3rd IMT GT Proceedings Libre

21-22 December 2009
Pan Pacific , KLIA , Malaysia

Organiser
Halal Products Research Institute
Universiti Putra Malaysia
2009
INTERNATIONAL SYMPOSIUM ON
IMT-GT
HALAL SCIENCE AND MANAGEMENT
3
rd
CD C D
PROCEEDINGS

3
rd
IMT-GT INTERNATIONAL SYMPOSIUM ON HALAL SCIENCE AND
MANAGEMENT 2009

PROCEEDINGS

December 21-22, 2009
KLIA Sepang, Malaysia

HALAL SCIENCE
AND
MANAGEMENT

Proceedings of the 3
rd
IMT-GT International Symposium
On Halal Science and Management 2009
December 21-22, 2009

3
rd
IMT-GT INTERNATIONAL SYMPOSIUM ON HALAL SCIENCE AND
MANAGEMENT 2009

Proceedings of the 3
rd
IMT-GT International Symposium
on Halal Science and Management 2009
21-22 December 2009

Editors
Dr Puziah Hashim
Prof Madya Dr Amin Ismail
Dr Awis Qurni Sazili
Nor Nadiha Mohd Zaki
Syariena Arshad
Nur Fadhilah Khairil Mokhtar

Halal Products Research Institute,
Universiti Putra Malaysia (UPM)
Putra Infoport
43400 UPM Serdang, Selangor
Malaysia

December 2009

Any query please subject to

Director
Universiti Putra Malaysia (UPM)
Putra Infoport, 43400 UPM Serdang
Selangor Darul Ehsan, Malaysia
Tel: (603) 8941 0405
Fax:(603) 8943 9745
Email: halal@putra.upm.edu.my
Website: www.halal.upm.edu.my

Perpustakaan Negara Malaysia

The 3
rd
IMT-GT International Symposium (2009: KLIA Sepang, Selangor)
Halal Science and Management : Proceedings on the 3
rd
IMT-GT International Symposium on
Halal Science and Management 2009, 21-22 December 2009/ editor Puziah et al.
ISBN 978-967-960-257-9
1. Analysis of Halal Products
2. Innovation of Halal Products
3. Management and Shariah

Front Cover Designer: Mohd Salehan Sanusi
Proceeding of the 3
rd
IMT-GT International Symposium on Halal
Science and Management 2009

All manuscripts printed in this proceeding were reproduced directly from the softcopies
submitted by the authors (unedited), only with minor editorial amendments. Although all efforts
were made to ensure the accuracy and correctness of the extended abstracts, Halal Products
Research Institute, Universiti Putra Malaysia, will not be responsible or liable for any
unintentional errors made during the publication of this proceeding.

Dr. Puziah Hashim
On behalf of the Scientific Committee
3
rd
IMT-GT International Symposium on Halal Science and Management 2009
Halal Products Research Institute, Universiti Putra Malaysia.

Date: December 17, 2009

CONTENT

Page
Preface
Acknowledgement
Analysis of Halal Products
1. Volatile Profiling of Alcoholic Food and Beverages and Industrial Alcohol
Using GCxGC-ToF-MS for Halal Authentication.
Farah Azura, K., Hashim, D. M., Che Man, Y.B., Awis Qurni, S.

1 6
2. Rapid Detection of Pork in Food Products by Electronic Nose for Halal
Authentication
Che Man, Y.B., Nurjuliana, M., Hashim, D. M., Mohamed,

A.K.S. and
Syahariza, Z.A.
7 13
3. Potential Use of Amino Acids Analysis for Distinguishing Bovine And Porcine
Gelatins
Norakasha, R., Hashim, D.M., Che Man, Y.B., Shuhaimi, M., and Noorfaizan
A.

14 18
4. Detection of Pork in Pastry Products for Halal Verification via Polymerase
Chain Reaction (PCR) Techniques
Mohd Hazim, M.Y., Che Man, Y.B. and Shuhaimi, M.

19 23
5. Porcine Specific Real-time Polymerase Chain Reaction (PCR) for Halal
Verification
Farihah Liyana,

K., Shuhaimi,

M., Che Man,

Y.B., Sazili,

A. Q., Aida,

A.A. and
Raha, A.R.

24 28
6. Extractability of Soluble Protein from Different Types of Skeletal Muscles in
Cattle Under The Ttreatment of pH, Molarity and Type of Buffers.
Noor Azihan, M.Z., Sazili, A.Q., Shuhaimi, M., M. Hilmi, J. M. Panandam

29 31
7. Identification of Alcoholic Compounds in Fermented Glutinous Rice (Tapai)
N. H. Abdul Hamid, D. M. Hashim, S. Mustafa Y.B. Che Man
32 36
8. Fourier Transform Infrared (FTIR) Spectroscopy Profiling of Lard and Other
Shortening in Puff Pastry
Wan Siti Farizan, M.R. and Che Man, Y.B., Ismail, A., Puziah, H.

37 42
9. Identifying of Fats of Halal And Non Halal using a Geometric Method
Adeeb Hayyan

43 51
10. Profiling of Mono- and Diglyceride Diglyceride from Edible Fats by GCGC-
TOF-MS for Halal Authentication
Indrasti, D., Chin, S.T., Che Man, Y.B., Shuhaimi, M., Dzulkifly, M.H.

52 56
11. Microbiological Analysis in Halal Foods
Noor Shaeda, I, Raja Arief Deli, R.N., Faridatul Akmar, M.N

57 60
12. Determination of Halal Limits for Alcohol Content in Foods by simulated
fermentation
Wan Nadiah W. A., Anis Najiha A., Tajul A. Y. and Norziah M.H.

61 66
13. Monitoring the Presence of Lard in Virgin Coconut Oil (VCO) Using Fourier
Transform Infrared (FTIR) Spectroscopy
Abdul Rohman, Che Man, Y.B., Ismail, A. and Hashim, P.

67 71
14. Distinguishing Different Animal Fat Contaminations in Sunflower Oil by
Differential Scanning Calorimetry
Marikkar, J.M.N., Dzulkifly, M.H., Nor Nadiha, M.Z. and Che Man, Y.B.
72 75
15. Food Safety Application to Halal Poultry Slaughter House and Products in
Thailand

Ammawath, S, Ammawath, W.

and Pattanakulchai, N.

76 79
16. Q-PCR of Microbial Ribosomal DNA Genes for Surveillance in Halal Chicken
Processing Industrial Plant
Shaharuddin, A

80 86
17. Pig Species Identification in Meatballs using Polymerase Chain Reaction-
Restriction Fragment Length Polymorphism for Halal Authentication
Yuny, E., Mohammad, Z.A., Abdul Rohman and Sismindari

87 91
18. Ethanol Content of Beverages And Condiments in Malaysia
Law, S. V., Dzulkifly , M.H., Fatimah, A. B., Nurul Aimi, R.

92 95
19. Discrimination of Alcoholic (Khamar) and Non-Alcoholic Beverages using an
Electronic Nose
Syariena, A. and Che Man, Y.B.

96 100
20. Identification of Pork in Raw Meat using Porcine-specific Polymerase Chain
Reaction Assay
Khairil Mokhtar, N.F., Shuhaimi, M., Sazili, A.Q., Nordin, R., Che Man, Y.B.

101-104
21. Comparison of Bovine and Porcine Skin Gelatin based on Amino Acid
Composition, Polypeptide Pattern and Gel Strength
Raja Mohd Hafidz, R.N., Che Man, Y.B., Anuar, N.

105-109
22. Detection of Alcohol in Cosmetic Products by Headspace GC/MS
Puziah, H., Che Man, Y.B., Norrahimah, K

110-114
Innovation of Halal Products
24. Effects of Pre-treatment on Rheological and Nano-Structural Properties of Fish
Gelatin Extracted from Perch (Lates niloticus)
Hammed, A., Irwandi, J. and Hamzah, M. S.

115-120
25. Characterization of Collagen from Freshwater Fish Skin
Umi Hartina, M.R., Jamilah, B., , Dzulkifly, M.H., Sazili, A. Q.
121-125
26. Sol Gel Transition Of Konjac Glucomannan
Siti Aisyah, M.B, Dzulkifly, M.H., Suhaimi, M.

126-129
27. The Effects of Ozone on the Germination of Brown Rice
M. Z. Nor Nadiha, N. H. Nor Irmey, D. M. Hashim, R. Z. Haroun

130-133
28. Alternative Ingredients for Halal Cosmetic and Personal Care Products
Puziah, H.

134-139
29. Special Oils for Halal Cosmetics
M. E. S. Mirghani
1*
, I. Jaswir
1
, H. M. Salih
1
, Yumi Z. H. Bt. Hashim
1
and Y.
B. Che Man
2

140-142
Management and Shariah
30. The Halal Certification on Pharmaceuticals: a Policy Issue
Shafie, S.B., Othman, M.B.

143-147
31. Factors Influencing Non-Compliance of Halal Standard among the Restaurant
Operators in Kuala Lumpur
Dzulkifly, M.H, Che Man, Y.B., Suhaimi, A.R., and Ilyia, N.A.R.
148-153
32. Quality Management Practices in the Malaysian Halal Food Industry
Hayati @ Habibah, A. T., Khairul Anuar, M. A. & Fadzli, I.

154-157
33. Consumer Knowldege And Awareness Toward Halal Characteristics On
Bakery Products
Adilah, M.R. and Hartini, J.

158-163
34. Awareness and Knowledge of Halal Food Issues and Alcohol among Food
Technology Students in a Public University in Malaysia
Wan Nadiah W. A., Anis Najiha, A., Roslinda M. R. And Nur Asyikin N.

164-168
35. The Theory of Istihalah From Fiqh Perspective : Analysis Of Determining
Halal and Haram for several Food Products
Mohammad Aizat, J., Mohd Anuar, R.

169-175
36. Halal Friendly Tourism: Capturing Market for Muslim Travellers.
Che Man, Y.B., Suhaimi, A.R., Sahida, W.W.Z.

176-180

Preface

The 3
rd
IMT-GT International Symposium on Halal Science and Management 2009 held in
Sepang was the third in a successful series of symposium held annually in each of the IMT-GT
(Indonesia, Malaysia and Thailand- Growth Triangle) member countries. Similar symposia have
been started at Thailand in 2007, followed by Indonesia in 2008. In 2009, Halal Products
Research Institute, Universiti Putra Malaysia is proud to be the organizer of the symposium.

These Proceedings include 34 manuscripts presented as poster presentation at this symposium.
We sincerely appreciate the cooperation from the authors in submitting their manuscripts for
publication in these Proceedings. We hope the Proceedings will be a valuable reference and will
be of lasting benefit. The Scientific Committee accepts no responsibility for the accuracy of their
content or the opinions expressed therein.

Acknowledgement

Organizing Committee

Patron : Prof Datuk Dr. Nik Mustapha Raja Abdullah
Advisor : Prof. Dr. Yaakob Che Man
Chairman : A.P Dr. Shuhaimi Mustafa
Deputy Chairman : Dzulkifly Mat Hashim
Secretary : Zufliha Zakaria
Treasurer : Ahmad Nizam Abdullah
Rohaizad Jasman
Norhawati Ahmad
Secretariat : Dr. Suhaimi Abdul Rahman
Noorfaizan Anuar
Siti Munira Abdul Razak
Mohd Salehan Sanusi
Mastura Abdul Kadir
Nor Hilman Hashim
Siti Nur Zaffan Arifin
Ahmad Faizal Hamidon
Scientific : Dr Puziah Hashim
A.P Dr. Amin Ismail
Dr Awis Qurni Sazili
Nor Nadiha Mohd Zaki
Nur Fadhilah Khairil Mokhtar
Syariena Arshad
Social : Raja Mohd Hafidz Raja Nhari
Saliza Shahrani
Mafuza Shamsudin
Nor Azlina Jaya
Rosmawatu Jaaper
Umi Noor Saadiah Husin
Technical and ICT : Sharifah Shahida Syed Naimi
A.P Dr. Suhaimi Napis
Amirnuddin Nazar
Azhar Ramayah

1

Analysis of Halal Products
A01

Volatile Profiling of Alcoholic Food and Beverages and Industrial Alcohol
Using GCxGC-ToF-MS For Halal Authentication

K. Farah Azura
1
, D. M. Hashim
1,
*, Y.B. Che Man
1
, S. Awis Qurni
2

1
Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor,
Malaysia.
2
Department of Animal Science, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM,
Serdang, Selangor, Malaysia
Abstract
This study focuses on the identification of the origins of alcohol present in foods using
comprehensive two-dimensional Gas Chromatography Time of Flight Mass Spectrometry
(GCxGC-ToF-MS). The volatile profiles of alcohols from industrial samples and alcoholic food
were extracted by Solid Phase Microextraction (SPME) and analysed using GCxGC-ToF-MS.
For this study, different types of wines including red, white and cooking wines, and an industrial
alcohol sample from sugarcane molasses were tested. The classification of volatile compounds
based on the organized structure of the peaks in the GCxGC contour plot has enabled alcohols
from different origins to be effectively characterized. Evaluation of the data by Principal
Component Analysis (PCA) revealed that the variables ethyl alcohol, 1-Propanol, 1-Butanol 3-
methyl are able to distinguish between these alcohols. It can thus be observed that
chromatographic metabolomic profiling represent a valuable approach in identifying the origin
of alcohols present in foods and beverage.
Keywords: Profiling; alcoholic beverage; industrial alcohol; GCxGC-ToF-MS; authentication

2

1.0 Introduction
Liquor (khamr) is defined in Islamic Law as any intoxicating drink that could affect the
persons mental coherence. As recorded in a Hadith, whatever intoxicates in large quantity, and
then a small quantity of it is also forbidden.
The industrial alcohol is a distilled ethanol, either produced from plant fermentation or
petrochemical synthesis. The properties of each will determine the suitability of their application
in the industry. The alcohol is is mostly used in food manufacturing as a solvent for flavor
extraction (United States Food and Drug Administration, 2007), food preservative, disinfectant,
material for vinegar fermentation, and washing liquid for the food processing machinery (Keiko,
et al., 2005).
The use of industrial alcohol as a medium for extracting flavors or dissolving them is
permissible as long as the alcohol is not derived from the alcoholic beverage production and its
amount is generally low and will not cause intoxication (National Islamic Council of Malaysia,
1988).
In the food service industry, alcoholic beverage is often used as an ingredient for
flavoring and preservation. This situation has resulted in increased concern regarding the
compliance of such food products from the halal perspective. With regards to this issue, the
development of various instrumental techniques is in great demand for halal food authentication
for identifying the origins of alcohol present in foods, and to ascertain if it originates from
industrial alcohol or an alcoholic beverage.
The aim of this study was to obtain a chromatographic metabolomic profiling of alcohols
derived from various origin based on the headspace SPME (HS-SPME) coupled with
comprehensive GCGCToF-MS.

2.0 Materials and Methods
2.1 Samples
Red, white and cooking wine were purchased from the local supermarket while the industrial
alcohol (ethanol) made from sugarcane was collected from ethanol manufacturer in Perlis, north
of Peninsular Malaysia.
2.2 HS-SPME methodology
3

The SPME holder for manual sampling and the Stableflex fibre coating with 65m
divinylbenzene-carboxen- polydimethylsilox ane (DVB/CAR/PDMS) used were purchased from
Supelco (Aldrich, Bellefonte, PA, USA).
2.3 Metabolomic Profiling Analysis
The volatile analysis were done using Comprehensive Two Dimensional Chromatography Time
of Flight Mass Spectrometre (GCGCToF-MS). The system consisted of an Agilent GC 6890N
gas chromatograph with a dual stage jet cryogenic modulator and a secondary oven. The detector
was a high-speed ToF mass spectrometer.

3.0 Results and Discussion

Figure 1: Separation of volatiles on 2D plane chromatogram of GCxGC-ToF-MS

The separation of GCxGC-ToF-MS is based on different polarity of primary and secondary
col
um
n.

Figure 1 showed the separation is based on the normal column combination with a non-polar
compound eluted on the first column and a polar phase as the secondary column. The polar
homologous series of alcohol distribute on the upper of plane, while the non-polar compound of
esters distribute on the bottom of column.

4

Figure 2: HS-SPME-GCxGC-ToF-MS peak apex plots of. (A) red wine; (B) white wine; (C)
cooking wine.

Figure 2 showed the apex plot of individually alcohol group for each wines sample; red wine,
white wine and cooking wine. Generally, it was showed that the tabulation of alcohol compounds
identified in those samples is having the similar pattern, although several congeners might
address the differential within each.

Figure 3: HS-SPME-GCxGC-ToF-MS peak apex plots of (A) 95% industrial alcohol (ia952); (B)
absolute industrial alcohol (iaabs)

Figure 3 showed the pattern of alcohols
compound from industrial alcohol samples
distributed on the apex plot. The absence of
several points on data plotted on absolute
alcohol signify that the number of higher alcohol
in absolute alcohol has been reduced due to
further distillation process of purified alcohol.

5

Figure 4: PCA score and loading plot of alcohols characterization in industrial alcohol (ia and
da), and wines sample; red wine (rw), white wine (ww), and cooking wine (cw).

As showed on the PCA plot (Fig. 4), the classification of industrial alcohols fall on the negative
region of PC1, while the wine samples were dominant fall on the PC1s positive region. This
figure signifies that the properties of alcohol congeners identified in industrial alcohols are vary
as compared to wines (red, white and cooking wine). Meanwhile, the wines might contain
similar component of alcohol group.

4.0 Conclusion

This profiling study able to characterize the profile of volatiles compound extracted from various
alcohols sample using HS-SPME- GCxGC-ToF-MS. In advance, the identification of alcohol
marker can be applied to authenticate Halal products by identifying the origins of alcohol present
in foods, and to ascertain if it comes from industrial alcohol or an alcoholic beverage such as red
wine, which is strictly forbidden to be consumed by Muslims.

5.0 References

Keiko, I.F., Shingo, G., Ryu, U., Keita, Y., Michikatsu, S. & Naohiro Y. (2005). Botanical and
Geographical Origin Identification of Industrial Ethanol by Stable Isotope Analyses of
C, H, and O. Bioscience, Biotechnology, Biochemistry, 69(11), 2193-2199.
National Fatwa Council of Malaysia (1988). Department of Islamic Development Malaysia
(JAKIM).
6

United States (US) Food and Drug Administration (2007), Code of Federal Regulations, Title
21, Volume 2, Revised on April 1, 2007.

7

A02

Rapid Detection of Pork in Food Products by Electronic Nose for halal Authentication.
M. Nurjuliana
1
, Y.B. Che Man
1*
, D. Mat Hashim
1
, and A.K.S. Mohamed
2

1
Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM, Serdang,
Selangor, Malaysia.
2
Department of Food Science, Faculty of Food Science and Technology, Universiti Putra
Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
*Corresponding author e-mail: yaakobcm@gmail.com

Abstract
In this study, electronic nose (zNose
TM
) was introduced as a new potential real time and fast
technique to analyze the aroma of raw meat and processed meat for halal authentication. The
zNose
TM
was successfully tested for its ability to provide individual fingerprints of the aroma
of pork and different types of sausages (beef sausage, chicken sausage and pork sausage).
This is achieved using a visual odor pattern called VaporPrint
TM
, derived from the frequency
of the surface acoustic wave (SAW) detector. Principal component analysis (PCA) was used
to structure the data matrix. The different meat samples were separated along the first PC.
The first PC described 94% of the total variance and showed four well defined groups:
chicken sausage, pork sausage, beef sausage and pork. This percentage seemed sufficient to
define a good model, especially for qualitative purpose. The high negative score of pork was
determined by the highest amount of C8, C13 and C16 among all samples.
Keywords: Authentication; pork; electronic nose; surface acoustic wave (SAW); principal
component analysis (PCA)

8

Introduction
Halal authenticity is an issue of major concern in the food industry and among the issues
is related to porcine based adulteration such as pork, lard and others. In the view of some
religions such as Islam and Judaism, pork and lard are serious matters and totally prohibited in
consumer products. As food is part of our daily life, Islamic Food Laws carry a special
significance as mentioned in the Holy Quran. In Islam, food containing pig sources are haram
(prohibited or unlawful) for Muslim consumption (Al-Taher, 2004). From a nutritional point of
view, amongst all animals, pig is the cradle of harmful germs and in addition, pork serves as a
carrier of diseases to mankind. It is for those reasons that made it unhealthy for human
consumption (Che Man, Syahariza, Mirghani, Jinap & Bakar, 2005). Hence, developing
analytical methods for halal authenticity is very important especially for the Muslim consumers
to protect them from fraud and deception and also to ensure food safety. Methods that have been
developed based on chromatography (Marikkar, Ghazali, Che Man, Peiris & Lai, 2005), DNA-
based technology (Aida, Che Man, Wong, Raha & Son, 2005), spectroscopic method (Che Man,
Syahariza, Mirghani, Jinap & Bakar, 2005) followed by a rapid, short column chromatography
technique, electronic nose (Gan, Che Man, Tan, NorAini & Nazimah, 2005). The electronic nose
has been introduced as a fast, non destructive, simpler and easier to handle for aroma profile
analysis which is preferred to routine laboratory analysis. Therefore, the aim of this work was to
study the use of an electronic nose based on surface acoustic wave sensor for the detection of
pork in the food products based on principal components analysis.

Materials and methods
Meat samples
Meat samples from sheep, cow, chicken and pork were used while for the sausages; two types of
pork sausages, a type of chicken and beef sausage were used and purchased from a local wet
market. All samples were stored at -20C in order to minimize and delaying the growth of
spoilage organism.
The Electronic nose
9

The zNose is based upon well known principles of gas chromatography. This electronic nose
uses a single, uncoated, and high quartz Surface acoustic wave(SAW) sensor.

Electronic nose analysis
The electronic nose analysis involved two steps process to analyse vapours. For the first step, the
vapours of the sample were concentrated in a Tenax trap. In the second step, the trap is rapidly
heated and released vapours. When volatiles adsorb on the surface of the sensor the frequency of
the surface acoustic wave will be altered, which will in turn affect the detection signal and allow
identification of the contaminants. The total cycle time per sample was 15seconds.
Statistical Analysis
Unsupervised multivariate analysis, principal component analysis (PCA) was used for data
processing. The principal components were classified and discriminate depending on the level of
information they produced.
Results and discussion
Electronic nose analysis
The VaporPrint
TM
by the electronic nose is a 2-dimensional olfactory image which provide the
odor concentration and characteristic shapes. Figure 1 displays the aroma profiles of pork, 2
types of pork sausages, 2 types of chicken sausage and beef sausage. Different meat samples
showed variations in the amount of every compound and generates a unique and easily
recognizable image.

10

a) b)

c) d)

e) f)

Figure 1: VaporPrint
TM
of different meat and sausages. (a) Pork; (b) Pork sausage 1; (c) Pork
sausage 2; (d) Chicken sausage 1; (e) Chicken sausage 2; (f) Beef sausage.

11

Principal component analysis (PCA)

The different meat samples were separated along the first PC described 94% of the total variance
(Figure 2) and showed four defined groups along PC1; chicken sausage, pork sausage, beef
sausage and pork. This percentage seemed sufficient to define a good model; especially for
qualitative purpose. A further separation among the meat samples and processed meat was
dominated by PC 2 which described 3% of the peak variation. The high positive correlation
between C9 and PC 1 indicated that the volatile profile of beef sausage had a higher proportion
of C9 (Figure 3). The high negative score of pork was determined by the highest amount of C8,
C13 and C16 among all samples.

Figure 2: PCA score plot of pork discrimination among the sausages.
12

Figure 3: PCA loading plot of pork discrimination among the sausages

Conclusion
This study indicates that electronic nose provides a rapid and reliable method for pork detection
and discrimination. Hence, it is a potentially technique for detection of porcine based
adulteration in food products for halal authentication.

Acknowledgment
This research work was supported by Universiti Putra Malaysia (Grant No. Research University
Grant Scheme: 91033) awarded to Professor Dr. Yaakob Bin Che Man.

References
Aida, A. A., Che Man, Y. B., Wong, C. M. V. L., Raha, A. R., & Son, R. (2005). Analysis of raw
meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat Science,
69(1), 47-52.

Al-Taher, F. (2004). Halal food production: Mian N. Riaz and Muhammad M. Chaudry (Eds.);
CRC Press, Boca Raton, FL, 2004, 379pp, Hardcover. Food Microbiology, 21(4), 490-490.

13

Che Man, Y. B., Syahariza, Z. A., Mirghani, M. E. S., Jinap, S., & Bakar, J. (2005). Analysis of
potential lard adulteration in chocolate and chocolate products using Fourier transform infrared
spectroscopy. Food Chemistry, 90(4), 815-819.

Gan, H. L., Che Man, Y. B, Tan, C. P., NorAini, I., & Nazimah, S. A. H. (2005).
Characterisation of vegetable oils by surface acoustic wave sensing electronic nose. Food
Chemistry, 89(4), 507-518.

Marikkar, J. M. N., Ghazali, H. M., Che Man, Y. B., Peiris, T. S. G., & Lai, O. M. (2005).
Distinguishing lard from other animal fats in admixtures of some vegetable oils using liquid
chromatographic data coupled with multivariate data analysis. Food Chemistry, 91(1), 5-14.

14

A06

Potential Use of Amino Acids Analysis for Distinguishing Bovine and Porcine
Gelatins

Norakasha, R.
a
, *Hashim, D. M.,
a
, Che Man, Y.B.,
a
, Shuhaimi, M.
a
a
*corresponding author email: dzulkifly@gmail.com.my

Abstract
Reverse Phase High Performance Liquid Chromatography (RP-HPLC) with pre-column
derivatisation was used to obtain amino acid profiles of bovine and porcine standard gelatin
samples from Sigma and Merck. Partial least-squares (PLS) regression was used to establish a
calibration model and the R
2
obtained was 0.991 and 0.983 for Sigma and Merck samples,
respectively. Classification and characterization of the amino acids were based on principal
components analysis (PCA). The results of PCA score plot showed that the method developed is
capable of distinguishing gelatin sources by utilizing the main amino acids present in gelatin
which are glycine, proline and hydroxyproline, as a potential biomarkers. The RP-HPLC ensures
accurate characterization of protein and amino acids. Besides that, it is a fast, repeatable and
reliable method to be apply as routine work. It is believe that this method can be used to
determine the unknown source of raw gelatins.
Keywords: RP-HPLC, gelatin, PLS, PCA, Glycine, Proline, Hydroxyproline

Introduction
Gelatin is an easily digestible food protein obtained by controlled hydrolysis of collagen usually
cows, buffaloes and pigs (Karim & Bhat, 2008; Nemati et al., 2004; Zhou & Regenstein, 2006).
The application is not only in food area, but also in cosmetics, medical products and veterinary
applications. It has been used as adhesive and gelling agent, foaming agent, protective colloid,
emulsifier, stabilizer, film forming, micro-encapsulation and clarifying agent (Hidaka & Liu,
2002; Dickinson & Lopez, 2001). Due to its wide area of utilisation, the sources of gelatins has
given rise to a lot of concern amongst certain consumers especially related to cultural, religious
and therapeutic aims including Muslims, Jews and Hindus. Certain countries were cautious of
15

bovine spongiform encephalopathy (BSE) thus restricting the use of bovine gelatins (Badii &
Howell, 2006; Bhat & Karim, 2009). As consumer awareness increased, there is a great demand
to have methods to identify sources of gelatin used in food, cosmetic and pharmaceutical
products. Reverse Phase High Performance Liquid Chromatography (RP-HPLC) with pre-
column derivatisation was used to obtain amino acid profiles of standard gelatin samples from
Sigma and Merck. Classification and characterization of the amino acids were based on principal
components analysis (PCA). The results showed that the method developed is capable of
distinguishing gelatin sources by utilizing the main amino acids present in gelatin. The method
can therefore be used to determine unknown sources of gelatins.
Gelatin samples, acetonitrile, hydrochloric acid and methanol were purchased from Sigma.
AccQ.Tag eluent A, amino acid standard and derivatising reagent and internal standard were
acquired from Waters (Milford, MA, USA). All chemicals were of analytical grade. High
Performance Liquid Chromatography (HPLC) was performed on an Acquity system (Waters) in
combination with a Fluorescence detector. The Unscrambler software version 9.7 (CAMO AS,
Trondheim, Norway) was used to classify pure and adulterated gelatins via principal component
analysis (PCA).

Results and discussion
Bovine and porcine gelatins share very similar amino acid compositions. However in
comparison, a few of the amino acids showed different amounts. This was used as the basis to
distinguish the sources of gelatin. Even though the peptides and amino acids vary in composition
and depending on the type of gelatin, they still represent structural similarity between the sources
which is expected to relate to their genetic.
The higher the hydroxyproline content, the higher the solubility of that particular gelatin.
In this case, bovine gelatin contains higher hydroxyproline compared to porcine gelatin. Glycine
present in gelatin is important to stabilise the gelatin structure because of one hydrogen bond per
turn is connected to the carbonyl oxygen of the peptide backbone. Hydroxyproline as the
prevalent amino acid is specific for gelatins. It was found that the hydroxyproline content was
10% by weight much higher compared to other sources such as elastin and acetyl choline
esterase (Bailey & Light, 1989). Thus, this is commonly used to quantify the amount of gelatin
16

in samples or products. Since glycine, proline and hydroxyproline are major amino acids in
gelatins, they may give the differences and this can be used to distinguish the origin of the raw
gelatins. Table 1 showed the average amount and ratio of glycine, proline and hydroxyproline in
bovine gelatin mixed with porcine gelatin at 0, 25, 50, 75 and 100% of adulteration (0%
adulteration indicate 100% bovine gelatin). Both glycine and proline showed increasing amount
when the bovine gelatin was added with porcine gelatin from 0 to 100%. However, the trend
differs in hydroxyproline the amount decrease when the percentage of adulteration increased.
Principal component analysis (PCA) is one of the ways to reduce the number of
orthogonal principal components (PCs) and transforms the results into a simple way of
explaining the variability in the data (Kher et al., 2006). The first two loadings of PCA results
were used to generate the projection plot that provides a visual determination of the connection
among the sample fingerprints. The score plot (Figure 1 (a)) showed the ability of this method in
distinguishing gelatins according to their origin. The x-loadings plot (Figure 1 (b)) shows that the
discrimination of bovine gelatin and adulterated gelatins were caused by the amount of glycine,
proline and hydroxyproline. The utilization of PCA facilitates the evaluation of data where
visualization method such as two-dimensional non-linear mapping is applied.

Conclusion
The comparative study of the amino acid values between bovine and porcine gelatins was
carried out. The results showed the ability to distinguish gelatin sources using amino acid
analysis together with PCA. This investigation appears to be unique in its aim to establish a
method to detect the sources of unknown gelatin.

Acknowledgements
We would like to thank the Ministry of Science, Technology and Innovation Malaysia (MOSTI)
(Escience Project No. 05-01-04-SF0625) awarded to Prof. Dr. Yaakob B. Che Man for funding
this study.

17

Table 1. Amount of glycine, proline and hydroxyproline in adulteration of bovine gelatin with
porcine gelatin from Sigma and Merck
% adulteration Amino acids
Gly Pro Hyp
0 243.07 2.55
d
121.76 0.36
c
132.20 1.27
a
25 249.80 3.10
c
117.88 0.03
d
104.50 1.56
b
50 257.10 1.13
b
121.84 0.17
c
103.99 0.33
b
75 270.01 2.02
a
126.06 0.20
b
104.40 1.27
b
100 271.50 0.57
a
135.13 0.53
a
100.40 1.13
c
a
Adulteration increasing porcine fraction
b
Data are average values of duplicate analysis
c
Different superscripts in the same column denote a statistically significant different (P 0.05) for each amino
acids.

Figure 1. Principal component analysis of bovine gelatin adulterated with porcine gelatin. (a)
Score plot (b) x-loading.
References
(a)
(b)
18

Badii, F., & Howell, N. K. Fish gelatin: Structure, gelling properties and interaction with egg
albumen proteins. Food Hydrocolloids, 2006, 20, 630-640.
Bailey, A. J., & Light, N. D. Connective tissue in meat and meat products. London & New York:
Elsevier Applied Science. 1989, pp. 238242.
Dickinson, E. & Lopez, G. Comparison of the emulsifying properties of fish gelatin and
commercial milk proteins. Journal of Food Science, 2001, Vol 66, 118- 123.
Hidaka S. and Liu S.Y. Effects of gelatins on calcium phosphate precipitation: a possible
application for distinguishing bovine bone gelatin from porcine skin gelatin. Journal of
Food Composition and Analysis, 2002,16: 477-483.
Karim, A. A., & Bhat, R. Gelatin alternatives for the food industry: recent developments,
challenges and prospects. Trends in Food Science & Technology, 2008, 19, 644-656.
Karim, A. A., & Bhat, R. Fish gelatin: properties, challenges and prospects as an alternative to
mammalian gelatins. Food Hydrocolloids, 2009, 23, 563- 576.
Kher, A., Mulholland, M., Green, E., & Reedy, B. Forensic classification of ballpoint pen inks
using high performance liquid chromatography and infrared spectroscopy with principal
component analysis and linear discriminant analysis. Journal of Vibrational
Spectroscopy, 2006, 40, 270-277.
Nemati, M., Oveisi, M. R., Abdollahi, H., & Sabzevari O. Differentiation of bovine and porcine
gelatins using principal component analysis. Journal of Pharmaceutical and Biomedical
Analysis, 2004,34, 485-492.
Zhou, P. and Regenstein, J. M. Determination of total protein in Gelatin Solutions with the
Lowry or Biuret Assay. Journal of Food Science, 2006, Vol. 71, Nr. 8.

19

A07

Detection of Pork in Pastry Products for Halal Verification via Polymerase
Chain Reaction (PCR) Techniques
Mohd Hazim, M.Y
1
., Yaakob, C.M
1*
., Shuhaimi, M
1
.
1
Halal Products Research Institute, Universiti Putra Malaysia, 43400 Serdang, Selangor
Malaysia
*corresponding author email: yaakobcm@gmail.com

Abstract
Pork identification in pastry fillings using polymerase chain reaction (PCR) was developed.
Genomic DNA of the pastry filling were successfully extracted and found to be good quality and
produced clear PCR products. In this study, two methods of PCR were used for detection of pork
adulteration in several types of pastry fillings, including Polymerase Chain Reaction-Restriction
Fragment Length Polymorphism (PCR-RFLP) and species-specific PCR amplification. PCR
amplification of mitochondrial cytochrome b gene (mt-cyt b) for PCR-RFLP produced DNA
fragments of approximately 360 bp. This generated amplicons were then digested with restriction
enzyme BsaJI, resulting in RFLP profiles of 228 bp and 131 bp in sizes which are specific for
pork. Besides that, the species-specific PCR amplification of cyt b gene produced DNA
fragments with approximate size of 398 bp as expected for the positive results. The findings from
this study can serve as a basis of reference for the research in halal food authentication.
Keywords: Pork; Halal; PCR; RFLP; Species-specific PCR

Introduction
Malpractices of some food producers have tremendously reinforced public awareness
regarding the origin of food containing animal product. However, labels do not provide sufficient
guarantee. Therefore, it is necessary to identify and authenticate the origin of food containing
20

animal product, thus protecting both consumers and producers from illegal substitutions. In this
regard, pork is a susceptible target due to some issues associated with adulteration of halal food
products (Yahya Ishmael, 2005). One of the issues was the use of pork in pastry fillings. With
respect to food prescriptions in Islam, Muslims have to follow a set of dietary laws intended to
advance their well-being. These dietary laws or prescriptions determine which foods are halal
(i.e. permitted) for Muslims. Consumption of pork is prohibited according to Islamic rulings
(Bonne & Verbeke, 2008). This is an example of how important it is to develop a reliable
technique to ensure the halal status of the food products which is crucial for halal authentication.

