Immune response of gilthead seabream (Sparus aurata) following experimental

infection with Aeromonas hydrophila

Martha Reyes-Becerril
a, b
, Tania Lpez-Medina
a
, Felipe Ascencio-Valle
a
, Mara ngeles Esteban
b,
*
a
Centro de Investigaciones Biolgicas del Noroeste (CIBNOR), Mar Bermejo 195, Col. Playa Palo de Santa Rita, La Paz, B.C.S. 23090, Mexico
b
Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain
a r t i c l e i n f o
Article history:
Received 2 March 2011
Received in revised form
21 June 2011
Accepted 2 July 2011
Available online 12 July 2011
Keywords:
Aeromonas hydrophila
Cellular immune system
Gene expression
Gilthead seabream (Sparus aurata L.)
a b s t r a c t
The Gram-negative bacteria Aeromonas hydrophila is a heterogeneous organism that causes the disease
known as motile aeromonad septicaemia, which is responsible for serious economic loss in seabream
culture due to bacterial infections. However, the immune mechanisms involved in this disease in sh are
still poorly understood. For the purpose of this study, gilthead seabream (Sparus aurata L.) specimens
received a double intraperitoneal injection of bacterial inoculums: a primary infection with 1 10
7
cell
ml
1
A. hydrophila, followed by a secondary infectionwith 1 10
8
cell ml
1
fourteen days later. Changes in
cellular innate immune parameters e phagocytosis, respiratory burst activity and peroxidase leucocyte
content e were evaluated 24 and 48 h after each injection. Simultaneously, the expression levels of nine
immune-relevant genes (TLR, NCCRP-1, HEP, TCR, IgM, MHC-IIa, IL-1b, C3 and CSF-1R) were measured in the
head-kidney, spleen, intestine and liver, by using q-PCR. Generally, the results showed a signicant
decrease in cellular immune responses during the primary infection and a signicant enhanced during the
second infection, principally in respiratory burst and peroxidase activity, thus indicating a recovery of the
immune system against this bacterial pathogen. Finally, transcript levels of immune genes were down-
regulated during the rst infection, except for the IL-1b gene. In contrast, mRNA expression levels
during the re-infection were signicantly up-regulated. The results seem to suggest a relatively fast
elimination of the bacteria and recovery of sh during the secondary infection.
2011 Elsevier Ltd. All rights reserved.
1. Introduction
Gilthead seabream is a marine sh with high economic value in
the Mediterranean aquaculture sector due to its good market price,
high survival rate and feeding habits. The most signicant factor
affecting aquaculture is the incidence of microbial pathologies,
mainly bacterial in origin [1]. One of the major bacterial diseases is
caused by the Gram-negative bacterium Aeromonas hydrophila,
which produces diseases known as motile aeromonad septicaemia
[2] affecting a wide variety of freshwater sh species and, occa-
sionally, marine sh [3,4]. This bacterium can also behave as
a secondary opportunistic pathogen, by assailing already compro-
mised or stressed hosts [5]. Several extracellular toxins and
enzymes have been described as responsible for the virulence of
A. hydrophila, including cytotoxins and enterotoxins [6] and
a repertoire of enzymes that digest cellular components, mostly
proteases and haemolysins [7]. Previous studies indicate that
disease resistance in sh species is correlated with innate immune
parameters, and that these parameters probably affect the inherent
capacity of sh to resist pathogens before a specic immune
response [2,8,9]. Innate immune response mechanisms against
A. hydrophila have been studied in several sh species [3,4,9];
however little is known on gilthead seabream. Understanding the
immune defence mechanisms of sh against bacteria is important
in terms of control and prevention, as it could provide the basis for
the development of improved vaccines [10]. The present work
contributes to the understanding of the complex interactions
between cellular immune parameters in head-kidney leucocytes
(main haemopoietic organ) and the transcriptional activity of
a range of genes involved in the innate and adaptive immune
system in gilthead seabream (Sparus aurata L.) responding to
primary and secondary A. hydrophila infections. Additionally, the
mechanisms involved in the A. hydrophila pathogenesis and the
role displayed by the immune response of sh are discussed.
2. Materials and methods
2.1. Fish and rearing conditions
Forty-eight specimens (84 g mean body weight) of the
hermaphroditic protandrous seawater teleost gilthead seabream
* Corresponding author. Tel.: 34 868367665; fax: 34 868363963.
E-mail address: aesteban@um.es (M. . Esteban).
Contents lists available at ScienceDirect
Fish & Shellsh Immunology
j ournal homepage: www. el sevi er. com/ l ocat e/ f si
1050-4648/$ e see front matter 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2011.07.006
Fish & Shellsh Immunology 31 (2011) 564e570
(S. aurata L.), obtained from CULMAREX S.A. (Murcia, Spain), were
kept running in seawater aquaria (ow rate 1500 l h
1
) at 28&
salinity, 20

