Name __________________________________

PID ______________________________


EXAM 1 BIO101 SUMMER SESSION I 2014



HONOR CODE PLEDGE_______________________________________










This exam has a total of 100 points on it.
Each question is worth 3 points. There is also a 1 point bonus question at the end.
Please turn in ALL materials at the end of the exam, including scrap paper.


____1. Which of the following is TRUE of genomes?
A) The number of genes is proportional to the size of the genome
B) The size of the genome is proportional to the complexity of the organism
C) The complexity of the organism is proportional to the number of introns in a gene
D) The size of the genome is proportional to the length of its exons

____2. The haploid number of Arabidopsis thaliana is 5. How many chromosomes would be
present in a leaf cell of a tetraploid Arabidopsis thaliana plant:
A) 4
B) 10
C) 5
D) 15
E) 20

____3. Imagine that a genome association mapping study revealed a particular variant of a
SNP to be strongly associated with susceptibility to insomnia. From these data, you could infer
that:
A) the SNP is closely linked to a location in the genome that plays a role in insomnia.
B) the SNP is located in a gene that determines insomnia.
C) the variant SNP most likely causes insomnia.
D) the variant SNP plays a role in insomnia.

____4. An intercalating agent inserts itself between base pairs in a DNA sequence. This type of
mutagen is most likely to cause a:
A) transition
B) transversion
C) framesift
D) depurination
E) deamination

____5. The graph to the right shows the percent similarity of the epigenomes between:
the liver cells from two identical twins at age 5
a liver and a skin cell from the same individual
the liver cells from identical twins at age 70

Each of these three samples represents either A, B, or C on the
graph. When the liver cells from two identical twins at age 5 are
compared, which of these bars do you think represents their
similarity?
A) A
B) B
C) C






____6. A man is found to be karyotypically 47,XXY. The presence of an extra X chromosome
CANNOT result from:
A) non-disjunction in a maternal meiocyte at meiosis I.
B) non-disjunction in a maternal meiocyte at meiosis II.
C) non-disjunction in a paternal meiocyte at meiosis I.
D) non-disjunction in a paternal meiocyte at meiosis II.
E) None of the choices, meaningit can result from non-disjunction in meiosis I or II from either
parent.

____7. How many of the children listed in the
table are the actual children of these two
parents?
A) 0
B) 1
C) 2
D) 3






____8. Ethyl methanesulfonate (EMS) is a mutagen that alters the chemical composition of
guanine causing it to pair with thymidine instead of cytosine. What type of mutation will most
likely occur during EMS mutagenesis?
A) Transition
B) Transversion
C) Frameshift
D) Translocation
E) None of the above

Use the table below for questions 9-10.
Patient DNA sequence data
1 TCTAAGCTAGACCGGAACTTTGCATCGATGGAC
2 TCTAGGCTAGACCGGAACTTTCCATCGAAGGCC
3 TCTAAGCTAGATCGGAACTTTGCATCGAAGGCC
4 TCTAGGCTAGACCGGAACTTTGCATCGATGGCC
5 TCTAGGCTAGATCGGAACTTTCCATCGATGGAC
6 TCTAGGCTAGACCGGAACTTTGCATCGATGGCC
7 TCTAAGCTAGATCGGAACTTTGCATCGAAGGCC

____9. Patients 4 and 6 are addicted to caffeine while the others are not. Which of the
following haplotypes may be associated the caffeine addiction?
A) ACGTA
B) GTCTC
C) ATGAC
D) GCGTC
SNP1 SNP2 SNP3 SNP4
mom
Hap 1: A G G T
Hap 2: A T C T
dad
Hap 1: A G G T
Hap 2: T G C G
Child 1

Hap 1: T G C G
Hap 2: A T C T
Child 2
Hap 1: A G G T
Hap 2: T G C G
Child 3
Hap 1: A T C T
Hap 2: A T C T
____10.How many different haplotype are represented in the data?
A) 2
B) 3
C) 4
D) 5

____11. The structure and function of the fibrilin protein in individuals with Marfan syndrome
is altered by various mutations in the gene FBN1. Fibrilin proteins interact in the extracellular
matrix to form microfibrils. The data below (Aoyama et. al, 1994) reflects the amount of
fibrillin synthesized and incorporated into the extracellular matrix in patients with Marfan
syndrome. Patients were divided into 5 different groups based on the type of mutation a
groups patients carried in their FBN1 gene. Note that all members of each group contain the
same mutation.