Materials and Methods
Four types of raw meats and seven types of pastry fillings were used (Table 1). Raw meat
samples from chicken, cow, sheep, and pig were used as controls. These raw meat samples were
obtained from Giant Hypermarket, Nilai and Halal Products Research Institute, Universiti Putra
Malaysia, Malaysia. Seven types of pastries were used as test samples, namely chicken floss
mooncake, golden floss mooncake, pork puff, curry puff, chicken pie, shanghai puff and
unknown puff (unlabeled product). These food products were purchased from several markets in
Sungai Besi, Petaling Street and Giant Supermarket in Nilai. Pork was used as a positive control
while three types of meats (chicken, beef and mutton) were used as negative control. All the raw
meats and food samples were stored at -20C before DNA extraction to avoid enzymatic
degradation of DNA.
DNA was extracted from 5 mg of meat tissue and pastry fillings using DNA purification
protocols for tissue samples provided with MasterPure DNA Purification Kit (Epicentre,
Madison, Wisconsin). A pair of primers (Sigma-Proligo, The Woodlands, TX, USA) was
employed in PCR reaction. The PCR primers of cytochrome b gene that have been used in RFLP
analysis were published by Aida et al (2007). The set of primer (Sigma-Proligo, The Woodlands,
TX, USA) used for species specific PCR amplification were Watanobe et al., (1999).
The detection of porcine DNA was done through the amplification using the Mastercycler
ep (Eppendorf AG, Hamburg, Germany). Each reaction tube contained 20 ml total volume of the
reaction mixture which consisted of 12.5 l 2x PCR mastermix (Promega, Madison, USA), 1 l
of 10 pmol of each primer and 9.5 l of nuclease free water.
Results
21

Figure 1

Figure 2

500bp
259bp
500bp
228bp
131bp
22

Figure 3
Discussion
Genomic DNA of the pastry filling were successfully extracted and found to be good
quality and produced clear PCR products. In this study, two methods of PCR were used for
detection of pork adulteration in several types of pastry fillings, including Polymerase Chain
Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) and species-specific PCR
amplification. PCR amplification of mitochondrial cytochrome b gene (mt-cyt b) for PCR-RFLP
produced DNA fragments of approximately 259 bp (Figure 1). This generated amplicons were
then digested with restriction enzyme BsaJI, resulting in RFLP profiles of 228 bp and 131 bp in
sizes which are specific for pork (Figure 2). Besides that, the species-specific PCR amplification
of cyt b gene produced DNA fragments with approximate size of 398 bp as expected for the
positive results (Figure 3).
Conclusion
PCR-RFLP analysis and PCR species-specific of cyt b used in this study represented a powerful
and easy method for detection of pig derivatives in raw meats and food samples. It is a
potentially reliable technique to be used for halal authentication.

398bp
23

References

Bonne, K.; Verbeke, W. Muslim consumer trust in halal meat status and control in Belgium Meat Sci.
2008, 79, pp 113-123.

Aida, A.A.; Che Man, Y.B.; Raha, A.R.; Son,

R. Detection of pig derivatives in food products for
halal authentication by polymerase chain reaction-restriction fragment length polymorphism. J.
Sci. Food and Agric. 2007, 87, pp 569-572

Watanobe, T.; Okumura, N.; Ishiguro, N.; Nakano, M.; Matsui, A.; Sahara, M.; Komatsu, M. Genetic
relationship and distribution of the Japanese wild (Sus scrofa leucomystax) and Ryukyu wild boar (Sus
scrofa riukiuanus) analysed by mitochondrial DNA. J. Mol. Ecol. 1999, 8 pp 1509-1512.

Yahya-Ishmael, R. When ignorance is not bliss: The Halal Journal 2005, pp 28-29.

24

A08
Porcine Specific Real-time Polymerase Chain Reaction (PCR) for Halal
Verification

Farihah Liyana, K.
1
, Shuhaimi, M.
1,2
, Che Man, Y.B.
1,3*
, Sazili A.Q.
4
, Aida A.A.
1
and Raha
A.R.
2
.
1
Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor.
2
Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 UPM
Serdang, Selangor.
3
Faculty of Food Science and Technology, Universiti Putra Malaysia, 43400 UPM Serdang,
Selangor.
4
Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor.

Abstract
A porcine-specific real-time polymerase chain reaction (PCR) detection of a region in the
mitochondrial DNA was developed for Halal verification. A pair of porcine-specific primers was
designed to generate a specific fragment of the porcine DNA. To verify the specificity of the
primers designed, the primer pair was tested against ten samples to detect any possible cross-
reactions. The reaction only amplified porcine DNA at C
t
25.03 0.33. The real-time PCR assay
employed in this work was proven to be very sensitive with a low detection limit. The assay was
done by preparing a 10-fold dilution series to determine the sensitivity of the reaction. The
sensitivity threshold was up to 0.001ng porcine DNA.

Keywords: Real-time PCR, SYBR Green I, Porcine DNA, ND5 gene, Halal verification.
Introduction
The development of new and increasingly sophisticated techniques for the authentication
of food products continues apace with increasing consumer awareness of food safety and
authenticity issues. Food authentication is also of concern to Muslim consumers that do not wish
to be cheated by unscrupulous processors who would gain on economic advantage from the
mispresentation of the food they are selling. However, not all Muslim consumers globally have
25

easy access to Halal food products. Since the awareness and demand for Halal food are
increasing, it is therefore important for the food manufacturers to understand the necessity of
these consumers who plays a significant part in the food market. The remarkable growth in the
Halal sector has initiated a growing interest among researchers in developing new, rapid and
reliable methods for Halal verification. The need for proper supervision, certification and
labeling should follow closely to offer reliable Halal food products. In relation to that, pork has
been implicated as a replacement for other meat types in food products (Aida, Che Man, Raha &
Son, 2007). For that reason, the detection of fraud and adulteration of food products involving
the Haram (prohibited) ingredients are crucial to protect the Muslim consumers (Aida, Che Man,
Wong, Raha & Son, 2005). Therefore, the identification of animal species in food products is an
important issue to be resolved in order to protect the consumers from illegal or undesirable
adulteration, for economic, religious and health reasons. The objective of this study was to
develop a rapid method for the determination of Halal food authenticity using real-time PCR. For
this purpose, we designed a porcine specific primer set and an optimized real-time PCR method
for the detection of porcine DNA in food.
Materials and Method
DNA was extracted from meat and plant samples using a commercial DNA extraction kit
according to the manufacturers instructions. The ten types of raw samples used in this study
were pork, beef, mutton, chicken, venison, turkey meat, mackerel, corn, spinach and wheat. The
primer pair used in this study was designed to amplify a fragment of the pigs (Sus scrofa)
mitochondrial DNA. The detection of porcine DNA was done through the amplification using
the real-time PCR machine.
Results and Discussion
A porcine-specific primer pair which amplifies a region of the mitochondrial DNA was
designed. Thus, the specificity of the primer pair was initially tested by the real-time PCR
amplification. The assay was carried out to test the primer pair against all ten samples and
ddH
2
O acted as no template control (NTC). Under the optimized real-time PCR amplification
conditions it has demonstrated that only pork sample indicated positive amplification, while the
other nine samples and NTC did not exhibit any (Figure 1). The porcine-specific system
amplified a fragment from porcine DNA (C
t
value of 25.03 0.33).
26

Figure 1: Specificity test on the porcine-specific primer pair designed against other meat and
plant species. (NTC - No Template Control).

Utilizing the 10-fold serial dilution method, the extracted porcine DNA was serially diluted
in water to determine the sensitivity of the reaction and was used in the construction of a
standard curve. In triplicates, the prepared dilutions of samples were analyzed using the real-time
PCR under the optimized amplification conditions. The detection limit for this porcine-specific
PCR was found to be at 0.001ng DNA (Figure 2).
27

Figure 2: Sensitivity and detection limit test on the porcine-specific primer pair utilizing the 10-
fold serial dilutions. (NTC - No Template Control).

Conclusion
The presence of 0.001ng of pork template DNA was detected when assessed using dilutions of
DNA in water. The primers designed are species-specific and highly sensitive, which has the
potential to be applied for monitoring the authenticity of Halal foods.

References
Aida, A. A., Che Man, Y. B., Wong, C. M. V. L., Raha, A. R. & Son, R. (2005). Analysis of raw
meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat Science,
69, 47-52.

Aida, A.A., Che Man, Y.B., Raha, A.R. & Son, R. (2007). Detection of pig derivatives in food
products for halal authentication by polymerase chain reaction-restriction fragment length
polymorphism. Journal of the Science of Food and Agriculture, 87, 569-572.

28

Che Man, Y. B., Aida, A. A., Raha, A. R. & Son, R. (2007). Identification of pork derivatives in
food products by species-specific polymerase chain reaction (PCR) for halal verification. Food
Control, 18, 885-889

29

A09

Extractability of Soluble Protein from Different types of Skeletal Muscles in
Cattle under the Treatment of pH, Molarity and type of Buffers.

M.Z. Noor Azihan
1,2
, A.Q. Sazili
1,2
, M. Shuhaimi
1,3
, M. Hilmi
2
, J. M. Panandam
2

1
Halal Products Research Institute, Putra Infoport,
2
Department of Animal Science, Faculty of
Agriculture,
3
Department of Microbiology, Faculty of Biotechnology and Biomolecular Science,
Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.
e-mail: noorazihan@gmail.com

Abstract
Soluble protein can be extracted if muscle fibres are lysed and the extractability depends on
several factors such as choice of buffer, presence of protein inhibitor and the osmolarity of the
resuspension buffer (1). Proteins can be severely affected by small changes in hydrogen ion
concentration. Some proteins tend to precipitate when the pH approaches their isoelectric point
(pI) (7). Therefore, in order to ensure reproducible results, it is important to maintain the protein
solution at the constant pH. Once an optimal pH has been determined, different buffer within the
same pH range may also be examined for specific buffer effects (2). Different types of skeletal
muscles are composed of different proportion of fibers at which the differences influence the
metabolic capability (4, 6). Differences in rate of post-mortem glycolysis could induce changes
in protein solubility (3). In addition, the selection of the ST, LD and SS muscles for the study
was based on their previously reported metabolite and contractile characteristic as well as fiber
type composition (5). The aim of this study was to evaluate the effects of the type, pH and
molarity of extraction buffer on protein extractability from beef Semitendinosus (ST)
Longissimus dorsi (LD) and Supraspinatus (SS) muscles.

Introduction
All muscle samples were dissected out from carcass immediately after slaughter and
subjected to extractions using freshly prepared buffers of different buffer type (Tris Base and
30

Tris HCl), pH (8.3 and 7.5) and molarity (100mM and 20mM). Following extraction, the total
extractable protein concentration was determined by Bradford assay.
The results exhibited significant (p<0.05) effects of muscle and buffer interaction (Table
1) on extracted total protein concentration. The statistical analysis also revealed interaction
between type of buffer, pH and molarity significantly (p<0.01) affected the extracted protein
concentration. The results of protein concentration extracted with Tris-HCl were significantly
lower than soluble protein that extracted with Tris-Base except for buffer with pH 7.5 and
100mM (Table 2). Higher concentration of soluble protein can be extracted using buffer with
higher pH than buffer with lower pH. It has been proven that low pH of buffer may cause the
soluble protein to precipitate as reported based on reduced of protein activity (7). Type of
muscle also influenced the effect of type of extraction buffer in protein extraction (p<0.05).
Based on Table 3, LD was found to have the highest protein extractability followed by SS and
ST for Tris-HCl and ST and SS for buffer Tris-Base.

Based on the results, optimal buffer suggested to use for muscle protein extraction is
Tris-Base with pH 8.3 and 100mM. The present study demonstrated that the extractability of
skeletal muscle protein was significantly influenced by the type, molarities and pH of the
extraction buffers used.

Table 1. Analysis of variance showing the effects of buffer type, pH and molarity of buffer
muscle type in protein extractability.
Effects df p Interactions df P
Buffer 1 <.0001 Buffer*pH*Molarity*Muscle 2 0.3407
pH 1 <.0001 Buffer*pH*Molarity 1 0.0011
Molarity 1 <.0001 Buffer*Molarity*Muscle 2 0.1511
Muscle 2 0.0003 Buffer*pH*Muscle 2 0.6334
pH*Molarity*Muscle 2 0.3550
Buffer*pH 1 <.0001
Buffer*Molarity 1 0.5085
Buffer*Muscle 2 0.0251
pH*Molarity 1 <.0001
pH*Muscle 2 0.4839
Molarity*Muscle 2 0.7292

31

Table 2. Mean of soluble protein (g/l) extracted from beef ST, LD and SS
Buffer Tris-Base Tris-HCl
pH 8.3 7.5 8.3 7.5
Molarity
(mM) 100 20 100 20 100 20 100 20
Muscle ST 7.28 6.35 4.27 6.86 3.75 4.18 3.61 5.08
LD 7.45 6.96 4.73 6.73 3.78 4.42 3.90 4.48
SS 6.58 6.75 5.13 5.86 4.57 5.01 4.03 5.47
Mean(g/l) 7.104
a
6.685
a,b
4.711
c
6.484
b
4.029
d
4.537
c
3.846
d
5.008
c

* Means with different superscripts are significantly (p<0.05) different.

Table 3.Effect of interactions between types of buffers and muscle soluble protein extractability
Buffer TH TB
Muscle SS ST LD SS ST LD
Mean(g/l) 4.300
c,d
4.002
d
4.77
c
5.877
b
6.342
a,b
6.517
a

* Means with different superscripts are significantly (p<0.05) different.

REFERENCES

1) Hafiz A, 2005. Preparation of buffer for protein extraction in Principles and reaction of protein
extraction, purification and characterisation. CRC Press, USA. 1-33.
2) Ferguson, W. J., Braunschweiger, K. I., Braunschweiger W. R., Smith, J. R., McCormick, J. J.,
Wassman, C. C., Jarvis, N. P., Bell, D. H. and Good, N. E., 1980. Hydrogen ion buffers for biological
research. Analytical Biochemistry, 104:300-310.
3) McLoughlin, J. V., 1968. Sarcoplasmic and myofibrillar protein in skeletal muscle of two breeds of
pigs. Journal of Food Science. 33:383-385.
4) M. Oe, M. Ohnishi-Kameyama, I. Nakajima, S. Muroya, K. Chikuni, 2007. Muscle type specific
expression of tropomyosin isoforms in bovine skeletal muscles. Meat Science, 75:558563.
5) Sazili, A. Q., Parr, T., Sensky, P. L., Jones, S. W., Bardsley, R. G. and Buttery, P. J., 2005. The
relationship between slow and fast myosin heavy chain content, calpastatin and meat tenderness in
different ovine skeletal muscles. Meat Science. 69:17-25.
6) Takemasa, T., Sugimoto, K., Miyazaki, M., Machida, M., Ikeda, S., Hitomi, Y., Kizaki T., Ohno, H.,
Yamashita, K., Haga, S., 2004. Simple method for the identification of oxidative fibers in skeletal
muscle. European Journal of Applied Physiology. 91: 357359.
7) Veiseth, E., & Koohmaraei, M., 2001. Effect of extraction buffer on estimating calpain and calpastatin
activity in postmortem ovine muscle. Meat Science.57:325-329.

32

A10

Identification of Alcoholic Compounds in Fermented Glutinous Rice (Tapai)
N. H. Abdul Hamid
1
, D. M. Hashim
1,
*, S. Mustafa
1,2
Y.B. Che Man
1

1
Malaysia.
2
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti
Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
*Corresponding author e-mail address: dzulkifly@food.upm.edu.my

Abstract
Fermented glutinous rice (tapai) is a popular dessert amongst Malaysian consumers. However,
consumption of tapai had rise the Halal issue to the Muslim community since its alcohol content
is similar to beer which is 5 %. Furthermore, the aim of this study is to provide information about
alcoholic compounds in tapai other than ethanol. The identification of the alcoholic compounds
was performed using headspace coupled to gas chromatography flame ionization detector (HS-
GC-FID). The tapai was fermented in the laboratory for 3 days at 30
0
C using inoculum obtained
from Malaysian Agricultural Research and Development Institute (MARDI). It was found that
after 3 days, the alcohols detected were short chain and long chain alcohol. Short chain alcohol
was ethanol, and the long chain alcohols were 1-propanol, 2-methyl-1-propanol and 3-
methylbutanol.
Keywords: Identification, glutinous rice, alcoholic compounds, HS-GCFID, Halal

Introduction

Tapai is a traditional delicacy dessert normally can be found throughout much of East-
and Southeast Asia country such as Malaysia, Indonesia, Philippines and Thailand. Tapai tastes
sweet yet slightly alcoholic, with a pleasant, fragrant aroma. Tapai which made of cooked
glutinous rice undergo alcoholic fermentation with the addition of starter culture known as ragi.
Nowadays, the awareness of Muslim consumers towards Halal products has increased
tremendously. The fact that tapai contained alcohol has create an issue of its Halalness since the
alcohol content of tapai is similar to the alcoholic beverages i.e beer. Beer contains
33

approximately 5% alcohol while tapai contains in the range of 2-5% alcohol (Merican & Quee-
Lan, 2004). However, many not know the alcoholic compound in tapai other than ethanol.
Due to its low toxicity effects, ethanol can be consumed by human. Ethanol is the main
constituent found in alcoholic beverages and other products that undergo fermentation. Besides
that, ethanol also can be found in non-food products such as mouthwash, cosmetic products and
medicine. Table 1 shows the toxicity of some alcoholic compounds obtained from Material
Safety Data Sheet (MSDS). In this project, fact about the alcoholic compounds found in tapai is
revealed.

Compounds Odour description Toxicology description

Ethanol

Sweet (Zeng et.al.,
2009)
Causes skin and eye irritation. Ingestion can
cause nausea, vomiting and inebriation.
1-propanol

Strong and pungent
smell and taste
(Nyknen et.al.,
1986).
Has been found to cause cancer in laboratory
animals. Skin, eye and respiratory irritant.
2-methyl-1-
propanol

Strong and pungent
smell and taste.
(Nyknen et.al.,
1986)
Causes irritation to respiratory tract. Effects
from overexposure include headache,
dizziness, muscle weakness, drowsiness, in
coordination, confusion, and coma.
3-methylbutanol

Strong and pungent
smell and taste.
(Nyknen et. al.,
1986)
Harmful if inhaled. May be harmful by
ingestion. Irritant.

Table 1 Toxicity description of selected alcoholic compounds

Material and method

Production of sample

Tapai samples were produced according to the Malaysian Agricultural Research
Development Institute (MARDI)s method. Starter culture used was obtained from MARDI.

Headspace extraction and chromatographic method

34

Three gram samples were transferred into a 20 ml headspace vial. The extraction of
alcoholic compounds in the samples was performed using a headspace autosampler G1888
(Agilent Technologies, Palo Alto, CA, USA). The extraction of alcoholic compounds in all
samples of fermented glutinous rice (tapai) was performed using a headspace autosampler
G1888 (Agilent Technologies, Palo Alto, CA, USA). Transfer line from the headspace sampler
was directly connected to the injector of the chromatograph. The oven was set for medium
shaking. The extraction conditions in the headspace autosampler were programmed as follows:
5.0 min for vial equilibration, 1.0 min for vial pressurization, 0.2 minutes for filling the injection
loop, 0.5 min for loop equilibration and 1.0 min for sample injection. Helium with purity of
99.999 % was used for vial pressurization and as carrier gas. The alcoholic compounds were
analyzed using GC (6890N) (Agilent Technologies, Palo Alto, CA, USA) equipped with flame
ionization detector (FID). A DB-624 (J & W Scientific, Folsom, USA) wide bore capillary
column was used (30 m x 0.32 mm i.d x 1.8 m) as stationary phase. The results from the
volatile analyses were provided in chromatographic peak area counts.

Results
Figure 1 Typical chromatogram of alcoholic compounds in tapai obtained by HS-GC-FID

Short chain alcohol (simple alcohol) Long chain alcohol (higher alcohol)
Ethanol 1-propanol
2-methyl-1-propanol
3-methylbutanol

Table 2 The alcoholic compounds in tapai after 3 days incubated at 30
0
C

35

Discussion

Ethanol

Ethanol can be found abundantly in tapai and was the main constituent contributed to the
aroma and alcoholic taste.

Higher alcohol

Higher alcohol is associated as secondary by-product of fermentation. Three types of
higher alcohol is successfully identified in tapai namely 1-propanol, 2-methyl-1-propanol and 3-
methylbutanol. The finding of 2-methyl-1-propanol and 3-methylbutanol in tapai is comparable
to Cronk, Mattick, Steinkraus and Hackler findings in 1979.

Conclusion

This research revealed fact about the alcoholic compounds that can be found in tapai
which fermented for 3 days. Besides ethanol, 1-propanol, 2-methyl-propanol and 3-
methylbutanol were also detected by the instrument. In addition, with the finding of this
research, it is hope that Muslims community will be aware of the food they consume, which will
cause no harm to them in the future.

Acknowledgement

Financial support from the Research Universiti Grant Scheme, Universiti Putra Malaysia
(UPM) is highly acknowledged (Grant No. 91018).

References

Cronk, T.C.; Mattick, L.R.; Steinkraus, K.H.; Hackler, L.R. Production of higher alcohols during
Indonesian tape ketan fermentation. Applied and Environmental Microbiology 1979, 37 (5), 892-
896.

Merican, Z.; Quee-Lan, Y. Tapai processing in Malaysia: A Technology in Transition. In
Industrialization of Indigenous Fermented Foods; K.H. Steinkraus, Ed.; Marcel Dekker, Inc:
New York, 2004, 1-24.

36

Nyknen, L. Formation and occurrence of flavour compounds in wine and distilled alcoholic
beverages. American Journal Enology Viticity 1986, 37 (1), 84-96.

Zeng, Z.; Zhang, H.; Zhang, T.; Tamogami, S.; Chen, J.Y. Analysis of flavour volatiles of
glutinous rice during cooking by combined gas chromatography-mass spectrometry with
modified headspace solid-phase microextraction method. Journal of Food Composition and
Analysis 2009, 22, 347-353.

37

A11

Fourier Transform Infrared (FTIR) Spectroscopy Differentiation of Lard and
Other Shortening in Puff Pastry
Wan Siti Farizan binti Mohamed Rani, Yaakob bin Che Man*, Amin Ismail and Puziah Hashim
Halal Products Research Institute, Putra Infoport, Universiti Putra Malaysia,
43400 UPM Serdang, Selangor, Malaysia

Abstract
Spectra differentiation using Fourier transform infrared (FTIR) spectroscopy had been done
individually on the three types of fats samples which contained the admixture of butter with lard
(BL) and margarine with lard (ML) through attenuated total reflectance (ATR) accessory. Total
fats that contain the admixtures were extracted from puff pastry prepared in laboratory by mixing
47g (wt/wt) of flour, 31.5g (wt/wt) of fat, 0.25g (wt/wt) of salt and 11.75g (wt/wt) of sugar prior
to analyze by FTIR spectroscopy. While the lard were weight in range of 12.587.5% with the
12.5% increment. Total baked puff pastries were 21 samples. Using the combination of
discriminant analysis (DA) and partial least square (PLS) the qualitative and quantitative of the
fat profile were examined by assumed that the whole range of fat concentration of butter and
margarine blended with lard was covered in this study at 1159 cm
-1
, 1115 cm
-1
and 1096

cm
-1
regions. Results showed the excellent binary mixture of BL and ML were achieved using PLS
coupled with DA can be used to detect as low as 0.5% content of lard.
Keywords: ATR, discriminant analysis, FTIR spectroscopy, lard, PLS, puff pastry

Introduction
Currently puff pastry has become well-known and contributes a large production scale among
the bakery products sold in the market. Traditional puff pastry are made of flour, fats, salt and
water with slightly changes in ingredients types, amount, mixing methods and shaping.
Commonly used fats like butter and margarine contribute to tenderness or shortness in pastry.
The fat content of pastry can range from 25% to almost 75% of the dough. Therefore, fats play a
very important role in puff pastry. Pure fats, such as lard, hydrogenated shortening and oils
38

exhibit different characteristics in pastry products than do butter and margarine which consist
16% water (Al-Jowder et al., 2002; Andrews et al., 2003).
However, adulteration of puff pastry with lard created problems for Muslim and Jewish
customers. A study conducted by Syahariza et al. (2005) for detection of lard adulteration in
cake formulation by Fourier transfrom infrared (FTIR) spectroscopy used the method of lard
mixture with commercial shortening at different percentage. A one major drawback of this
approach is that it does not have explain the reason of using hydrogenated soybean and cotton
seed oils as commercial shortening in the study. As different types of fats presented different
characteristics of final products.
FTIR spectroscopy had been used as the potential instrument for classification of lipid
functional groups. IR spectrum provides wealth of information about the sample compositions
beside the beneficial element of FTIR spectroscopy that is rapid, involve not much sample
preparation and easy to handle. This study describes comparative investigation of pure lard,
butter, margarine as well as binary mixture of butter with lard (BL) and margarine with lard
(ML) in puff pastry preparation through spectra analysis.

Commercial butter and pastry margarine were obtained from local retail outlets. The rendering
process of pure lard had been done in the laboratory. Lard was blended with butter and
margarine at range of 12.5 100.0% (wt/wt) in increments of 12.5%. In total, 8 mixtures of lard
with butter and 8 mixtures of with margarine were prepared. Each sample was collected in
triplicate. All chemicals and solvents used were analytical grade.

Binary mixture of butter BL (top) and ML (bottom) are shown in Figure 1 at spectral regions of
1300 900 cm
-1
contain most valuable information related to fats variation and overall
intensities. Chemometric data analysis of PLS and discriminant analysis (DA) was used.
Using the major feature at about 1159 cm
-1
a small two bands appeared at 1115 cm
-1
and
1096 cm
-1
. The best results were achieved using 8 partial least square (PLS) factors with a good
linear relationship in the actual and predicted value of BL and ML with coefficient of
determination, R
2
of 0.981 (BL) and 0.938 (ML) achieved (Figure 2). In both cases, a trend with
39

increasing lard will increase the spectra absorbance. Using this approach, 99% of all pure fats
correctly identified with the specific lard adulterants, detection limits of 0.5% (wt/wt),
respectively, were estimated.
Further analyses were performed using DA showed in Figure 3. Using the information
contained in FTIR spectroscopy it is possible to discriminate clearly between genuine and spiked
puff pastry with lard at 12.5 to 87.5%. The results of discrimination indicate that the techniques
can be used in quantifying the adulteration (Baeten and Aparicio, 2000).

Conclusion
Differentiation of lard with other shortening can be performed with FTIR spectroscopy in
combination with powerful chemometric at frequency of 1159 cm
-1
, 1115cm
-1
and 1096 cm
-1
,
respectively. Partial least square (PLS) and discriminant analysis (DA) allows a quantification
and classification of lard in puff pastry.

A
b
s
o
r
b
a
n
c
e

950 1000 1050 1100 1150 1200 1250 1300
100% lard
87.5% lard
75% lard
62.5% lard
50% lard
37.5% lard
25% lard
12.5% lard
Butter
Wavenumbers (cm-1)
40

Figure 1 Infrared spectrum of butter with lard (above) and margarine with lard (below) in
regions of 1300 900 cm
-1

A
b
s
o
r
b
a
n
c
e

950 1000 1050 1100 1200 1250 1300
Wavenumbers (cm-1)
100% lard
87.5% lard
75% lard
62.5% lard
50% lard
37.5% lard
25% lard
12.5% lard

Margarine
1150
41

Figure 2 Partial least squares (PLS) cross-validation results (actual versus predicted lard content)
for mixtures of lard in butter and margarine.

Figure 3 Discrimination between authentic and adulterated puff pastries.

References
42

Al-Jowder, O., Kemsley, E. K., and Wilson, R. H. Detection Of Adulteration In Cooked Meat
Products By Mid-Infrared Spectroscopy. Journal of Agricultural and Food Chemistry, 2002, 50,
1325-1329.

Andrews, S. L., Harte, J. B., & Benjamin, C. Pastry products: Ingredient Functionality And
Dough Characteristics. Oxford: Academic Press. Encyclopedia of Food Sciences and Nutrition,
2003; pp. 4412-4415.

Baeten, V. and Aparicio, R. Edible Oils And Fats Authentication By Fourier Transform Raman
Spectrometry. Biotechnol. Agron. Soc. Environ, 2002, 4, 196-203.

Syahariza, Z. A., Man, Y.B.C., Selamat, J. and Bakar, J. Detection Of Lard Adulteration In Cake
Formulation By Fourier Transform Infrared (FTIR) Spectroscopy. Food Chemistry, 2005, 92,
365-371.

43

A12

Identifying of Fats of Halal and Non Halal Animals Using a Geometric
Method
Adeeb Hayyan
1&2*
, Mohamed E. S. Mirghani
1&2
, Hamzah M. Salleh
1&2
, Abdul Razak A.
Al-Saadi
3
, Maan Hayyan
4
, Mohammed A. Al-Saadi
1

1
Bioenvironmental Engineering Research Unit (BERU),
Department of Biotechnology Engineering, Kulliyyah of Engineering,
2
Halal Industry Research Centre, IIUM, Malaysia
3
Department of Arabic Language and Literatures, Kulliyyah of IRKHS,
International Islamic University Malaysia (IIUM), P.O. BOX 10, Kuala Lumpur, 50728,
Malaysia
4
Department of Chemical Engineering, Faculty of Engineering, University of Malaya,
Kuala Lumpur, 50603, Malaysia
*corresponding author email: adeeb.hayyan@gmail.com

Abstract
Providing new methods to analyze, identify and authenticate halal and non halal foods is crucial
because halal food is obligatory for Muslims. This study was carried out using simple and rapid
method to identify fats of halal and non halal animal and to gain new knowledge about fatty
acids compositions for edible oils and fats. Different types of fats had been presented via plotting
chains numbers of fatty acids against present fatty acid composition of each type of animal fat. A
comparison among different animal fats (tallow, mutton, Arabian camel, whale blubber, chicken
and lard) was carried out. Significant representative images were shown to different types of
animal fats used in this study, which could be used for authentication of pure type of animal fats.
The results of this study provide a new library to authenticate halal and non halal fats.

Keywords: Animal fats, Fatty acid compositions, Halal, Geometric method

44

1. Introduction

It is estimated that 70% of Muslims worldwide follow halal food standards (Dorothy Minkus-
McKenna, 2007). The increasing global halal market needs advanced processes, technologies
and rapid methods for authentication and analyzing food products. Oils and fats are widely used
mainly for food cooking and frying. Quality assessment and the need for authentication are
increasingly important features of the food and especially for oils and fats which are always a
potential source of adulteration (Michael, 2002). There are many reasons to scientifically
authenticate commercial oils and fats including suitability for certain applications and for
religious dietary reasons especially for Muslims because halal food is obligatory for Muslims.
Many tests have been used to authenticate, identify and analyze oils and fats based on physical
properties such as refractive index, viscosity or melting point of the fat, the fatty acids or the
salts of the fatty acids (Michael, 2002). In addition, there were also many chemical tests such as
Reichert, Polenske, iodine, saponification and acetyl values: these tests gave information as to
the composition of the fat, fatty acid composition, as well as other non-glyceride components of
the fat. The American Oil Chemists' Society methods for fatty acids are now one of the most
frequently used methods in the analysis of fats (AOCS, 1990; Michael, 2002). Modern methods
of authentication began with the development of chromatography. The first practical use of gas
chromatography (GC) for any purpose was to separate the methyl esters of (short chain) fatty
acids (James and Martin, 1952). Nowadays the methods used to authenticate fats and oils
component is GC or high performance liquid chromatography (HPLC) because results are
obtainable with ease and within a short time. Recently Fourier transform infrared (FTIR)
spectroscopy has also been used as specific and rapid analytical technique to identify chemical
compounds and functional groups of oils and fats (Jaswir et al., 2003). The best approach in
checking the authenticity of oils and fats is by carrying out a series of analyses and comparing
the results. The objective of this investigation is to gain new knowledge about fatty acids
compositions of halal and non halal animal fats by comparing data of halal and non halal fats
from selected animals.

45

2. Materials and Method

Data for six types of animal fats (tallow, mutton, Arabian camel, whale blubber, chicken and
lard) were retrieved from published works and represented via plotting fatty acids composition
versus weight percent of each fatty acid in animal fat.

3. Results and Discussion

2.1 Comparison of different types of animal fats using geometric method

The hypothesis of geometric method for identification is based on the notion that Allah (the God)
creates everything with different properties and compositions. This includes fats and oils.
Chemically, fats and oils are triacylglycerols (TAG), triesters of glycerol with three long-chain
carboxylic acids (McMurry and Simanek, 2007). Data from six different types of fats - tallow,
mutton, camel, whale blubber, chicken and lard - have been selected for comparison in this
study. Beef tallow fat showed notable fatty acids including 47% oleic acid, 26% Palmitic acid
and 14% stearic acid as shown in Fig. 1 (National Research Council, 1979; Ma and Hana, 1999;
Gerpen, 2004).

Fig. 1: Fatty acids composition versus weight percent of tallow.

In the case of mutton fat, the highest fatty acid found was oleic acid (31.27%), whereas palmitic
acid and stearic acid were present in almost similar amount, 28.1% and 27.1%, respectively
0
5
10
15
20
25
30
35
40
45
50
C14 C16 C16-1 C18 C18-1 C18-2 C18-3
Fatty acids composition
W
e
i
g
h
t
%
46

(Bhatti et al., 2008; Semma, 2004). Other notable common fatty acid found in mutton fat includes
lauric acid and linoleic acid, 4.38% and 1.6%, respectively (Fig. 2).

Fig. 2: Fatty acids composition versus weight percent of mutton fat.
The data of fatty acid composition in chicken fat and its percentage weight was obtained from
the study by (Bhatti et al. 2008; Semma, 2004). Figure 3 shows that the highest fatty acid in
chicken fat was oleic acid (45.18%), followed by palmitic acid, linoleic acid and palmitoleic acid
at 24.65%, 12.58% and 7%, respectively.

Fig. 3: Fatty acids composition versus weight percent of chicken fat.