C and a 12 h light:12 h dark photoperiod. The animals
were fed with a commercial pellet diet at a rate of 1% body weight
day
1
. Animals were acclimated for 15 days prior to the experi-
ments. Seabream were conrmed bacterial-free by standard
microbiological techniques to determine the presence or absence
of allochthonous A. hydrophila [11] and by a PCR technique using
the primers combination strategy described by Vazquez-Juarez
et al. [12].
2.2. Bacteria
Virulent A. hydrophila was isolated from intestine of leopard
grouper (Mycteroperca rosacea) during an experimental infection
and maintained at the Laboratory of Microbial Pathogenesis of the
Center of Biological Investigation of Northwest (CIBNOR), La Paz,
B.C.S., Mxico. Just before the experimental challenge in gilthead
seabream, some bacteria were reactivated and cultured on Luria-
Bertani, L3152 (LB, SIGMA) agar plates for 24 h at 30

C. Biomass
was recovered fromplates and resuspended in 10 ml of phosphate-
buffered saline (PBS 7.4). The bacterial cells were then collected by
centrifugation (2000 rpm, 10 min) and washed three times with
PBS also by centrifugation. The pellet obtained was suspended in
PBS at a concentration of 1 10
9
cells ml
1
, and then it was serially
diluted to obtain the 1 10
8
and 1 10
7
cells ml
1
suspensions.
Gilthead seabream were injected intraperitoneally twice with
bacterial inoculum (rst infection, day 1:200 ml of 1 10
7
cell ml
1
;
second infection, day 15:200 ml of 1 10
8
cell ml
1
) or PBS (rst
infection, day 1:200 ml of PBS; second infection, day 15:200 ml of
PBS) (control group).
To conrm the efcacy of infection, some bacteria were recov-
ered from tissues of experimentally challenged sh and their
identities were conrmed according to Popoff criteria [11] and
polymerase chain reaction (PCR) detection [12].
2.3. Sample collection
Six sh from each aquarium were randomly sampled at 24 and
48 h after each bacterial injection (days 2, 3, 16 and 17 after starting
the experimental design). Before sampling, the sh were starved
for 24 h and, after being euthanized, head-kidney leucocytes (HKLs)
were isolated from each sh under sterile conditions, according to
Esteban et al. [13]. Briey, the head-kidney was excised, cut into
small fragments and transferred to 8 ml of sRPMI [RPMI-1640
culture medium (Gibco)] supplemented with 0.35% sodium chlo-
ride, 100 IU ml
1
penicillin (Flow), 100 mg ml
1
streptomycin
(Flow), 10 IU ml
1
heparin (Sigma) and 5% foetal calf serum (FCS,
Gibco). Cell suspensions were obtained by forcing fragments of the
organ through a 100 mm nylon mesh, washed twice (400 g, 10 min),
counted (Z2 Coulter Particle Counter) and adjusted to 10
7
cells ml
1
in sRPMI. Cell viability was determined by the trypan blue exclu-
sion test. Head-kidney, spleen, intestine and liver fragments were
also sampled and immediately stored at 80

C in TRIzol Reagent
(Invitrogen) for RNA extraction (see below).
2.4. Phagocytic activity
The phagocytosis carried out by HKLs of gilthead seabream was
studied by ow cytometry according to Rodrguez et al. [14]. Heat-
killed and lyophilized yeast cells were labelled with uorescein
isothiocyanate (FITC; Sigma), washed and adjusted to
5 10
7
cells ml
1
sRPMI. Phagocytosis samples consisted of
labelled yeast cells and leucocytes. Samples were mixed, centri-
fuged (400 g, 5 min, 22

C), resuspended in sRPMI, incubated at
22

C for 30 min and then placed on ice to stop phagocytosis, at
which point 400 ml ice-cold PBS was added to each sample. The
uorescence of the extracellular yeasts was quenched by the
addition of 40 ml ice-cold trypan blue (0.4% in PBS). Standard
samples of FITC labelled yeast or leucocytes were included in each
phagocytosis assay. The samples were then analyzed in a FACScan
(Becton Dickinson) ow cytometer with an argon-ion laser
adjusted to 488 nm. Phagocytic ability was dened as the
percentage of cells with ingested yeast cells (green-FITC uorescent
cells, FL1

