAGAGGACGTGAAACCGGAGAGGTG clone1598+1599+1600 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG clone1601+1602+1603 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG clone1607+1608+16 GTGGTAAACTTCATCTAAGACTTAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGTAAGGTG Cl 1610+1611+1612 GTGGTAAACTTCATCTAAGACTCAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGAGAGGTG Cl 1613+1614+1615 GTGGTAAACTTCATCTAAGACTCAATATTGCCACGAGACCGATAGCAAACAAGTACTGTGAAGGAAGGTTGCAAAGCACTTTGAAGAGAGAGTTAAAGAGGACGTGAAACCGGAGAGGTG Proprietary database with 2,500 SSU rDNAs covering all major terrestrial and freshwater nematode groups (= haystack) Specific DNA sequence signatures for most plant parasitic nematodes (= needles) Nematode DNA database World-wide largest nematode DNA database. . enabling clear detection of needles in haystack Nematode DNA database World-wide largest nematode DNA database Proprietary nematode DNA extraction method Proprietary primers for plant pathogenic nematodes Diagnostic Q-PCR tests (validated and in use) We generated: M.chit. DNA + M.chit. primers 10 -6 10 -5 10 -5 10 -6 M.fal. DNA + M.fal. primers M.fal. DNA + M.chit. primers M.chit. DNA + M.fal. primers Specificity of Q-PCR tests (1) Specificity of Q-PCR tests (2) M.fal. DNA + (M.chit. DNA +) M.fal. primers M.fal. M.chit. 10 -4 10 -5 10 -5 10 -5 10 -6 10 -5 10 -7 10 -5 10 -8 10 -5 Sensitivity of Q-PCR tests Most accurate diagnostics of nematodes: M.chitwoodi 0 5 10 15 20 25 30 35 40 45 1--10 10--100 100--1000 1000-100000 Aantal aaltjes per besmetting a a n t a l
b e s m e t t e
m o n s t e r s Mic. 2007 DNA 2007 M.minor 0 1 2 3 4 5 1--10 10--100 100--1000 1000-100000 Aantal aaltjes per besmetting A a n t a l
b e s m e t t e
m o n s t e r s Mic. 2007 DNA 2007 #nematodes/infected sample # i n f e c t e d
s a m p l e s #nematodes/infected sample # i n f e c t e d
s a m p l e s microscope molecular Calibration line Chitwoodi 0 0,5 1 1,5 2 2,5 20 22 24 26 28 30 Average Ct value (Q-PCR) L o g
a m o u n t
n e m a t o d s Calibration line M.Fallax 0 0,5 1 1,5 2 2,5 22 24 26 28 30 32 Average Ct value (Q-PCR) L o g
a m o u n t
n e m a t o d s M. chitwoodi 1 40 nematodes M. fallax 1 40 nematodes Quantification with Q-PCR tests Most technologies: Molecular identification in a pre-selected pool - Barely up-scalable - Not automatable Our technology: Molecular detection and quantification without any pre-selection - Up-scalable - Automatable target Main advantage of our Q-PCR tests: Service laboratory: routine analyses of nematodes > 40.000 soil samples / year for nematodes > 250.000 Q-PCR tests / year (~ 20.000 samples) Extensive use of Q-PCR tests 40.000 samples/year 20.000 samples/year 20.000 samples/year Current routine workflow Quantitative molecular tests (Q-PCR SybrGreen based): Meloidogyne chitwoodi*, M. fallax*, M. minor, M. naasi, M. hapla Globodera rostochiensis*, G. pallida*, G. artemisiae, G. achilleae Ditylenchus dipsaci, D. destructor Heterodera schachtii, H. betae/trifolii Pratylenchus thornei, P. crenatus, P. penetrans, P. neglectus, P. vulnus Trichodorus spp., T. primitivus, T. similis, T. viruliferus Paratrichodorus spp., P. teres, P. pachydermus, P. nanus, P. anemones Radopholus similis .. + ~20 families of non-plant parasitic nematodes * in EPPO Standards Currently in use 1) Diagnostic kits for nematodes: DNA extraction & purification Species identification Species quantification 2) Dedicated system (including Training, Support and Trouble shooting) ClearDetections offers Most accurate diagnostics of nematodes: Simple protocol (monophasic) Identical PCR program for all primers Specific and sensitive Objective and robust Quantitative No sequencing required No fishing required Easy to standardize Europe: ClearDetections tests in EPPO Standards (European Plant Protection Organisation) ClearDetections offers All primers have the same annealing temperature (63C): Meloidogyne chitwoodi*, M. fallax*, M. minor, M. naasi, M. hapla Globodera rostochiensis*, G. pallida*, G. artemisiae, G. achilleae Ditylenchus dipsaci, D. destructor Heterodera schachtii, H. betae/trifolii Pratylenchus thornei, P. crenatus, P. penetrans, P. neglectus, P. vulnus Trichodorus spp., T. primitivus, T. similis, T. viruliferus Paratrichodorus spp., P. teres, P. pachydermus, P. nanus, P. anemones Radopholus similis .. + ~20 families of non-plant parasitic nematodes * in EPPO Standards Ta: 63C DNA extraction kit (single nematodes and communities) Species identification kits for: Meloidogyne chitwoodi & M. fallax Globodera rostochiensis & G. pallida & G. tabacum Pratylenchus (several species) Heterodera (several species) Ditylenchus dipsaci & D. destructor Many more to follow: also fungi, bacteria, viruses Our first kits DNA extraction & purification materials Q-PCR primers for Control DNA Simple protocol Q-PCR primers (SybrGreen) for target species Q-PCR primers (SybrGreen) for all nematodes as control Positive control DNA (plasmid) of target species Negative control DNA (plasmid) of non-target species Simple protocol Nematode identification kits Website: www.cleardetections.com availabe from end of June 2012 YouTube movie: search for cleardetections http://www.youtube.com/watch?v=LEKW2CbdkDc More information, suggestions & contact: info@cleardetections.com Thank you!