0
5
10
15
20
25
30
35
40
45
50
C8 C10 C12 C13 C14 C14-1 C16 C16-1 C17 C18 C18-1 C18-2 C18-3 C20 C20-1 C22
W
e
i
g
h
t
%
0
5
10
15
20
25
30
35
40
45
50
C8 C10 C12 C13 C14 C14-1 C16 C16-1 C17 C18 C18-1 C18-2 C18-3 C20 C20-1
W
e
i
g
h
t
%
47

Whale blubber is a common marine animal fat. The data of fatty acid composition of whale
blubber and its percentage weight reveals that oleic acid (35%) is the highest fatty acid found in
this species as presented in Fig. 4 (McMurry and Simanek, 2007, Dahl, 2000).

Fig. 4: Fatty acids composition verses weight percent of whale blubber

Fig. 4: Fatty acids composition against weight percent of whale blubber
Figure 5 shows the data for lard (McMurry and Simanek, 2007, Ma and Hana, 1999; Gerpen,
2004). The fatty acids found in lard were oleic acid (50%), palmitic acid (25%) and stearic acid
(15%).

Fig. 5: Fatty acids composition versus weight percent of lard.

A study on Arabian camel (Camelus dromedarius) aimed to quantify the amount of fatty acids in
the hump and abdomen fats of three different age groups of camels was conducted by Kadim et
al., (2002). The study reported that the saturated fatty acids in the hump fats accounted for 58.3,
0
5
10
15
20
25
30
35
40
45
50
55
60
C14 C16 C18 C18-1 C18-2 C18-3
W
e
i
g
h
t
%
0
5
10
15
20
25
30
35
40
45
50
C14 C16 C18 C18-1 C18-2
W
e
i
g
h
t
%
48

67.6, and 63.0% of the total fatty acids for age (<1 year old), (13 years old) and (>3 years old),
respectively. Palmitic acid (C16:0) was the major fatty acid in camels hump fat with 32.06%,
32.90% and 34.37%, followed by oleic acid (C18:1) at 33.65%, 21.66% and 28.91% and stearic
acid (C18:0) at 18.85%, 24.13 and 20.74% for age (<1 year old), (13 years old) and (>3 years
old), respectively. The study concludes that fatty acid composition of the hump and abdomen
depot fats of Arabian camel in different ages had similar fatty acid patterns with more saturated
than unsaturated fatty acids. Figure 7 illustrates the range of fatty acid composition of lard using
geometric method to report the range of non halal fat. The range of fatty acid composition of lard
has been reported by Gerben, et al. (2004).

Fig. 6: Fatty acids composition versus weight percent of Arabian camel.

Fig.7: Range of fatty acids composition of lard (Non Halal fat)

0
5
10
15
20
25
30
35
40
45
50
C14 C14-1 C15 C15-1 C16 C16-1 C17 C18 C18-1 C18-2 C19 C20
W
e
i
g
h
t
%
0
10
20
30
40
50
60
C14 C16 C18 C18-1 C18-2 C18-3
W
e
i
g
h
t
%
49

3.2 Islamic Shariah concepts of Halal Animals
HALAL is an Islamic legal term meaning permissible as Ibn qusim mentioned in Matn Al
Ghayeh wal taqreeb, which is one of the five Sharia provisions (Wajeb, Mandob, Mobah,
makroh, Haram) translated as: must, desirable or preferable, permitted, reprehensive and
prohibited. Halal or mobah (permissible) according to the Sharia terminology is that not be
prohibited nor is ordered to do so by the almighty Allah. While the Halal term that used in the
trade marks means that this material does not contain any prohibited thing according to Muslim
belief But this material could be (wajeb) like the water for Wodhoo, or desirable like dates for
Iftar. Regarding the animals, and according to Sharia there are animals permitted to be eaten and
others are prohibited. In Holy Quran the permitted are three groups. The firs group includes
sheeps, goats, camels and cows called (Anaam). The second Halal group includes the suitable
birds among the Arabs not the birds of prey these two groups are permitted to be eaten after
legal slaughter see Quran Surah AlAnaam (118,142-146) and surah AlHajj (28). The third Halal
group is the aquacultures unless it causes certain hazard to human life. All the parts of Halal
animal such as meat, fat, boan, skin and hair are Halal. The died animals without legal slaughter
are non Halal, but it is prohibited and it considered as dirtiness (Najasah) with all its parts (Matn
Al Khodari). The non Halal animals are not allowed to be used in applications that of direct
contact with human body such as food or medication, but can be used in other application for
example fertilizer, biodiesel fuel, lubricant or machine greases.

3. Conclusion
Geometric method is an authenticating method that can give a rapid result of source of fats based
on weight percentage of fatty acids composition from data that gas chromatography provides.
The results of this study provide a new library to authenticate halal and non halal of animal fats.
The information of this library will be as images of representation graphs of all common animal
fats. The results of this study found that oleic acid is the highest fatty acid in animal fats and the
composition of others fats was different in the composition and its percentage. Geometric
method can be used for authenticate unknown sources of fats and can be identify the fat even if
mixed with cheap types of fats or non halal fats by referring to the library of geometric method in
case the fat was not in the range of any halal animal means this fat extra tests for identification
the source of this fat. A comparison among different animal fats (tallow, mutton, Arabian camel,
50

whale blubber, chicken and lard) was carried out. This study provides a preliminary results and
investigation which can lead to potential library to authenticate halal and non halal fats.
Significant representative images of different types of animal fats approve that geometric method
can be use to identifying of fats of halal and non halal animals. In addition geometric method can
be used in order to read the data which obtained from GC in faster time to help to provide
knowledge about fatty acid composition of fats.

Acknowledgments
The authors would like to thank Halal Industry Research Centre and the Department of
Biotechnology Engineering, International Islamic University Malaysia (IIUM) for providing the
facilities to undertake this research.
References

Al Khodari, M.; Usual Alfiqh; Riyadh modern library, Saudi Arabia. P 54.
Bhatti, H. N.; Hanif, M. A.; Qasim, M., Ata-ur-Rehman, Biodiesel Production from waste tallow. Fuel.
2008, 87, pp 2961-2966.
Dahl, T. M.; Lydersen, C.; Kovacs, K. M.; Falk-Petersen S.; Sargent, J.; Gjertz, I.; Gulliksen, B.
Fatty acid composition of the blubber in white whales (Delphinapterus leucas). Journal of
polar biology. 2000, 23, pp 401-409.
Gerpen, J. V; Shanks, B.; Pruszko, R.; Clements, D.; Knothe, G. Biodiesel analytical methods; NREL/SR,
Colorado, 2004; pp 1-12.
James, A. T.; Martin, A. J. P. Gas-liquid partition chromatography: the separation and microestimation of
volatile fatty acids from formic acid to dodecanoic acid. Biochem. J.1952, 50, pp 679690.
Jaswir, I.; Mirghani, M. E. S.; Haji Hassan, T.; Said, M., Z., M. Determination of Lard in Mixture of
Body Fats of Mutton and Cow by Fourier Transform Infrared Spectroscopy. Journal of Oleo
Science. 2003, 52, pp 633-638.
Kadim, I. T.; Mahgoub, O.; Al-Maqbaly, R. S.; Annamalai, K.; Al-Ajmi, D. S. Effects of age on fatty acid
composition of the hump and abdomen depot fats of the Arabian camel (Camelus dromedarius).
Meat Science. 2002, 62, pp 245-251.
Ma, F.; Hanna, M.A. Biodiesel production: a review. Biores. Technol. 1999, 70, pp 115.
Matn Al Ghayeh wal taqreeb with Ibn qusim explanation and Bajuori Hashiah, Dar Ehyaa Arbic books.
Indonesia, vol.2 page 283.
McMurry, J.; Simanek, E. Fundamentals of Organic Chemistry; Thomson Brooks/Cole, Belmont, 2007;
pp 510-516.
51

Michael, J.; Oils and Fats Authentication; CRC: Boca Raton, FL, 2002; pp 1-24.
National Research Council; Fat Content and Composition of Animal Products, Printing and Publishing
Office, National Academy of Science, Washington, D.C., 1976; p. 203.
Semma, M. Trans Fatty Acids: Properties, Benefits and Risks. Journal of Health Science. 2002, 48
(1), pp 7-13.

52

A14

Profiling of Mono- and Diglyceride from Edible Fats by
GCGC-TOF-MS for Halal Authentication
Indrasti, D., Chin, S.T., Che Man, Y.B.*, Shuhaimi, M., Dzulkifly, M.H.
Halal Products Research Institute, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
Email: yaakobcm@gmail.com

Abstract
Production practice of mono- and diglycerides (MG-DG) compound, as emulsifying
agent, involves interesterification of glycerines with triglycerides (TG) derived from plant or
animal or through enzymatic process. Analysis of MG-DG mixtures using GCGC technique
coupled to time-of-flight mass spectrometry (TOF-MS) of three different oils of lard (LA), palm
(PA) and butter (BU) remains a challenging prospect for tracking the TG source in the study of
Halal authentication. The results show that PA and LA have similar compositions in terms of
concentrations of MG-DG contents. However, compared to PA, LA contains much more of MG
C18. BU is discriminated on its content of MG C10, MG C14, DG 1,3-C14, and DG 1,3-C16.

Keywords: monoglycerides, diglycerides, comprehensive two-dimensional GC, GCGC, TOF-MS

Introduction
Monoglycerides (MG) and diglycerides (DG) are commonly used as emulsifiers for
products stabilization since last decades. Presently, production of MG and DG compounds
involves interesterification of glycerines with triglycerides (TG) obtained from plants or animals
in the presence of inorganic alkali as catalyst [1]; or through enzymatic glycerolysis [2]. Source
of TG and enzymes used to produce MG-DG become of concern to Muslim consumers regarding
to Halal compliance.
Analysis of MG-DG mixtures using GCGC technique coupled to time-of-flight mass
spectrometry (TOF-MS) remains a challenging prospect for tracking the TG source in the study
of Halal authentication. This approach was demonstrated in this work to rapidly unravel the
53

composition of MG-DG in the glycerolysis products from 3 different TG origins, which are oils
of lard (LA), butter (BU) and palm (PA).

A 35g of oil sample was blended with 15g glycerine and 0.2g NaOH then heat at 250C
under a vigorous mixing condition for 60 minutes. For sample purification, the SPE-diol
cartridge conditioned with 4ml hexane and then 500L sample (50mg/ml hexane) was loaded
onto it. 6ml mixture of hexane, dichloromethane and diethyl ether (78: 20: 2) was added
followed by 4ml mixture of chloroform and methanol (1:1). The last eluted fraction was dried
prior to dissolution in 200L pyridine and trimethyl-silyl (TMS) derivatization with 200L
Sylon reagent. The 0.1L TMS-derivatized sample was then injected into the GCGC-TOF-MS
system, with configuration as follow (Table 1).

Table 1. GCGC TOF-MS system configuration
Configuration Parameter
Injection setting 350C, split ratio 100:1, 0.5 ml/min constant flow rate
1
st
dimension DB17ht (6m x 0.10mm i.d x 0.10m df)
120C (1 min)- 220C (50C/min)- 290C (10C/min)- 320C
(5C/min,1 min).
2
nd
dimension SLB-5ms (60cm x 0.10mm i.d x 0.10m df)
135C (1 min)- 235C (50C/min)- 315C (10C/min)- 335C
(5C/min,1 min).
Modulation offset 55C, 2s period/ 0.5s hot pulse, transfer line 350C.
MS setting 120s acquisition delay, EI at 230
o
C, 1700V detector voltage
mass scan from 35 to 800 amu

Entire separation of MG-DG groups was obtained using the fast GCGC-TOF-MS
approach, thus figuring an evenly allocation of complex mixture compounds along the contour
plots under the non-orthogonal systems. TMS components were classified orderly by shifting the
modulation offset accordingly with different carbon chain length and level of unsaturated bonds.
The MG groups were eluted separately earlier than the DG groups; both were eluted gentle
according to the number of carbon atoms in the fatty acids component and number of double
bonds. MG clusters left the column before 500s and DG came up after 600s (Figure 1).
Generally, there were three cluster groups representing even-carbon C14-C18 in the DG profile.
54

Within each group, they were further divided in to sub-groups based on the positional
distribution of the fatty acid chains. The 1,2-isomer of DG was eluted just ahead of the
corresponding 1,3-isomers. In non-orthogonal columns set separation in the first dimension
depends on volatility and polarity. Compounds with short carbon chain were having higher
volatility level than those compounds with long carbon chain.
LA and PA contain relatively complete MG, from C11 to C18 as well as DG (Table 2).
MG 3-C16 and MG C18 compounds were found to be present in abundance in all tested samples.
There were a few other components where the level were noticeably high of certain specific
species, and they were namely, DG C18:1t in LA; DG 1,3-C16 in BU; DG 1,3-C18 and DG
C18:1t in PA.
Using a combination of non-orthogonal column set, DG with C18 fatty acid does not
come out in BU. Fagan et al [3] demonstrated the presence of C18 in DG structure from butterfat
samples using BD 17ht column. The same result was found by Bareth et al. [4] using BD5
column. The existence of MG C10 and DG 1,3-C14 are not found in all species tested except
BU. Hexadecanoic acid (C16) is the fatty acid attached in the MG and DG structure in LA and
PA, which is present in a significant amount. MG with palmitin in the third position of
acylglycerol backbone appeared to have the highest concentration in comparison to others.
Similar configuration of fatty acids in MG-DG structure of LA and PA could present the
possibility of them substituting each other.

Conclusion
A simple and rapid GCGC-TOF-MS method involving non-orthogonal columns
combination developed in this work has shown the ability to determine mono- and diglycerides
profile within 20min. This approach can be used as a basic data for quality monitoring including
detection of lard adulteration in food, cosmetics, pharmaceuticals, and other products to fulfill
the Halal requirement.

Acknowledgement
The authors acknowledge The Ministry of Science, Technology, and Innovation Malaysia for
providing the research grant (Science Fund 05-01-04-SF0285).

55

Figure 1. Contour plot of MG-DG distribution in samples

Table 2. Concentration of MG-DG in samples *
Analyte
Concentration
LA BU PA
Monodecanoyl-sn-glycerol MG C10 nd 0.88 (0.31) nd
Monoundecanoyl-sn-
glycerol
MG C11 nd 0.53
a
(0.04) 0.06
b
(0.08)
Monododecnoyl-sn-
glycerol
MG C12 0.23
b
(0.31) 0.88
a
(0.45) 0.04
b
(0.06)
Monotetradecanoyl-sn-
glycerol
MG C14 0.09
b
(0.03) 6.03
a
(0.83) 0.04
b
(0.02)
2-monopalmitoyl-sn-
glycerol
MG 2-C16 0.56
a
(0.07) 0.45
a
(0.63) 0.22
a
(0.30)
3-monopalmitoyl-sn-
glycerol
MG 3-C16 12.04
b
(0.77) 16.94
a
(0.69) 11.99
b
(0.44)
Monostearoyl-sn-glycerol MG C18 12.00
a
(6.69) 7.08
ab
(1.51) 0.36
b
(0.04)
1,3-ditetradecanoyl-sn-
glycerol
DG 1,3-C14 nd 1.41 (0.76) nd
1,2-dipalmitoyl-sn-glycerol DG 1,2-C16 0.32
b
(0.38) 5.78
a
(1.28) 0.61
b
(0.86)
1,3-dipalmitoyl-glycerol DG 1,3-C16 1.08
b
(0.66) 10.34
a
(0.70) 1.77
b
(2.50)
1,3-distearoyl-glycerol DG 1,3-C18 1.59
b
(0.62) nd 4.26
a
(0.23)
Dioleoyl-glycerol DG C18:1 1.58
b
(0.05) nd 0.70
c
(0.01)
1,3-dielaidin DG C18:1t 3.25
ab
(1.56) nd 3.86
ab
(3.55)
1,3-dilinoleol-rac-glycerol DG C18:2c 0.30
b
(0.05) nd 0.02
b
(0.02)
PA
LA
BU
56

nd means not detected
abcd
means significant varies among the species (p<0.05 under Duncan test).
* The average value for six replicate analyses of single lipid extracts. Standard deviation values
are shown in parenthesis.

References

1. Sonntag, N.O.V. Glycerolysis of Fats and Methyl Esters-status, Review and Critique. J. Am.
Oil Chem. Soc. 1982, 59, pp 795A-802A.
2. Lee, G.C.; Wang, D.L.; Ho, Y.F.; Shaw, J.F. Lipase-catalyzed Alcoholysis of Triglycerides
for Short-chain Monoglycerides Production. J. Am. Oil Chem. Soc. 2004, 81, pp 533-536.
3. Fagan, P.; Wijasundera, C.; Watkins, P. Determination of Mono- and Diglycerides in Milk
Lipids. J. Chromatogr. A. 2004, 1054, pp 251-259.
4. Bareth, A.; Strohmar, W.; Kitzelmann, E. Gas Chromatographic Determination of Mono- and
Diglycerides in Milk and Milk Poducts. Eur. Food Res. Technol. 2003, 216, pp 365-368.

57

A15

Microbiological Analysis in Halal Foods

Noor Shaeda, I
*
, Raja Arief Deli, R.N., Faridatul Akmar, M.N

Food & Agriculture Analysis Program, Technical Services Centre, MARDI. 43400 Serdang,
Selangor, Malaysia
*
Corresponding author email: shaeda@mardi.my

Abstract
The Malaysian Standard MS 1500: 2004 stated that food permitted under the Syariah law should
be safe and not harmful and the foods are prepared, processed, packaged, transport and stored
using appliances and facilities that are free from anything unlawful according to Islamic law.
From the microbiological perspective, the presence in high numbers of microorganisms in foods
would suggest that the food has been contaminated whilst the presence of bacteria like E.coli and
Faecal coliforms indicates that there is a possibility that the food has been contaminated with the
discharge (feces) from human or animals. The detection of these microorganisms and other
pathogens can be considered as an index for sanitary, food safety and overall food quality, a
requirement in MS 1500:2004. The Food Microbiological Analysis Laboratory, Technical
Services Centre, MARDI provides services in microbiological analysis tailored to comply with
the MS 1500:2004 requirements. A list of microbiological analysis which include the sanitary,
hygiene, pathogens and other food safety analysis are offered. The laboratory is equipped with
the state-of-art equipment and competent staff to provide microbiological testing of food
samples. The laboratory is MS ISO/IEC 17025 accredited (from the Department of Standard
Malaysia) since year 2001.
Keywords: halal foods, food safety, microbiological analysis, feces contamination,
laboratory services

1. Introduction
The promotion of halal foods globally has created a greater demand from consumers and food
exporters for safer and cleaner foods. Hygiene and sanitation are the main factors involved when
talking about food safety. Thus, emphasizes given to elements of food safety such as proper
58

handling, processing, packaging and storage of halal foods are essential. The HACCP concept
has been applied widely and it also covers microbiological hazards. The combination of HACCP
and halal food productions ensure the foods sold in market is not only safe but free from any
unlawful traces. The Malaysian Standard MS 1500:2004 stated that halal foods shall free from
harmful and anything unlawful according to Islamic law. The standard also prescribes that the
halal foods shall be free from najs or discharge (feces).
Enterobacteriaceae has been used in Europe as indicators of food quality while in the
United States, coliforms is used as indicators of insanitation in food processing environments
(Kornacki & Johnson 2001). A study by Brodsky et al (1982) concludes that Escherichia coli can
also be used as a marker for the potential presence of other intestinal pathogens. Thus, the
suitable indicator for food hygiene and food safety of halal foods and its processing in the
microbial perspective are Coliforms, Faecal coliforms and E.coli.
Food Microbiological Analysis Laboratory, MARDI is one of the ISO/IEC 17025
accredited laboratory which provide microbiological analysis for foods and the services are
tailored to the clients individual needs with experts, prompt and cost effective laboratory
analysis. Food testing capabilities include but are not limited to Total Plate Count, Yeast &
Mould Count, E.coli, Coliforms, Faecal coliforms, Salmonella, Staphylococcus aureus, Bacillus
cereus, Howard Mould Count, Water activity, Incubation test and Commercial sterility test.
Since its services from year 1997 to date, there were foods analyzed to be contaminated with
Coliforms, Faecal coliforms and E.coli. Amongst the foods are fruit salads, herbs and spices,
fruit juices, milk and flour.

2. Materials and Methods
There are a variety of methods that can be use for the detection of microorganisms. Clients have
a choice of either a rapid or conventional methods. Currently, the laboratory offers both rapid
and conventional methods for the detection of Coliforms, Faecal coliforms and E.coli to check
for food quality. The methods used in the laboratory are validated and verified before use. The
selection of method is based on intended use, to meet clients requirements and availability of
laboratory resources such as equipment, personnel and environment. The schematic presentation
of the methods used by the laboratory for the detection of Coliforms, Faecal coliforms and E.coli
are shown in Figure 1.
59

Conventional Rapid
(MPN method) (Petrifilm method)

Homogenize and dilute sample Lift top film

Lauryl tryptose broth (3-MPN Dispense 1 ml sample onto center
or 5-MPN) of the film
(371
0
C / 24-48 h)

Coliforms E.coli Roll top film onto the sample
Gas positive Gas positive
tubes tubes

EMB agar EC broth & Gently pressed spreader center
371
0
C/24h Tryptone water to distribute sample evenly
44-44.5
0
C/
Typical 24 & 48h
colonies Indole test Gel is formed

MPN table EMB agar Incubate at 32 1
0
C for 24 2h
371
0
C/24h
Typical colonies
Typical colonies

MPN table

Figure 1 Flow diagram of conventional method (Craven et al 1997) & rapid method (3M
Microbiology 2004) for the detection of Coliforms & E.coli

60

3. Discussions
The varieties of methods offered by the laboratory give clients an option to choose based on their
needs and satisfactions. Beside expectations on quality and of halal foods, the analysis also
provides other benefits which include meeting exporting countries regulatory requirements,
penetrating wider market, to remain competitive in the market and as adding value to food
products.

4. Conclusions
The microbiological testing for halal foods is carried out not only to conform to the Malaysian
Standard MS 1500:2004 requirements but also to assess the effectiveness of control in every step
in the food processing in the production, preparation, handling and storage. The testing would
increase the consumers confidence towards halal foods because the foods are not only
wholesome but safe and halal.

5. References
3M Microbiology Manual. United States. 2004

Brodsky, M.H.; Boleszczuk, P.; Entis, P.; Effect of stress and resuscitation on recovery of
indicator bacteria from foods using Hydrophobic Grid -Membrane Filtration. J. Food Protein.
45:1326

Craven, H.; Eyles, M.J.; Davey, J.A. Enteric Indicator Organisms in Food In Foodborne
Microorganisms of Public Health Significance. 5
th
Edition. AIFST. 1997. pp 139

Kornacki, J.L ; Johnson, J.L. Enterobacteriaceae, Coliforms and Escherichia coli as Quality and
Safety Indicators In Compendium of Methods for the Microbiological Examination of Foods. 4
th

Edition. APHA. 2001. pp 69

Malaysian Standard MS 1500. General Guidelines on the Production, Preparation, Handling and
Storage of Halal Foods. 2004
61

A21

Determination of Halal Limits for Alcohol Content in Foods by simulated
fermentation
Wan Nadiah W. A.
1
*, Anis Najiha A.
2
, Tajul A. Y.
2
and Norziah M.H.
2
1
Bioprocess Technology Division,
2
Food Technology Division, ,
School of Industrial Technology, Universiti Sains Malaysia, Penang, Malaysia
*
Corresponding author email: wnadiah@usm.my

Abstract
The Halal food market holds the promise of rapid and sustained growth from its present USD 2.1
trillion industry. However, inconsistencies in standards for the certification of Halal products
have proven to be a setback in the development of the global market for halal foods. One such
example is the level of alcohol permitted for halal certification of foods by various Muslim
countries. Most halal certifying bodies accept small amounts of inherent alcohol, generally less
than 0.1% and sometimes up to 0.5%. The Islamic Food and Nutrition Council of America
(IFANCA) accepts a level of 0.1%; Majlis Ulama Indonesia, 1%; and Thailand, not exceeding
1.5% in end products by natural fermentations. On the other hand, JAKIM Malaysia does not
state a permissible level whilst the Brunei Standards for Halal Foods does not even allow the use
of alcohol-based carriers. This study seeks to identify the permissible limits of alcohol in foods
and drinks based on a simulated fermentation of Nabidh, a grape or date juice as was found in
the tradition (Hadith) of the Prophet Muhammad (pbuh). Preliminary results suggested that
0.78% alcohol might still be permissible for halal certification of foods and drinks.
Keywords: Halal, Nabidh, Alcohol standards, Permissible levels,

1. Introduction
Alcoholic drinks or beverages are totally prohibited in Islam, and even a small amount of
the drink added into foods or drinks will render the products haram (Riaz, 1997). However, trace
amounts of ethanol (naturally present or ethanol used in food processing) is allowed if the
amount is insufficient to cause intoxication. Permissibility of ethanol is based on the concept of
Al Istihlak (assimilation or consumption), that is, if a small amount of a prohibited substance
62

mixed with a dominant permissible substance and the prohibited substance loses all its attributes
such as taste, colour and smell, this substance loses the qualifications of being impure (INFAD,
2004).
Generally, 0.5% residual ethanol is acceptable in food ingredients (Riaz and Chaudry,
2004), but the acceptable limit for food products differs for various countries and organisations.
Most halal certifying bodies accept small amounts of inherent alcohol, generally less than 0.1%
and sometimes up to 0.5%. The Islamic Food and Nutrition Council of America (IFANCA)
accepts a level of 0.1% (Riaz & Chaudry, 2004); Majlis Ulama Indonesia, 1% (Anon, 2009); and
Thailand, not exceeding 1.5% in end products by natural fermentations (Halal Science Center,
2009). On the other hand, JAKIM Malaysia does not state a permissible level (Anon, 2009a)
whilst the Brunei Standards for Halal Foods (The Religious Council Negara Brunei Darussalam,
2007) does not even allow the use of alcohol-based carriers. These inconsistent limits of ethanol
for halal certification of food products however have proven to be one of the issues that could
affect the growth of global halal market. This prompts the need to establish a standard global
limit applicable to all countries and halal certifying bodies. Thus the objective of this study was
to use a scientific approach to identify the permissible level, based on a hadith (sayings of the
Prophet, peace be upon him) that allowed nabidh (drink traditionally made from fruits such as
raisins, grapes or dates) (Wikipedia, 2009) to be consumed within three days of preparation. This
paper reports on a preliminary study carried out by simulating the natural fermentation of nabidh
and the monitoring the concentration of ethanol produced throughout 5-day storage.

2. Materials and Method
Eight samples from a variety of grapes, dates and raisins were randomly selected and
purchased from the local supermarket for screening purpose. Dried samples consisted of two
varieties of dates (China and Egyptian) and raisins (golden and black raisins) while fresh samples
consisted of four varieties of grapes (red seedless grape, Crimson grape, black seedless grape and
Sugarone grape respectively). Samples with seeds were pitted, crushed and blended with distilled
water in a ratio of 1:2 (w/w sample to water) to form a suspension. The suspension was filtered
through a piece of Muslin cloth, aliquoted (200 mL) into 250 mL plastic bottles (duplicates),
capped and incubated as nabidh at 30 C.
63

The nabidh were analyzed for reducing sugar content and ethanol concentration. All
analyses were done in duplicates. The reducing sugar content in the nabidh was analyzed using
the DNS method (Miller, 1959) with the absorbance measured using a spectrophotometer
(Thermo Spectronic Genesis IDUV). Ethanol concentration was determined according to the
method 984.14 (AOAC, 1990) for ethanol analysis in beer using gas chromatography. Analysis
was carried out using GC (Shimadzu GC 17A) equipped with Flame ionization detector (FID)
and computer integrator software. The temperature of the FID detector and the injection port was
set at 150
o
C and 250
o
C respectively. A capillary column (SGE ID-BP20, 30 m, 0.25 mm id),
with Helium (3

mL/min) as the carrier gas was used. Oven temperature was initially set at 60 C
and then increased to 80 C by programming at 20 C/min.
ANOVA analyses were performed on the data using SPSS version 17.0 for Windows.
Significance was accepted at P < 0.05.

This preliminary study on the limit of allowable ethanol in halal foods provides an
alternative on how the setting of limit could be scientifically carried out based on authentic
scriptures of Islam. The transition state between halal and haram of nabidh were made clear in
the following hadith.
Ibn Abbas reported that Nabidh was prepared from raisins for Allah's Messenger
(may peace be upon him) in the waterskin and he would drink it on that day and on
the next day and the day following and when it was the evening of the third day, and
he would drink it and give it to (his Companions) and if something was left over, he
threw that away (Translation of Sahih Muslim - Book 23, No. 4974).
The changes in the ethanol concentration from halal state before and on the third day of
fermentation to haram state after day-3 of fermentation were monitored and percentage of
ethanol in nabidh on the third day of fermentation will be considered as the limit of ethanol
permitted in halal foods.
Results (Table 1) showed no significant increase in ethanol concentration in the first two
days of fermentation. However significant increases of ethanol concentrations started to be
observed in nabidh samples of dates (Egypt) and grapes (Red, Crimson and Sugarone) on day 3,
and in all nabidh samples except for the ones from dates (China) by day 4. The fact that
64

significant changes only started on day-3 of fermentation suggests a scientific explanation behind
the reason day-3 of fermentation was chosen as the limit in the hadith of the Prophet (pbuh).
Since the highest concentration of ethanol on day-3 was 0.78 % in nabidh from Red grapes
(Table1) that level of ethanol may be suggested as still acceptable for halal certification of foods
and drinks in the light of the hadith quoted earlier.
Table 1: Ethanol contents in nabidh from different sources, measured during 5-days static
fermentation at 30C.
Sample Type Ethanol Content (%) v/wt
Day 1 Day 2 Day 3 Day 4 Day 5
Date (Egyptian) 0.003
a
0.011
a
0.636
b
2.254
c
2.834
c

Date (China) <0.001 <0.001 <0.001 0.010
a
0.130
b

Raisin (Black) 0.010
a
0.009
a
0.008
a
1.047
b
3.677
c

Raisin (Golden) 0.004
a
0.005
a
0.019
a
1.576
b
9.301
c

Grape (Black) 0.041
a
0.039
a
0.050
a
0.201
b
0.720
c

Grape (Crimson) 0.072
a
0.040
a
0.418
b
1.356
c
2.291
d

Grape (Red) 0.048
a
0.042
a
0.777
b
1.141
c
2.078
d

Grape (Sugarone) 0.004
a
0.003
a
0.001
b
0.012
c
0.040
d

Values along the same row having the same superscripts are not significantly different (P < 0.05).

It should be noted, however that several factors affect the production of ethanol during
fermentation. Apart from the type and amount of natural flora (yeasts) present on the samples,
the amount of ethanol produced would also depend on the storage temperature, the amount of
sugars available in the nabidh and the degree of aeration or lack of it. Thus these parameters that
must be controlled in simulating the nabidh fermentation and should mirror as much as possible
the conditions and practices during the time of the Prophet (pbuh). The fermentation temperature
is reported to exert a pronounced effect on growth, metabolism and survival of the fermenting
organism (Gaur,2006). In this preliminary study, nabidh was kept at 30C which is the
temperature of average mid-October of the primary harvest season in Madinah, Saudi Arabia
(The cherished date palm, 1997). It is assumed that nabidh were widely made and drunk during
this season in Madinah, Saudi Arabia where this hadith was revealed.
Simulation fermentation of nabidh samples were done in small capped bottles (250mL)
as nabidh must not be prepared in open container. This is based on hadith cited from Abu
Hurairah:
65

Abu Hurairah reported that Allah's Apostle (may peace be upon him) said to the
group of Abd al-Qais: I forbid you (to prepare Nabidh) in gourd and green pitcher,
hollow stump and varnished jar and the waterskin having its upper end cut, but
(prepare it) in your small waterskin, and tie its mouth. (Sahih Muslim, Book
023, Number 4916)
Scientifically, fermentation must be done in closed containers to avoid possible oxygen in
the air from promoting the growth of additional yeast cells and thus producing more ethanol in
primary fermentation.

4. Conclusion
An initial screening of nabidh from different sources suggested that 0.78% ethanol in
foods is still permissible for halal certification. However, if the standard global limit is to be
suggested, more simulations need to be carried out and additional studies on method validation
and measurement of uncertainty are necessary to precisely state a reliable figure.

5. References
Anonymous, Hukum Makanan Hasil Peragian. http://blog.re.or.id/hukum-makanan-hasil-
peragian.htm (accessed Nov 05, 2009)

Anonymous (2009a), Ruangan Soal Jawab Kemusykilan Agama,
http://baheis.islam.gov.my/web/musykil.nsf/0/b5bc213371902bce48256d2e0056e50f?OpenDocu
ment(accessed Nov 05, 2009)

AOAC (Association of Official Analytical Chemists) Official method of analysis, 15
th
Ed.
Association of Official Analytical Chemists, Washington D.C. 1990.

Gaur, K. Process optimization for the production of ethanol via fermentation. Dissertation,
Thapar Institute of Engineering & Technology. 2006.

Halal Science Center, Chulalongkorn University. Alcohol Training Manual, Halal Forensic
Laboratory Training Course for IMT-GT and ASEAN Scientists. Bangkok, Thailand, 28
September 2 October 2009.

66

INFAD, (Institut Pengurusan dan Penyelidikan Fatwa Sedunia, 2004). Alcohol in soft drink.
http://knowledge.hdcglobal.com/en/articles/art434.html. (accessed Nov 05, 2009).

Miller G.L. Use of Dinitrosalicyclic acid reagent for determination of reducing sugar. Analytical
Chemistry. 1959, 31(3), pp. 426-428.

Riaz, M.N.; Chaudry, M.M. Halal food production; CRC Press: United States of America, 2004;
p. 34.

Riaz, M.N. Alcohol: the myths and realities, in handbook of halal and haram products.
Richmond Hill, New York: Publishing Centre of American Muslim Research & Information.
1997, pp. 16-30

The cherished date palm. http://www.saudiembassy.net/files/PDF/Publications/
Magazine/1997Winter/date-palm.htm. (accessed Nov 05, 2009)

The Religious Council Negara Brunei Darussalam, Halal Food-Piawai Brunei Darussalam PBD
24:2007,First edition. http://www.scribd.com/doc/17782682/Halal-Food-Standards (accessed
Nov 05, 2009)

Wikipedia (2009). Nabidh. http://en.wikipedia.org/wiki/Nabidh. (accessed Nov 05, 2009)

67

A22

Monitoring the Presence of Lard in Virgin Coconut Oil (VCO) using Fourier
Transform Infrared (FTIR) Spectroscopy for Halal Authentication Study
Abdul Rohman
1,2
, Y.B. Che Man
1*
, A. Ismail
1
, and H. Puziah
1

1
Malaysia.
2
Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Gadjah Mada University,
Yogyakarta, 55281, Indonesia.
*Corresponding author email: yaakobcm@gmail.com

Abstract
This study highlights the application of Fourier transform infrared (FTIR) spectroscopy
combined with chemometrics to analyze the presence of lard in virgin coconut oil (VCO). The
spectral bands associated with VCO, lard, and its blends of VCO and lard with different
concentrations of lard were scanned, interpreted, and identified. Discriminant analysis and partial
least square (PLS) were used for qualitative and quantitative analyses, respectively. In order to
check the validity of PLS model, the calibration model obtained was cross validated using leave
one out method. The results showed that PLS able to predict the lard contents in VCO with
equation y = 0.999x + 0.006, for the relation between actual value of lard (x) and FTIR predicted
value (y) with coefficient of determination (R
2
) of 0.999 at frequency regions of 1120 950 cm
-1
.
Furthermore, DA was successfully exploited for classification of VCO and that adulterated with
lard.
Keywords: Lard, Virgin coconut oil, FTIR spectroscopy, partial least square, discriminant analysis.