) within the phagocyte cell population. The relative

number of ingested yeasts per cell (phagocytic capacity) was
assessed in arbitrary units from the mean uorescence intensity of
the phagocytic cells.
2.5. Respiratory burst activity
The respiratory burst activity of gilthead seabream HKLs was
studied using the chemiluminescence method [15]. Briey, samples
of 10
6
leucocytes in sRPMI were placed in the wells of a at-
bottomed 96-well microtitre plate and lled with 100 ml Hanks
balanced salt solution (HBSS) containing 1 mg/ml phorbol myristate
acetate (PMA; Sigma) and 10
4
M luminol (Sigma). The plate was
shaken and immediately read in a microplate reader (BIO-RAD,
model 3350-UV) for 1 h at 2-min intervals. The reaction kinetic was
analyzed and the maximum slope of each curve was calculated.
Backgrounds of luminescence were calculated using reagent solu-
tions containing luminol but not PMA.
2.6. Leucocyte peroxidase activity
The peroxidase content inside HKLs was determined using
a colorimetric method [16]. Briey, aliquots of 1 10
6
lysed leu-
cocytes were dispensed in a 96-well plate containing 25 ml of
10 mM 3,3,5,5-tetramethylbenzidine hydrochloride and 5 mM
H
2
O
2
. The colour-change reaction was stopped after 2 min by
addition of 50 ml 2 M sulphuric acid and the optical density was
read at 450 nm in a plate reader. Standard samples without HKLs
were used as blanks.
2.7. Real-time PCR
Twenty-four and forty-eight hours after each injection (days 2,
3, 16 and 17 after the start the experiment), total RNAwas extracted
from 0.5 g of pooled seabream head-kidney (main haematopoietic
organ), spleen and intestine (secondary immune organs) and liver
using TRIzol Reagent (Invitrogen). It was then quantied and the
purity assessed by spectrophotometry; 260:280 ratios were
1.8e2.0, and treated with DNase I (Promega) to remove genomic
DNA contamination. Complementary DNA (cDNA) was synthesized
from 1 mg of total RNA using the SuperScript III reverse transcrip-
tase (Invitrogen) with an oligo-dT
18
primer. The expression of the
nine immune-relevant genes selected was analyzed by real-time
PCR, which was performed with an ABI PRISM 7500 instrument
(Applied Biosystems) using SYBR Green PCR Core Reagents (Applied
Biosystems). Reaction mixtures (containing 10 ml of 2 SYBR Green
supermix, 5 ml of primers (0.6 mMeach) and 5 ml of cDNA template)
were incubated for 10 min at 95

