Supratim's Report

This watermark does not appear in the registered version - http://www.clicktoconvert.
com
Detection of Rotavirus in acute

gastroenteritis cases
A Dissertation work submitted to Barkatullah University,

Bhopal in partial fulfillment of the requirement for the award of
the Degree of Master of Science in Microbiology
By
Supratim Biswas
Enrolment no: R7-37032
Department of Microbiology
Extol Faculty of Life Sciences
Supervised by: Submitted by:

Dr. Triveni Krishnan Supratim Biswas
Division of Virology
National Institute of Cholera & Enteric Diseases
Indian Council for Medical Research
P33 CIT Road, Scheme XM, Beliaghata, Kolkata-700010
This watermark does not appear in the registered version - http://www.clicktoconvert.com
I dedicate this work

Of mine to my best
Friend Insha
Acknowledgement
Acknowledgement
At the very onset I would thank my parents for their
constant support, motivation and endless faith they had on
me though they had been doing the same right from my
birth till date and its useless thanking them cause its
impossible for anyone to repay ones parents.
I thank the almighty for blessing me and giving me all
strength to move on.
I want to thank Dr.G.B Nair, Director of the
National Institute of Cholera and Enteric Disease, for
allowing me for carrying out my dissertation work in his
research institution.
I am grateful to my guide Dr. Triveni Krishnan
Assistant Director Dept. of Virology National Institute of
Cholera and Enteric Diseases Kolkata for her guidance.
I am grateful and like to extend immense gratitude
towards Dr. Mamta Chawla Sarkar Senior Research
Officer Dept. of Virology National Institute of Cholera
and Enteric Diseases Kolkata for her support and co-
operation.
I am thankful to Mr. B Ganesh Research Officer
National Institute of Cholera and Enteric Diseases
Kolkata.
I thank Dr. Shaswati Bhattacharya Head of the

Department, Department of Life Sciences Extol Institute
Of Manangement.
I am thankful from the deepest core of my heart to
Anupamda, Shiladityada, Debaratidi, and Pariksitda.
They had been always there with their valuable comments
and suggestion which really helped me a lot. I also take the
opportunity to thanks Dipajanda, Mehulidi, Anurodhda.
I am thankful to Narayanda,Berada,Shayamalda for
their help.
Last but not the least I would like to thank my
friends Prantik,Priyam,Souvik,Pravat,Joyee,Deepti and
Richa for their constant unconditional love and support.
Date:
Place: Supratim Biswas

List of abbreviation
List of Abbreviations
A Adenine
APS Ammonium persulphate
Bisacrylamide N,N’-methylene-bisacrylamide
bp Base pair
BPB Bromophenol blue
C Cytosine
Ca2+ Calcium ion
cDNA Complementary DNA
dATP Deoxy adenosine tri phosphate.
dCTP Deoxy cytosine tri phosphate
dGTP Deoxy guanosine tri phosphate
dH2O Double distilled water
DLP Double layer particle
DMSO Dimethyle sulfoxide
DNA Deoxy ribonucleic acid
dNTP Deoxy nucleotide tri phosphate
dsRNA Double stranded RNA
DTT Dithiothreitol
dTTP Deoxy thymine tri phosphate
EDTA Ethylenediaminetetraacetic acid
ELISA Enzyme link immuno sorbent assay
EM Electron microscopy
ER Endoplasmic reticulum
EtBr Ethidium bromide
G Guanine
gm Gram
Kbp Kilo base pair
KD Kilo Dalton
LA Latex agglutination
M Molar
mA Miliampere
MBA N,N’-methylene bisacrylamide
mg Milligram
Mg2+ Magnesium ion
ml Milliliter
mM Millimolar
mRNA messenger RNA
N Normality
nm Nanometer
NSP Non-structural protein
O.D. Optical density