Introduction
Compared with other industrial sectors such as pharmaceutical industry, profit margins
obtained from food industry is relatively narrow. Therefore, some devious suppliers of oils
attempt to maximize the revenues by counterfeiting and adulterating practices (Schieber, 2008).
Lard has similar color with virgin coconut oil (VCO), consequently the presence of lard in VCO
can not be detected using naked eye. For this reason, lard can be potential adulterant in VCO to
gain economical profits in the fats and oils industry. Authentication is an important issue for
consumers, producer, and legislation makers due to legal compliance, economic reasons, use of
safe ingredients, and religious aspects (halal and kosher) (Kamm et al., 2001).
68

The presence of lard in any food systems is serious problems in view of religious
concerns, because some religions like Islam, Judaism and Hinduism forbid their followers to
consume any foods containing porcine and its derivatives such as lard (Regenstein et al., 2003).
This study highlights the application of Fourier transform infrared (FTIR) spectroscopy
combined with chemometrics to analyze the presence of lard in VCO.

Materials and method
VCO was obtained from a local market in Jogjakarta, Indonesia. Lard was obtained from
rendering of pigs adipose tissue according to Rohman and Che Man (2009
a
).
Quantification and Classification
Quantification of lad in VCO was performed using multivariate calibration of partial least square
(PLS), meanwhile classification was carried using discriminant analysis (DA) technique. Both
PLS and DA are done using software of TQ Analyst
TM
version 6 (Thermo electron Corporation,
Madison, WI). For PLS calibration, twenty samples containing of lard in VCO with
concentration range of 0.5-50 % (wt/wt) were prepared. The calibration model was subsequently
subjected to cross validation using seventeen independent samples. For classification using DA,
a series of pure VCO and VCO containing lard were prepared and subjected to FTIR analysis.

FTIR analysis
The spectral bands associated with VCO, lard, and its blends of VCO and lard with different
concentrations of lard were scanned using Nicolet 6700 FTIR spectrometer (Thermo Nicolet
Corp., Madison, WI) equipped with a detector of deuterated triglycine sulphate (DTGS), a
KBr/Germanium beam splitter, and connected to software of the OMNIC operating system
(Version 7.0 Thermo Nicolet). Data of FTIR spectra were collected from 32 scans at a resolution
of 4 cm
-1
with strong apodization throughout the frequency regions of 4000650 cm
-1
. These
spectra were subtracted against background of air spectrum.

Figure 1 shows FTIR spectra of lard and virgin coconut oil (VCO) at mid infrared region
of 4000 650 cm
-1
. Both spectra look very closely and exhibited a typical characteristic of
absorption bands for common edible oils. The functional groups responsible for IR absorption of
69

each peak can be seen elsewhere (Guillen and Cabo, 1997; Rohman and Che Man, 2009
b
;
Lerma-Garcia et al., 2010). The big differences of the two spectra are assigned with (a) and (b) in
Figure 1 at two frequencies, 3006 and 1098 cm
-1
. A peak at 3006 cm
-1
(a) is present in lard, but is
absent in the spectrum of VCO. It is due to cis C=CH stretching. This is not surprising because
lard has a higher iodine value than that of VCO (Manaf et al., 2007). Furthermore these
frequencies were exploited for quantification and classification of lard in VCO.

Figure 1. FTIR spectra of lard and VCO recorded at frequency of 4000-650 cm
-1
. The assigned
peaks with arrow (a and b) are absorption bands which are significant in
differentiation between VCO and lard.

Quantification of lard using multivariate calibration of PLS showed that PLS able to
predict the lard contents in VCO with equation y = 0.999x + 0.006, for the relation between
actual value of lard (x) and FTIR predicted value (y) with coefficient of determination (R
2
) of
0.999 at frequency regions of 3020-3000 cm
-1
and 1120 1000 cm
-1
. Furthermore, the model
was verified using cross validation and an equation of y = 0.988x + 0.401; with R
2
of 0.997, was
obtained.
The frequencies used for quantification were also used for classification using DA (3020-
3000 cm
-1
and 1120 1000 cm
-1
). The samples were classified into two groups: pure VCO or
training sets and adulterated samples of VCO with lard. DA was subjected for both classes and
the Coomans plot was formed. Figure 2 demonstrated The Coomans plot for the classication of
70

VCO and that added with 0.550% of lard using 6 principal components. The x-axis
demonstrates the Mahalanobis distance to corresponding VCO, while the y-axis demonstrates the
distance to the class of the adulterated VCO with lard.

Figure 2. The Coomans plot of VCO and lard: () VCO; () VCO adulterated with lard.

Pure VCO and that adulterated with lard as visualized by the Coomans plot demonstrated
the separated group. DA can accurately classify 100 % of all evaluated samples according to its
classes (pure VCO and adulterated VCO), meaning that no samples were mistakenly classied
into the incorrect class.

Conclusion
The presence of lard in VCO can be successfully detected and quantified using FTIR
spectroscopy in combination with chemometrics of partial least square and discriminant analysis
at frequency region of 3020-3000 cm
-1
and 1120 1000 cm
-1
. FTIR offers an ideal technique due
to its rapidity, ease in sample preparation, and environmentally friendly.

References
Guillen, M.D.; Cabo, N. Characterization of edible oils and lard by Fourier transform infrared
spectroscopy. Relationships between composition and frequency of concrete bands in the
fingerprint region. J. Am. Oil Chem. Soc. 1997, 74, pp 1281 1286

71

Kamm, W.; Dionisi, F.; Hischenhuber, C.; Engel, K-H. Authenticity assessment of fats and oils.
Food Rev. Intern. 2001, 17, pp 249 -290.

Lerma-Garca, M.J.; Ramis-Ramos, G.; Herrero-Martnez, J.M.; Sim-Alfonso, E.F.
Authentication of extra virgin olive oils by Fourier-transform infrared spectroscopy. Food Chem.
2010, 118, pp 7883

Manaf, M.A.; Che Man, Y.B.; Hamid, N.S.A.; Ismail, A.; Syahariza, Z.A. Analysis of
adulteration of virgin coconut oil by palm kernel olein using Fourier Transform Infrared
spectroscopy. J. Food Lipids. 2007, 14, pp 111121.

Regenstein, J. M.; Chaudry, M. M.; Regenstein, C. E. The kosher and halal food laws. Compr.
Rev Food Sci F. 2003, 2, pp 111127.

Rohman, A; Che Man, Y.B. Analysis of Cod-Liver Oil Adulteration Using Fourier Transform
Infrared (FTIR) Spectroscopy. J. Am. Oil Chem. Soc. 2009
a
, 86, pp 1149-1153

Rohman, A.; Che Man, Y.B. Monitoring of virgin coconut oil (VCO) adulteration with palm oil
using Fourier transform infrared spectroscopy. J Food Lipids. 2009
b
, 16, 618628

Schieber, A. Introduction to Food authentication in Modern techniques for food authentication;
Elsevier Inc: New York, USA, 2008, pp 1-23.

72

A25

Distinguishing Different Animal Fat Contaminations in Sunflower Oil by
Differential Scanning Calorimetry

J.M.N. Marikkar*, M.H. Dzulkifly, M.Z. Nor Nadiha, and Y.B. Che Man

Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

*corresponding authors email: nazrim_marikkar@putra.upm.edu.my

Abstract

Mixing of animal fats especially lard and tallow in any form in food products is a cause of
concern for certain religions. In this study, the use of differential scanning calorimetric heating
thermograms for monitoring the presence of natural lard (LD), beef tallow (BT), and chicken fat
(CF) as adulterants in sunflower oil was investigated. Sunflower oil samples spiked separately
with LD, BT, and CF in levels ranging from 1 to 20% (w/w) were analyzed using DSC to obtain
their heating profiles. The results showed that presence of both LD and BT in sunflower oil
tended to cause adulteration peaks in the higher temperature region of heating thermogram while
CF adulteration caused changes only in the exiting thermal transitions in the low temperature
region. The distinction between LD and BT adulterations could be made easily as there were
many characteristic differences between them with respect to their peak size, shape and position.
Keywords: Animal fats, food adulteration, lard detection, sunflower oil, thermal analysis.

1.0 Introduction

Animal fats have long been used in many food applications. In the past, lard and tallow were
used to mix with vegetable oils for the purpose of development of new products. Animal fats are
sometimes mixed into sunflower oil either for flavor enhancement or increased stability during
frying. For instance, sunflower oil blending with beef tallow was undertaken in order to prepare
a special kind of shortening (Rodriguez et al, 2001). However, mixing of animal fats with plant
oils may not be desirable due to religious restriction and negative nutritional perception
regarding the consumption of animal fats. Hence, there has been much effort for detection of
animal fats in food systems. The objective of this study was to investigate the use of DSC
heating thermograms to distinguish lard from other animal fats contaminations in sunflower oil.
73

2.0 Methods and materials

2.1 Materials. Sunflower oil (SuO) sample was purchased from a super market. LD, BT and CF
were extracted using adipose tissues of animals collected from local slaughter houses according
to the method reported previously by Marikkar et al. (2001).

2.2 DSC Thermal Analysis. A Perkin - Elmer Model DSC-7 DSC (Norwalk, CT) was used to
analyze the thermal characteristics of the oil samples. The analyses were performed according to
the method reported previously by Marikkar et al. (2001).

3.0 Results and discussion

The DSC profile of the uncontaminated sample of SuO displayed two distinct endothermic
transitions at -39.0 C and -25.1 C with a shoulder peak appearing at -8 C. The temperature
region of the heating curve of SuO between 0 to 50 C is found to exist without any significant
thermal transitions. This could be due to the fact that SuO does not possess higher melting
saturated TAG molecular species, but is largely comprised of TAG molecules esterified with
oleic and linoleic acids (Tan and Che Man, 2000; Davidson et al, 1996). Once sunflower oil was
adulterated with animal fats, such as LD, CF, and BT, new groups of TAG molecules having
higher melting points could be introduced into the system. As a result, the thermal behavior of
the resulting oil mixture would be different from that of the original sample. However, the
changes caused by different animal fats in the melting profile of SuO varied significantly.
Among the thermal transitions of the uncontaminated sample of SuO, the shoulder peak at -8.0
C was found to be sensitive to compositional changes caused by all three animal fats and hence,
it increased significantly. However, more important features reflecting the nature of adulteration
would have been found to emerge in the higher temperature region extending from -5.5 to 50 C.
In this part of the DSC curve, CF adulteration did not cause any significant transition, while both
LD and BT adulterations were found to cause characteristic changes (Tables 1 and 2). The data
showed that the gradual increase of BT and LD in SuO has given rise to additional thermal
transitions. The data presented in Table 1 showed that the adulteration peak corresponding to
LD is a sharp singlet. On the other hand, the data presented in Table 2 showed that the
adulteration peak corresponding to BT is a broad doublet (Table 2). The differences in the peak
74

shape and positions of thermal transitions would be helpful to distinguish the two types of
adulterations.

Table 1: DSC Characteristics of samples series adulterated with lard

DSC parameter Lard content (%, w/w)
8 10 12 15 17 20
Peak shape
Sharp
singlet
Sharp
singlet
Sharp
singlet
Sharp
singlet
Sharp
singlet
Sharp
singlet
Peak position (C) 13.670.03 14.550.05 15.280.43 16.630.15 17.130.12 17.800.2
Peak area (J/g) 0.020.01 0.120.01 0.450.01 0.870.02 1.110.02 1.290.03

Table 2: DSC Characteristics of samples series adulterated with tallow

DSC parameter Tallow content (%, w/w)
5 10 15 20
Peak shape Broad doublet Broad doublet Broad doublet Broad doublet
Peak position (C)
Min: 13.20.04
Max: 34.10.05
Min: 15.30.04
Max: 36.20.05
Min: 17.10.03
Max: 37.50.02
Min: 18.50.05
Max: 39.10.04
Peak area (J/g) 0.550.03 2.050.02 3.510.04 4.690.03

4.0 Conclusion
This study demonstrated the potential use of DSC in detecting the contamination of sunflower oil
by different animal fats. Based on the characteristic shape, size and position of the adulteration
peak, it could be possible to distinguish lard contamination from other animal fats
contaminations. This finding could be a valuable source of information for analytical method
development for detection of lard in vegetable oils.
References

Rodriguez, A.; Castro, E.; Salinas, M. C.; Lopez, R.; Miranda, M. Interesterification of tallow
and sunflower oil. J. Am. Oil Chem. Soc., 2001, 78, 431-436.

Marikkar, J. M. N.; Lai, O. M.; Ghazali, H. M.; Che Man, Y. B. Detection of lard and
randomised lard as adulterants in RBD palm oil by differential scanning calorimetry. J. Am.
Oil Chem. Soc., 2001, 78, 1113-1119.

Tan, C. P.; Che Man, Y. B. Differential Scanning Calorimetric Analysis of Edible Oils:
Comparison of Thermal Properties and Chemical Composition, Ibid, 2000, 77, 143-155.
75

Davidson, H.F.; Campbell, E.J.; Bell, R.J.; Pritchard, R.A. Sunflower oil, in Bailey's Industrial
Oil and Fat Products, Vol. 2, 5
th
edn. edited by Y. H. Hui, John Wiley and Sons, Inc.,
New York, 1996, pp. 603-676.

76

A26

Food Safety Application to Halal Poultry Slaughter House and Products in
Thailand

Ammawath, S
1
.
*
, Ammawath, W
1
.

and Pattanakulchai, N
2
.
1
Faculty of Science and Agricultural Technology, Rajamangala University of Technology Lanna
Lampang 52000, Thailand.
2
Saha Farms Co. Ltd., 44/4 Nawamin Rd. Kawnayaw, Bangkok 10230
* Corresponding author email: setham@hotmail.com

Abstract

Halal science and management in Thailand is endeavored at producing Halal food for the
Muslim consumers. The Halal meat in Thailand is accomplished industrial poultry slaughtering
and processing plant for the domestic and international markets. Currently, food safety in
accordance to Shariah plays an increasing role in consumer acceptance for products and services,
both by the muslims and non-muslims, globally. The GMP is at least, required in meat
processing factories as for the domestic consumption and the HACCP is compulsive for the
international export. A large integrated farm has adopted the concept of the Halal Industry
Development for its poultry production and processing by following the shariah, as well as,
applied the food safety procedures, accompanying from the farm through slaughtering house and
processing chain. Obtaining the Halal certificate from the Halal Industry Development
Corporation (HDC), Malaysia is to guarantee and to assure that high quality poultry meat and its
products are in compliance with the concept of maintaining Halal integrity from farm to table.
Best practices in personal hygiene and industrial plant sanitation are obligatory as to minimize
any microbial contamination and without any pathogenic organisms, as well as, to avoid any
possible recontamination that may subsequently occur. According to the Halal practices in
Thailand, it was found that the minimum non-pathogenic microbial allowance for poultry
products, in terms of the microbial total counts, for fresh meat, frozen meat and cooked meat,
TPC is lower than 10E4.0, l0E3.0 and 10E1.0 cfu/g, respectively, with zero pathogenic
organisms.
Keyword: Food safety, Halal, Poultry, Thailand, Microbial count

77

Introduction
The food-processing industry utilizes a variety of measures to limit potential food hazards. Some
pathogenic microbes may be carried by food even though they do not grow in the food itself.
Others are able to grow in foods, increasing dramatically in numbers when held under certain
conditions, particularly warm temperature (Bennion, 1995). Therefore, the concept being used by
food industry to ensure food safety is GMP and HACCP (DAoust, et al., 2007). Food Safety
also was concerned from all of us as an essential for both public health and international trade in
Halal food. Food processing in Thailand emphasized on Halal food and food safety. Therefore,
Thai chicken meat producer has adopted Shariah for chicken production according to from farm-
to-table manner. The GMP and HACCP were applied to slaughter and processing.
The aim of this study was to design and present a microbiological food safety approach on Halal
chicken meat.
The animal health, welfare and food safety to produce Halal natural chicken meat were
integrated to fulfill the requirements (Figure 1). Fresh, frozen and cooked chicken meats were
sampled from SAHA Farm processing line. A range of different tests were done to ensure high
standard of food quality. Samples were determined for total plate count (TCP) (APHA, 2001),
Coliform (AOAC, 2005), Escherichlia coli (E. coli) (AOAC, 2005), Enterococci (NMKL, 2004),
Staphylococcus aureus (S. aureus) (ISO6888, 1996), Listeria monocytogenes (L.monocytogenes)
(ISO 11290-1, 2004) and Campylobacter jejuni (C. jejuni) (ISO 10272, 2006). Personal hygiene
was used by hand swab method and were determined on TCP, Coliform, E. coli, Enterococci, S.
aureus and Listeria spp. Food contact was used by instrument swab method and was determined
on TCP, Coliform, E. coli, Enterococci, Listeria spp. and Enterobacteriaceae.

Figure 1: The principals of Halal Natural Chicken meat production

78

The results from Table 1 and 2 indicated that cooked chicken meat shows the lowest microbial
count of TCP, Coliform and Enterococci while E. coli, S. aureus, Cl. perfringens, Salmonella, L.
monocytogenes and C. jejuni were not found in cooked chicken meat. Therefore, Thai Halal
fresh, frozen and cooked chicken meat meet the high quality standard for Halal food.
Table 1: Results of microbiology test in chicken meat
Product
TPC
(cfu/g) *
Coliform
(cfu/g) *
E. coli
(cfu/g) *
Enterococci
(cfu/g) *
Fresh chicken
meat
<10
4
- - -
Frozen chicken
meat
<10
3
<10
3
<10
2
<10
3

Cooked chicken
meat
<10 <10 N <10
*cfu/g: colony forming unit per gram
Table 2: Results of microbiology test in chicken meat (continue from Table 1)
Product
S. aureus
(cfu/25 g)
Cl. Perfringens
(cfu/25 g)
Salmonella
spp.
(cfu/25 g)
L. monocytogenes
(cfu/25 g)
C. jejuni
(cfu/25
g)
Fresh
chicken meat
- - - - -
Frozen
chicken meat
- - N - N
Cooked
chicken meat
N N N N N

The microorganism on personal hygiene and food contact are presented in Table 3 and 4. The
data indicated that TPC and Coliform on personal hygiene and food contact were lower than
10E1.0 cfu./swap while E. coli and Listeria spp. were not found in both personal hygiene and
food contact. The results also indicated that Enterococci on personal hygiene and
Enterbacteriaceae on food contact were lower than 10E1.0 cfu./swap while Listeria spp. and
S.aureus were not found on personal hygiene and Enterococci were not found on food contact.

Table 3: Microbiology test of Personal hygiene by hand swab method
TPC
(cfu./swab)
Coliform
(cfu./swab)
E.coli
(cfu./swab)
Enterococci
(cfu./swab)
Listeria
spp.
(per swab)
S.aureus
(cfu./swab)
<10 <10 N <10 N N

79

Table 4: Microbiology Test of food contact by instrument swab method
TPC
(cfu./swab)
Coliform
(cfu./swab)
E.coli
(cfu./swab)
Enterococci
(cfu./swab)
Listeria
spp
(per swab)
Enterobacteria
ceae
(cfu./swab)
<10 <10 N N N

<10

Conclusions
Food should be safe with respect to microorganism capable of causing food-borne disease. This
study indicated that the integration of animal health, animal welfare and food safety bring Thai
Halal chicken meat to meet the high quality standard for Halal food.
Acknowledgement
We would like to thanks SAHA FARMS Co., Ltd. for useful information and laboratory
facilities.
References
APHA. Compendium of methods for the microbiological examination of foods, 2001.
AOAC. Petri film for E. coli/ Coliforms count plate at 35 Celsius, 2005.
BAM. Culture method for enumeration and identification of Clostridim perfringens in foods,
2001.
Bennion, M. Food Safety, in Introductory Foods. Practice Hall, 1995; pp 45-66. DAOUST,
J.Y. et al. Food Safety Handbook. Biomerieux Education, 2007; pp 1-245.
ISO 6579. Microbiology of food and animal feeding stuffs-Horizontal method for the detection
of Salmonella spp., 2002. Amendment 1, 2007.
ISO 6888. Microbiology of food and animal feeding stuffs-Horizontal method for the
enumeration of coagulase-positive staphylococci (S. aureus and other species), 1999.
ISO 10272. Microbiology of food and animal feeding stuffs-Horizontal method for the
enumeration of C. jejuni, 2006.
ISO 11290-1. Microbiology of food and animal feeding stuffs-Horizontal method for the
detection and enumeration of L. monocytogenes, 1996. Amendment 1, 2004.

80

A27

Q-PCR of microbial ribosomal DNA genes for surveillance in Halal Chicken
Processing Industrial Plant
Shaharuddin Aziz
Biochemistry & Health Biotechnology, University Kuala Lumpur Royal College of Medicine,
Ipoh, Perak

Abstract
The process of halal slaughtering begins by reciting of Allah's name (Bismillah Allahu Akbar)
and always takes place before the processing line is started and is constantly repeated during
production at the time of slaughter of broilers. At the point of slaughter, a manual hand held
knife or a highly accurate, rotary knife blade precisely severs the respiratory tract, esophagus,
jugular vein and arteries, leaving the head attached thus fulfilling halal slaughtering. As the halal
chickens come off the line, they are inspected for quality and food safety assurance. Thus food
safety assurance other than slaughter is an integral part of Halal and Zabiha compliance
certification. The issue which remains unattended to is thoyyiban. In this report, real-time
quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S- DNA gene molecule, a
universal phylogenetic marker, was used to quantify the relative abundance of individual
bacterial members of a diverse microbial community from a broiler processing plant. Results
tabled in this abstract shows quantitative detection of pathogenic bacteria species of potential
human gastrointestinal hazards found at broiler processing plants. This finding is important for
the purposes of all-inclusive (halal-zabiha-thoyyiba) authentication.
Keywords: Halal and Zabiha compliance, quantitative PCR TaqMan qPCR, small subunit (SSU), 16S- DNA
gene.

81

Introduction

O ye people ! Eat of what is on earth, halal and thaiyiban, and do not follow the footsteps of
the Evil one, for he is to you an avowed enemy (Al Baqarah 2: 168).

The shariah compliance here is concerned with lawful dietary laws (halal) safety, healthy and of
quality or simply hygienic (thoyyiban). Failing this compliance would tantamount to consuming
impurities and harmful diets thus following the footsteps of the evil one. While halal diets have
been clearly defined by authorities like the Department of Islamic development Malaysia
(JAKIM) and emphasis have been placed other than hygiene, sanitation and food safety also
included on product processing handling and distribution as prerequisites for shariah compliance.
With this in view and investigation was conducted on environmental bacterial community
diversity in situ. This report verifies that a large portion of the microbial community particularly
the CFB group within the chicken processing plant industry may consist of currently
unculturable microorganism.


1. Quantitative-PCR technique
The technique is used to amplify and simultaneously quantify a targeted DNA molecule
and applied to rapidly detect the presence of genes of pathogens involved in infectious
diseases particularly those microbial communities in the environment. The environment
in this case means the water and sediments.
2. SSU rRNA gene sequences

The present study uses small subunit (SSU) rRNA gene sequence data and quantitative
real-time PCR (TaqMan qPCR BioRad ) to provide a quantitative analysis of microbial
communities and their surveillance in the broiler chicken processing plant.

The choice of this gene loci was based on the following criteria:

i) its presence in almost all bacteria
ii) the function of the 16S rRNA gene over

time has not changed,
iii) the

16S rRNA gene (1,500 bp) is large enough for informatics purposes

82

iv) this gene was well conserved in bacteria and it was easy to get sequences simply by PCR.
v) the ends of the SSU rRNA gene are conserved and this means that to develop universe
primers for PCR is relatively less difficult.

In this study the (TaqMan qPCR Applied Biosystem) of the small subunit (SSU) 16S-like
rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of
individual bacterial members.
In order to construct an internal standard for q-PCR analysis , the SSU rRNA sequences for the
target bacteria and the SSU rRNA sequences of other bacteria in the environmental sample is
required. This information was obtained from the Ribosomal Database Project (RDP ;15
www.cme.msu.edu/RDP/html/index.html) and Acession numbers for sequences deposited in
GenBank at www.ncbi.nim.nih.gov

The species for purpose of internal standards and primers used in this study among others were:

Species Acesssion No. Forward Primer
(5 -3)
Reverse Primer
( 5 -3)
Bacteroides
fragilis
X83941 AGTAACACGTATCCAACCTG TATCGCAAACAGCGAGTA
Escherichia coli
(E. coli) O157:H7
JO1859 AGTAATGTCTGGGAAACTGC GAAAGCCAACAGCAAGTC
Bacteroides
ovatus
X83952 AGTAACACGTATCCAACCTG TATCGCAAACAGCGAGTA

For all Taqman QPCR assays a single normalization standard was used.

4. Treatment of environmental samples (The size of the sample required to yield enough
bacteria varies depending on the source)

a. Effluent : bacteria collected by filtration by using a Millipore filter 25 PA(5 mm
pore size , 49 mm diameter). Bacteria is eluted from the filter.

b. Solid matter : Suspension in sterilized doubled distilled water and
centrifugation.

c. Atmospheric environment : Clean room HEPA filters and bacteria eluted by
centrifugation in sterilized distilled water.
83

The free microbes are separated from the filter matrix before DNA extraction begins.
SEE: www.idahotech.com

5. DNA extraction and purification (suitable for PCR)

DNA was extracted from 100g of environmental samples treated earlier using direct lysis
with glass beads and SDS followed by potassium acetate precipitation, polyethylene
glycol precipitation, phenol extraction and isopropanol precipitation. Extraction buffer is
100 ml of 100 mM Tris-HCl [pH 8.0], 100 mM sodium EDTA [pH 8.0], 1.5 M NaCl.

Samples were centrifuged (10,000g for 20 min) and the partially purified nucleic acid
pellet resuspended in 20 ml of TE (10 mM Tris-HCl, 1 mM sodium EDTA, pH 8.0).
Potassium acetate (7.5 M) was added to a final concentration of 0.5 M. Samples were
transferred to ice for 5 min then centrifuged (16,000 g, 30 min) at 4C to precipitate
proteins and polysaccharides. The aqueous phase was extracted with phenol/chloroform
and chloroform/isoamyl alcohol and DNA was precipitated by adding 0.6 volume
isopropanol. After 2 hrs at room temperature, DNA was pelleted by centrifugation
(16,000g for 30 min) and resuspended in TE (1 ml).

Results & Discussions

1. Following q-PCR amplification the standard Taqman software was used to calculate the
amount of Bacteroides and Escherichia coli (E. coli) O157:H7. The estimate was used
to calculate the number of specific bacteria in the sample. The internal standard q-PCR
method produces accurate estimates of the amount of specific DNA sequences in the
sample.
2. The sequences of the SSU rRNA genes uniquely identified the Bacteroides and E.coli
O157:H7 in the environmental sample.
3. Quantitative PCR of SSU rDNA can indeed and a necessary requirement to monitor and
provide the surveillance of pathogenic bacteria in samples contaminated with fecal
matter as in the Broiler Chicken Processing plants.
84

q-PCR : Poultry Environmental Pathogens

Table 1: Chicken Farm Samples of TaqMan Assays Ct Values , the cycle number at which
Amplification was detectable and visualizable by SYBR Green I stainining for the
amplified SSU rDNA sequence of interest. Blank was zero Ct value an N
SYBR Green I amplification.
Species q-PCR Ct
Value
Farm
effluent q-
PCR SYBR
Green I
Farm air
(atmosphere)
SYBR Green I
Farm soil with
chicken fecal
matter SYBR
Green I
Bacteroides fragilis 25.5 +ve N +ve
Bacteroides ovatus 27.5 +ve N +ve
Bacteroides
acidofaciens
29.8 +ve N +ve
Escherichia coli (E.
coli) O157:H7
26.7 +ve +ve +ve
Table 2: Chicken Broiler Processing Plant of TaqMan Assays Ct Values , the cycle number
at which Amplification detection was evident and visualizable by SYBR Green I
stainining for the amplified SSU rDNA sequence of interest. Blank was zero Ct
value an N SYBR Green I amplification.
Species q-PCR Ct
Value
Chicken
processing
plant
effluent q-
PCR SYBR
Green I
De feathering
tanks q-PCR
SYBR Green I
Slaughter
shackles and
transport
cages q-PCR
SYBR Green I
Bacteroides fragilis 25.5 +ve N +ve
Bacteroides ovatus 27.5 +ve N N
Bacteroides
acidofaciens
29.8 +ve N N
Escherichia coli (E.
coli) O157:H7
26.7 +ve N N

+ve signifies positive amplification ; N signifies no amplificatio

Conclusions
a. While the CODEX ALIMENTARUS and HACCP have established efficient codes of
compliance, local authorities responsible for Shariah compliance should take into
account concepts of scientifically based and determined thoyyiba.
85

d. Asean-IMTGT initiatives on standards, certification (Halal-Zabiha-Thoyyiba) should be
more stringent on enforcement to prevent fraud , abuse and violation of food security.
References
1. Cullen, D.W. and Hirsch, P.R. 1998.
Simple and rapid method for direct extraction of microbial DNA from soil for PCR. Soil Biol.
Biochem. 30: 983-993.

2. Edgcomb, V.P., McDonald, J.H., Devereux, R., and Smith,D.W.1999.
Estimation of bacterial cell numbers in humic
acid-rich salt marsh sediments with probes directed to
16S ribosomal DNA. Appl. Environ. Microbiol. 65: 1516-1523.

3. Malaysian Standard MS 1500-2004, Halal Food- Production, Preparation and Storage
General Guidelines (1
st
Edition 2004).

Broiler Chicken Processing Plant (where environmental samples were collected)

A: Slaughter Shackles

86

B: Tranportation Cages at Processing Plant

87

A29

Pig Species Identification in Meatballs Using Polymerase Chain Reaction
Restriction Fragment Length Polymorphism for Halal Authentication

Yuny Erwanto
1
, Mohammad Zainal Abidin
1
, Abdul Rohman
2
and Sismindari
3

1
Division of Animal Products Technology, Faculty of Animal Science, Gadjah Mada University,,
Jl. Fauna No. 3, Karangmalang, Yogyakarta 55281, Indonesia
2
Faculty of Pharmacy, Gadjah Mada University, Jl. Kaliurang Km 4,5 55281 Yogyakarta
3
Integrated Laboratory of Research and Testing, Gadjah Mada University, Jl. Kaliurang Km 4,
55281Yogyakarta
*Corresponding author e-mail: yunyer@yahoo.com

Abstract

The information given to consumers is essential for them to choose one food product over
another. The falsification of food contents on product labels is a widespread problem, especially
with products related with pig or others prohibited food in Islam. Proving conclusively that fraud
has occurred requires the detection and quantification of food constituents. Falsifications of meat
or food are often biochemically similar to the materials they replace, consequently the
identification and measurement extremely difficult. The DNA based methods have now been
successfully adapted for detection of food substitution. In this research, Polymerase Chain
Reaction (PCR) products of cytochrome b mitochondrial DNA gene were applied to identify the
existence of pig in meatball product. Genomic DNA of pig, bovine, and chicken were isolated
and subjected to PCR amplification targeting the mitochondrial cytochrome b gene. Pig species
differentiation was determined by digestion of obtained 359 bp amplified product with BseDI
restriction enzymes, which generated pig species electrophoresis pattern. PCR-Restriction
Fragment Length Polymorphism (RFLP) revealed the presence of the pig meat in meatball
product and distinguished between bovine, chicken, and pig sample. Pig mitochondrial
cytochrome DNA gene was cleaved into 228 bp and 131 bp fragments but the bovine, and
chicken cytochrome b gene were not digested by BseDI enzyme. The digestion was conducted at
55
o
C for 3 h and visualization of the digest product was performed in 2% agarose gel. PCR-
RFLP technique using BseDI restriction enzymes is reliable for the detection of the pig meat in
meatball for the Halal authentication.
Key words: Pig species, Identification, PCR-RFLP, Halal authentication.
88

Introduction
Indonesian traditional meatballs is one of the comminuted meat products and its
popularity in all classes of Indonesian society. Meat are processed to make bakso originally from
beef but nowadays some others such as chicken, fish, and pork commonly also been mixed in
some meatball products. The wide variety of meatball products availabe on the market in
Indonesia seems favourable but leads to several fears, where almost population are moslem who
prohibited to consume pork. This is an important challenge for the people in charge of the
official control of food, that have to verify the species of meat ingridients that are not always
easily identifiable.
Many various methods based on DNA techniques have developed such as multiplex PCR
assay (Matsunaga et al., 1999), PCR-based finger printing (Saez et al., 2004). Colgan et al.
(2001) analyzed meat bone meal using real time PCR to investigate the meat source origin and to
verify the quantity of meat in DNA mixture complex. Lopes-Andreo et al. (2005) was also able
to identify the meat species using the same methods.
However the identification of meat species in Indonesia was very rare and there was a
little publication on this field. This study reported PCR-RFLP method for meat species
identification in Indonesian meatball using DNA mitochondrial as universal primer in PCR
reaction. The digestion of the PCR amplicon products to determined meat species was
established by BseDI restriction enzyme.
Authentic muscle samples of beef, pork and chicken were obtained from the traditional
market in Yogyakarta, Indonesia. Meatball was prepared in laboratory scale with separate
equipment to prevent unexpected cross contamination. DNA was extracted from meatball
samples using the High Pure PCR Template Protocol for animal tissue provided with the High
Pure PCR Template Kit (Roche, Germany).
The set of primers used for amplification consisted of Cyt b-FW and Cyt b-REV
oligonucleotides:

CYT b FW 5-CCA TCC AAC ATC TCA GCA TGA TGA AA-3
CYTb REV 5-GCC CCT CAG AAT GAT ATT TGT CCT CA-3
89

Amplification of the mt cyt b gene was performed in a final volume of 25 l containing
250 ng of extracted DNA, mega-mix royal (optimized mixture of Taq polymerase, anti-Taq
polymerase monoclonal antibodies in 2 X reaction buffer (6 mM MgCl
2
with 400 M dNTPs,
stabilizer and blue loading dye) (Microzone Ltd, West Sussex, UK), and 20 pmol of each primer.
Amplification was performed with the following PCR step-cycle program: pre-denaturation of
94C for 2 min, followed by 35 cycles of denaturation at 95C for 36 s, annealing at 51C for 73
s, and extension at 72C for 84 s. Final extension at 72C for 3 min followed the final cycle for
complete synthesis of elongated DNA molecules.
Two units/l of RE BseDI (Fermentas) were applied to 10 l of amplified DNA in a final
volume of 20 l digestion mixture and were incubated at 55C for 3 h for optimal result. Five
microlitres of the digested samples were electrophoresed at constant voltage (50 V) on 2%
agarose gel (Promega, Madison, USA).
Results And Discussion
Genomic DNA isolation from the meatball can extracted but it is ascribed to the fact that
thermal strongly accelerates DNA degradation from the meatball samples (data not shown).
According to Martinez and Yman (1998) and Saez et al. (2003) reported that heat treatments
which mainly affected the quality DNA causing degradation into small size fragment.
Genomic DNA was used as a template for the amplification of PCR with the universal
primer. Gene of cytochrome b used for the amplification of PCR resulting fragment of
approximately 360 bp (Fig. 1). This result indicated that isolate DNA of mixture meatball was
enough for amplification on PCR reaction. The same result of PCR amplification has also been
reported yet, according to Kocher et al. (1989), Aida et al. (2005) and Erwanto et al. (2007).