C, followed by 40 cycles of 15 s at
95

C, 1 min at 60

C, and nally 15 s at 95

C, 1 min at 60

C and 15 s
at 95

C. For each mRNA, gene expression was corrected against the

endogenous level of the house keeping gene 18S content in each
sample in order to standardize the results by eliminating variation
in mRNA and cDNA quantity and quality [8].
No amplication product was observed in negative controls and
no primer-dimer formations were observed in the control
templates. The primers used are shown in Table 1. In all cases, each
M. Reyes-Becerril et al. / Fish & Shellsh Immunology 31 (2011) 564e570 565
PCR was performed with triplicate samples and repeated at least
twice. Modication of gene expression is represented with respect
to the control sampled at the same time of the treatment.
2.8. Statistical analysis
All bioassays were made in duplicate and all measurements
were performed on three replicates; the mean standard error
(SE) for each group was calculated. Two-way ANOVA was per-
formed to determine the effects of treatments (non-infected and
infected) on different parameters (injections and time) after
checking for normality and homogeneity of variance by the
Kolgomorov-Smirnov and Levene tests (P > 0.05), respectively. All
statistical tests were conducted using the computerized software
Statistical Package for Social Sciences (SPSS) v.15.0 software.
Differences were considered signicant at P 0.05.
3. Results
3.1. Pathogenicity
A total of 40 sh (corresponding at 83% of survival) survived the
primary infection and received re-infection with a highest
concentration (1 10
8
cell ml
1
) 14 days after the primary infec-
tion. The sh infected during the rst infection showed typical
signs of acute septicaemia with swollen, haemorrhages around the
anus and the caudal ns. After the second infection no mortality
was registered. On the other hand, external symptoms were not
observed in re-infected sh (secondary infection). Internal clinical
signs (visceral hemorrhages principally in liver) were detected in all
infected sh and never in sh from control groups.
3.2. Phagocytic activity
A. hydrophila signicantly inhibited the phagocytic ability
(percentage of phagocytic cells) of leucocytes fromsh sampled 24
and 48 h after the rst bacterial injection, if compared with those
isolated from the control group (non-infected sh). However, after
the second injection (1 10
8
cell ml
1
), the phagocytic ability was
enhanced in infected sh respect to the control group, observing
a signicant difference after 24 h (Fig. 1). The phagocytic capacity of
infected sh was no signicantly affected at any time of the
experiment (Fig. 2).
3.3. Respiratory burst activity
The respiratory burst activity e measured as the production of
reactive oxygen species (ROS) from head-kidney leucocytes of
experimentally infected sh e was signicantly lower than that
obtained from leucocytes of the control group, both 24 and 48 h
after the rst injection. Conversely, leucocytes fromre-infected sh
increased signicantly this activity after 24 and 48 h, if compared
with the control group (Fig. 3).
3.4. Leucocyte peroxidase activity
Peroxidase activity of head-kidney leucocytes was signicantly
lower 24 h but not 48 h after the rst bacterial injection in infected
specimens. After the second injection, this activity was enhanced in
infected sh, but the increase was not-statistically signicant, if
compared with the sh control group (Fig. 4).
3.5. Real-time PCR
Genes considered important for the immune system were
analyzed using real-time PCR from seabream head-kidney, spleen,
intestine and liver (Table 2). Lowlevels of constitutive expression of
all the examined genes were detected 24 and 48 h during the
Table 1
Primers used for real-time PCR.
Gene GenBank number Primer sequence (5
0
e3
0
)
18S AY587263 CGAAAGCATTTGCCAAGAAT
AGTTGGCACCGTTTATGGTC
TLR9A AY751797 ATTCCCGGAGTCCCAACAAG
GCTGCTGAACCATGAAGAAAGC
NCCRP-1 AY651258 ACTTCCTGCACCGACTCAAG
TAGGAGCTGGTTTTGGTTGG
Hep EF625900 GCCATCGTGCTCACCTTTAT
CTGTTGCCATACCCCATCTT
TCRa AY751745 GGAAGTGGAACCAGACTGAACG
GATCACTCTGAGGCACAGGACG
IgM AY619988 TTACTACTGTCAGAGTTTTC
ATCCCAGTGAGGGGAAGC
MHCIIa DQ019401 ATGATGAAGATGATGAAGATGATG
TCACGCTCTGTCCGTTCTTGG
IL-1b SAU277166 GCTCAACATCTTGCTGGAGAGC
GGCACATATCCACTGGCTTG
C3 CX734936 ATAGACAAAGCGGTGGCCTA
GTGGGACCTCTCTGTGGAAA
CSF-1R AM050293 ACGTCTGGTCCTATGGCATC
AGTCTGGTTGGGACATCTGG
2nd injection
24h 48h 24h 48h
)
%
(
s
l
l
e
c
c
i
t
y
c
o
g
a
h
P
0
20
40
60
80
100
Non-infected
Infected
1st injection
*
*
*
Fig. 1. Effect of Aeromonas hydrophila infection 515 on gilthead seabream head-kidney leucocyte phagocytic ability. Data represent the mean SE (n 6). Asterisk denotes
statistically signicant differences between control and challenged groups (P 0.05).
M. Reyes-Becerril et al. / Fish & Shellsh Immunology 31 (2011) 564e570 566
Table 2
Quantitative expression (q-PCR) of immune genes in different tissues of gilthead seabream following primary and secondary infection with Aeromonas hydrophila.
Gene Group Relative gene expression level