ORF Open reading frame
ORS Oral rehydration salts
ORT Oral rehydration therapy
PAGE Poly acrylamide gel electrophoresis
PBS Phosphate buffer saline
PCR Polymerase chain reaction
RdRp RNA dependent RNA polymerase
RH Random hexamer
RNA Ribonucleic acid.
RPHA Reverse passive hemagglutination assay
rpm Revolution per minutes
RT PCR Reverse transcription polymerase chain reaction
SDS Sodium dodecyl sulfate
SPACE Solid phase agglutination of coated erythrocytes
T Thymine
TBE Buffer Tris-Borate-EDTA BUFFER
TEMED N,N,N,N'-tetramethylethylene diamine
Taq DNA pol Thermus aquaticus DNA polymerase
Tris Tris (hydroxy methyl) aminomethane
U Uracil
UV light Ultra violet light
V Volt
VP Viral protein
Degree Celsius
Contents
Contents
Sl. No. Topic Page no.
1 Introduction 1-27
1.1 Virology 1-2
1.2 Viral gastroenteritis 3-10
1.3 Rotavirus 11-27
Materials and
2 30-46
methods
3 Results & discussions 47-52
4 Appendix 53-56
5 References 57-58
Introduction
VIROLOGY
Study of viruses is known as Virology. Viruses are infectious agents so
small that they can only be seen at magnification provided by the electron
microscope. The distinctiveness of viruses resides in their simple,
acellular organization and pattern of reproduction; they are 10 to 100
times smaller than most bacteria with an approximate size range of 20-
300 nm. A complete virus particle or virion consists of one or more
molecules of DNA or RNA enclosed in a coat of protein and sometimes
also have lipid bilayer membrane (or envelope). But this is acquired from
host cell, usually by budding through a host cell membrane. Viruses are
incapable of independent growth in artificial media. They can grow only
in animal and plant cell or in microorganism. They reproduce in the cell
by replication. Thus virus is referred to as obligate intracellular parasites.
The difference between viruses and living cells can be inferred by
at least three points
1. Their simple acellular organization
2. The presence of DNA or RNA but not both in almost all virions and
3. Their inability to reproduce independently and carry out cell division
as prokaryotes and eukaryotes do. Actually virus in transit from one
host cell to another are small packet of genes
The nucleic acid is enclosed in a highly specialized protein coat of a
varying design. The coat protects genetic materials when the virus is
outside of host cells and serves as a vehicle for entry into another specific
host cell.
Structure of virus:
Virus morphology has been intensively studied over the past decades
because of the importance of viruses. Virions range in size from about 10
to 300 or 400 nm in diameter. All virions , even if they possess other
constituents are constructed around a nucleocapsid core (indeed some
viruses consists only of a nucleocapsid). The nucleocapsid is composed
of a nucleic acid either DNA or RNA held within a protein coat called the
capsid, which protectsviral genetic material and acids in its transfer
between host cells. There are four general morphological types of capsid
and virions structure.
1. Some capsid is icosahedral in shape. An icosahedron is a regular

polyhedron with 20 equilateral triangular faces and 12 vertices. This
capsid appears spherical when viewed at low power in the electron
microscope.
2. Other capsids are helical and shaped like hollow protein cylinders
which may be either rigid or flexible.
3. Many viruses have an envelope ie. an outer membranous layer
surrounding the nucleocapsid. Enveloped viruses have a roughly
spherical but somewhat variable shape even though their
nucleocapsid can be either icosahedral or helical.
4. Complex viruses have capsid symmetry that is neither purely
icosahedral nor helical. They may possess tails and other structure
(e.g many bacteriophages) or have complex multilayered walls
surrounding the nucleic acid (e.g pox virus such as vaccinia)
Viral gastroenteritis
Gastroenteritis caused usually by infection with one of these viruses:
Rotavirus, Adenovirus, Astrovirus, Calicivirus etc are called viral
gastroenteritis.
These viruses are found all over the world and are
particularly problematic where sanitation is poor.
Typical exposure to these viruses occurs through
the fecal-to-oral route, by ingesting food that is
contaminated with fecal material or by coming in
contact with an infected person's vomit or
diarrhea and then inadvertently bringing the
contaminant to the mouth. Other routes of
transmission are quite likely, because exposure to
as few as 100 virus particles can cause an
infection. Viral gastroenteritis is a common
infection of the stomach and intestine that results
in vomiting, diarrhea. It can be caused by
different viruses. Viral gastroenteritis is highly
contagious. Anyone can get viral gastroenteritis
and most people recover without complication.
Gastroenteritis typically lasts about three days.
However viral gastroenteritis can be serious when The digestive system
people cannot drink enough fluid to replace what
is lost through vomiting and diarrhea. Especially infants, young children,
the elderly and people with weak immune system are the most susceptible
ones.
Symptoms: The main symptoms of viral gastroenteritis are vomiting and
watery diarrhea. Other symptoms may include nausea, fever, abdominal
pain, headache, and muscle aches, dehydration can follow. For most
people, gastroenteritis is not a serious illness. It typically resolves within
two to three days and there are usually no long-term effects. If
dehydration occurs, recovery is extended by a few days. If symptoms do
not resolve within one week, an infection or disorder more serious than
gastroenteritis may be involved. Prompt medical attention is required if
the child has any of these symptoms:
· a high fever of 102°F (38.9°C) or above