Fig.1. PCR products of cytochrome b gene fragments 359 bp long of samples from different meatball products
separated by 2% high-resolution agarose gel electrophoresis. PCR amplification using cyt b universal primer. (A)
90

M: marker 100 bp DNA ladder (Invitrogen), 1: pork (100%), 2: (beef 75% : pork 25%) 3: (Beef 90% : Pork 10%), 4:
(Beef 95% : Pork 5%)5: (Beef 97% : Pork 3%), 6: (Beef 99% : Pork 1%), 7: (Beef 100 %). (B): M: marker 100 bp
DNA ladder (Invitrogen), 1: pork (100%), 2-6: (chicken : pork) 3: 7: (Beef 100 %)

The PCR reaction allowed fragments of the expected length to be obtained in all meatball
samples both beef and chicken mixed with pork, although with variable efficiency. The
mitochondrial cytochrome b gene has been selected in this study as template for DNA
amplification because it has an acceptable length and an adequate grade of mutation and there
are numerous sequences available in the databases (Kocher et al., 1989).
Sequence DNA of cytochrome b gene cattle, goat, chicken and pig obtained from
database NCBI, then employed by alignment using the software CLC sequencer. The result
average of alignment mitochondrial of cytochrome b gene among beef, mutton, chicken and pork
is 86.64%.
A clear band with a length between 100 and 150 bp and thus referable to the 131 bp
fragment can be observed in Fig 2 (lane 1). In the same lane a thicker band can be traced back to
the 228 bp fragment. The difference between BsaJI and BseDI restriction enzyme is the
incubation time for the digestion. Using BseDI needed 3 h for digestion but digestion using BsaJI
have to incubated for more than 12 h.

Fig.2. Restriction fragment produced by BseDI restriction enzyme on 359 bp amplicons of cytochrome b gene (A)
M: marker 100 bp DNA ladder (Invitrogen), 1: pork (100%), 2: (beef 75% : pork 25%) 3: (Beef 90% : Pork 10%), 4:
(Beef 95% : Pork 5%)5: (Beef 97% : Pork 3%), 6: (Beef 99% : Pork 1%), 7: (Beef 100 %). (B): M: marker 100 bp
DNA ladder (Invitrogen), 1: pork (100%), 2-6: (chicken : pork) 7: (Beef 100 %)
Conclusions
Our results allow us to conclude that PCR-RFLP of the mitochondrial Cytochrome b
gene is a suitable alternative that can be applied to the detection of pig species present in
commercialized products such as meatballs.
91

Acknowledgements
This research was financially supported by grants from Riset Unggulan Strategis
Nasional LPPM-UGM (Grant number LPPM-UGM/1309/2009) and fully supported by
Integrated Laboratory of Research and Testing, Universitas Gadjah Mada.

References

Aida, A. A., Y. B. Che Man, C. M. V. L. Wong, A. R. Raha, R. Son. 2005. Analysis of raw
meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat
Science, 69, 4752.
Arslan A., O. I. Ilhak, and M. Calicioglu. 2006. Effect of method of cooking on identification of
heat processed beef using polymerase chain reaction (PCR) technique. Meat Science, 72,
326330.
Colgan S., L. O'Brien, M. Maher, N. Shilton, K. McDonnell, and S. Ward, (2001), Development of a
DNA-based assay for spesies identification in meat and bone meal. Food Research International
34/5, 409-414
Downey, G. 1998. Food and food ingredient authentication by mid-infrared spectroscopy and
chemometrics. trends in analytical chemistry, vol. 17, no. 7, p:418-424.
Erwanto, Y., Arief. B. W., and Rusman. 2007. Identifikasi daging babi dengan PCR-RFLP
sebagai acuan untuk menentukan status kehalalan. (Pig Meat Identification using PCR-
RFLP to determine the Halal Status). Proceeeding Seminar Cluster, LPPM, Universitas
Gadjah Mada
Kocher, T. D.; Thomas, W. K.; Meyer, A.; Edwards, S. V.; Paabo, S.; Villablanca, F. X.;
Wilson, A. C. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification
and sequencing with conserved primers. Proc. Natl. Acad. Sci. U.S.A. Vol. 86, 6196-6200.
Lopez-Andreo, I., L. Lugo, A. Garrido-Pertierra, M. I. Prieto, and A. Puyet. 2005. Identification
and quantitation of spesies in complex DNA mixture by real-time polymerase chain
reaction. Analytical Biochemistry. 339.p. 73-82.
Matsunaga, T., K. Chikuni, R. Tanabe, S. Muroya, K. Shibata, J. Yamada, Y. Shinmura. 1999. A
quick and simple method for the identifcation of meat species and meat products by PCR
assay. Meat Science, 51, 143-148
Martinez and M. I. Yman. 1998. Species identification in meat product by RAPD analysis. Food
Research International, 31, 459-466
Saez, R. Y. Sanz and F. Toldra. 2003. PCR-based fingerprinting technique for rapid detection of
animal species in meat product. Meat Science, p, 659-665.
Tanabe, S., Eiji M., Akemi M., and Kazuhiro M. 2007. PCR method of detecting pork in foods
for verifying allergen labeling and for identifying hidden pork ingredient in processed
foods. Bioscience Biotechnology Biochemistry. 71. pp : 70075-1-5.

92

A30

Ethanol Content of Beverages and Condiments in Malaysia

Law Se Vern
1
, Dzulkifly Mat Hashim *
1
, Fatimah Abu Bakar
1
, Nurul Aimi Radi
1

1
2
Faculty of Food Science and Technology, Universiti Putra Malaysia, 43400 Serdang,
*
Corresponding Author Email: dzulkifl@putra.upm.edu.my

Abstract
The study involved the detection of the ethanol content of various market food and beverage
products. The objectives of this study are to identify the food products that contain ethanol and to
quantify the percentage of ethanol present. Headspace Gas Chromatography-Mass Spectrometer
(HS-GC-MS) was used to screen the samples for detection of ethanol and further quantification.
Samples were purchased from several hypermarkets in the Klang Valley and Selangor. A total of
119 samples, including fermented and cultured beverages, carbonated drinks, juices and cordials,
tea and coffee, energy drinks, colouring and flavourings, vinegars and sauces were analyzed. Of
the total number of samples screened, 58 were found to contain ethanol. The ethanol content in
the samples ranged from 0.001% to 3.510%. The Headspace method is proven to be an effective
and reliable methof for the detection of low alcohol concentrations by minimizing the loss of the
ethanol compound during sample preparation and extraction. Ethanol is present due to natural
fermentation of the product or added as solvent during production.
Keywords : ethanol content, beverages, condiments, GC/MS, headspace

Introduction
Foods are the basic needs for human being survivor and also play an important role in a
communitys religious, social and culture. Islam is the worlds second largest religion with the
estimation population of 1.3 billion worldwide (Riaz and Chaudry, 2004). Awareness of Muslim
consumers toward the validity of the halal status and prohibition in choosing the food product.
Issues had been raised about the validity of the halal status of a certain market food products.
93

Among all, determination of the alcohol, especially ethanol content of in food products become
one of the critical issue.
Ethanol is a common chemical in nature, produced during fermentation or added for the
aid of processing. Alcohol, especially ethanol consumption has health and social consequences
via intoxication (drunkenness), alcohol dependence, and other biochemical effects of alcohol
(WHO, 2004) Ethanol acts as a drug affecting the central nervous system. Its behavioral effects
stem from its effects on the brain. . Consumption of alcohol in any form is totally prohibited in
the Quran and for the Muslim community The Arabic term used for alcohol in the Quran is
khamr, implies not only to alcoholic beverages but also to all things that intoxicate or affect
ones thought process.
Ethanol compound has several unique properties that give rise to the difficulty in their
analytical and interpretive procedures. Gas chromatography had been widely used in
determination of the alcohol in foods and beverages either for scientific research or routine
analysis in the industry (Molina et al., 1993; Gonzalez-Arjona et al., 1999; Lachenmeier et
al.,2008) Headspace sampling has shown to be a simple, rapid, solvent less, and reliable
technique. Study aim to identify the food products that contained ethanol and to quantify the
percentage of ethanol present. Data can be collected and used as part of data based for alcohol
content of market foods and beverages in Malaysia.

Samples tested are procured from hypermarket around Klang Valley including energy
drinks, carbonated drinks, other soft drinks, juices and cordial, fermented and cultured drinks,
condiments, flavouring and colouring. 126 samples were tested. Gas Chromatography equipped
with mass spectrometry as detector was used in the study for detection and quantification of the
ethanol compounds present. The . J & W fused silica capillary column (J & W Scientic,
Folsom, CA, USA) of 30 m x 0.32 mm coated with a 1.8 mm film of DB-624 stationary phase
was installed in an Agilent 7890 GC equipped with a split/split less injector and a mass
spectrometry detector. Injection was carried out in the fast mode using the Agilent G1888 Auto
sampler. Using helium as a carrier gas, with a constant gas velocity of 45 cm s1, a split ratio of
5:1, and an oven program from 40 C (2 min), ramp at 50 Cmin1 to 200 C and hold for 2
minutes
94

119 samples tested and 58 samples found to contained ethanol. Table 1 showed the range
of concentration of the ethanol detected in the market products. Only selected brands of energy
drinks contained ethanol the highest make up to 0.142%. Sample with the highest ethanol content
is one of the orange flavouring. Orange flavour is oil derived from orange skins and does not
dissolve in water but dissolved easily in ethanol. Hence, the presence of higher ethanol content in
orange-flavoured flavouring is detected.
Sauce samples tested include tomato, chili, oyster and soy sauce. Study detected ethanol
in tomato and chili sauces, ranges from 0.020-0.040%. Soy sauce and vinegars are products from
fermentation. As ethanol is one of the products of natural fermentation, ethanol was found
present in all the soy sauces tested and imported vinegar samples. For local brand white vinegars
(3 brands), no ethanol was detected.
Study screened 13 different carbonated drink products, including different brands of cola.
No ethanol detected from the selected tested samples. Ethanol compounds present in juices and
cordials with high sugar content and especially in canned fruit syrup. Ethanol can be natural
product from fermentation in those high sugar products or added as solvent for flavour and
colour. Sparkling juices found to contain 0.05% ethanol. For malt fermented beverages that
claimed free-alcohol, results showed an agreement with the statement, no ethanol detected. For
all 5 brands of soy bean milk tested, results showed all five samples contained ethanol, ranges
from 0.003-0.013%. For cultured drinks, brand 1 contained 0.004% for all 3 flavours tested,
whereas other 2 brands, no ethanol detected.

95

Table 1: Different categories of beverages and condiments and the range of concentration of
ethanol detected.
Food Samples Number of
Sample Tested
Number of Sample
contained Ethanol
Amount of
Ethanol
Detected (%)
Energy Drink 13 5 0.002 - 0.142
Carbonated Drink 13 0 Not Detected
Tea and Coffee 19 4 0.002-0.053
Soy Bean Milk 5 5 0.003-0.013
Juices and Cordials 16 10 0.001- 0.122
Fermented and Cultured
Drink
16 5 0.001-0.078
Sparkling Juices 5 5 0.003-0.049
Sauces 17 14 0.004-0.093
Vinegars 10 7 0.08-0.18
Flavouring and Colouring 5 3 0.002-3.510
Total 119 58

Conclusion
Study found that 58 out of 119 market food products tested contained ethanol compounds.
Ethanol compound present can be product natural fermentation or added to aid in process.
GC/MS is a suitable to detect small amount of ethanol present in complex sample matrix such as
foods.
Keywords : ethanol content, beverages, condiments, GC/MS, headspace

References
Gonzlez-Arjona, D., Gonzlez-Gallero, V., Pablos, F., & Gustavo Gonzlez, A. (1999).
Authentication and differentiation of Irish whiskeys by higher-alcohol congener analysis.
Analytica Chimica Acta, 381(2-3), 257-264
Lachenmeier, D.W.; Rehm, J.; Gmel, G. Surrogate alcohol: what do we know and where
do we go? Alcohol. Clin. Exp. Res. 2007, 31, 1613-1624.
Riaz M.N.; Chaudry M.M.. Halal Food Production, CRC Press: Boca Raton, FL, 2004;
pp 29-31
WHO. Global Status Report on Alcohol; World Health Organization: Geneva,
Switzerland, 2004

96

A31

Discrimination of Alcoholic (Khamar) and Non-Alcoholic Beverages Using An
Electronic Nose
Syariena, A. and Che Man, Y.B.
*
Halal Products Research Institute, Universiti Putra Malaysia, Putra Infoport, 43400 UPM,
Serdang, Selangor, Malaysia.

Abstract
Nowadays khamar abuse had become a social problem among Muslims. Islamic religion
prohibited khamar consumption because of the effect that khamar has on the body and behavior.
Some Islamic country had restricted the consumption and distribution of khamar for Muslims
and underage citizens. Thus it is essential to establish a method that can detect and discriminate
khamar from non-alcoholic beverages. This study demonstrates the usage of electronic nose
(zNose
TM
) for khamar and non-alcoholic beverages discrimination. This device had the
advantages of fast and in situ measurement compared to conventional devices which come with
bulky equipment and were time consuming. The principal detection of aroma compound was
based on gas chromatogram and detected by the surface acoustic wave (SAW) sensor. Four
different types of khamar and three different types of non-alcoholic beverages were analyzed and
categorized using the principal component analysis (PCA). The PCA analysis revealed that 84%
of the total variance was described by PC 1 and PC 2.
Keywords: discrimination, electronic nose, khamar and non-alcoholic beverages, principal component analysis

Introduction
The detection of khamar had become essential studies especially for Muslim consumer
because it is prohibited in Islam and furthermore contributed to the health and social problem.
Due to the increasing public awareness in halal issues especially in Muslim countries, the
Muslim community wishes for the restriction of khamar distribution and electronic nose is seen
as the potential technique for a fast and reliable method in the detection and discrimination of
khamar and non-alcoholic beverages.
97

Electronic noses are useful tools for khamar detection since its allowed identification and
finger printing of aroma. Over 1000 compounds were detected from beverages and sensory
evaluation is impossible to be implemented for the detection of large number of chemical
compounds (Noguerol-Pato, et al., 2009). Thus the usage of zNose
TM
to detect a large number of
chemical compounds is appropriate since the detection is based on the principal of gas
chromatograph which allows chemical compounds to elute at different time and then the
compounds will be detected by the sensitive surface acoustic wave (SAW) detector.
Khamar beverage discrimination using electronic nose has been already reported (Lozano
et al. 2008, Ragazzo-Sanchez et al. 2008, Ragazzo-Sanchez et al. 2006), but the studies on
discrimination of khamar and non-alcoholic beverage has not been perform. The aim of this
study was to develop a rapid method to discriminate the khamar and non-alcoholic beverage.
Methodology
Beverage samples
Four different brands of khamar and three different types of non-alcoholic beverages
were purchased from local suppliers. All samples were stored at -20
0
C in crew cap vials.
Electronic nose Analysis
Measurements were performed with a zNose
TM
Model 7100 vapor analysis system
(Electronic Sensor Technology EST, Newbury Park, CA). Ten grams of each beverage was
weighed into a vial of 40 ml sealed with a screw cap containing a septum. Then the sample vapor
was introduced into the electronic nose. The flow rate (helium) was fixed at 3.00 cm
3
, the SAW
sensor was operated at a temperature of 40
O
C, the column temperature was 40
O
C, the valve
temperature was 165
O
C, the inlet temperature was 200
O
C and the trap temperature was 200
O
C.
The detection started with the vapors entering a temperature-controlled inlet and then the
concentrated vapors was injected to the capillary column. The vapors then pass to a SAW
detector which record the amount and retention time of the compounds. In between each sample
measurement at least one blank and cleaning by methanol was run to ensure cleaning of the
system and stable baseline. All measurements were conducted in triplicate to ensure repeatability
and each measurement was conducted on different days.
Data analysis
98

The data was analyzed and samples were categorized into different groups using the
principal component analysis (PCA). Unscrambler software version 9.7 (CAMO AS, Trondheim,
Norway) was used for these analyses.

Electronic nose Analysis
Fig. 1 and Fig. 2 show the gallery of VaporPrint
TM
images for different types of khamar
and non-alcoholic beverage. These images are a chemical signature of an odour and this visually
display images provide an easier recognition for zNose
TM
user to distinguish different types of
beverage.

Fig. 1 VaporPrint
TM
of different types of khamar

Fig. 2 VaporPrint
TM
of different types of non-alcoholic beverage

Principal Component Analysis
The score plot PC 1 versus PC 2 from the analysis of khamar and non-alcoholic
beverages was shown in Fig. 3. The first PC described 48% of the variation and PC 2 described
another 17% of the variation which resulted in 84% of the total variance. The score plot also
showed two well separated groups of khamar and non-alcoholic beverage. PCA showed that
electronic nose is able to distinguish khamar and non-alcoholic beverages.
99

Fig. 3 PCA score plot of khamar and non-alcoholic beverages

PCA data loading was plotted in Fig. 4 to determine the variables that influenced the
separation of the samples. The contribution of the variable to the model is greater if the variable
is farther away from the origin. Based on PC 1, the components that cause the separation of the
samples were 11, 17 and 25, while components 9, 16 and 39 were responsible for the separation
of samples for PC 2.

Fig. 4 PCA loading plot of khamar and non-alcoholic beverages

100

Conclusion
The ability of zNose
TM
to quantitatively distinguish khamar and non-alcoholic beverages
was successfully demonstrated in this study. The rapid detection and the ability to produce aroma
VaporPrint
TM
image had increase the potential of this technique to be implemented for food and
beverage screening in food industry. The PCA analysis revealed that the khamar group was well
separated from the non-alcoholic beverage group. This indicated that zNose
TM
has good
sensitivity and selectivity to discriminate different types of khamar and non-alcoholic beverages.

References

Gan, H.L., Che Man, Y.B., Tan, C.P., NorAini, I., Nazimah, S.A.H. 2005. Characteristic of
vegetable oils by surface acoustic wave sensing electronic nose. Food Chemistry 89: 507-
518.

Lozano, J., Arroyo, T., Santos, J.P., Cabellos, J.M., Horrillo, M.C. 2008. Electronic nose for
wine ageing detection. Sensors and Actuators B 133: 180-186.

Lozano, J., Santos, J.P., Horrillo, M.C. 2008. Enrichment sampling methods for wine
discrimination with gas sensors. Journal of Food Composition and Analysis 21 (8): 716-723.

Marina, A.M., Che Man, Y.B., Amin, I. 2009. Use of the SAW sensor electronic nose for
detecting the adulteration of virgin coconut oil with RBD palm kernel olein. J Am Oil Chem
Soc.

Mart, M.P., Boqu, R., Busto, Olga, Guasch, J. 2005. Electronic noses in the quality control
of alcoholic beverages. Trends in Analytical Chemistry 24 (1): 57-66.

Noguerol-Pato, R., Gonzalez-Barreiro, C., Cancho-Grande, B., Simal-Gandara. J.
Quantitative determination and characterisation of the main odourants of Mencia
monovarietal red wines. Food Chemistry 117 (2009) 473484.

Ragazzo-Sanchez, J.A., Chalier, P., Chevalier, D., Calderon-Santoyo, M., Ghommidh, C.
2008. Identification of different alcohol beverages by electronic nose couple to GC. Sensors
and Actuators B 134: 43-48.

Ragazzo-Sanchez, J.A., Chalier, P., Chevalier, D., Ghommidh, C. 2006. Electronic nose
discrimination of aroma compounds in alcoholised solutions. Sensors and Actuators B 114:
665-673.

101

A32

Identification of Pork in Raw Meat using Porcine-specific Polymerase Chain
Reaction Assay
Khairil Mokhtar, N.F., Shuhaimi, M., Sazili, A.Q., Nordin, R., Che Man, Y.B
*
.
*corresponding author email: ycm@putra.upm.edu.my

Abstract
The porcine-specific polymerase chain reaction (PCR) assay was developed to detect the
presence of pork in raw meat either in pure or in a mixture with different meat species. A
porcine-specific DNA fragment could be amplified using porcine-specific primer designed based
on a porcine specific sequence of mitochondrial D-loop gene. Amplification of porcine DNA
produced 174 bp porcine-specific DNA fragment and no PCR products detected when assay
applied to DNA of other meat species confirming the specificity of the primers. The assay has a
high potential to be employed in detection of pork in raw meat products.
Keywords: Porcine-specific PCR assay, Mitochondrial D-loop gene, specificity, detection limit, sensitivity

1.0 Introduction

The problem of fraud and adulteration of meat products have been an issue since 1980s when the
price of meat and meat products increased. Unreliable labeling of the adulterated meat products
lead to consumer concern especially related to religious and health issues. For instance, pork and
its derivatives are prohibited in Islam and Jewish. Thus it demands for reliable techniques for
analysis and determination of species in meat products. Species-specific PCR assay utilizing
mtDNA D-loop gene sequences has been developed for some animal species such as chicken,
duck and pig (Sosa et al., 2000, Haunshi et al., 2009). In the present work, identification of
porcine species in raw meat products was developed using new porcine-specific fragment of
mtDNA D-loop gene.

102

2.0
3.0 Methods and Materials

3.1 Materials
Fresh raw meat samples of pork, beef, chicken, chevon, venison and mutton were
purchased from local wet markets in Selangor, Malaysia. The samples were stored frozen
at -20C until use to prevent enzymatic degradation of DNA.
3.2 DNA extraction
DNA extraction was performed using DNeasy Blood and Tissue Kit (Qiagen, Hilden,
Germany). Extracted DNA from different raw meat samples were visualized using
Florescence UV-Vis Imaging system (Alpha Innotech, USA).
3.3 Porcine-specific PCR assay
Porcine-specific PCR assay employing the newly designed primer based on porcine
specific fragment of D-loop sequence was tested on DNA of raw meat samples (pork,
beef, chicken, chevon, venison and mutton). The assay which is based on conventional
PCR was done on a Mastercycler Gradient PCR (Eppendorf, Germany). PCR reagents
were supplied from Qiagen.

4.0 Results and Discussion

PCR amplification of the porcine-specific D-loop fragment produces PCR product of
approximately 174bp (Fig. 1). In this experiment, no non-specific PCR product has been detected
in all replicates showing that the primer pair is highly specific to the D-loop sequences. The
porcine-specific assay was then cross-tested on several animal species (cattle, sheep, goat,
chicken, and deer). As expected, the 174bp band, an amplicon specific to the porcine were not
produced in all other animal species tested (Fig. 2). No other impurities such as product
degradation, primer-dimer and contaminants were observed. This concludes that the designed
primer can only specifically amplify porcine DNA and exclude other animal species DNA. The
primers sequence mismatch with the D-loop sequences of cattle, sheep, goat, chicken, and deer
cause the primer to be unable to bind and amplify the specific fragments.

103

Fig. 1: Electrophoresis analysis of porcine-specific PCR products from gradient PCR
amplification. M; DNA Ladder 100bp, 1-12: PCR products from amplification using porcine
DNA; C: Negative Control.

Fig. 2: Specificity test of porcine-specific PCR assay on various meat species. (A) M: DNA
Ladder 100bp, 1-5: chicken DNA, 7-10: sheep DNA, C: Negative control. (B) M: DNA Ladder
100bp, 1-5: cattle DNA, 7-10: deer DNA, C: Negative Control. (C) M: DNA Ladder 100bp, 1-5:
Goat DNA, C: Negative Control.
5.0 Conclusion

104

This study successfully developed a porcine-specific PCR assay based on mitochondrial D-loop
DNA sequence for detection of pork in raw meats. The assay is specific as such neither non-
specific amplification nor production of primer-dimer being detected. The data provided proves
that the use of the designed pork-specific primers is reliable, reproducible and specific. This
technique can be used for routine Halal authentication that requires sensitivity as high as possible.

References

Sosa, J.F.; Pesini, M.; Montoya, E.R.; Roncales, J.; Perez, P.; Martos, A.P. Direct and highly
species-specific detection of pork meat and fat in meat products by PCR amplification of
mitochondrial DNA. Journal of Agricultural and Food Chemistry 2000, 48, 28292832.

Haunshi, S.; Basumatary, R.; Girish, P.S.; Doley, S.; Bardoloi, R.K.; Kumar, A. Identification of
chicken, duck, pigeon and pig meat by species-specific markers of mitochondrial origin.
Meat Science 2009, 83, 454-459.

105

A33

Comparison of Bovine and Porcine Skin Gelatin based on Amino Acid
Composition, Polypeptide Pattern and Gel Strength
R.N. Raja Mohd Hafidz,Y.B. Che Man
*
, N. Anuar
Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor,
Malaysia
*corresponding authors e-mail: ycm@putra.upm.edu.my

Abstract

The ability to compare bovine skin gelatin (BSG) and porcine skin gelatin (PSG) based on their
amino acid content, polypeptide pattern and Bloom strength were investigated. Amino acid
composition analysis of the two types of gelatin showed that the content of glycine, proline and
arginine in PSG were higher than BSG. In the other hand, the Bloom strength of PSG and BSG
was determined in different pH value ranging from pH 3 to pH 10. Within this pH range, PSG
confer higher Bloom strength as compared to BSG. Both gelatins have the highest Bloom
strength at pH 9 while the lowest Bloom strength of BSG and PSG was at pH 3 and pH 5
respectively. However, there is no difference of polypeptide pattern between PSG and BSG as
both of them consists of and chains.
Keywords: Gelatin, amino acid analysis, polypeptide pattern, Bloom strength

1.0 Introduction

Gelatin is a hydrocolloid which has widespread use in food, pharmaceutical, cosmetic
and photographic industries. Generally, mammalian gelatin from bovine and porcine has been
utilized due to its high melting and gelling point and its thermo-reversibility properties. Gelatin
is a high molecular weight and water soluble protein (Jamilah and Harvinder, 2002). Only
tryptophan is absent in gelatin while methionine, cystine and tyrosine are found in low amount as
a result of degradation during hydrolysis process (Chapman and Hall, 1997). Different species
and type of tissue may differ in amino acid composition of gelatin which reflects the difference
of their chemical properties. The nature or severity of gelatin extraction conditions may also
affect its molecular weight distribution (Zhou and Regenstein, 2006). Thus, in this study, we aim
106

to investigate the difference between bovine and porcine skin gelatin based on amino acid
composition, polypeptide pattern and Bloom strength.

2.0 Materials and methods

2.1 Materials. Gelatins from bovine skin (type B) (BSG) and porcine skin (type A) (PSG) were
purchased from Sigma Co., USA.

2.2 Methods

2.2.1 Waters HPLC system Model 2695 (Milford MA, USA) equipped with online degasser,
auto injector and a multi-wavelength fluorescence detector Model 2475 was used to determine
amino acid content of BSG and PSG.
2.2.2 The polypeptide patterns of BSG and PSG were analyzed according to the method of
Laemmli (1970) by using Bio-Rad Laboratories SDS-PAGE system Model Mini-PROTEAN
Tetra Electrophoresis System (Hercules, CA, USA).
2.2.3 The Bloom strength of BSG and PSG was determined in different pH value range from pH
3 to pH 10 according to the method of Gelatin Manufacturers Institute of America, Inc. (GMIA,
2006) with a slight modification by using texture analyzer Model TA.HD PLUS Stable Micro
Systems (Surrey, England).

3.0 Results and discussion

Table 1 show the amount of amino acids in each gelatin tested. PSG contain high amount
of glycine (239.49), proline (151.29) and arginine (110.91) as compared to BSG with its glycine
(108.04), proline (63.02) and arginine (46.76). The effect of pH on the Bloom strength of BSG
and PSG in gel condition is shown in Table 2. Generally, the Bloom strength of PSG was higher
than BSG at all pH value where the highest Bloom strength value was determined at pH 9. This
was probably caused by higher proline content of PSG which play a great role in aggregation of
gelatin subunits. The amount of tyrosine and serine which had a free hydroxyl group in PSG
contributed more hydrogen bonds, hence increasing gel strength. This result complies with the
previous amino acid composition analysis in which PSG contains more tyrosine and serine as
compared to BSG.

107

Table 1. Amino acid composition of bovine and porcine skin gelatin (residues per 1000 total amino acid residues); BSG: bovine
skin gelatin; PSG: porcine skin gelatin.

Table 2. Gel strength of BSG and PSG at different pH value; BSG: bovine skin gelatin at 6.67% (w/v); PSG: porcine skin gelatin
at 6.67% (w/v)

The polypeptide patterns of both gelatins are shown in Figure 1. The separated bands
within the molecular weight range of 100-220 kDa were observed, representing and chain.
The differentiation of both gelatins through SDS-PAGE was difficult to be made due to the same
profiles of polypeptide pattern. There were two additional polypeptide bands (Figure 1) within
the range of 45-100kDa observed in PSG but not appear in BSG. However, this difference may
be due to the presence of non-collagen residues.
108

Figure 1: Polypeptide pattern of bovine and porcine skin gelatin. M: protein marker, BSG: bovine skin gelatin; PSG: porcine
skin gelatin; and chains: polypeptide component of gelatin. The marked box show additional bands.

4.0 Conclusion

The bovine and porcine skin gelatin was able to be differentiated based on amino acid
composition analysis and Bloom strength although their polypeptide patterns cannot be used to
distinguish the origin of gelatin. This preliminary study can be further improved by testing other
source of gelatin with different acid or alkaline treatments.

References
Chapman & Hall (1997). Thickening and gelling agents for food, 2
nd
edition. Blackie Academic
& Professional, London. Pp. 150-153.

Gelatin Manufacturers Institute of America, Inc. (GMIA) Standard methods for the testing of
edible gelatin. Gelatin Manufacturers Institute of America, Inc. Revised 2006.

Jamilah, B. & Harvinder, K.G. (2002). Properties of gelatins from skins of fish-black tilapia
(Oreochromis mossambicus) and red tilapia (Oreochromis nilotica). Food Chemistry, 77, 81-84.

Laemmli, U.K (1970). Cleavage of structural proteins during assembly of head of bacteriophage
T4. Nature, 277, 680-685.

109

Zhou, P. & Regenstein, J. M. (2006). Determination of total protein content in gelatin solutions
with the Lowry or Biuret Assay. Journal of Food Science, 71 (8), C474-C479

110

A35

Analysis of Alcohol in Cosmetic Products by Headspace Gas
Chromatography Mass Spectrometry

Puziah Hashim
*
, Yaakob Che Man, Norrahimah Kassim

Halal Products Research Institute, Universiti Putra Malaysia, Putra Infoport,
43400 UPM Serdang, Selangor, Malaysia
*
Email: puziah_h@putra.upm.edu.my

Abstract

The Muslim consumers are very concerned of the presence of alcohol, in particular the presence
of ethanol in cosmetic products. Nowadays, there are many cosmetic products in the market
being labelled and claimed to be alcohol-free. In this study, our aim is to analyse the alcohol
content in cosmetic products claimed to be alcohol-free using the headspace gas
chromatography-mass spectrometry (GC/MS) method. The linear concentration range is 1-
1000ppm and the correlation coefficient is relatively good (R
2
=0.99270.) The method is very
sensitive as the detection limit (LOD) and the limits of quantification (LOQ) of the ethanol are
approximately 7ppb and 34ppb, respectively. Eleven samples of cosmetic product were analysed
and the concentration range were 7ppb-600ppm.
Key Words: headspace, GC/MS, ethanol, cosmetic, alcohol.
Introduction
The increasing awareness of the Muslim consumers has created a growing demand for cosmetic
products with halal certification with regards to their sources, ingredients used, and the manner
the products are being processed. In addition, there is growing interest in products of safe and
high quality (1). Alcohol in cosmetics refers to ethanol (ethyl alcohol). Muslims are prohibited
from consuming alcohol even in small quantities (2). It is allowed to use in cosmetic products as
long as it is not of the alcoholic beverages or khamr (3, 4). However, many Muslims are
concerned of the presence of alcohol in the cosmetic products, in particular the ethanol. They
prefer those products with no alcohol. To prevent the alcohol in a cosmetic product from being
illegally used as an alcoholic beverage, it may be denatured. This means that it contains an
added denaturant which are chemicals that makes it poisonous to drink (5). Many of the
poisons added are neurotoxic such as gasoline, acetone, formaldehyde, pine tar and even
111

kerosene (6). This highly purified form of alcohol is used in cosmetics as a vehicle to deliver
ingredients to the skins surface. SD Alcohol evaporates almost instantly, which makes it an
ideal base for fragrances and toner or astringents. Ethanol can cause irritation and dryness to
skin. Consumers who have problem with acne, wrinkles, dry skin or oily skin would like to avoid
cosmetic products that contain alcohol, SD alcohol, or denatured alcohol (7).
In this study, our aim is to analyse the alcohol content in cosmetic products claimed to be alcohol
free using the headspace gas chromatography-mass spectrometry (GC/MS) method.
Apparatus
Gas chromatograph (GC System 7890A) coupled with triple axis detector model 5975C and link
with Network Headspace Sampler model G1888 from Agilent Technologies were used to detect
ethanol in cosmetic products. The GC is equipped with a DB-624 capillary column 30 m length,
320 m diameter, 1.8 m film thickness (J & W Scientific), in the temperature program from
20
o
C to 260
o
C. Helium is a carrier gas flowed at 7.5mL/min with a 5:1 split ratio with pressure
of 1.8804 psi.
Reagents and chemicals
Ethanol analytical grade (99.9% purity) were purchased from Merck (Darmstadt, Germany) and
used as standard.
Standard, LOD and LOQ determination
Calibration standards in the range of 5, 10, 200, 400, 1000ppm were prepared by serial dilutions
of the stock solution (1000ppm). For the LOD and LOQ determinations, a range of serial
dilutions of 5ppb, 7ppb, 34ppb, 50ppb and 100ppb were prepared. For the LOD and LOQ
determinations 7 replicates of standards are used.
Samples
Samples of cosmetic products (cleanser, toner and perfume) claimed to be free alcohol content
on the label were purchased from the market.
Procedure
All samples and standards are prepared in triplicates. One millilitre of cosmetic product was
sealed in a 20 ml headspace glass vial with an aluminium-coated silicone rubber septum. The
analysis of ethanol using headspace GC-MS were carried out using method from Agilent
Technologies with slight modifications (8). After 5 min equilibration at the sample is extracted
112

into a loop and equilibrates again for 0.5 min at 80
o
C, followed by sample injection. The GC
was programmed from 50
o
C to 200
o
C with a holding time of 2 min for every 50
o
C and the total
run time of the analysis was 7.2 min.
Result and discussion
The linear concentration range of the ethanol standards was 1-1000ppm and the correlation
coefficient was relatively good with R
2
=0.99270 (Fig. 1). The method was very sensitive as the
detection limit (LOD) and the limits of quantification (LOQ) of the ethanol were approximately
7ppb and 34ppb, respectively. Figure 2 show a typical GC-MS ethanol chromatograms obtained
from sample and standard with a retention time of ethanol standard at 2.341 min. Eleven samples
of cosmetic products were analysed and the concentration range were 7ppb-600ppm (Table 1).
Even though the cosmetic products were labelled and claimed as free of alcohol, the products can
be detected to contain very low level of alcohol. The presence of alcohol may be due to the
carried over ingredients in the formulation of the cosmetic products itself.