Spleen Liver Intestine Head-kidney
1st injection 2nd injection 1st injection 2nd injection 1st injection 2nd injection 1st injection 2nd injection
24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48
TLR Control 0.9 .0.04 0.1 0.00 1.1 0.00 1.3 0.01 4.2 1.60 14.1 0.04 0.9 0.02 1.3 0.08 0.5 0.06 2.9 0.06 1.0 0.02 0.4 0.01 0.4 0.01 1.4 0.08 1.7 0.00 0.8 0.00
Infected 1.1 0.06 0.3 0.00 0.9 0.02 0.8 0.01 0.3 0.10 0.7 0.02 0.8 0.03 0.7 0.04 2.0 0.20 0.4 0.05 1.0 0.00 2.4 0.20 2.3 0.07 0.7 0.02 0.6 0.02 1.3 0.10
NCCRP-1 Control 0.2 0.02 9.9 1.30 0.4 0.00 0.4 0.00 1.0 0.20 0.7 0.00 0.9 0.06 0.7 0.00 0.8 0.04 2.4 0.01 0.9 0.01 0.8 0.02 0.5 0.01 0.5 0.00 0.5 0.00 0.2 0.00
Infected 5.9 0.95 0.0 0.00 2.2 0.04 2.3 0.20 1.0 0.20 1.4 0.03 1.3 0.10 1.6 0.03 1.3 0.00 0.4 0.04 1.1 0.04 1.2 0.04 1.9 0.05 1.9 0.20 2.0 0.06 4.4 0.30
Hep Control 0.1 0.01 0.1 0.00 0.0 0.00 0.1 0.00 2.6 0.04 0.8 0.00 0.4 0.00 0.2 0.00 1.5 0.06 0.5 0.00 0.8 0.06 0.3 0.00 1.0 0.06 1.0 0.06 0.5 0.01 0.2 0.00
Infected 9.0* 1.50 0.0 0.00 19.5* 2.70 8.0 0.50 0.4 0.00 1.3 0.09 2.2 0.20 5.6 0.10 0.7 0.02 2.0 0.04 1.2 0.02 3.7 0.20 1.0 0.06 1.1 0.06 2.4 0.30 5.7 1.00
TCR b Control 6.6 0.10 0.1 0.00 1.7 0.02 1.0 0.00 5.9 0.28 3.1 0.60 1.0 0.01 0.9 0.00 2.1 0.08 4.8 0.60 0.5 0.00 0.7 0.00 6.2 0.57 3.1 0.50 1.1 0.60 0.6 0.01
Infected 0.2 0.00 0.2 0.00 0.6 0.02 1.1 0.03 0.2 0.00 0.3 0.07 1.0 0.02 1.0 0.00 0.5 0.01 0.2 0.02 1.8 0.04 1.4 0.09 0.2 0.01 0.3 0.00 1.0 0.01 1.3 0.06
IgM Control 9.5 0.84 0.1 0.00 0.9 0.00 0.5 0.00 48.1 8.47 0.8 0.11 1.0 0.00 0.4 0.00 8.1 3.00 7.2 0.80 1.6 0.21 0.3 0.00 2.9 0.93 11.8 1.00 0.9 0.04 0.8 0.00
Infected 0.1 0.00 0.0 0.00 1.0 0.02 2.1 0.08 0.0 0.00 1.3 0.10 1.0 0.00 2.7 0.08 0.1 0.02 0.1 0.00 0.6 0.02 3.1 0.10 0.4 0.07 0.1 0.01 1.0 0.04 1.3 0.04
MHCIIa Control 1.6 0.00 0.0 0.00 1.5 0.01 3.7 0.60 4.5 0.70 24.9 1.80 1.4 0.06 3.8 0.09 5.2 0.15 10.3 6.9 0.5 0.00 0.9 0.08 3.9 0.24 0.5 0.06 1.8 0.09 2.9 0.08
Infected 0.6 0.00 0.0 0.00 0.7 0.01 0.3 0.03 0.2 0.02 0.0 0.00 0.7 0.02 0.3 0.01 0.2 0.00 0.0 0.00 1.9 0.00 1.0 0.03 0.3 0.01 2.7 0.03 0.5 0.02 0.3 0.00
IL-1b Control 0.0 0.00 13.9 1.20 0.2 0.00 0.2 0.00 0.0 0.00 0.1 0.00 0.0 0.00 0.4 0.00 0.1 0.00 3.5 0.90 0.2 0.00 0.1 0.00 0.0 0.00 0.0 0.00 0.2 0.00 0.0 0.00
Infected 46.3* 0.90 0.0 0.00 7.3 0.60 5.7 0.10 53.4* 3.10 11.8 0.60 26.2* 3.20 2.2 0.05 11.8 1.00 0.3 0.02 4.5 0.04 12.4* 0.90 20.8* 0.70 49.6* 2.50 6.3 0.50 25.0* 0.10
C3 Control 4.8 0.08 0.8 0.00 0.3 0.00 0.2 0.00 4.0 0.05 0.9 0.00 0.5 0.00 0.4 0.00 0.9 0.08 1.1 0.04 1.2 0.02 0.2 0.00 2.2 0.05 0.1 0.00 0.9 0.04 0.8 0.01
Infected 0.2 0.00 1.9 0.01 3.6 0.20 5.8 0.40 0.3 0.00 1.1 0.03 2.2 0.03 2.5 0.10 1.2 0.10 0.9 0.05 0.8 0.05 4.6 0.70 0.4 0.10 12.7* 0.80 1.3 0.03 1.3 0.06
CSF-1R Control 0.1 0.00 0.9 0.00 1.5 0.00 1.2 0.04 0.7 0.00 2.3 0.06 0.6 0.01 1.0 0.02 7.1 0.90 3.7 0.57 0.7 0.00 0.2 0.00 9.0 1.30 0.4 0.00 0.8 0.00 0.6 0.01
Infected 0.1 0.00 0.0 0.00 0.7 0.00 0.9 0.03 0.1 0.00 0.4 0.01 1.7 0.06 1.0 0.01 1.2 0.00 0.3 0.00 1.4 0.10 5.4 0.04 0.3 0.00 2.8 0.01 1.2 0.00 1.9 0.08
24 and 48 h post-injection. Fold increase of target gene relative to elongation factor a ( S.D.). Expression was compared to controls injected with PBS.
*Indicates signicant up-regulation relative to control (p<0.05).
primary infection (Table 2). One of the most interesting results was
that pro-inammatory cytokine (IL-1b) expression levels were
signicantly regulated due to infection. Thus, IL-1b was expressed
in all the tissues sampled 24 h after the rst injection, although the
greatest increase was observed in the liver (53.4 fold up-regulated),
followed by the head-kidney (49.5 fold) 48 h after the st infection.
During the re-infection period or secondary infection, the expres-
sion of several genes was up-regulated after 24 and 48 h (Table 2).
Again, we can observe an increase in IL-1b level in the second
injection any time of the experiment in all the tissues sampled. Pro-
inammatory cytokine IL-1b expression was 26.1-fold higher in
liver-infected sh 24 h after the secondary infection compared with
the control group. On the other hand, the transcripts of the C3 and
Hep were signicantly increased in spleen and head-kidney during
the rst and second injection, respectively. The number of C3 gene
transcripts was 12.7 fold increased 48 h in the infected sh
24h 48h 24h 48h
y
t
i
v
i
t
c
a
e
s
a
d
i
x
o
r
e
P
0
1
s
t
i
n
U
(
)
s
e
t
y
c
o
c
u
e
l
0
10
20
30
40
50
Non-infected
Infected
2nd injection 1st injection
*
Fig. 4. Effect of Aeromonas hydrophila infection on seabream head-kidney leucocyte peroxidase content. Data represent the mean SE (n 6). Asterisk denotes statistically
signicant differences between control and challenged groups (P 0.05).
y
t
i
s
n
e
t
n
i
e
c
n
e
c
s
e
r
o
u
l
f
n
a
e
M
e
t
y
c
o
g
a
h
p
r
e
p
0
200
400
600
800
1000
1200
1400
Non-infected
Infected
24h 48h 24h 48h
2nd injection 1st injection
Fig. 2. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte phagocytic capacity. Data represent the mean SE (n 6). Asterisk denotes statistically