The mutation in members of Group II is MOST LIKELY a:
A) null mutation
B) gain-of-function mutation
C) reduction-of-function mutation
D) over-expression mutation
E) any one of the above mutations could be present in patients in Group II

____12. Researchers have hypothesized that the patients in Group IV have a dominant
negative mutation in the FBN1 gene. Which of the following explanations would provide the
strongest evidence that Group IV patients have a dominant negative mutation?
A) It leads to over-expression of the FBN1 gene
B) It decreases the relative amount of fibrilin that is present in the extracellular matrix
C) The mutant protein interferes with fibrilin microfibril formation
D) All of the above

____13. Tautomeric shifts tend to lead to:
A) Deletion of affected gene
B) Frameshift mutations
C) Missense mutations
D) Aneuploidy
E) none of the above

____14. Six individual plants were genotyped for a variant (v1-v7) of a gene involved in floral
development. A (+) indicates the variant was present. Which of the following is a CORRECT
interpretation of the data shown below.

A) This species is diploid.
B) There are not multiple alleles of this gene in
the population.
C) Plant 6 has just one allele of this gene
D) This plant has 3 homologs of each
chromosome.
E) Plants 1 and 3 have the same genotype.

____15. Which statement about SNPs is FALSE?
A) The difference between a SNP in one person verses another is the variation of number of
DNA nucleotides at that SNP
B) There are millions of different SNPs in the human genome.
C) For each SNP, a person has two copies.
D) SNPs can be located inside or outside of a functional coding region in the genome.
E) SNPs can be associated with ones risk for an adverse drug reaction.
If you answered C here, you may hand write an explanation as to why you chose C and turn it in
to Dr. Steinwand by 5pm Monday 6/30. If she is not in her office, slip it under the door!

Use the table below to answer question 16 on the Ames Test.
Plate Number of colonies
Test substance + rat liver enzyme + distilled water 500
Test substance + distilled water 2
Distilled water 10
Rat liver enzymes 1
Positive control 675
Negative control 12

____16. The test substance is:
A) a mutagen
B) a mutagen but only when metabolized
C) not a mutagen
D) cannot tell because there is contamination in this experiment

____17. The crab-eating rat (Ichthyomys pittieri) has 92 chromosomes per diploid cell (2n=92).
How many chromatids, and how many chromosomes are there in a crab-eating rat cell that is
in the prophase of meiosis II?
A) 184 chromatids and 184 chromosomes
B) 92 chromatids and 92 chromosomes
C) 46 chromatids and 92 chromosomes
D) 184 chromatids and 92 chromosomes
E) 92 chromatids and 46 chromosomes



____18. A mutation occurs in a germ cell of a pure-breeding, wild-type male cat prior to DNA
replication. The mutation is not corrected, and the cell undergoes DNA replication and a
normal meiosis producing four gametes. How many of these gametes will carry the mutation?
A) 1
B) 2
C) 3
D) 4
E) It is impossible to predict.

Questions 19-21 are True or False.
____19. A linked SNP must be present in <1% of the population.
A) True
B) False

____20. A frameshift mutation will MOST LIKELY lead to a loss-of-function mutation.
A) True
B) False

____21. A dominant allele is more likely to be found in a population.
A) True
B) False

____22. Homologous chromosomes are brought together during:
A) mitosis
B) DNA replication
C) fertilization
D) all of the above

____23. The CCR5 gene encodes protein found on the surface of certain immune cells. The HIV
virus attaches to CCR5 as a way to enter a hosts cell. A deletion in the CCR5 gene that does
not allow the HIV virus to bind to the hosts cell is best characterized as a:
A) loss-of-function mutation
B) gain-of-function mutation
All received credit for this question. It was poorly worded.