Fig. 1. Calibration curve of ethanol
113

Fig. 2. Chromatograms of ethanol standard and cosmetic product
Table 1. Ethanol content in cosmetic product
Cosmetic Product Ethanol (ppm) Ethanol (%)
1.Cleanser A 2 0.0002

2.Toner A 2 0.0002
B N.D at 7ppb N.D
C 300 0.03

3.Perfume B 100 0.01
D 200 0.02
E 300 0.03
F 100 0.01
G 100 0.01
Atar A 100 0.01
Atar B 600 0.06

Note: ND not detected

Conclusion
The Headspace GC/MS is a rapid and sensitive technique to detect the present of ethanol in
cosmetic products. Varies low concentration levels (7 ppb600ppm) of ethanol in cosmetic
products have been detected in products claimed to have no alcohol content.

114

Acknowledgments
This study was carried out with the financial support of eScience Fund project no. 5450353-
10205 awarded to Prof. Dr. Yaakob Che Man, Halal Products Research Institute, Universiti Putra
Malaysia, Serdang Selangor.

References
1. Halal Awakening for the Middle East, The Halal Journal (2009), retrieve from
http://www.halaljournal.com/article/3355/halal-awakening-for-the-middle-east
2. Al-Qardawi, Y. (ed). The Lawful and the Prohibited in Islam. Islamic Book Trust, Kuala
Lumpur (1995)
3. Department of Standards Malaysia (DSM). (ed). Malaysian Standard MS 2200: Part
1:2008 Islamic Consumer Goods part 1: Cosmetic and personal Care - General
Guidelines. Standard Malaysia (2008).
4. Brunei fatwa of the State Mufti (ed). Issues on Halal Products, State Muftis Office,
Prime Ministers Office, Brunei Darussalam, pp. 219-231 (2007)
5. United States (US) Food and Drug Administration, Alcohol free, In Cosmetic Labelling
and Label Claims, Revised on March 7 (2000).
6. Bone, A.B. Alcohol in astringents, toners,and other cosmetics, healthy and green living.
Available at http://www.care2.com/greenliving/alcohol-in-toners-cosmetics.html (1999)
7. Alcohol in cosmetics, available at http://www.savyskin.com/alcohol-in-cosmetics
8. Data sheet from Agilent Technologies, Solvent Retention Data for DB-624, DB-1, and
DB-WAX Columns, available at http://www.chem.agilent.com/EN-
US/SUPPORT/Pages/default.aspx

115

Innovation of Halal Products

A04

Effects of Pre-treatment on Mechanical and Nano-Structural Properties of
Fish Gelatin Extracted from Perch (Lates niloticus)

Hammed Ademola
1
, Irwandi Jaswir
1,2*
and Hamzah Mohd. Salleh
1,2

1
Department of Biotechnology Engineering
2
Halal Industry Research Centre,
International Islamic University Malaysia

Abstract
Although fish gelatin production is still low, factors such as outbreak of BSE (mad cow
disease) and increasing demand for non-mammalian gelatin for halal and kosher food markets
have revived interest in gelatin produced from fish raw materials. This study was conducted to
determine the effects of pretreatment solutions on the mechanical and nano-structural properties
of the fish gelatin extracted from perch (Lates niloticus). Four types of pre-treatment solution
were used during fish gelatin extraction in this study. They were acetic acid (A), acetic acid-
NaCl (AS), acetic acid-NaOH (AB) and acetic acid-NaOH-NaCl (ABS). Results showed that
each pretreatment gave different nano imaging patterns; A (fibril), AS (zig-zag cracks), AB
(straight rods) and ABS (cross-linked rods). Cross-linked rods observed in ABS denote adequate
removal of non-collagen content of the fish skin and increase its surface area. Consequently,
several junctions formed in ABS during gelation enhanced water entrapment, thus highest in gel-
strength. Analyses of gel-yield and gel-strength for ABS sample were 22.84% and 179.84,
respectively, whereas for other samples were AS (21.86%, 78.61), AB (20.55%, 146.97) and A
(19.02%, 5.6) respectively. Hence, ABS is suggested as the best pretreatment for perch fish
gelatin.
Key words: FESEM, gelatin, nano-structure, extraction, gel-strength

INTRODUCTION
Gelatin sourced from fish has been identified as the most safe and acceptable mostly due
to its Halal status and also its epidemic free nature as compared to other counterpart sources i.e
116

porcine, bovine and pig. Consequently, opportunity to market for alternative materials like fish is
open up (Hongshun et. al., 2007).
Generally, mammalian gelatin has high bloom value compared to fish gelatin.
Nanotechnology has the potential to impact many aspects of food and agricultural systems
(Weiss et al., 2008). Nano structures of gelatin have been produced in order to correlate the
structural information obtained with physical properties (Wang and Yang, 2008). Some recent
works for nano structural analysis of gelatin involve the use of Atomic Force Microscopy (AFM)
and Scanning Electron Microscopy (SEM) by Wangtueai and Noomhorm (2009) respectively.
Extraction conditions have been identified as major influencing factors that may affect
the composition and distribution of hydrophobic amino acid, which influences the physical
properties of gelatin, even more than the imino acid content (Mentero and Gomez-Guillen,
2000). Pretreatment of fish skin for gelatin extraction are conducted by acid, base and salt. These
can be used singly or combined. Gimenez et al. (2005) used only acid, Mentero and Gomez-
Guillen (2000) used acid, salt and base, Yang et al. (2008) used both acid and base and Zhou and
Regenstein (2005) used acid and base. All these pretreatment have different impact on the
collagen structure and thus the resulting gelatin. Hence, the focus of this work is to analyze the
effects of various pretreatments on nano-structure, gel-strength, and yield of gelatin from perch
fish.

MATERIALS AND METHODS
Gelatin Extraction
Frozen perch fish was obtained from a local supermarket (Kompleks Idaman, Gombak Selangor)
and transported in frozen condition to the laboratory where their skins were peeled, washed with
water (4
o
C) and cut into small sizes (2-3 cm squares). Pretreatment solutions (0.115% acetic
acid, 0.2% NaOH and 0.1 M NaCl) were prepared and kept at ~ 4
o
C. The skins were divided
into four groups, each groups weighing at least 30 g, namely A, AB, AS and ABS. Group A was
pretreated with only acetic acid, AB pretreated with NaOH and then acetic acid, AS pretreated
with acetic NaCl and then acid while ABS was pretreated with NaCl followed by NaOH and then
acetic acid. Pretreatment timing are; NaCl (24 hrs), NaOH (3 hrs) and acetic acid (84 mins).
After every pretreatment, the skin was adequately washed (3 times) with water and drained using
four layers of cheesecloth. Ratio of skin to solutions/water is 1:6 (w:v) while temperature of
117

solutions and water was ~ 4
o
C. Extraction was performed with distilled water in a water bath at
55
o
C for 3 hours. The solution was filtered through four layers cheesecloth and the filtered
solution was kept at -20
o
C.

Determination of Gel-Yield
Protein concentration gelatin solution was determined by Biuret method and gel-yield was
calculated using the equation below.

Determination of Gel-Strength
Gelatin solution was adjusted to 3.3% protein concentration and then gel-strength was
determined after allowing the solution to mature for 16-18hr at 10
o
C using a Universal Texture
analyzer.
FESEM Imaging
Powdered samples of lyophilized gelatin was mounted each on Forced Emission Scanning
Electron Microscopy (FESEM, JEOL JIM-5600), subjected to prefixing by cold slush Nitrogen
(cryo-fixation) and then viewed for their nano structures with aid of computer.

RESULTS AND DISCUSSION
Gel-Yield and Gel-Strength
The gel-yield as a function of protein content is lowest in gelatin pretreated with acid (17.88%)
followed by acid-base (19.00%), then acid-salt (24.11%) and highest in acid-base-salt (24.74%).
These results suggest that additional pretreatment with alkaline and salt enhance gelatin
extraction from the skin of fish.

118

Fig. 1: Gel-Strength at 3.3% protein concentration
Combination of these three pretreatment solutions have different contributive effects on partial
denaturation of collagen structure which reflect in its conversion to gelatin and release into water
during water extraction. Likewise the gel-strength is highest in ABS and lowest in A as could be
seen in Fig. 1. In contrast to gel-yield, AB is higher than AS given alkaline an edge over salt in
terms of mechanical property. This observation has also been noticed by Peng and Joe (2005)
that application of alkaline solution not more than 0.1 M favors high gel strength.
Effect of Pretreatments on Nano Structure of Gelatin
The nano structure of gelatins obtained from the four pretreatments are shown in Fig. 2a d.
Different patterns of the nano images were obtained supporting the fact that acid, alkaline and
salt have different effects on the nanostructure of gelatin. Figure 2a shows fibril structure for
gelatin treated with only acetic acid which is the same as that obtained by Yang et al. (2008).
Figures 2b, 2c and 2d show that additional hydrolysis occurred due to alkaline and/or salt
resulting into overlapping straight rods, zig-zag cracks and crosslink rods for acid-alkaline, acid-
salt and acid-alkaline-salt respectively. It is evident that the pretreatments have direct impact on
the primary structure of the polypeptides by hydrolysis of collagen at different amino acid
locations which also agrees with Yang et al. (2008).

(b) AB: Overlapping straight rods
(d) ABS: Cross-linked rods (c) AS: Zig-zag cracks
(a) A: Fibril pattern
Fig.2: Nano-structure of gelatin at
100
119

Although, Zhou and Regenstein (2005) only associated alkaline to breaking of some polypeptide
chains of collagen into small pieces, salt also initiate other effects. In fact salt causes irregular
cracking of collagen structure which proof greater impacts on primary structure than alkaline.
The crosslink rods in Fig. 2d reveals the popular collagen tubular structures originally formed
from coils of triplex strands of primary structures (protein backbone) but now in disarranged
manner due to combine effect of acid-alkaline and salt. The alteration of helical properties is
vividly clear from this image. The upshot structure noticed in Fig. 2d is associated with the
agglomeration of salt due to uneven distribution during application.
CONCLUSION
We have shown that acid, alkaline and salt solutions have different effects on gelatin nano
structure, gel yield and mechanical properties. These three solutions are additive in nature and
their combination is best for pre-treating fish skin for gelatin production. Optimization study is
ongoing.
REFERENCES
Gimenez, B., Go mez-Guille n, M. C., and Montero, P. (2005). The role of salt washing of fish
skins in chemical and rheological properties of gelatin extracted. Food
Hydrocolloids, 19: 951957.
Hongshun Yang, Yifen Wang, Mingkang Jiang, Jun-Hyun Oh, Josh Herring, and Peng Zhou
(2007) 2-Step Optimization of the Extraction and Subsequent Physical Properties
of Channel Catfish (Ictalurus punctatus) Skin Gelatin.JCF C: Food Chemistry
and Toxicology, 72: 4.
Karim A.A. and Rajeev Bhat (2008) Gelatin alternatives for the food industry recent
developments, challenges and prospects. Trends in Food Science and Technology
19: 1664-656.
Montero, P., & Go mez-Guille n, M. C. (2000). Extracting conditions for megrim
(Lepidorhombus boscii) skin collagen affect functional properties of the resulting
gelatin. Journal of Food Science, 65:434438.
Wangtueai S. and Noomhorm A. (2009) Processing optimization and characterization of gelatin
from lizardfish (Saurida spp.) scales LWT - Food Science and Technology
42:825834
120

Weiss J., Takhistov P., and McClementsd. J. (2006) Functional Materials in Food
Nanotechnology. Journal of Food Science 71:107.
Yang H, Wang Y. and Joe R. M. (2008) Characterization of Fish Gelatin at Nanoscale Using
Atomic Force Microscopy. Food Biophysics 3:269-272.
Zhou Peng and Regenstein Joe M. (2005) Effects of Alkaline and Acid Pretreatments on Alaska
Pollock Skin Gelatin Extraction. Journal of Food Science, 70:392.

121

A19
Characterization of Collagen from Freshwater Fish Skin
Umi Hartina, M.R.
a
Jamilah, B.
a,b
, , Dzulkifly, M.H.
a,b
, Sazili, A. Q.
a,c

a
b
Faculty of Food Science and Technology
c
Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor

Abstract
Collagen extraction from the skins of barramundi and tilapia were carried out using mild acid
treatment. The yield and physico-chemical properties of the extracted collagen were evaluated.
The yield, proximate composition, colour, odour, and amino acid profiling of the extracted
collagen was determined. The collagen, obtained from the skins of barramundi (Lates calcarifer)
and red tilapia (Oreochromis nilotica) had a yield between 40 % and 44 % by weight. The colour
of tilapia skin collagen is different from that of barramundi skin collagen. Both of the collagens
were basically colourless and odourless. The predominant amino acids were glycine, proline,
alanine and arginine.
Keywords: Collagen, acid treatment, physic-chemical properties, amino acid profiling
Introduction
Collagen for industrial application is generally produced from traditional sources such as bovine
and porcine skins and bones. Porcine collagen is unacceptable for some religious followers such
as the Muslim, Jews and Hindus. Those from bovine sources are at risk of contamination with
bovine spongiform encephalopathy (BSE) (Choi and Regenstein, 2000). As a consequence,
increasing attention has been paid to alternative collagen sources, especially fish skin and bone
from seafood processing wastes. About 30% of these wastes consist of skin and bone, which are
very rich in collagen (Gomez-Guillen et al., 2002). Recent interest has been focused on aquatic
sources as an alternative raw material for collagen production (Jongjareonrak et. al., 2005;
Zhang et. al., 2007; Skierka and Sadowska, 2007).

Production of freshwater fish from aquaculture activities has grown tremendously in Malaysia
and world-wide. Barramundi (Lates calcarifer) and red tilapia (Oreochromis nilotica) are
122

currently cultured in Malaysia, and are marketed in the live and filleted forms. Fish skins,
comprising of about 10-12% of the whole fish is discarded during the filleting process. Presently,
the common utilizations of fish skins are for fishmeal and for organic fertilizer. Therefore, as an
attempt to increase the value of the waste and the need to overcome the issues related to
mammalian collagen, the aim of this study was to investigate the potential use of barramundi and
tilapia skins as collagen source.
Sample Fresh barramundi (Lates calcarifer) and red tilapia (Oreochromis nilotica)
Collagen extraction Extraction of collagens were carried out according to Nalinanon et al. (2007)
and Yata et al. (2001) for barramundi and red tilapia skin, respectively.
Analyses Protein content was determined according to AOAC (1995) standard procedure. Color
measurements were made using Hunterlab Ultrascan Sphere Spectrocolorimeter (Minolta Cr-300
Series, US) and the odour characteristics of collagens were analyzed using the electronic nose,
zNose (7100 Vapor Analysis System, Electronic Sensor Technology, New Bury Park, USA).
Amino acid compositions of collagens were determined using high performance liquid
chromatography (HPLC) (Waters 2690/5, Waters Co., Milford, USA).
Results
Table 1: The yield, protein content and instrumental colour of collagen from the skins of barramundi
red tilapia.
1

1

Val
ues
wer
e
mea
ns
stan
dar
d deviation of three replicates. Values with the different superscripts within each row were
significantly different (p< 0.05).

Properties

Barramundi collagen Red tilapia collagen
Yield (% dry basis) 43.911.19
a
40.154.55
a

Protein content (%) 92.50.96
a
25.831.01
b

Hunter colour values
1

L
a
b

44.760.02
a

0.740.02
a

2.140.04
a

94.630.3
b

-0.650.04
b

7.240.37
b

123

Table 2: Amino acid composition of collagen from barramundi and red tilapia skins (mg/g).
Amino acid
(mg/g)
1

Barramundi skin collagen

Red tilapia skin collagen
Gly 192.080.31 69.092.21
Arg 83.160.08 32.910.84
Ala 88.900.12 34.471.05
Pro 127.720.07 51.543.11
Total 760.92 268.64
1
Values are presented as the mean SD of duplicates sample. ND- not detected

Figure 1: Amino acid chromatogram of collagen Figure 2: Amino acid chromatogram of collagen
from barramundi skin from red tilapia skin

Figure 3: Odour profiles of extracted collagen

(a) Barramundi collagen (b) Red tilapia collagen
Discussion
Yields of collagen (dry weight basis) extracted from the two fish species were not significantly
different (p>0.05). The yields were similar to those reported for ocellate puffer fish (44.7 %)
(Nagai, Araki & Suzuki, 2002) and for and grass carp fish (46.6 %) (Zhang et al., 2007). The
protein content of collagen samples is given in Table 1. Protein content of collagen from
barramundi skin was 4-fold higher than that of red tilapia skin. Barramundi collagen also had
higher protein content than collagen from bigeye snapper skin (94.0%) (Kittiphatanabawon et.
al., 2005). Collagen from red tilapia skin exhibited whiter appearance compared to barramundi
collagen. Hunter colour values of collagen extracted from the two different fishes are as shown
in Table 1. L value of collagen from red tilapia skin was significantly higher than that from
barramundi skin. This corresponds with the visual observation made. Odour properties of the
124

extracted collagen characterized using electronic nose are as shown in Figure 1. The collagens
are characterized as odorless based on the peak distributions from the chromatogram. Total
amino acids content (mg/g) of the collagens is shown in Table 2. Barramundi collagen had
higher total amount of amino acid than the red tilapia. The major amino acids found in both
samples were glycine, proline, alanine and arginine, in descending order.
Acknowledgment
The authors would like to thank Universiti Putra Malaysia for the financial support. (Research
Grant Research University Grant Scheme (RUGS) No. 91022.
Conclusion
Barramundi (Lates calcarifer) and red tilapia (Oreochromis nilotica) can be a viable source for
commercial collagen and may find many usage for both food and non-food applications.
References
AOAC (1995).Official Metohd of Analysis. Assoc. off. chem. Washington D.C., USA.
Choi, S. S., & Regenstein, J. M. (2000). Physicochemical and sensory characteristics of fish
gelatin. J. Fd. Sc., 65, 194199.
Gomez-Guillen, M. C., Turnay, J., Fernandez-Daz, M. D., Ulmo, N., Lizaebe, M. A., &
Montero, P. (2002). Structural and physical properties of gelatin extracted from different marine
species. Fd. Hyd., 16, 2534.
Jongjareonrak, A., Benjakul, S., Visessanguan, W., Nagai, T., & Tanaka, M. (2005). Isolation
and characterization of acid and pepsin-solubilised collagens from the skin of Brownstripe red
snapper (Lutjanus vitta). Fd. Chem., 93, 475484.

Kittiphattanabawon, P., Benjakul, S., Visessanguan, W., Nagai, T., & Tanaka, M. (2005).
Characterisation of acid-soluble collagen from skin and bone of bigeye snapper (Priacanthus
tayenus). Food Chemistry,89:363372.

Nagai, T., Araki, Y. & Suzuki, N., (2002). Collagen of the skin of ocellate puffer fish (Takifugu
rubripes). Fd. Chem., 78: 173-177.

Nalinanon, S., Benjakul, S. Visessanguan, W. & Kishimura, H. (2007). Use of pepsin for
collagen extraction from the skin of bigeye snapper (Priacanthus tayenus). Fd. Chem., 104:593-
601.

125

Skierka, E., and Sadowska, M. (2007). The influence of different acids and pepsin on the
extractability of collagen from the skin of Baltic cod (Gadus morhua).Fd Chem. 105:1302-1306

Yata, M., Yoshida,C., Fujisawa, S., Mizuta, S., & Yoshinaka, R. (2001). Identification and
characterization of molecular species of collagen in fish skin. J. Fd. Sc., 66(2):247-251

Zhang, Y., Liu, W., Li, G., Shi, B., Miao, Y., and Wu, X. (2007) Isolation and partial
characterisation of pepsin-soluble collagen from the skin of grass carp (Ctenopharyngodon
idella). Fd. Chem. 103:906-912

126

A37

Sol Gel Transition Of Konjac Glucomannan
Siti Aisyah, M.B, Mat Hashim, D*, Shuhaimi, M.
Halal Products Research Institute, Universiti Putra Malaysia, 43400 Serdang, Selangor,
Malaysia.

*corresponding author: dzulkifly@gmail.com

Abstract
Konjac glucomannan (KGM) is a high molecular weight plant found in tubers of the
Amorphophallus konjac. Due to adulteration of porcine gelatine in pharmaceutical products,
KGM obtained an ideal characteristic which can be developed as substitute to gelatine. The
transition from the liquid state (sol) to the solid state (gel) is called the sol-gel transition and the
critical point for the transition is defined as the gel point. To study a gelling material, it is
important to have a method to determine the gel point in an accurate and reproducible manner.

Keyword: sol gel transition, konjac glucomannan, gel point.

Introduction
Gelatine is a very critical food additive in the whole world especially to the Muslim ummah due
to the halal issue. Gelatine plays its role in many applications especially in the pharmaceutical
and cosmetics, food, biotechnology and fine chemical industries (Zhang, et al., 2005). Demand
for the gelatine was increasing in every year. Gelatine is derived from animal bones or skin.
Commonly, gelatine available in the market is made from pigs derivative due to its abundance,
easily available and more efficient in production. However, gelatine made from cattles bones
and skin, sea weed, vegetables also can be obtained from the market but the amount is very
small. Gelatine made from cattles bones and skin still cannot be consumed by Muslim unless the
cattles slaughtering are done in halal manner.

127

There have been increasing efforts by various parties to find alternative to the gelatine. For
Malaysia and Islamic communities, the halal requirement is one of he main drivers for these
efforts. Many works have been done to search for the altenatives. Gelatine sourced from fish,
see weed and vegetable are become an interest materials for many researchers.

In this preliminary work, sol gel transition behaviours of konjac glucomannan from tubers of
Amorphophallus konjac have been studied. This rheological characteristic should be similar or
closes to gelatine in form of gelling and melting temperature.

Methodology
Materials and method
A sample of refined KGM powder was obtained from Konjac Food, Sunnyvale, USA and was
used without further purification. Samples of KGM powder were then accurately weight and
dispersed in distilled water at room temperature with stirring using magnetic stirrer until it
completely dissolved (Karim, et al.,2005).

Rheological analysis
Rheological properties were studied with a stress-controlled rheometer AR-G2 (TA Instruments).
The cone-and-plate geometry with 60mm cone diameter, 1 cone angle and 23m gap have been
used for the rheological measurements. The sample is loaded between the cone-and-plate discs.
A thin layer of paraffin oil was spread over the outer edge of the sample to prevent evaporative
loss during measurement. For the dynamic rheological experiments, a strain sweeps were
performed at a frequency of 1 Hz at 25 C to determine the linear viscoelastic region of the
samples. A value of the strain which lies within the linear viscoelastic region is used in the
setting of the strain in the temperature sweep measurement .

The two main parameters determined in a dynamic rheological test are the elastic modulus, G,
and the viscous modulus, G. The elastic modulus is a measure of the solid-like response of the
material, whereas the viscous modulus is a measure of the liquid-like response of the material.
All dynamic measurements were obtained at a frequency of 1 Hz and a strain of 1% (Chiou et al.,
2006).
128

The samples were cooled at a rate of 1 C min
-1
from

70 to 15C and subsequently heated from
15 to 70C at the same heating rate. The transition temperature of melting was determined as the
cross-over point of the storage (G) and the loss moduli (G).

Result and discussion

From figure 1, at delta 45, the gelling temperature of KGM is at 29.7C while figure 2 showing
the melting temperature of KGM take place at 31.0C at the same delta degree. Intercept point at
delta 45 have to be considered because at this point, material will transform to a gel form from
liquid like or solid like initially. Gelling and melting temperature of KGM should be closed to
body temperature because gelling and melting temperature of porcine gelatine most similar to
body temperature. Thus further work must be done to get an ideal mix for KGM with other
substances in order to have an alternative to haram gelatine sources from plant base.

Figure 1. Elastic and storage modulus versus
temperature for 1.2% of KGM at temperature
ramping from 70 to 15C.
Figure 2. Elastic and storage modulus versus
temperature for 1.2% of KGM at temperature
ramping 15 to 70C.
129

Conclusion
KGM possess an unique thermal transition properties. Eventhough the sol gel temperature are
not likely to be as body temperature, but KGM have potential to be gelatin substitute. Further
effort have to put on to realizing a plant base gelatine.

Reference:

A.A. Karim, Y.P. Chang, M.H. Norziah, F. Ariffin, M.Z. Nadiha, C.C. Seow (2005). Exothermic
events on heating of semi-dilute konjac glucomannan-water systems. Carbohydrate Polymers,
61, 368-373.

Bor-Sen Chiou , Roberto J. Avena-Bustillos , Justin Shey , Emma Yee , Peter J. Bechtel , Syed
H. Imam , Greg M. Glenn , William J. Orts (2006). Rheological and mechanical properties of
cross-linked sh gelatins. Polymer, 47, 6379-6386.

Ying-qing Zhang, Bi-jun Xie, Xie Gan (2005). Advance in the applications of konjac
glucomannan and its derivatives. Carbohydrate Polymers, 60, 27-3.

130

A36

The Effects of Ozone on the Germination of Brown Rice
M. Z. Nor Nadiha
a
, N. H. Nor Irmey
a
, D. M. Hashim
a*
, R. Z. Haroun
b
a
Halal Products Research Institute, University Putra Malaysia, Putra Infoport, 43400 UPM
Serdang, Selangor, Malaysia.
b
Microscopy Unit, University Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.
dzulkifly@gmail.com

1. Introduction
Rice had been consumed as staple food in east region through over decade. According to
Agriculture Organization of the United Nation (2002), the consumption of rice worldwide
increases more than 500 Kcal per capita, which indicated high demand in rice market. The
increasing of rice consumption and the reduction of physical activity might accelerate the
occurrence of many health-related problems such as diabetes, obesity and cancer. Owing to
that reason, germinated brown rice had been introduced in rice market. Germinated Brown
Rice (GBR) is produced through germination by soaking the brown rice Brown Rice (BR) in
the water. GBR contain higher nutritional content such as vitamins, mineral and fibre as
compared to white rice. Furthermore, -aminobutyric acid (GABA) content in GBR is five
times higher than brown rice (Komatsuzaki, 2005). GABA is the neurotransmitor that can
induce hypotensive and diuretic effects (Okada et al., 2000) and that it is involved in the
regulation of cardiovascular functions, such as blood pressure (Hayakawa et al., 2004).
GABA also has a role in prevention of chronic alcohol-related diseases (Oh, Soh, & Cha,
2003), inhibits leukaemia cell proliferation, and stimulates cancer cell apoptosis (Oh & Oh,
2004).
At the same time, many methods have been developing to optimize the germination
process. Ozonation is one of the new methods that have been developing to increase the
germination process. Ozone is widely used as antimicrobial agent, plant sanitation and food
hygiene. The use of ozone in germination process has not been fully discovered. This
research attempted to study the effect of ozonation on the germination of brown rice.

131

2. Materials and methods
2.1 Materials
Brown rice was purchased from Kompleks Bernas, Tanjung Karang, Selangor
Malaysia.
2.2 Methods
2.2.1 Germination of Brown Rice
Rice germination method was adopted from Barka et al. (2004) with some modification.
Briefly, brown rice was ozonate for 0, 10, 20 and 30 min using Top-Ozone (F5-505). Then,
the ozonate brown rice was soaked at 30C in water bath for 8 hours. For germination, the
brown rice was spread on aluminium dishes and incubated at 30C for 15 hours. The
germinated rice was then allowed to dry at 38C for 24 hours.
2.2.2 Scanning Electron Microscopy
The elongation of germinated brown rice was observed using a scanning electron
microscope (Leo 1455 VPSEM, UK). Samples were mounted onto aluminium stub using a
double-slided carbon tape and coated with 100-200 thickness of gold.

(a) (b)

(c) (d)
132

Fig 1: Elongation of germinated brown rice with different ozonation times (a) 0 min, (b) 10
min, (c) 20min, (d) 30 min.
Figure 1 (a-d) and Fig 2 shows the elongation of germinated brown rice with different
ozonation time. It is observed that the ozonation can give significant effect of brown rice
elongation during germination. According to Hill & Rice (1982), ozone will easily degrade to
oxygen in solution. Thus, the soaked brown rice with ozonate water can generate the
production of oxygen (O
2
) for brown rice. It is believed that the production of O
2
resulted in
increased of mitochondrial respiration of the seeds and promoted the breaking process of the
seed and allowed the seeds to interact with water (Ogawa and Iwabuchi, 2001).

Fig 2: The elongation of germinated brown rice in different ozonation time
4. Conclusion
The ozonation of brown rice can exhibit the promotion of germination. Longer time of
ozonation increased the O
2
concentration in solution, thus enhanced the elongation of
germination.
References
Hayakawa, K., Kimura, M., Kasaha, K., Matsumoto, K., Sansawa, H., & Yamori, Y. (2004).
Effect of c-aminobutyric acid-enriched dairy product on the blood pressure of spontaneously
hypertensive and normotensive WistarKyoto rats. British Journal of Nutrition, 92, 411417.

133

Komatsuzaki, N., Tsukahara, K., Toyoshima, H., Suzuki, T. Shimizu, N., Kimura, T. (2007).
Effect of soaking and gaseous treatment on GABA content in germinated brown rice. Journal of
Food Engineering, 78, 556-560.
Oh, C. H., Oh, S. H. (2004). Effect of germinated brown rice extracts with enhanced levels of
GABA Mal J Nutr on cancer cell proliferation and apoptosis. Journal of Medicinal Food, 7 (1),
19-23.

Oh, S.-H., Soh, J.-R., & Cha, Y.-S. (2003). Germinated brown rice extracts shows a
nutraceutical effect in the recovery of chronic alcohol-related symptoms. Journal of Medicinal
Food, 6, 115121.

Barka M Kabeir, Mustafa Shuhaimi, Kharidah Muhammad, Suraini Abd-Aziz &
Abdul Manap Yazid(2004). 10(2), 183-193.

Hill, A. G., & Rice, R. G. (1982). Historical background, properties and applications. In R. G.
Rice (Ed), Ozone treatment of water for cooling application (pp. 1-37). Ann Arbor Science
Publishers.

Ogawa, K. And Iwabuchi, M. (2001). A mechanism for promoting the germination of Zinna
elegans seeds by hydrogen peroxide. Plant Prod. Sci. 4, 166-172.