signicant differences between control and challenged groups (P 0.05).
y
t
i
v
i
t
c
a
t
s
r
u
b
y
r
o
t
a
r
i
p
s
e
R
)
n
i
m
e
p
o
l
S
(
0
5000
10000
15000
20000
25000
Non-infected
Infected
24h 48h 24h 48h
2nd injection 1st injection
*
*
*
*
Fig. 3. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte respiratory burst activity. Data represent the mean SE (n 6). Asterisk denotes
statistically signicant differences between control and challenged groups (P 0.05).
M. Reyes-Becerril et al. / Fish & Shellsh Immunology 31 (2011) 564e570 568
(primary infection), whereas the antimicrobial peptide Hep was
elevated 19.5 fold 24 h after re-infection.
4. Discussion
The present study reveals the changes in cellular innate immune
response and immune-relevant gene expression of gilthead seab-
ream exposed to primary and secondary infection with A. hydro-
phila. The use of this bacterium as a model pathogen to elucidate
immune mechanisms in seabream is of signicance, because acute
septicaemia caused by this pathogen is a serious threat to sh
production [17]. The bacteria were isolated from the infected
seabream and identied as a motile Aeromonas strain, and it was
responsible for the disease outbreak. In this work, seabream
infected with A. hydrophila showed typical signs of acute septi-
caemia with gross haemorrhagic lesions on the ventral surface of
the body, the n and the tail rot, as well as visceral haemorrhages.
Similar lesions have also been described in Indian major carp, Labeo
rohita [2], zebrash, Danio rerio [9] and leopard grouper, M. rosacea
[4], where external and internal symptoms (abdominal and visceral
haemorrhages with abdominal distension) were always observed
after experimental infections.
It is evident that immune defence mechanisms play a critical
role in preventing bacterial disease in sh [18]. Several authors
have documented such changes in innate as well as in adaptive
immune parameters in sh exposed to different pathogens
[9,10,19,20]. However, the immunomodulation mechanism
induced by A. hydrophila in sh is still poorly understood. In this
study A. hydrophila did not cause signicant mortality, although
seabream specimens were found to be very sensitive to this
bacterium, as it is reported above in the description of the gross
lesions visible on skin and muscle. In this study a clear decrease in
the main cellular immune parameters were observed after the rst
infection. Similarly, phagocytosis and respiratory burst dimin-
ished. Phagocytosis is a major mechanism used to remove path-
ogens and cell debris; respiratory burst is the rapid release of
reactive oxygen species from immune cells e mainly superoxide
radical and hydrogen peroxide. Concomitantly, 24 h after the rst
injection, the leucocyte peroxidase content of this group was
signicantly lower than that of the control group. The resistance of
A. hydrophila to oxygen radicals has already been reported by
some authors [21]. These authors have reported that some Aero-
monas bacteria possess a Mn-superoxide dismutase (Mn-SOD) and
catalase enzyme that protects them from the external anion
superoxide and hydrogen peroxide generated by macrophages
inhibiting phagocyte activity. Conversely, numerous experiments
with a variety of microbes have demonstrated that the apoptosis
of professional phagocytes is a common event in pathogenesis and
plays a pivotal role in the initiation of the infection, the survival of
the pathogens, and the evasion of the rst line of defence of the
immune system [22].
Fourteen days following the rst infection, the surviving seab-
ream were re-infected with a second injection using a concentra-
tion (1 10
8
cell ml
1
) higher than that used in the rst injection.
Twenty-four and forty-eight hours after the second injection the
innate immune parameters recovered e in contrast to the param-
eters in the specimens of the control group e and no mortality was
observed. The results demonstrate that a second challenge of gilt-
head seabreamwith A. hydrophila confers thempartial immunity. A
similar recovery pattern of sh immune system was found in
rainbow trout challenged twice with the enterobacterium Yersinia
ruckeri [19].
Regarding the expression of the immune-relevant genes, the
results show a pronounced increase of the cytokine interleukin-1b
in infected seabream in both primary and secondary infections,
thus suggesting a strong inammatory response to A. hydrophila.
Evidence that many bacterial toxins induce cytokine release is
accumulating in recent years [23]. IL-1b is a major player in
immune response of sh as in mammals [24]. It is a key mediator in
the response to microbial invasion and tissue injury, and it can
stimulate immune responses by activating lymphocytes, or by
inducing the release of other cytokines capable of triggering
macrophages, NK cells and lymphocytes. Macrophages are the
primary source of IL-1b, although it is also produced by a wide
variety of other cell types. Bacterial components are known to