· blood or mucus in the diarrhea
· blood in the vomit
· bloody stools or black stools
· confusion
· severe abdominal pain or swelling
· inability to keep liquids down
Gastroenteritis is not an anatomical or structural defect, nor is it an

identifiable physical or chemical disorder. Symptoms can be observed
between one to three days or sometime longer. A diagnosis of viral
gastroenteritis is based on the person’s symptoms laboratory confirmation
is rarely sought except in outbreak when testing of vomit or feces is
important.
Causes: The viruses that cause viral gastroenteritis damage the cells in
the lining of the small intestine. As a result fluid leaks from the cells into
the intestine and produces watery diarrhea. Four types of viruses cause
most viral gastroenteritis.
· Rotavirus is the leading cause among the children 3 to 15 months
old and the most common cause of diarrhea. In children under age
of 5 years symptoms of Rotavirus infection appears 1 to 2 days
after exposure. Rotavirus typically causes vomiting and watery
diarrhea 3 to 8 days along with fever and abdominal pain.
Rotavirus can also infect adults who are in close contact with
infected children.
· Adenovirus occurs mainly in children under the age of 2 years. Of
the different types of Adenoviruses, types 40, 41 of subgenus F
affects the gastrointestinal tract causing vomiting and diarrhea
symptoms that typically appear 1 week after exposure. Adenovirus
infection occurs year round.
· Caliciviruses cause infection in people of all ages. This family of
viruses is divided into four types, the noroviruses being the most
common and most responsible for infecting people. The
noroviruses are usually responsible for epidemics of viral
gastroenteritis and occur more frequently in food borne
gastroenteritis. Infected people experience vomiting and diarrhea,
fatigue headache and sometimes muscle aches. The symptoms
appear after one to three days of exposure.
· Astrovirus also infects primarily infants, young children and
elderly. This virus is mostly active during the winter months.
Vomiting and diarrhea appear within 1 to 3 days of exposure.
· Picobirnavirus a novel group of viruses recently detected in

children and several species of animals including chickens.
Adenovirus
Electron microscopic image of Adenovirus

Adenoviruses are icosahedral particles measuring 70 to 100 nm
diameter. The particles contains DNA, protein no membrane or lipid,
and trace amounts of carbohydrates because the virion fiber protein is
modified by addition of glucosamine. Virions consist of a protein shell
surrounding a DNA – containing core. The protein shell (capsid) is
composed of 252 subunits (capsomers) of which 240 are hexons and
12 are pentons. As suggested by their names, penton and hexon
subunits are surrounded by five six neighbors respectively. Each
penton contains a base which forms part of the surface of the capsid
and a projecting fiber whose length varies among different serotypes.
Several different serotypes of human Adenoviruses cause infections of
the upper respiratory tract, however depending on the serotypes they
can cause gastroenteritis, conjunctivitis, tonsillitis etc. Most people
recover from Adenovirus infection by themselves but people with
immune-system problems sometimes die of Adenovirus infection and
very rarely even previously healthy people can die of these infections.
Classification: The Adenoviruses constitute the Adenoviridae family
of viruses which is divided into two genera. Mastadenovirus and
Aviadenovirus. The Aviadenovirus genus is limited to viruses of birds,
the Mastadenovirus genus includes human, simian, bovine, equine,
porcine, ovine, canine and opossum viruses.
Calicivirus
Electron microscopic image of calicivirus