134

Alternative Ingredients for Halal Cosmetic and Personal Care Products
Puziah Hashim
Halal Products Research Institute, Universiti Putra Malaysia, Putra Infoport 43400 UPM
Serdang, Selangor Darul Ehsan, Malaysia
Email: puziah_h@putra.upm.edu.my
Abstract
The cosmetic and personal care products are used and become part of our daily life. Due to the
increasing awareness, the muslim consumers are concerned of the safety, quality, composition
and the halalness of the cosmetic and personal care products. They want to know the source of
the ingredients used and the way it is processed. With the advancement and innovation in
cosmetic technology, there are many cosmetic ingredients available today that are derived from
various sources including animal. These animal sources may possess or cause some problems of
its form; either it is from the forbidden animals such as pig, dog or from the unslaughtered halal
animals such as cattle, sheep or chicken. Therefore, the cosmetic ingredients need to be inspected
and tested for permissibility to meet the halal compliance. The non-halal source of the raw
materials for the cosmetic and personal care products can be substituted with alternative
ingredients. This presentation will discuss the details of these alternative ingredients.
Keywords: halal, cosmetic, alternative ingredients, personal care products.
Introduction
Cosmetic and personal care products are use externally to keep the skin clean and healthy. In
general, cosmetics are used repeatedly on the skin over the long term period. Cosmetic and
personal care products are any substance or preparation intended to be placed in contact with
various external parts of the human body such as epidermis, hair system, nails, lips and external
genital organs or with teeth and mucous membranes of the oral cavity (1). The functions of these
items are mainly to cleaning them, perfuming them, changing their appearance and/or correcting
body odors and/or protecting them or keeping them in good condition. The cosmetics can be
classified according to their use and area of applications such as skin care products, hair care,
body care, oral care and others (2). Based on the ingredients used, the cosmetic and personal care
135

products may have many different functions such as anti-aging, skin whitening, moisturizing,
cleansing, and etc.
According to the Malaysian Standard MS 2200 (3), the definition of halal cosmetic and personal
care products are products permitted under the Islamic Law and meet the followings conditions
for the ingredients: do not contain raw material from human parts or ingredients derived from
thereof; do not contain any parts or substances derived from animals forbidden to Muslims by
Shariah Law; do not use halal animal which are not slaughtered according to Shariah Law; do
not contain any materials or genetically modified organism (GMO) which are decreed as najs;
and do not harm the user. Materials for cosmetic and personal care produced synthetically are
halal except those that are hazardous and or mixed with materials that are decreed as najs. Najs
according to Shariah law are things and animals that are themselves not permissible such as dog
and pig and all its derivatives, blood and carrion.
Due to the increasing awareness, the Muslim consumers are concerned of the safety, quality,
composition and the halalness of the cosmetic and personal care products. They want to know
the source of the ingredients used and the way it is processed. With the advancement and
innovation in cosmetic technology, there are many cosmetic ingredients available today that are
derived from various sources including animal. The non-halal source of the raw materials for the
cosmetic and personal care products can be substituted with alternative ingredients for halal
compliance.
The raw materials of cosmetic formulations
The principal ingredients used to manufacture the cosmetics are water and oily materials such as
oils, fats, wax esters, and ester oils, surface active agents used for emulsifier and solubilizing
agents, humectants, thickening agents, antioxidants, sequestering agents, active agents such as
plant extract, coloring, perfume and others (2). There are several factors to be considered when
selecting the raw materials. The most important factors for the selection of raw materials are: a)
meet the purpose of the product; b) safe to consumers; c) stability; and d) quality being
maintained. Some of these raw materials for the cosmetic ingredients are obtained either from
plants and animals or from living materials. These animal sources may possess some problems of
136

its form; either it is from the forbidden animals such as pig and dog or from the unslaughtered
halal animals such as cattle, sheep or chicken. Therefore, the cosmetic ingredients need to be
inspected and tested for permissibility to meet the halal requirement. Subsequently some of the
ingredients are unable to identify the source which can be categorized as shubhah or questionable
(doubtful) and these ingredients should be avoided. The followings are some of the list of the
alternative ingredients for the halal cosmetic and personal care products (Table 1)
Table 1. Types of raw materials in cosmetic and its alternative ingredients
Group of raw
materials (2,4)
Function Source Alternative
1. Oily materials
a) Oil and fats
- triglyceride of
fatty acids and
glycerin
- Control
moisture
evaporation
(emollient)

- Enhance
feeling
on use
- Animal (lard,
tallow) and
plant
Plant (olive oil, camellia
oil, castor oil, palm oil,
etc)
b) Wax esters
- esters of higher
fatty acid and
higher alcohols
Plant and
animals
Carnauba wax (palm),
candelila wax, jojoba
oil, bees wax, lanolin
(sheep wool)
c) Higher fatty
acids
- stearic acid

Beef tallow

Hydrogenated soy bean
oil and cotton seed oil
d) higher alcohols
- cetyl alcohol
- stearyl alcohol

Beef tallow

Saponification of whale
oil

2. Emulsifier/
surfactant
- anionic, cationic,
nonionic,
amphoteric
emulsifier

Surfactant
that allows
oil- and
water-soluble
components
to mix
a) stearic acid
fat
(anionic
emulsifier)
beef tallow,
lard

b) Polysorbate
(nonionic)
Animal
c) esters of
mono,
diglycerides
fatty acids
a) - stearic acid from
soy bean
- palmitic acid from
Palm oil
- natural surfactant
lecithin (egg yolk,
soy
beans), lanolin,
saponin (plant)
b) Plant source

c) Plant source
137

Group of raw
materials
Function Source Alternative
3.Humectant (5)
a) Hyaluronic acid
(HA) (6)

b) glycerin

Maintaining
skin moisture

a) HA - rooster
comb

b) animal and
plant fats and
oils

a) HA from pine
cellulose,
microbial
fermentation,
seafood (chitosan)
(7)
b) - Plant fats and oils
- Plant extract eg.
portulaca extract
4. Polymer
- thickening agent
It also used as
humectants
and
surfactants
(2)

- from animal
(gelatin,
collagen)

- plant (guar gum,
Arabic
gum, carrageenan,
starch,
pectin), microbial
(dextran, xanthan
gum),
marine collagen &
gelatine, synthetic
(polyvinyl alcohol,
polyvinyl pyrrolidone)
5. Functional
properties
- used in
cosmetics
to give them
specific
properties

a) anti-ageing

a) human and
animal placenta

b) bovine or
porcine
collagen

c) enzyme
CoQ10 (beef
heart)

a) Slaughtered halal
animal, vitamin C
(plant/fruits)
b) Slaughtered animal
Others:
- AHA (alpha-
hydroxyacids) from
fruits and milk
sugars.
- Plant extract
(green
tea, Centella
asiatica,
pomegranate,
mangostene
c) Slaughtered animal,
plant( wheat germ,
soy, spinach),
microbial
fermentation
138

b) skin
lightening
(inhibit
melanin
production
in

melanocytes)
- Hydroquinone
and tretinoin
(cause skin
allergy,
redness,
swollen)
- mercury
(toxic)
- Arbutin (bearberry
extract), kojic acid
(microbial
fermentation),
plant extract (Zingiber
zerumbet, Curcuma
xanthorrhiza), fish
extract (budu), vitamin
C
& its derivatives (plant)
6. Alcohol (ethyl
alcohol)
Perfume,
cleanser,
antiseptic (2)
Natural &
synthetic
Synthetic (industrial
alcohol petroleum),
denatured alcohol

Conclusion
The cosmetic and personal care products have become part of our daily life to make
us feel beautiful and comfortable. Muslim consumers must ensure the halalness of the
cosmetic ingredients by checking the source, composition, quality and the safety
aspects. There are many non-halal ingredients which can be replaced by the
alternative halal ingredients that have been proven to be as good or even better. Apart
of that, the cosmetic and personal care ingredients from natural products are
psychologically and spiritually healthy. They are not harmful to the skin and their bioactive
agents are effective.
References
1. National Pharmaceutical Control Bureau (NPCB). Guidelines for Control of Cosmetic
Products in Malaysia (Revision 02). (2009).
2. Mitsui, T. (ed). New Cosmetic Science. Elsevier, Amsterdam- Lausanne New York
Oxford Shannon Singapore Tokyo. 121-147 (2000).
3. Department of Standards Malaysia (DSM). (ed). Malaysian Standard MS 2200: Part 1:
2008 Islamic Consumer Goods - Part 1: Cosmetic and Personal Care - General
Guidelines. Standard Malaysia (2008).
4. Nova News. Putting on a good face the chemistry of cosmetics, published by Australian
Academy of Science. Available at http://www.science.org.au/nova/083/083key.html
(2004)
139

5. Humectants (moisturizing agents), copy right by Somerset Cosmetic Company, P.O.Box
3372, Renton, WA 98056. Available at http://www.makingcosmetic.com/ articles/13-
humectants-moisturizing-agents-in-cosmetics.pdf
6. Hyaluronic acid, pure encapsulations. Available at
http://www.purecaps.com/pdf/pi/hyaluronic_acid.pdf
7. Dee, G. J. Chitosan-multifuntional marine polymer. Allureds Cosmetics and Toiletries
magazine, 116, 39-44 (2001).

140

A18
Special Oils for Halal Cosmetics
M. E. S. Mirghani
1*
, I. Jaswir
1
, H. M. Salih
1
, Yumi Z. H. Bt. Hashim
1
and Y. B. Che Man
2

1
Halal Industry Research Centre (HIRC), Kulliyyah of Engineering, IIUM, Gombak P.O. Box
10, KL, 50728 Malaysia.
2
Halal Products Institute, UPM, Serdang, Selamgor DE, Malaysia.
*Corresponding author: elwathig@iiu.edu.my

Abstract
Three types of non conventional oils were extracted, analyzed and tested for toxicity. Date palm
kernel oil (DPKO), mango kernel oil (MKO) and Ramputan seed oil (RSO). Oil content for tow
cultivars of dates Deglect Noor and Moshkan was 9.67% and 7.30%, respectively. The three
varieties of mango were found to contain about 10% oil in average. The red yellow types of
Ramputan were found to have 11 and 14% oil, respectively. The phenolic compounds in DPKO,
MKO and RSO were 0.98, 0.88 and 0.78 mg/ml Gallic acid equivalent, respectively. Oils were
analyzed for their fatty acid composition and they are rich in oleic acid C
18:1
and showed the
presence of (dodecanoic acid) lauric acid C
12:0
, which reported to appear some antimicrobial
activities. All extracted oils, DPKO, MKO and RSO showed no toxic effect using prime shrimp
bioassay. Since these oils are stable, melt at skin temperature, have good lubricity and are great
source of essential fatty acids; they could be used as highly moisturizing, cleansing and
nourishing oils because of high oleic acid content. They are ideal for use in such halal cosmetics
such as skin care and massage, haircare, soap and shampoo products.
Key words: Cosmetics, Date palm kernel, Halal, Mango kernel, Oil, Ramputan seed.
Introduction:
Halal is a Quranic term meaning permitted, allowed or lawful. Halal when used in relation to
food and other consumer goods means permissible for consumption and used by Muslims.
Increasing awareness of Muslim consumers on their religious obligations creates greater demand
for halal products and other consumer goods. More than 2 billion Muslims out of world
population ensuring food and other consumer products authentically halal is obligatory for every
Muslim including cosmetic. For halal business in cosmetic trade, huge opportunities for trade
looking at halal concept as a new tool for marketing.
Many types of oils and fats from various sources are used in cosmetic industry depending on
their specifications as moisturizing, cleansing and nourishing properties. However for Muslim
consumer all these specifications and properties are needed as well as the fat or oil used in
preparation of the cosmetic agent should be from halal source.
141

Materials and methods:
Three types of plant materials were used in this study including date palm kernel (DPK), mango
kernel (MK) and Ramputan seed (RS). Oil was extracted from all the above type of seeds and
kernels using Sexhlet extraction technique and n-hexane as solvent for extraction followed by
rotary evaporator to recover the hexane. The extracted oils were analysed for their specifications
using different techniques.
Results and discussion:
Three types of mango kernel fat (black gold, waterlily and lemak) were analyzed for their
phenolic compound content and the result is shown in Figure 1 below. The highest amount of
total phenolic content 4.55 mg/ml was obtained from the Black Gold mango kernel oil. In
addition that the lauric acid content is high which has antimicrobial effect?

Two varieties of date palm (Phoenix dactylifera) kernel oil (DPKO) were analysed for free fatty
acid content, saponification value, iodine value, unsapoifiables and total phenolic compounds
and the result is shown in Table 2. The two varieties were Deglect Noor oil (DPKDNO) and
Moshkan (DPKMO).
Table 2: Shows some parameters of date palm kernel oils (DPKO)
of the two cultivars date palm in this study*
Variety
Melting
Point
o
C
FFA % SV IV Unsab. %
TPC
mg/ml
DPKDNO 37.5 2.4 216.3 51.6 0.837 0.964
DPKMO 38.0 1.4 207.8 54.8 1.355 0.982
*FFA = Free fatty acids, SV = Sapoinification value, IV = Iodine value, Unsab. = Unsaponifiable matter, TPC =
Total phenolic compounds
Total phenolic content in extracted oil
4.55
4.2
0.889
0
1
2
3
4
5
Black Gold Water Lily Lemak
Types of mango
T
o
t
a
l

p
h
e
n
o
l
i
c

c
o
n
t
e
n
t

(
m
g
/
m
l

G
A
E
)
142

Ramputan seed oil was also analyes smae way and showed good potential to be used as an
alternative for coemetic production
Conclusion:
The three type of fats and oils used in this study date palm kernel oil (DPKO), mango kernel oil
(MKO) and Ramputan seed oil (RSO) were proven to be suitable oils and ideal for use in halal
cosmetics such as skin care and massage, haircare, soap, shampoo and other products.
Selected References:
1- M. E. S. Mirghani, F. Yosuf, N. A. Kabbashi, J. Vejaya and Z. B. M. Yousuf.
Antibacterial Activity of Mango Kernel Extracts. Journal of Applied Sciences, 9:(17)
3013 -3019 (2009).
2- Y.B. Che Man, Z.A. Syahariza, M.E.S. Mirghani, S. Jinap, and J. Bakar. Analysis of
potential Lard Adulteration in Chocolate and Chocolate Products Using Fourier
Transform Infrared Spectroscopy. Food Chemistry 90: 815-819 (2005).
3- Mohamed E. S. Mirghani
1*
, Nasereldin A. Kabbashi
1
, Ismail H. H
2
., A. A. A. Yassin
2
,
Y. B. Che Man
3
and N. Ellyana B. M. Noor
1
. The Potential of Date Palm Kernel Oil.
International Palm Oil Congress (PIPOC 2009), Kuala Lumpur Convention Centre
(KLCC), Malaysia, 09 -12 November, 2009.
4- Che Man, Y.B. and M.E.S. Mirghani, Detection of Lard Mixed with Body Fats of
Chicken, Lamb and Cow by Fourier Transform Infrared Spectroscopy. J. Am. Oil Chem.
Soc. 78(7):753-761 (2001).
5- Mohamed E. S. Mirghani, faridah Yosuf, N. A. Kabbashi, Jaya Vejaya and Zaima M.
Yousuf. Antibacterial Activity of Mango Kernel Extracts. 3
rd
International Conference on
Chemical and Bioprocess Engineering in conjunction with the 23
rd
Symposium Of
Malaysian Chemical Engineers (SOMChE 2009). August 12
th
14
th
, 2009.

143

Management and Shariah

A03
The Halal Certification on Pharmaceuticals: a Policy Issue

Shafie, S.B
1
.
*
, Othman, M.B
2
.

1,2
Faculty of Business & Accountancy, Universiti Malaya, 56100 Kuala Lumpur, Malaysia
*corresponding author email: shahidan.shafie@gmail.com
Abstract
The issue of halal in pharmaceuticals is very contemporary, sensitive and controversial.
Products such as vaccine to treat meningitis and medicine for diabetes could come from
sources which are suspected or shubhah. The promotion of Malaysia as a World Halal Hub
appeared to focus on six categories: processed food, cosmetics, toiletries, leather goods,
pharmaceuticals and Islamic financial services. It is misleading however to highlight
pharmaceuticals in this spectrum as the Department of Islamic Development of Malaysias
Manual Procedure of Halal Certification categorized pharmaceuticals as non-certifiable -
application pertaining to medicine or products categorized as pharmaceuticals by the
Ministry of Health Malaysia will be rejected. Findings from several series of qualitative
research interviews indicated that there were growing awareness and interest on the subject
of halal and shariah-compliant. Although Islam allows one to consume a religiously
questionable product as a medicine under compulsion (dharurat), a highly halal-
conscious consumer might avoid knowingly taking anything that is religiously doubtful. In
view of this, it is time that the regulatory framework and the policy on certification
involving pharmaceuticals be reviewed so that consumers could make an informed choice
thus not only be able to satisfy their needs but also give them peace of mind.
Keywords: Policy, Regulatory, Pharmaceuticals, Halal, Shubhah

144

Introduction
Halal awareness in the non-food products continues to rise with one of the most recent case
involving two manufacturers of toothpaste products. The case has attracted public attention as
toothpaste is a product category which has a very high usage incidence. Both companies
appeared to intensify their efforts behind their brands through the management of an integrated
advertising and promotional campaign. The case served as evidence that halal certification in
Malaysia no longer concerns just food-based products but also cover non-consumable products
as well.
In another development, the ground work to develop halal medicines was initiated by the
Universiti Sains Malaysia's (USM) which spearheaded research to produce the world's first halal
vaccine to treat meningitis (see "Halal vaccine to treat meningitis," The New Straits Times, Oct
19
th
, 2007). This initiative was part of the responses to the Saudi governments ruling which had
made it compulsory for all pilgrims to be vaccinated against meningitis because of the high risk
of infection during haj and umrah seasons.
Other news highlights include the Consumers Association of Penangs (CAP) concern over the
increase in the diabetic cases. The statistic showed that diabetes had reached an alarming
proportions where 10% of Malaysians were afflicted by Type-2 diabetes, which was linked to
high sugar consumption and obesity (see "Daily diet: Sugary stuff feeding diabetes" The New
Straits Times, Sept 3
rd
, 2007.)
For both of the above cases, the medicine or vaccine that is given could come from sources
which are suspected or shubhah. Note that some vaccines are made with components from pigs
which are considered haram.
Halal certification on pharmaceuticals is a very contemporary, sensitive and controversial issue.
The Department of Islamic Development of Malaysias (JAKIM) Manual Procedure of Halal
Certification (2005) categorized pharmaceuticals as non-certifiable. The guideline specifically
states that application pertaining to medicine or products categorized as pharmaceuticals by the
Ministry of Health Malaysia will be rejected.
145

The pharmaceutical industry in Malaysia is represented by over 200 companies which include
local as well as multinational companies. The industry could be categorized into four broad
sectors: Prescription Drugs, Over-the-Counter Medication, Traditional Medicine, and Health
Supplements. It is a highly competitive market.
Methodology
The objective of this research was to investigate the extent of halal certification in the
pharmaceutical industry. It seek to explore the views of the public and the health practitioners on
the relevant of halal certification on the pharmaceutical products given that these products are
not considered as direct food items but are either ingested, injected or applied to ones body.
The research employs qualitative approach via in-depth personal interviews and store
observations. In addition, the secondary data sources such as the Global Market Information
Database were also referred to obtain the latest statistics on the industry.
Findings
Judging from the store observations, the print and broadcast media as well as the online
communication channels, it seemed that among the four sectors of the pharmaceutical industry,
only the health supplements appeared to utilise halal logo on their products packaging. Some of
the manufacturers of these products also extended the usage of the halal logo onto the products
advertising and promotion materials.
Among the consumers, there appeared to be a varying degree of a halal-conscious consumer
low, moderate, or high. A highly halal-conscious consumer would check on products' labels
and ingredients list to verify that the products do not contain items which are not religiously
permissible. If they were prescribed with medication, they might want to know for instance,
whether the capsules that were given were made using gelatin from bovine or porcine. According
to some pharmacists, purchasers of prescription drugs, being it Muslim or non-Muslim would
also inquire for the source of materials for their medication as prescribed by their doctors. This
however was less obvious for the medication dispensed at the public and private clinics.
146

The research also found that some medical practitioners indicated that they were in favor of
stocking halal-certified medication. However they were concern on the availability and
continuous supply of such products. They were less particular about the costs of halal
alternatives as compared to the non-halal counterparts. As for the government hospitals/clinics,
the supply of the pharmaceuticals was centrally coordinated and the individual doctors do not
participate in the procurement and the decision making process for the sources and the supply of
the medication.
Discussion
The usage of halal logo in sectors besides the health supplements appeared to be non-existence.
While there are no reasons given for this, it is assumed that JAKIM and the Health Ministry are
of the view that pharmaceuticals should be excluded from halal certification. This is in order to
avoid a scenario where a patient might be reluctant to consume a religiously questionable
product at a time when there are no alternative medication to cure his disease or to help
overcome his illness. Note that, there is a prevailing view that Islam allows one to consume a
religiously questionable product as a medicine under compulsion (dharurat). However, a "highly
halal-conscious consumer might avoid taking anything that is religiously doubtful. To them,
living in compliance with the shariah covers the public and the private aspects of life. They are
tend to be more inquisitive on products' choices as, according to them, halal no longer cover
food-based products but practically all kinds of products including hygiene, economics, politics,
banking, business, entertainment, sexuality, and other social aspects.
Conclusion
The formulation of products nowadays constitutes various innovative ingredients. The process
has become more complex due to the advancement in the technology, the change in the global
supply chain management and the dynamic in manufacturing process. This simply means that
certain areas have not been searched or researched enough, or that the search and research were
in the wrong place or direction.
As the health-related sector grows, there bound to be demand for the supplies of halal-
compliance medicine and pharmaceutical products. Thus it is believed that the category would
warrant full certification. It is time that JAKIM acting together with the Halal Development
147

Corporation (HDC) and the Health Ministry review the regulatory framework and the policy on
certification involving pharmaceuticals.
While the main objective of offering products and services is to meet the needs of the target
consumers, manufacturers and marketers that take an additional, voluntary step to manufacture
and market their products according to the halal and shariah requirements would be able to not
only meet and satisfy their consumers' needs but also give them peace of mind!
References
Manual Procedure of Halal Certification (2005), Department of Islamic Development of
Malaysia (JAKIM)
Global Market Information Database, Euromonitor International, 2009
"Halal vaccine to treat meningitis," The New Straits Times, Oct 19
th
, 2007
"Daily diet: Sugary stuff feeding diabetes" The New Straits Times, Sept 3
rd
, 2007

148

A05

Factors Influencing the Non-Compliance of Halal Standard among Restaurant Operators
in Kuala Lumpur
Ilyia Nur, A. R, Suhaimi, A.R, Dzulkifly, M. H, Che Man, Y. B
Halal Products Research Institute, Putra Infoport, Universiti Putra Malaysia, 43400 UPM
Email: suhaimi@econ.upm.edu.my

Abstract
The foodservice industry is deemed to be the final link in the entire food industry supply
chain. Thus, it has a crucial role to ensure that the food served is safe and suitable for
consumption. In Islam, looking for Halal and Toyyib food is mandatory for every Muslim. The
Muslims not only need to observe that the food consumed is Halal but also safe and free from
contamination. Today, as the business of Halal food experiences a rapid growth, the duty of
ensuring the food is Halal has been shifted to restaurant operators and this can be seen through
the introduction of Halal certification. However, many restaurant operators did not comply with
this Halal standard and led to Halal fraudulent practices. Reports on Halal fraudulent decrease
lack of confidence amongst the Muslims. This study attempt to identify the factors, studies the
extent of the factors influencing the non compliance of Halal standard among the restaurant
operators and developing the profiles of the non- compliance of Halal standard restaurant
operators with various types of restaurants. The methodology used in the study involves in depth
interview as well as survey. Sample of 100 restaurant operators who purported to sell food to
Muslim consumer will be interviewed via structured questionnaires and series of depth interview
between various enforcement bodies will be conducted. The data will be analyzed using
Statistical package for Social Science version 17.0 and the Nvivo data analysis. The result will
be the suggestion for further improvement on compliance towards Halal standard among
restaurant operators.

Keywords: Foodservice industry, Halal compliance, hukm syarak, Halal certification
149

Introduction

Recently, there is no study done towards non compliance of Halal standard specifically.
However other studies on non compliance of other standards, regulations or policies such as
security policy, food safety and ecotourism guidelines will be used as literature study.

Foodservice Industry

Foodservice industry is an organization outside the home that prepares food for people,
either for sale as in a restaurant, or as part of a service, as in hospital (Wallace, 2007). In
Malaysia, it was reported that there were 82, 325 units of eating establishments consist of fast
food restaurants, coffee shops, restaurants cum night clubs, cafes, caterers, canteens and
hawkers, where 2.3 per cent of the establishments are located in the urban area and 27.7 per cent
in the rural area (Chern, B.H, 2008). The foodservice industry is deemed to be the final link in
the entire food industry supply chain before a product reaches to the consumer. Thus, it plays a
crucial role as to eliminate the Haram risk and maintain the Halalness of the product.

According to Sungkar (2008), there are five major growth factors of the foodservice in
Malaysia. The factors include:
i. Increasing number of working women who spend less time in kitchen preparing meals
and relatively low cooking/ culinary skills
ii. Declining of eating together as a family which is always implemented in the traditional
culture.
iii. Increasing in income has led to higher proportion of income spent during eating out in
foodservice outlet. In Malaysia, expenditure on food and beverage away from home
tended to increase. Generally, a household within the income of more than RM 5,000 per
month spend 45 per cent of income on eating out while those income brackets on RM
1,000 to RM 1,999 spend only 33.4 per cent.
iv. Rising demand among the consumer of Western style cuisine such as burgers, fries, pizza
and fried chicken. The increase level of Westernisation correlates to the popularity of
Western fast foods or coffee shops and so on.
150

v. Growing number of tourists visiting Malaysia seen as direct increase in food spending.

In Malaysia, the total sales of the food service sector is projected to grow for about USD 7.5
billion by 2010 due to the rising disposable income, urbanisation and the growing popularity of
eating out.

Increasing awareness in food hygiene and safety among consumer required a higher
percentage of food suppliers to have safety certifications like GMP and HACCP. In addition,
Halal is also important as to ensure that the food serve is not only hygiene and safe but also
allowable to the Muslims. In Islam, there are no restrictions about cooking, as long as the kitchen
is free from Haram ingredients and the food is safe and in a good quality. In the aspect of food
preparation, it should cover the whole aspect of Halalan tayyiban from farm to consumer
consumption.

The Importance of Halal

In the Holy Quran, Allah has commanded Muslims and all Mankind to eat and live on
Halal and Tayyib (pure, clean, wholesome, nourishing and pleasing to the taste) things (Doi,
1984) as stated in this verse, O ye people! Eat of what is on earth, lawful and good; and do not
follow the footsteps of the Evil One, for he is to you an avowed enemy. (Al-Baqarah: 168).
Injunction from the hadith, the importance of halal has also been mentioned such as Allah's
saying: "The flesh that grows from that forbidden, then more feasible with the Fire." (Hadith Al-
Thabarani) and in hadith At-Targheeb, Anas (RA) asked Prophet (SAW) to pray for him so that
he may become Mustajab-ud-dawaat. Prophet (SAW) replied: Yaa Anas, earn an honest
living and eat Halaal food, Allah (SWT) will make you Mustajab-ud-dawaat, and will grant
you whatever you ask. Keep yourself away from Haraam, because even a morsel i.e. a small bite
of Haraam food invalidates supplications for forty days.

From the above sources, it is clearly mentioned that Muslim need to take halal food
because halal is not only merely allowable but also recognize hygiene, safety and quality
151

assurance where the product must be prepare in clean, safe, well taken care of, with good
presentation and served in proper manner and quality for everybody (Amat, 2006).

Eating Halal and Tayyib food is an important as a matter of worship of God like
performing a prayer, fasting, alms giving and other religious activities. The general principle
then would be: what is lawful and what is good (Tayyib), should be followed. In the context of
our daily food intake, any foodstuff that causes, or has the potential to cause, any negative effect
to the mind, spirit, integrity and health, is Haram. The habitual consumption of Haram foods
may be manifested by the exhibition of impure spirit, unsound mind, impairment of personal
character and unhealthy body (Che Man & Hashim, D. M, 2008) As Muslims, we are expected to
eat for survival, to maintain good health and not just to live for eating.

Halal Fraudulent in Foodservice Industry

Effects of many reports claimed on Halal fraudulent practices among the restaurant
operators such as using fake Halal logo or private Halal logo, deception by non Muslim operators
wearing Muslim attire, misuse of the holy verses of the Qur'an by non-Muslim restaurant
operators to attract customers is Muslim and so on, make the consumers starting to confuse and
have doubt toward the Malaysia Halal logo. This may due because of many restaurant operators
did not comply with the Halal requirement or standard even there are purported to sell food to
the Muslims. Furthermore, there are many holes in Malaysia legal framework especially in Halal
rulings which need to be improved by the government.

Objectives

This study is an attempt to identify factors and studies the extent of the factors that
influencing the non compliance of Halal standard among the restaurant operators. Then,
developing the profiles of the non- compliance of Halal standard restaurant operators with
various types of restaurants such as Mamak restaurant, fast food, fine dining restaurant and food
court.

152

Methodology

The methodology used in this study is survey as well as in depth interview. Sample of
100 restaurant operators from every 5
th
restaurants licensed by the Dewan Bandaraya Kuala
Lumpur (DBKL) which purported to sell food to Muslim consumers will be selected and
interviewed via structured questionnaires to derive factors influencing to the non compliance
towards Halal standard. A series of in depth interview from among the enforcement bodies
(Ministry of Domestic Trade, Consumer and Cooperative, MDTCC and Jabatan Kemajuan Islam
Malaysia (JAKIM) would also be conducted to derive information about Halal governance and
legal framework on Halal enforcement. The data will be analyze using Statistical Package for
Social Science version 17.0 using factor analysis, correlation, multiple linear regression and
descriptive analysis. While for interview analysis, the Nvivo version 8 data analysis will be used.

Conclusion

The Halal market is moving and expanding very rapidly and Halal issues is a serious
matter to Muslim consumer when choose the right eating establishment. Lack of compliance
towards Halal standard among restaurant operators makes it is necessitates identifying the factor
and studying the extent of the factor. This study not only helps for futher improvement towards
compliance on Halal standard among the restaurant operators and also as guidance for the
consumer to define clearly Halal products and services, the certification authority and procedures
to assure consumers get not only Halal food but also be guarantee the Tayyiban aspects of the
food i.e. the quality, safety and reliability of such products and services.

Acknowledgement

Special thanks to Dr Suhaimi Ab Rahman, En Dzulkifly Mat Hashim and Prof Yaakob
Che Man for all your guidance throughout this study and to my family and friends for your
supportive and understanding.

153

References

Al-Qardawi, Y (2001). Definitions In The lawful and the Prohibited in Islam.2
nd
ed. Al- Falah
Foundation for Translation, Publication and Distributions, p XXV
Amat, S (2006). Paper presented in the 9
th
Efficient Consumer Response Conference on 15
th

November 2006 at Kuala Lumpur Convention Centre (KLCC), Kuala Lumpur, Malaysia.
Charlotte, Y., and Robyn, F. Factors affecting food safety compliance within small and medium-
sized enterprises: Implications for regulatory and enforcement strategies. Journal of Food
Control, Volume 17, Issue 1, Pages 42-51.
Che Man, Y. B, Hashim, D. M (2008). Syariah Principles and Requirement Pertaining to Halal.
Course of Halal Profesional Program in HDC Halal Modul Training.
Chern, B. H (Accessed on 16 April, 2009).Lecture notes: Classification of Food Service
Industry.
Doi, A. R. I (1984). Syariah the Islamic Law. Ta Ha Publishers, p 406-417
Ercan, S. Attitudinal compliance with ecotourism guidelines. Annals of Tourism
Research.Volume 24, Issue 4. Pages 919-950
Regenstein, J.M., Chaudry, M.M. and Regenstein, C.E. (2003). The Kosher and Halal Food Law.
Comprehensive reviews in food science and food safety vol 2, p 111-127
Seppo, P., Mikko, S., and Adam, M. Employees Behavior towards IS Security Policy
Compliance. Proceedings of the 40th Hawaii International Conference on System
Sciences 2007.
Sungkar, I (Sept- Oct, 2008). The Rising Importance of the Food Service Sector. The Halal
Journal, p 30-31
Wallace, L. R (2007). A host of opportunities: An introduction to hospitality Management, 2
nd

ed, edited by Van Hoof,H.B, Vallen, G. K, McDonald, M. E, and Wiener, P.J. Pearson
prentice Hall.

154

A13

Quality Management Practices in the Malaysian Halal Food Industry

Hayati @ Habibah Abdul Talib
1*
, Khairul Anuar Mohd Ali
2
& Fadzli Idris
3
1
College of Science and Technology,
Universiti Teknologi Malaysia, International Campus, 54100 Kuala Lumpur
2
Faculty of Science and Technology,
3
Faculty of Economics and Business
Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor Darul Ehsan
*corresponding author email: hayati@ic.utm.my

Abstract
The Halal issue has not only attracted much public attention but has also become an important
tool for the economy especially as Malaysia inspires to be the Global Halal Hub in this region.
An equally important issue that arises out of this aspiration is the management of quality. For
this reason, quality management has attained much attention in the agribusiness and the food
industry. Therefore, focus on the implementation of the quality management practice is vital for
the improvement of the quality of manufactured products. At present very few studies on the
TQM in the SME food industries have been carried out or published in literature. This paper
aims to introduce the Critical Success Factor (CSF) of quality management practices in the food
industry in Malaysia, especially in the Halal food industry. In addition, it is also targeted to test
its effects on the performance of these firms. In this study, a research model has been developed
to link the relationship of the CSFs to organizational performance. The instrument used is
reliable as its reliability is between 0.7 and 0.9, and it has shown that the two most critical
quality management practices needed by the SMEs in this industry are customer focus and
quality assurance.

Keywords: Food Industry, Halal, Quality Management, Critical Success Factor, SME

Introduction
155

A study on the quality management practice in the halal food SMEs in Malaysia is going to be a
breakthrough in the research for quality management. Nevertheless, there is very little empirical
study associated with quality management in the food industry. Consequently, there many
unanswered questions that arise in the quality management practices in the food industry in
Malaysia. Thus, the research framework developed concerns leadership, corporate planning,
human resource management, customer focus, supplier focus, information management, process
management and quality assurance as the CSF, while the mediating variable is the accreditation.
Although, the results are only based on a pilot study, they do provide the fundamental impression
of the quality management practices among the SMEs in the food industry in Malaysia and it is
expected that the accredited companies have a higher extent of practice of the eight constructs
than that of the non-accredited companies. Furthermore, the hypothesis of this study is: H
0
:
1
=
2
; there is no significant difference between the practices of the companies that are accredited
or are non-accredited.

The exploratory study was done to double check, whether factors presented in literature are in
good agreement with the opinion or practices of company owners, particularly in the context of
the food industry in Malaysia. The survey instrument used in this study is largely derived from
reviewing various conceptual and related empirical studies on quality management, such as by
Powell et al. (1995); Arawati (2000), Brah et al. (2002); Conca et al. (2004); Tari et al. (2007);
Feng et al. (2008); and etc. The questionnaire developed has been modified and adapted to the
background of the food industry in Malaysia. The updated questionnaires were then distributed
to a selected 100 companies by convenient sampling. These questionnaires were sent to the
managing directors of the companies or to the knowledgeable company personnel on the quality
management practices and performance of the companies. Only thirty-three questionnaires were
returned to the researcher and these provided a respondent percentage of 33%. However, only 30
samples were acceptable to run the pilot test.

Results
The results of the reliability test demonstrate that the alpha values ranges from 0.720 to 0.898.
This indicates that the instrument has a high internal consistency with the alpha value which is
156

more than 0.70, thus no items have been dropped from each variable and from the instrument.
Furthermore, the overall mean for each construct was calculated and then sorted based on the
mean ranking. Customer focus and quality assurance are perceived to be the two most critical
constructs. These results indicate that customer focus and quality assurance practices by the food
industry SMEs are the two important aspects of the organizational performance. On the other
hand, Information Management (IM) is the least important and this may probably be due to fact
that SMEs food-processing companies do not have any systematic information management
system. The next step, was conducting the t-test to find out whether the eight constructs were
practiced differently between the two types of company. All the t-values of the constructs were
more than the significant level of 0.05, thus the null hypothesis is accepted. The results show no
significant difference between the two types of company based on accreditation status in
practicing the constructs.

Discussion
The t-test analysis indicates that there is no significant difference between the accredited and the
non-accredited companies regardless of whether they are practicing all the eight constructs. This
may probably be due to the fact that both these two types of company may attain the same level
of practices of all constructs. However, based on the means it can be seen that the accredited
companies have a higher mean compared to the non-accredited companies. This may be due to
the practicing of quality management constructs which are probably motivated by the
accreditation received.

Conclusion
The proposed framework is a concept although it is developed from the literature reviewed but it
has to be validated empirically through a questionnaire or some other empirical method.
Furthermore, the reliability test for the internal consistency has shown that the alpha value ranges
from 0.720 to 0.898. This indicates that the overall instrument has been proven to be an
acceptable instrument and suitable for the actual study. Although this result is only of a pilot
study, it is however expected that the study will foster the implementation of quality
management or TQM in the food SMEs. Therefore, further research will focus on collecting
157

more data and analyzing the relationship between the quality management practices (CSF),
accreditation and organizational performance.

References
Powell, T.C. Total Quality Management as Competitive Advantage: A Review and Empirical
Study; Strategic Management Journal. 1995; 16, 15-37.

Arawati Agus. Total Quality Management Practice in Public Listed Manufacturing Companies
in Malaysia; A Thesis of Doctor of Philosophy; Universiti Kebangsaan Malaysia. Selangor.
2000.

Brah, S. A.; Tee, S. S. L.; Rao, B. M. Relationship between TQM and performance of Singapore
companies; International Journal of Quality & Reliability Management. 2002; 19(4), 356 379.

Conca, F. J; Llopis, J.; Tari, J.J. Development of a Measure to Assess Quality Management in
Certified Firms; European Journal of Operational Research. 2004; 156, 683-697.

Feng, M.; Terziovski, M.; Samson, D. Relationship of ISO 9001:2000 Quality System
Certification with Operational and Business Performance: A Survey in Australia and New
Zealand-Based Manufacturing and Service Companies; Journal of Manufacturing Technology
Management. 2008; 19(1), 22-37.