stimulate rainbow trout macrophages, induce IL-1b expression and
stimulate lymphocyte proliferation [25,26]. This can explain the
marked peak in transcript of IL-1b, seen in different tissues of
seabream during the primary infection. During the re-infection
(secondary infection), the number of transcript such as Hep, C3,
CSF-1R, NCCR-1 genes was signicantly up-regulated, if compared
with their expression during the primary infection. Hepcidin is an
antimicrobial peptide that acts against Gram-negative and Gram-
positive bacteria [27], and it has recently been suggested to also
act as a central regulator of intestinal iron absorption and iron
recycling by macrophages [28]. In mammalian, hepcidin is greatly
stimulated by inammation, and it is principally induced by
interleukin-1, interleukin-6, LPS and iron overloading [29]. In this
context, it is worth noting that a highly signicant correlation exists
between Hep and IL-1b expression, as it was found in this work, and
in agreement with some reactions found in other sh species
following bacterial infection [19]. In addition, small but signicant
increases in complement factors C3 were noted during the
secondary infection. Fish have a well-developed complement
system that plays an important role in their innate immune
response, including membrane attack complex (which lyses
bacteria), opsonisation for phagocytosis, and release of the ana-
phylatoxins C3a and C5a, which attract neutrophilic granulocytes to
the site of inammation and infection [30,31]. Finally, NCCRP-1 and
CSF-1R genes were only up-regulated during the secondary infec-
tion. These genes encode leucocyte receptors that, in some
instances, might be considered cell markers for non specic cyto-
toxic cells (NCC), antigen cells and macrophages respectively, and
several studies have concluded that they are very good candidates
for this end [32,33].
In conclusion, this is the rst study on the immune response of
gilthead seabreamagainst primary and secondary infections with A.
hydrophila. The cellular immune parameters, as well as the tran-
script level (pro-inammatory cytokines) studied in this research
indicate immunodepresion of seabream during the primary infec-
tion, but not in re-infection. The results suggest that recovery of
cellular innate immune activities and up-regulation of cytokines
(such IL-1b) may play an active role for the rapid elimination of this
pathogen during the re-infection period. Further extensive work is
recommended to get aninsight intothe mechanisms involved in the
recovery of the immune system following the rst infection and in
the generation of immunological memory, which made the rapid
elimination of bacteria possible in successive challenges.
Acknowledgements
The author thanks Francisco Guardiola and Rebeca Cerezuela for
technical support. M. Reyes received a postdoctoral scholarship from
the Mexican Consejo Nacional de Ciencia y Tecnologa (CONACYT
grant 164653). T. Lpez has a fellowship from the CONACYT-Mxico
(grant 48444). This work was partially funded by the Spanish
Ministry for Science and Innovation (AGL2008-05119-C02-01) and
Fundacin Sneca de la Regin de Murcia, Spain (06232/GERM/07).
M. Reyes-Becerril et al. / Fish & Shellsh Immunology 31 (2011) 564e570 569
References
[1] Zorrilla I, Chabrilln M, Arijo S, Daz-Rosales P, Martnez-Manzanares E,
Balebona MC, et al. Bacteria recovered from diseased cultured gilthead sea
bream (Sparus aurata L.) in southwestern Spain. Aquaculture 2003;218:
11e20.
[2] Sahoo PK, Das Mahapatra K, Saha JN, Barat A, Sahoo M, Mohanty BR, et al.
Family association between immune parameters and resistance to Aeromonas
hydrophila infection in the Indian major carp, Labeo rohita. Fish and Shellsh
Immunology 2008;25:163e9.
[3] Sahu S, Das BK, Mishra BK, Pradhan J, Sarangi N. Effect of Allium sativum on the
immunity and survival of Labeo rohita infected with Aeromonas hydrophila.
Journal of Applied Ichthyology 2007;23:80e6.
[4] Reyes BM, Tovar RD, Ascencio VF, Civera CR, Gracia LV, Barbosa SV, et al.
Effects of dietary supplementation with probiotic live yeast on the immune
and antioxidant systems of leopard grouper Mycteroperca rosacea infected
with Aeromonas hydrophila. Aquaculture Research; 2010:1e11.
[5] Tellez BMC, Santerre A, Casas-Solis J, Zairseva G. Endosulfan increases seric
interleukin-2 like (IL-2L) factor and immunoglobulin M (IgM) of Nile tilapia
(Oreochromis niloticus) challenged with Aeromonas hydrophila. Fish and
Shellsh Immunology 2010;28:401e5.
[6] Yadav M, Indira G, Ansary A. Cytotoxin elaboration by Aeromonas hydrophila
isolated from sh with epizootic ulcerative syndrome. Journal of Fish Diseases
1992;5:183e9.
[7] Leung KY, Stevenson RMW. Characteristics and distribution of extracellular
proteases from Aeromonas hydrophila. Journal of General Microbiology 1988;
134:151e60.
[8] Reyes BM, Salinas I, Cuesta A, Meseguer J, Tovar RD, Ascencio VF, et al. Oral
delivery of live yeast Debaryomyces hansenii modulates the main innate
immune parameters and the expression of immune-relevant genes in the