____24. All of the following are identical in BOTH a muscle cell AND a skin cell EXCEPT:
A) the alleles
B) the genes
C) the chromsomes
D) the epigenome
E) all of the above are identical in both cell types

____25. In which of the following organisms would a loss of function mutation be best
tolerated?
A) haploid bacteria
B) diploid chimpanzee
C) triploid banana
D) it depends on the size of the gene
____26. Bob has Jacobs syndrome (XY
1
Y
2
). Assume the two Y chromosomes pair in meiosis I.
If meiosis is normal, which of the following is NOT a possible sex chromsome combination in
Bobs gametes?
A) XY
1
, XY
1
, Y
2
,

Y
2

B) XY
2
, XY
2
, Y
1
,

Y
1

C) Y
1
Y
2
, Y
1
Y
2
, X, X
D) all of the above are possible sex chromosome combinations
E) none of the above are possible sex chromosome combinations

____27. Which of the following is characteristic of an active gene?
A) Epigenetically marked DNA
B) DNA tightly wound around histones
C) Few introns
D) Little condensation of chromatin
E) Regulatory mutations
____28. M. Ethyl Layton, a biologist studying
methylation on gene expression compared the gene
expression of the same gene under control of either a
human or drosophila promoter. The table lists the
number of methyl tags on the human or drosophila
promoter and the relative gene expression of the gene.
Based on these data, what general conclusion can you
make about methyl tags?
A) Drosophila genes are expressed at higher rates than
human genes because the drosophila genome contains less methyl tags
B) This seems to be a primary mechanism of gene suppression in humans, but only a minor
suppressor in drosophila, suggesting there are other, more important, gene regulators in
drosophila.

Use the following information for questions 29-30.
A genome association study was conducted to test for a correlation between Type 2 diabetes
and a higher frequency of SNPs in the genome. The results are shown below.
Percent of individuals
with Haplotype 1
Percent of individuals
with Haplotype 2
Number of
individuals
Type 2 diabetes 61.8% 9.46% 207
Non-diabetic
(controls)
56.9% 12.5% 235
____29. Do we accept or reject the null hypothesis?
A) accept
B) reject

____30. Is there a significant association between these haplotypes and type 2 diabetes?
A) Yes

Number of
methyl tags
Relative
percent of
gene
expression
Human
regulatory
region
0 100
9 50
20 25
35 2
Drosophila
regulatory
region
0 100
7 99
14 97
26 95
B) No

Use the following information for questions 30-32.
Cultures of several E.coli met- mutants were treated with two mutagens separately and
spread onto a plate lacking methionine to look for revertants. In the chart below, - indicates
that no colonies grew, and + indicates that some met+ revertants grew. NOTE: UV light
induces single-base substitutions and proflavin is an intercalating agent that causes insertion
or deletion of a base.
Mutant # Proflavin UV light
1 - +
2 + -
3 - -
4 - +
____31. Given the results, the original mutation in strain 2 was most likely a(n):
A) tranversion
B) deletion of a single base pair
C) insertion of several base pairs

____32. If a gene were inserted into an animal embryo:
A) only the sperm and egg cells should contain the gene
B) only the somatic cells should contain the gene
C) the animal should become sterile
D) every cell should contain the gene
E) the genes protein will be expressed in all cells

____33. Which of the following would NOT be used as a control in this experiment?
A) a plate that lacks treatment, but contains methionine, mutant
B) a plate the lacks methionine and treatment but contains mutant
C) a plate that lacks a mutant but contains methionine and treatment
D) a plate that lacks methionine but contains two different mutants

____34. What kind of puppy is Dr. Steinwand getting this summer? (Note: There IS a correct
answer here but you will get this point no matter what you bubble in!)
A) Golden retriever!
B) Boxer
C) Beagle
D) Chihauhau
E) Weimaraner