Tari, J.J.; Molina, J.F; Castejon, J.L. The Relationship between Quality Management Practices
and Their Effects on Quality Outcomes; European Journal of Operational Research. 2007; 183,
483-501.

158

A17

Consumer Knowldege and Awareness toward Halal Characteristics on
Bakery Products

1
Adilah Md Ramli and Hartini Jun

Abstract
The research on consumer knowledge and awareness toward Halal characteristics on bakery
products are conducted due to the increase bakery outlet in Kota Kinabalu and most consume
food items eaten by university students. The objective of the research is to observe the spending
habits on bakery products, the knowledge on bakery products and the awareness on Halal bakery
ingredients. Questionnaire method had been with non parametric statistical analysis. Majority
students spend RM 41- 60 a month, most students are knowledgeable on bakery item and
ingredient such as gelatine and rennet. Factors that influenced respondents to purchased bakery
products are the taste, Halal certificate and logo, nutrition information, price, and brand name.
The main reason respondents did not felt any influence, if the premises or the product obtain
Halal logo and certificate due to the thought that its only for Muslim consumers. Respondent felt
it is not important to have the Halal logo or the premises need to have certification from Jabatan
Kemajuan Islam Malaysia (JAKIM). Conclusion, consumers are lacked of information of bakery
product Halal source and on Halal certification.

Key words: Knowledge, Awareness, Halal characteristics, Bakery products, Spending Habits

Introduction
Malaysia consumer lifestyle on eating habits showed that bakery product is the second highest on
packaged and processed food 2000/2005 with 4% growth between the years (Euromonitor,
2009b). Malaysia baked goods such as artisanal baked goods from bakery and pastries shop and
packaged/industrial bread sold in supermarket and convenience store are starting to grow
prominently in Malaysia market with 4 % and 5% increase of each sector in 2008. Bread
purchases especially on artisanal baked goods are base on product variety and impulse
purchasing from the consumer especially at urban city. For the packaged/industrial product such
159

as white bread are popular among consumer due to the taste, texture and also the healthier option
such as wholemeal bread (Euromonitor, 2009a). Increased demand for bread due to consumption
of bread that become a staple diet to Malaysian consumer, it also a quick meal for busy people,
been eaten from breakfast, lunch and dinner. Can be bought conveniently at bakery shop,
convenience store, grocery store, supermarket, minimarket and petrol stations (NL Chin, 2005).

Malaysia is a multiracial country with various ethnic groups and religion, issues of Halal/Haram
especially in the bakery ingredients play great importance as many consumers do not understand
the Islamic dietary rules, to determining halal status of a product goes beyond ensuring that food
is pork-free. Ingredients may be import from non-Muslim country whose halal is unknown.
Through development in food technology, food processing has become more complex.
Consumers have a wider variety of processed food that could contain Haram substances.
Example of ingredients that may have a connection with bakery product is gelatine based product
(such as jelly, cream cheese), food additives (glycerine, lecithin/L-cystine and fatty acids ), fats
(lard or fat coming from animal sources), Cheese (from animal source pepsin and rennet, ) and
alcohol (such as vanilla extract) usually can be found in a bakery products such as bread, pastry
and cakes (CAP,2006). In Kota Kinabalu there is a growth of bakery product and premises, but
the number shop outlet and manufacturer that already gain Halal certificate from JHEAINS
(Jabatan Hal Ehwal Agama Islam Sabah) are only in small percentages (Halal Sabah,2009). The
objective of the research is to observe the spending habits on bakery products, the knowledge on
bakery products and the awareness on Halal bakery ingredients.

Material and Methods
A self-administered structured, four section questionnaires in Bahasa Malaysia was distributed to
respondents. This includes demographic section, knowledge section (Halal general information,
Halal logo and labelling, ingredients in bakery product), and consumer awareness on purchasing
bakery product section and lastly perception and influence on Halal issues. On knowledge
section, each correct answer is given 1 mark. The knowledge is categorized into 2 categories:
Knowledgeable and non-Knowledgeable (Sanlier ,2008; Christoph et al, 2008; and Touliatos &
Compton, 1988). All data were analyzed for summary descriptive and cross tabulating and non
160

parametric test. 400 respondents are from undergraduate students, Universiti Malaysia Sabah
(UMS).

Result and Discussion

Respondent comprised of 200 Muslim and 200 non-Muslim. Most respondents are coming from
peninsular Malaysia 51.8% and at the age of 21-23 years old 56%. The religions background
with 50% is Muslim and 50% non-Muslim consist of Christian, Buddha, Hindu and Others.
Ethnic background shows 34.2% are from Chinese background, Malay at 27.8% and Sabah
Bumiputra 27.5%. Most student are usually consumed bakery product due to hectic schedule and
as a quick meal before coming into classes, the bakery product are commonly consumed by
younger generation due to the fast pace of life and the convenience offered by these product, the
younger generation also willing to try new foodstuffs, especially western influenced food best
example bakery products (Euromonitor, 2009b).

Majority students (50%) spend RM 41- 60 a month on food expenditure. Whereby they
purchased bakery product at least 1 to 3 times a week at 71%, for late morning snack 37% and
breakfast at 26% most of the time. Increased demand for bread due to consumption of bread
become staple diet to Malaysian consumer (in this case undergraduate student), it also a quick
meal for busy people, been eaten from breakfast, lunch and dinner (NL Chin, 2005). As a whole,
respondent at 49.3% are knowledgeable (scoring 4-6 marks), whereby only 80% respondent
known the source of gelatine, but not the source of rennet (21.2%) can come from Halal or
Haram sources. Muslim respondent showed a significant correlation (<0.05) between religion
and knowledge. Religion do play an important role in knowledge and purchasing behaviour as
respondent have an obligation to follow restriction that impose by their religion respectively.
Gelatine is derived from bovine (cow) or porcine (swine) based. In Malaysia, JAKIM strictly
maintain that the use of gelatine is only permissible if it is source from a lawful animal and that
animal must be slaughtered within confines of Shariah (Mohd Hashim Tajuddin, 2006).

Factors that influenced respondents to purchased bakery products are the taste (44.8%), Halal
certificate and logo (22.8%), nutrition information (16%), price (12.5%) and lastly brand name
161

(4%). There is a significant (<0.05) relationship on religion and ethnic background with factors
influencing purchased bakery product, supported by past marketing research showing
packaged/industrial bakery product such as white bread are popular among consumer due to the
taste, texture and also the healthier option such as wholemeal bread (Euromonitor, 2009a).

Respondents agree nutrition labelling and halal certification are factors influencing them in
purchasing bakery product at 59.8%. Majority Muslim respondent agreed with the statement
(72.8%) and only 27.25% are coming from non-Muslim, the main reason respondents especially
non-Muslim (83%) did not influenced if the premises or the product item obtain Halal logo and
certification due to the thought that the logo and certification are only for Muslim consumers
(51%), and the insufficient numbers of bakery product or premises that have halal logo or
certification (19.5%); lastly, respondent felt it is not important to have the Halal logo or
certification from responsible authority such as Jabatan Kemajuan Islam Malaysia (JAKIM) with
18.3%. The results is consistent with past researched where Muslim consumer generally have
highest awareness level of Halal meat and meat based product at 94-98%, products coming from
processed food at 40-64% (this include bakery product), cosmetics (24-30%) and pharmaceutical
(18-22%), the difference in awareness levels was not merely due to the lack of general
knowledge (such as Haram ingredients), but also due to differences in how things conducted and
understood in various country (Irfan Sungkar, 2008).

Conclusion
The findings showed a great concerned on the effects on consumers that usually buy bakery
products such as bread and cakes for daily consumption especially Muslim consumers. The
bakery premises and the ingredients information must become known to the consumers. Only a
few of bakery premises and manufacturers obtain Halal Certificate in Sabah. Most consumers did
not aware of these situation and many still purchase bakery products from supermarket or bakery
premises in Kota Kinabalu, Sabah. Using Halal Certificate or Halal logo on the products ease the
headache to identified ingredients or the cleanliness of the bakery premises.

162

References
Baked GoodsMalaysia (atas talian)
http://www.portal.euromonitor.com/passport/ResultsLists.aspx. Dicetak 29 April 2009a.

Consumer Lifesyles-Malaysia(atas talian)
http://www.portal.euromonitor.com/passport/Magazine.asx. Dicetak 28 April 2009b.

Disebalik Empuknya Roti(atas talian). http://www.halalguide.info/artikel. Dicetak 30 Oktober
2006.

Senarai Premis Halal (atas talian) http://www.sabah.gov.my/HalalSabah/senhalal.htm. Dicetak
3 Disember 2009.

Abdulhamid Eyang. 2005. Halal perspectives: Understanding The Muslim Market. The Halal
Journal. Mac/April: 10-11.

CAP (2006) Halal Haram An Important Book for Muslim Consumer. Pulau Pinang: Consumer
Association of Penang.

Christoph, I.B, Bruhn, M., Roosen, J. 2008. Knowledge, Attitude Towards and Acceptability of
Genetic Modification in Germany. Appetite. 51: 58-68.

Irfan Sungkar. (2008) Muslims Awareness Of Halal In The Age of Globalisation. The Halal
Journal. May/June: 36-37.

Mohd Hashim Tajuddin. 2006. Views On Gelatine. The Halal Journal. Mac/April: 36-38.

NL Chin. (2005). An overview of the evolution of the bread industry in Malaysia. Jurutera IEM,
Bil.2005, No.4, 14-15, 17.

Riaz M.N. & Chaudry M.M. 2004. Halal Food Production. USA: CRC Press.
163

Sanlier, Nevin. 2008. The Knowledge and Practice of Food Safety by Young and Adult
Consumer. Food Control. 20: 538-542.

Touliatos, J., Compton, N.H. 1998. Research Methods. US: Iowa State U Press.

164

A20

Awareness and Knowledge of Halal Food Issues and Alcohol among Food
Technology Students in a Public University in Malaysia

Wan Nadiah W. A.,
1
*Anis Najiha, A
2
, Roslinda M. R.
2
and Nur Asyikin N.
2

1
Bioprocess Tech. Division, School of Industrial Technology, Universiti Sains Malaysia

2
Food Technology Division, School of Industrial Technology, Universiti Sains Malaysia,
Malaysia, Penang, Malaysia
*corresponding author email: wnadiah@usm.my

Abstract
The Halal food market is on the threshold of major developments that hold the promise of rapid
and sustained growth. To position itself as a major player, and assume the role of a Halal hub,
Malaysia must prime itself, not just in terms of technology, but also the man power as the key
players. This study was carried out to evaluate the current level of awareness and knowledge of
halal food laws with special emphasis on alcohol, amongst food technology students of a public
university. One hundred sets of self-administered questionnaire were distributed among Food
Technology students of Universiti Sains Malaysia (USM), Penang comprising of 54% non-
muslims and 46 % muslims. A majority of the respondents (73 %) admitted that they understand
about the halal concept in Islam and most of them (91%) agreed that wine consumption was
forbidden. However, despite of their initial perceived understanding of halal concepts and issues,
their responses in the questionnaire on the halal limits of alcohol in foods and the halal status of
foods like tuak, nyira, grape juice, apple cider, tapai, vinegar and rum balls showed a number of
uncertainties and misconceptions.
Keywords: halal awareness, halal knowledge, alcohol, halal food

1.0 Introduction
165

Malaysia has for some years expressed its aspiration to become a global hub for the
production and distribution of halal products and services. An important prerequisite towards
achieving this status is the supporting infrastructure, technology, and manpower to further
leverage the available resources to the optimum. Therefore this study serves to gauge the current
level of awareness and knowledge of halal food laws especially pertaining to alcohol amongst
food technology students of a public university. Majoring in food technology, they are expected
to possess an interest in food issues, as well as a better grasp of knowledge about food. Food
technologists also form the pool of manpower that would be contributing towards the above
aspiration.
2. Methodology
2.1 Survey Design
Respondents were required to answer a series of questions in the form of a questionnaire
which consisted of 15 questions divided into three sections. Section A (4 questions) was on
respondents demography, Section B (8 questions) was on the respondents knowledge of
alcohol in halal food and the credibility of local and international halal certification (not
discussed in this paper) and Section C (3 questions) was to be answered only by Muslim
respondents regarding their awareness on the choice of halal food products in the market (not
discussed in this paper). The questionnaire was written in Bahasa Malaysia with yes, no and
not sure responses. Closed ended answers were chosen to increase the precision of the answer.
Some of the questions were provided with multiple choice answers.
2.2 Respondents and Sampling Procedure
The target respondents were first and final year Food Technology students of School of
Industrial Technology, Universiti Sains Malaysia. Quota sampling was employed and 50
respondents from each batch of students were targeted. The questionnaires were distributed to
respondents at the lecture hall. Out of 100 questionnaires distributed, retrieval was 96%.
2.3 Data Analysis and Treatment
Analysis was based on the total number of students answering each particular question.
Descriptive data are presented as frequency (percentages).
3.1 Profile of respondents
166

Respondents were made up of 73% female and 27% male. In terms of religious beliefs,
46% of the respondents professed to be Muslims. Similarly, 46% of the respondents were first
year students, and the remaining 54 %, final year students.
3.2 Knowledge of alcohol in the halal context
Most of the respondent (73%) perceived that they knew about halal concept in Islam,
with the Muslim respondents making up the majority of those that responded in affirmation
(Table 3.1). About 90% of the respondents regardless of their religion opined that alcohol
consumption was forbidden due to its intoxicating characteristic. This is in line with the main
reason alcohol was forbidden in Islam, as can be derived from the Quranic verse:
Approach not prayers with a mind befogged, not until you can understand all
that you say. (An-Nisa: 4:44)
Table 3.1: The responses by respondents pertaining to the understanding of halal principles and
the reason for alcohol prohibition in Islam
Question
Response (%)
Yes No Not Sure
1. Do you actually understand what Halal concept in
Muslims food means?

73 1 26

2. Alcoholic drinks is forbidden in Islam because:
a) Alcoholic drinks cause intoxication 90 4 6

b) Alcoholic drinks are impure 41 26 33

c) Alcoholic drinks contain ethanol 91 4 5

d) Alcohol causes addiction 87 7 6

Despite the benefits of consumption of alcoholic drinks as stated in the Quran (2:219) and
supported by scientific studies highlighting the benefits of moderate alcohol consumption
(Moore & Pearson, 1986), these benefits are outweighed by the sins and the harm alcoholic
drinks could cause to human (Quran 2:219). Thus, it should be noted that alcoholic drinks
consumption was not forbidden solely due to its ethanol content, as trace amounts of ethanol is
allowed in foods given that the amount is insufficient to cause intoxication (Riaz & Chaudry,
2004). However, more than half of the respondents (55%) believed that no ethanol can be
permitted in halal foods, and respondents were still divided about the level of ethanol allowed
(Table 3.2)
167

Table 3.2 Permitted level of ethanol in halal food according to respondents perception
Question Perceived level of
alcohol permitted
Response
%
Based on your knowledge, what is the permitted level of
ethanol in halal food?
0.0% 55
0.1% 15
0.5% 15
1.0% 9
5.0% 5
The next set of questions in the questionnaire was aimed at assessing the actual
awareness and understanding of the respondents on the controversial issues involved in halal
food (Table 3.3). The response showed a lot of uncertainties amongst the respondents despite
their initial perceived understanding of halal concepts and issues Some respondents (30%) even
believed that tuak is not haram. On the contrary, only 37% of respondents believed that rum balls
are haram.
Table 3.3: Response pertaining to halal issues of alcohol in food products
Statement Response %
1. Vanilla Essence is made from vanillin that had been extracted using
alcohol. Thus, vanilla essence is haram.
Yes 24
No 38
Not Sure 38
2. Alcohol will evaporate at elevated temperatures, therefore it is halal to
add wine during cooking
Yes 17
No 31
Not Sure 53
3. The products listed are haram
3.1 Wine Yes 91
3.2 Nyira Yes 8
3.3 Grape juice Yes 3
3.4 Cider Yes 33
3.5 Tapai Yes 10
3.6 Soy sauces Yes 2
3.7 Vinegar Yes 28
3.8 Tuak Yes 70
3.9 Rum balls Yes 37
Although 91% of respondents agreed that wine is haram, more than half of respondents (53%)
were still unsure whether wine can be added during cooking of halal foods. In the case of vanilla
essence extracted using ethanol, Regenstein et al. (2003) stated that synthetic or grain alcohol is
permitted in food processing provided the remaining ethanol in the final product is negligible.
However, only 39% of the respondents concluded that such vanilla essence is not haram

168

4. Conclusion
Despite of respondents initial perceived understanding of halal concept and issues (73%), the
response showed a lot of uncertainties amongst the respondents when the controversial halal
issues were asked. This showed that, many of the food technology students still may not fully
understand about the halal concept, especially in relation to alcohol, in Islam.
5. References
1. Moore, R. D.; Pearson, T. A. Moderate alcohol consumption and coronary artery
disease: A review. Medicine. 1986, 65(04), pp 242-267.
2. Regenstein, J.M.; Chaudry, M.M.; Regenstein, C.E. The kosher and halal food laws.
Comprehensive Reviews in Food Science and Food Safety. 2003, 2, pp. 111-127.
3. Riaz, M.N.; Chaudry, M.M. Halal food production; CRC Press: United States of
America, 2004; p. 34.

169

A28
The Theory of Istihalah from Fiqh Perspective : Analysis of Determining halal
and haram for several Food Products

Mohammad Aizat bin Jamaludin,
1
Mohd Anuar bin Ramli,
2
Norhaizam Md. Sani,
3
Azurah Ab.
Aziz,
1
Mohd Elyas Harun.
1*

1
Executive, Manager
2
, Training Department, Halal Integrity, Halal Industry Development
Corporation (HDC), 5.02, Level 5, KPMG Tower, First Avenue, Persiaran Bandar Utama,
Bandar Utama, 47800 Petaling Jaya, Selangor, Malaysia
3
Lecturer, Fiqh & Usul Department, Academy of Islamic Studies, Univ. Malaya, 50603 Kuala
Lumpur, Malaysia
*aizat@hdcglobal.com, rausyanfekr@yahoo.com

Abstract
This research focuses on application of the theory of Istihalah from fiqh perspective. It will apply
the theory of Istihalah for several food products especially pig and its derivatives. In order to
achieve the objectives, the researcher has used various methods comprising the collection of data
from the library and field work research. The collected data was analyzed according to
deductive, inductive and comparative methods. The selected sample is applied on the basis of
two models of Istihalah, namely, Istihalah Sahihah (accepted change) and Istihalah Fasidah
(damaged change). As a results, plants that are fertilized with faeces and dirt are halal to
consume. This is due to the Istihalah Sahihah process that the plants have undergone. The
fertilizers only act as the catalyst in the plant growth. On the other hand, animals such as Kobe
cattles are haram to consume since they have undergone Istihalah Fasidah process until it is
irreversible. The findings of the study show that Istihalah is very relevant to be applied as an
alternative for instrument of purification to overcome the issues mainly involving food
production.

Keywords: Fiqh, Istihalah, Halal, Consume, Food Products.
170

Introduction
The issue related to the production of food products which closely link to halal and haram
often occurs in the community. Recurrently reports related to this matter has been published or
by other means of mass communication.
Examples of the relevant issues are silver catfish feed with porcine derivative, plants
fertilized with porcine menure, usage of fat from porcine base in food products, vaccine and
medicines from porcine derivatives, production of cosmetic from the same source and many
more. Besides porcine and its derivative, there are many other related issue which is a polemic
within the society. Through the Islamic perspective, there are options which can be implemented
to resolve these polemic issues. One of it being, the use of al-darurah instrument which act as a
safe solution method. Meanwhile in the Islamic law, there are instrument which can be use as a
platform in confirming the halal and haram, among others is the alternative purification method
namely al-Istihalah, al-Istihlak, al-Istibabra and others related to it.
Therefore, the researchers will only focus on Istihalah as the alternative purification
instrument in deciding the halal and haram status.

Objectives
1. Introduce the concept, structure and categories of Istihalah.
2. To elaborate fuqahas view according to Istihalah polemic.
3. To aply the model of Istihalah in several food products i.e. pork and their derivatives.

Research Methodology
Data collection process is a combination of literature research and field work.
*Literature research aimed in gathering information referring to the primary and secondary
sources.
*Field work conducted in collecting and accumulating further information from Muslim scholar
and science background experts through the method of interviewing and observation.
-Data collected, segregated and qualitatively analyzed based on the deductive, inductive and
comparative methods.
Concepts of Istihalah
171

Istihalah can be defined as transformation or conversion of material to another material
which involves conversion of substance and properties or conversion of najs properties to pure.
Based on theory by Nazih Hammad, Istihalah means najs material or haram material
changing its concept and substance into another material which is halal, though differ from the
original form either in the form of name, criteria (including smell, taste and colour) and
properties.
Al-Zuhayli justify Istihalah as conversion to another material due to changes in its properties.
These changes convert certain najs material or contaminated with najs to pure and therefore able
to change certain haram material to permissible material according to Shariah law.
Based on definition of language and terminology, the researcher conclude there are 3
situation of Istihalah as discussed :
i) Istihalah involving physical changes and contents.
For example, deers blood becomes kasturi, carrion becomes salt crystal when immerse in
sea of salts and animal feaces becomes ash after being furnaced.
ii) Exterior changes , for example animal leather except from dogs and pigs, converted to
pure through the dibagh process, and conversion of fat and oil to soap.
iii) Istihalah involves changes of content only.
Conversion of material substances such as alcoholic beverages converted to vinegar.
Therefore, it can be concluded that Istihalah is conversion of material to another form which
involve changes of it physical and substances.

Categories of Istihalah
Istihalah Sahihah (Acceptable Changes)
Istihalah Sahihah is a conversion process accepted by Islamic scholars. It involves any
form of conversion of one material to the other though natural process or whereby the end
product formed is halal. This can be clearly explained in Diagram 2.
Istihalah Fasidah (Damaged Conversion)
Istihalah Fasidah is a conversion process which is damage or unacceptable. The process
involves conversion from one halal material to a new form which is haram through a halal or
haram conversion agent. After going through the process, the end product produced is
categorized as haram.
172

Structure of Istihalah

Diagram 1: Structure of Istihalah

Fuqaha Views
Generally, Islamic Scholars accept the concept of Istihalah theoritically. Unfortunately,
there are disagreement of opinion on the implementation aspect. This is due to the reason
whereby some scholars intended to broaden the usage of Istihalah meanwhile there are some
which intend to mimimise it. The differences is in line with the acceptance of the conversion
agent wether it is naturally or artificial through human being intrusion or synthetic.
The first groups opinion to expand the usage of Istihalah are from the Hanafis, Maliki,
Inb alArabi, Ibn Taymiyyah, Ibn alQayyim, al-Syawkani and Hazm Al-Zahiri. They
materialise theory of Istihalah in a more general concept. This is because, they accept the
Istihalah theory as a process that can convert najs material to pure form wether through a natural
process. For examples, alcoholic beverages fermentation converted to vinegar or artificial
process through addition with other materials.
Second groups opinion limiting the application of Istihalah theory to certain aspect only.
This view is being supported by scholars from Shafie and one of the opinion from Hanbali.
Shafies considered that any material which is najs cannot become pure by converting its
substance except for 3 situation. Firstly, alcoholic beverages converted to vinegar naturally.
Secondly, leather from dead animal except from dog and pigs can be pure when gone through
dibagh process. Thirdly, conversion of material to animal for example carrion changes to
maggots due to appearing of a new form of life.
Thus, Hanbali in one opinion stated that any material which is najs, cannot be pure with
Istihalah process except for alcoholic beverages converted to vinegar naturally. Conversion
(Mixing Process)
(Conversion process)
(Conversion Process)
Naturally
Conversion
Agent
(Raw Material)
(Mixing Process)
(Finished Product)
Artificial
173

process which happens due to burning, dibagh or mixing with other materials are not pure or
unlawful.
Based on Islamic scholars opinion to broaden or limiting the usage of Istihalah concept ,
it is found that opinion from Hanafi is more relevant to be applied and suitable with the current
situation. Reason being, the opinion is in line with the rapid development of science and
technology which is base on effective and acurate laboratory analysis. Varoius discoveries and
research had been conducted and due to this situation which exist a new issue especially in food
production. Nevertheless, opinion from Shafie Islamic scholar is still strongly acceptable in
Malaysia.

Discussions
Pig is an animal which is haram or unlawful in Islam. Its prohibition has been clearly
stated in the Quran and Sunnah including Islamic scholars ijma. The prohibition is based on the
hazard it poses either chemically, microbiologically and behaviorly (psychologically). Currently,
in food production, porcine and its derivatives are the most common ingredients used. For
example, gelatin, rennet, shortening, collagen, whey, calcium stearate, oleic acid, pancreatic
extract, suet, bone ash and others. There are pro and cons opinion related to usage of these
materials. Majority of the Islamic scholar prohibited the results of these mixing processes though
conversion occurred. In spite of that, there is Islamic scholar who allowed it due to the changes
happened to the original form of the material. For example, plants status which is being fertilized
with porcine manure is lawful because it has gone through the Istihalah process Sahihah process.
Similarly, al-Jallalah plants like Spirulina plantesis which is being grown in porcine sewage
water which is being categorized as Istihalah Sahihah process. The process is as stated in
Diagram 2.

Diagram 2: Process for Istihalah Sahihah

RAW MATERIAL
A (HALAL)

CONVERSION AGENT
B (HARAM)

FINISH PRODUCT
(HALAL)
Mixing Process Conversion Process
174

RAW MATERIAL
A (HALAL)

CONVERSION AGENT
B (HARAM)

FINISH PRODUCT
(HARAM)
Mixing Process Conversion Process
Nevertheless, Islamic scholars considered that animal husbandry like fish which is feed
with animal feel from the porcine source and its derivatives continuously as Istihalah Fasidah.
Refer to Diagram 2 for Istihalah Fasidah process.

Diagram 3: Process for Istihalah Fasidah.

The same goes for other food products which contain porcine base and its derivatives like
sausage casing made from collagen of porcine intestine, porcine shortening in biscuits, pie
dough base and other related products is being categorized as Istihalah Fasidah. Due to the fact
that najs elements can still be detected through laboratory analysis.

Conclusion
Research shows Istihalah theory is relevant to implement as an alternative purification
instrument in solving current issue which especially related to food production. Nevertheless, in
Malaysia, products which contain porcine derivatives are acceptable but only in al-Dharurah
situation. The acceptance of al-Dharurah instrument compare to Istihalah causing dilemma
among the Malay Muslims. These agree with the high sensitivity of porcine issue which thickens
among the Malays in Malaysia. Consideration between the usage of halal product based on
Istihalah concept and prohibited products based on al al-Dharurah concept must be done by local
Islamic law scholars to achieve dynamic Islamic law. Therefore, it is not wrong to firmly hold on
Shafies sect without excluding or setting aside other sects opinion which is relevant and better
to ensure parallelism of Islamic law with the expanding and development of science and
technology.
References
Ghananim, Qazafi Izzat al-, al-Istihalah wa Ahkamuha fi al-Fiqh al-Islami, Urdun: Dar al-Nafais,
2008.
Hammad, Nazih, al-Mawad al-Muharramah wa al-Najisah fi al-Ghiza wa al-Dawa bayna al-
Nazariyyah wa al-Tatbiq, Damsyik: Dar al-Qalam, 2004.
Riaz, Mian N. & Chaudry, Muhammad M., Halal Food Production, London: CRC Press, 2004.
175

Sakr, Ahmad H., Understanding Halal Food Fallacies and Facts, Illinois, USA: Foundation for
Islamic Knowledge, 2006.
Tarifi, Abd Allah bin Muhammad bin Ahmad al-, al-Idtirar ila al-Atimah wa al-Adawiyah al-
Muharramah, Riyadh: Maktabah al-Maarif, 1992.
Zuhayli, Wahbah al-, Ahkam al-Mawad al-Najisah wa al-Muharramah fi al-Ghiza wa al-Dawa,
Damsyiq: Dar al-Maktabi, 1997.

176

A34

Halal Friendly Tourism: Capturing the Muslim Market

Dr. Suhaimi Ab Rahman*, Prof. Dr. Yaakob Che Man, Wan Sahida Wan Zulkifli

Halal Products Research Institute, Putra Infoport, Universiti Putra Malaysia, 43400 UPM

Email: suhaimi@econ.upm.edu.my

Abstract

Halal friendly tourism is becoming the next important sector in the halal industry. The increasing
awareness for Muslim travelers has given an impact on the development of tourism industry.
Muslim travelers, who represent 23 % of the estimated 2009 world population of the 6.8 billion,
are the main market for this sector. The industry players as well as the governments should steps
by developing the halal friendly tourism infrastructural. Among the fundamentals of the halal
friendly tourism it includes halal friendly hotel, halal foodservice and also Islamic tour packages.

Keywords: Halal friendly tourism, Halal conscious travelers, halal Foodservice

Introduction

Halal products and services are one of the fastest growing industries in the world. The increasing
interest halal industry shows that there is a massive potential for this industry to grow.
Nowadays, there is a high demand from Muslim consumers for health and quality products
which conform to shariah requirement (Al- Harran, 2008). The global market value for trade in
halal and non-halal food product was worth about 2.77 trillion annually (MATRADE).

The countries such as South Central Asia contribute about USD 210,000 million, Africa with
USD 144,250 million, West Asia with USD 116,850 million, South East with USD 97,300
million, Europe including Russia with USD 63750 million), China with USD 22,925 million,
North America, USD 12425 million, South America, USD 1,550 million and Oceania with USD
177

900 million. The increasing awareness on halal products and services would give opportunities to
the business industries, marketers and manufacturers to capture the halal conscious consumers

Halal Friendly Tourism

Tourism refers as activities of person traveling and staying in places outside the usual
environment for not more than one consecutive year for leisure, business and other purposes
(Ching 2008). Halal friendly tourism is a new halal service that offers Islamic packages to the
halal conscious travelers. It is provides holiday packages, tour packages, food, cultural and
heritage that conform to the shariah requirements.

The increasing awareness for Muslim travelers about halal has given an impact on the tourism
industry. Due to this fact, the government of Malaysia has established the Islamic Tourism
Centre (ITC) purely to capture the Muslim travelers. On the other part of the industry players,
there have been some developments, like providing the halal friendly services to cater the needs
of the Muslim travelers. The rating for halal friendly hotels has also been conducted in order to
provide services to the halal conscious travelers, thus, the Muslim travelers should be able to
browse and check the hotel that provides the halal friendly services such as halal food and
beverages, prayer facilities and other facilities that conform to the requirements.The Minister of
Tourism Malaysia, DR. Ng Yen Yen has made statement that Malaysia had realized and moving
forward to develop the halal friendly tourism in order to capture Chinese Muslim market. In
Malaysia, there are six hotels that have been rated by the Crecentrating for this purpose. In
addition, there are 57 number of hotel in Malaysia that have halal certificate in their hotel kitchen

Fundamentals of Halal Friendly Tourism

In order to promote, the halal friendly tourism fundamental facilities then components of halal
tourism should be planned and developed. Shamim (2009) recommended the fundamentals
should include the halal friendly hotel that provides halal foods and also other services that
178

conform to the shariah requirements. These three elements therefore would support the
development of halal friendly tourism.

i) Hotel Friendly Hotel

1. The foods served in hotel restaurants need to be halal.
2. All food ingredients must be halal and go through halal compliant processes.
3. The beverages served in hotel and restaurant should be free from alcohol.
4. The hotel need to conduct samak cleansing for any utensil in the room has been
suspected polluted by najis mughallazah.
5. Facilities such as swimming pool, gym facilities and spa facilities need to be separated
between man and woman.
6. Each kitchen in hotels should have Halal Certificate endorsed by JAKIM
7. Provide prayers facilities such as prayer mat, copies of the Quran, prayer time and
direction of Qiblat

(i) Food Premises

1. The foods served in restaurants should be halal and free from non- halal ingredients.
2. The foods premises or restaurant should have halal certificate from JAKIM
3. The foods served in restaurants should comply to the MS 1500:2004
4. The foods must be brought and prepared within halal environment.

(iii) Travel packages Services

1. Islamic travel packages should be introduced in order to develop the halal friendly
tourism.
2. Visit place which have Islamic concept such as mosques, Islamic museum in order to
promote the halal friendly tourism

Market Potential for Halal Friendly Tourism

There are 1.57 billion Muslims in the world today, representing 23 % of an estimated 2009 world
population of 6.8 billion (Pew Research Centers October 2009). The market potential for this
179

halal friendly tourism could be materialized the Middle East countries, which have vast tourism
expenditure. Below is the statistic of the overal tourism expenditure from year 1995 until 2007:

Table 1: International Tourism Expenditure by Source Country (in Billion USD):

Source: (www.crescentrating.com, adopted from World Tourism Organization)

Conclusion
Halal friendly tourism is becoming the next important sector for halal industry. There is huge
market for this sector that needs to be given a special attention to the reason that there is an
increase demand. This is due from the halal conscious travelers that looking for halal friendly
services. Thus, the halal industry players should grab this market opportunities by developing
halal friendly tourism to capture the Muslim market

Acknowledgement

This study was carried out with the financial support of eScience Fund project no. 5450301-
10205 awarded to Prof. Dr. Yaakob Che Man, Halal Products Research Institute, Universiti Putra
Malaysia, Serdang, Selangor.

Countries Year 1995 Year 2000 Year 2006 Year 2007
UAE 2.6 3.0 8.8 9.2
Kuwait 2.2 2.5 5.3 6.1
Iran 0.2 0.7 5.3 6.0
Malaysia 2.3 2.1 4.0 5.6
Saudi Arabia 0.7 0.8 1.8 4.9
Indonesia 2.2 3.2 4.0 4.9
Qatar 0.3 0.3 3.8 4.0
Turkey 0.9 1.7 2.7 3.3
Egypt 1.3 1.1 1.8 2.4
Total 12.7 15.4 37.5 46.4
180

References

Al-Harran, S. and Low, P. (2008), Marketing of halal products: the way forward, HalalJournal,
March, available at: www.halaljournal.com

Bahardeen , F. (2009,December ). Halal Conscious Travelers the New Media Perspective. Paper
presented at International Islamic Tourism and Halal Week Conference
Ching, P.W. (2008) Malaysian Economy. Malaysia: Second Edition, Prentice Hall

Halal Malaysia, e-Halal, Jabatan Kemajuan Islam Malaysia (JAKIM) available at
http://www.halal.gov.my/maklumat_hotel.php

Lugo, L. (2009). Mapping The Global Muslim Population. A Report on Size and Distributions
on the World Muslim Population. Retrieved from Pew Research Centre website:
http://pewforum.org/docs/?DocID=450

Shamim,Y.(2009 May). The Real Sense of Shariah Hospitality Concept. Paper Presented at The
World Halal Forum 2009 in Kuala Lumpur

3rd IMT GT Proceedings Libre

Diunggah oleh

Informasi Dokumen

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

3rd IMT GT Proceedings Libre

Diunggah oleh

Hak Cipta:

Format Tersedia

21-22 December 2009

Pan Pacific , KLIA , Malaysia

Anda mungkin juga menyukai