gilthead seabream (Sparus aurata L.). Fish and Shellsh Immunology 2008;25:
433e8.
[9] Rodrguez I, Novoa B, Figueras A. Immune response of zebrash (Danio rerio)
against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish and
Shellsh Immunology 2008;25:239e49.
[10] Raida MK, Buchmann K. Development of adaptive immunity in rainbow trout,
Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri.
Fish and Shellsh Immunology 2008;25:533e41.
[11] Popoff M. Aeromonas. In: Krieg NR, editor. Bergeys manual of systematic
bacteriology. Baltimore, MD: Williams & Wilkins; 1984. p. 545e8.
[12] Vazquez-Juarez RC, Barrera-Saldana HA, Hernandez-Saavedra NY, Gomez-
Chiarri M, Ascencio F. Molecular cloning, sequencing and characterization of
omp48, the gene encoding for an antigenic outer membrane protein from
Aeromonas veronii. Journal of Applied Microbiology 2003;94:908e18.
[13] Esteban MA, Mulero V, Muoz J, Meseguer J. Methodological aspects of
assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seab-
ream (Sparus aurata L.) by ow cytometry and electron microscopy. Cell &
Tissue Research 1998;293:133e41.
[14] Rodrguez A, Esteban MA, Meseguer J. Phagocytosis and peroxidase release by
seabream (Sparus aurata L.) leucocytes in response to yeast cells. Anatomical
Record 2003;272A:415e23.
[15] Bayne CJ, Levy S. Modulation of the oxidative burst in trout myeloid cells by
adrenocorticotropic hormone and catecholamines: mechanisms of action.
Journal of Leukocyte Biology 1991;50:554e60.
[16] Quade MJ, Roth JA. A rapid, direct assay to measure degranulation of bovine
neutrophil primary granules. Veterinary Immunology and Immunopathology
1997;58:239e48.
[17] Fang HM, Ling KC, Ge R, Sin YM. Enhancement of protective immunity in blue
gourami, Trichogaster trichopterus (Pallas), against Aeromonas hydrophila and
Vibrio anguillarum by A. hydrophila major adhesion. Journal of Fish Diseases
2000;23:137e45.
[18] Mohanty BR, Sahoo PK, Mahapatra KD, Saha JN. Innate immune responses in
families of Indian major carp, Labeo rohita deleting in their resistance to
Edwardsiella tarda infection. Current Science 2007;92:1270e4.
[19] Raida MK, Buchmann K. Innate immune response in rainbow trout (Onco-
rhynchus mykiss) against primary and secondary infections with Yersinia
ruckeri O1. Developmental and Comparative Immunology 2009;33:35e45.
[20] Mohanty BR, Sahoo PK. Immune responses and expression proles of some
immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda
infection. Fish and Shellsh Immunology 2010;28:613e21.
[21] Leclere V, Bechet M, Blondeau R. Functional signicance of a periplasmic Mn-
superoxide dismutase from Aeromonas hydrophila. Journal of Applied Micro-
biology 2004;96:828e33.
[22] Hilbi H, Zychlinsky A, Sansonetti PJ. Macrophage apoptosis in microbial
infections. Parasitology 1997;115:S79e87.
[23] Henderson B, Wilson M, Wren B. Are bacterial exotoxins cytokine network
regulators? Trends in Microbiology 1997;5:454e8.
[24] Secombes CJ, Wang T, Hong S, Peddie S, Crampe M, Laing KJ. Cytokines and
innate immunity of sh. Developmental and Comparative Immunology 2001;
25:713e23.
[25] Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI. Expres-
sion proling and validation of reference gene candidates in immune relevant
tissues and cells from Atlantic salmon (Salmo salar L.). Molecular Immunology
2006;43:1194e201.
[26] Panigrahi A, Kiron V, Satoh S, Hirono I, Kobayashi T, Sugita H, et al. Immune
modulation and expression of cytokine genes in rainbow trout Oncorhynchus
mykiss upon probiotic feeding. Developmental and Comparative Immunology
2007;31:372e82.
[27] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al.
Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge.
European Journal of Biochemistry 2002;269:2232e7.
[28] Shi J, Camus AC. Hepcidins in amphibians and shes: antimicrobial peptides
or iron-regulatory hormones? Developmental and Comparative Immunology
2006;30:746e55.
[29] Lee P, Peng H, Gelbart T, Beutler E. The IL-6- and lipopolysaccharide-induced
transcription of hepcidin in HFE-, transferrin receptor 2-, and b2-
microglobulin- decient hepatocytes. Proceedings of the National Academy
of Sciences of the United States of America 2004;101:9263e5.
[30] Lambris JD, Mavroidis M, Sunyer JO. In: Erdei A, editor. New aspects of
complement structure and function. Austin, TX: R. G. Landes; 1994. p. 15e34.
[31] Boshra H, Li J, Sunyer JO. Recent advances on the complement system of
teleost sh. Fish and Shellsh Immunology; 2006:239e62.
[32] Cuesta A, Esteban MA, Meseguer J. Molecular characterization of the nonspecic
cytotoxic cell receptor (NCCRP-1) demonstrates gilthead seabream NCC
heterogeneity. Developmental and Comparative Immunology 2005;29:637e50.
[33] Roca FJ, Sepulcre MP, Lpez-Castejn G, Meseguer J, Mulero V. The colony-
stimulating factor-1 receptor is a specic marker of macrophages from the
bony sh gilthead seabream. Molecular Immunology 2006;43:1418e23.
M. Reyes-Becerril et al. / Fish & Shellsh Immunology 31 (2011) 564e570 570