The family Caliciviridae is composed of small non enveloped icosahedral
viruses that possess a linear Positive – sense single-stranded RNA
genome. The capsid appears hexagonal/spherical with a diameter of 35-
39nm. Caliciviruses have a broad host range and can cause various
disease syndromes. Calicivirus infections commonly cause acute
gastroenteritis, which is the inflammation of the stomach and intestines.
Symptoms can include vomiting and diarrhoea.
These symptoms emerge after an incubation time of 2 days and the
symptoms only generally last for 3 days. Most calicivirus infections
do not call for medical attention, but those who are immuno
compromised may need to be hospitalized for rehydration therapy.
Transmission of caliciviruses is generally by the fecal-oral route, but
they can also be transmitted via the respiratory route.
The Caliciviridae family includes the following genera:
Genus Vesivirus; type species: Swine vesicular exanthema virus
Genus Lagovirus; type species: Rabbit hemorrhagic disease virus
Genus Norovirus; type species: Norwalk virus
Genus Sapovirus; type species: Sapporo virus
Classification: The two groups of human

Caliciviruses have been classified into distinct genera within the family
Caliciviridae and they have been provisionally named the “Noroviruses”
and the “Sapo viruses”. Although all Calicivirus share a common
ancestor in phylogenetic analysis, the “Noroviruses” and “Sapoviruses”
forms distinct genetic clades within the Caliciviridae. In addition certain
features of their RNA genome organization distinguished them from each
other genera in the Caliciviridae. The family has two additional genera
Lagovirus and Vesivirus each of which includes Caliciviruses of
veterinary importance such as RHDV and FCV respectively.
Astrovirus
Astrovirus were first described in 1975 as a result of electron microscopic
studies of an outbreak of diarrhea. Astrovirus is characteristically star
shaped.
There are human as well as animal Astroviruses. They are icosahedral
viruses and non-enveloped. Astrovirus contains positive sense single-
stranded RNA. Astroviruses are small 28nm in diameter round shape
virus particles. They are found in stool of infants hospitalized with
diarrhea. Surveys conducted using electron microscopy showed that
Astrovirus infection occurs worldwide and accounts for 2 to 8 % cases of
diarrheas in infants. A major advance in the abilities of laboratory to
diagnose Astrovirus came as results of the findings that they could be
propagated in a continuous line of colon carcinoma cell CaCo2
(Willcocks et. al, Arch-Virol, 1990; 113; 73-81). The development of
enzyme immunoassay (EIA) in the late 1980s for detecting viruses in
stool showed that Astrovirus is significant cause of diarrhea in developing
countries. There are 8 serotypes of human Astroviruses; they are stable at
pH 3, resistant to cholofrom and detergents and lipid solvent. The single
stranded RNA is approximately 6800 nucleotides in length excluding
polyA tail at the 3’ end. Viral genome comprises of 3 ORFs. 2ORFs at 5’
end of the genome designated as ORF 1a and ORF 1b encodes
nonstructural protein. The third ORF designated as ORF 2 encodes for
structural protein and is found at 3’ end of the genome. This ORF is
common to both the genomic and sub genomic RNA.
The transmission of Astrovirus takes the fecal-oral route. Astrovirus
replication occurs in intestinal tissues in humans usually children under 3
years age mostly gets affected. Actinomycin D, an inhibitor of DNA
transcription did not inhibit Astrovirus infection in these systems. Among
the 8 serotypes of Astrovirus the serotype 1 appears to be the most
prevalent. Human Astrovirus infection includes a mild watery diarrhea
that lasts for 2 to 3 days associated with vomiting, fever, anorexia,
abdominal pain and various constitutional symptoms.
Picobirnavirus
Picobirnavirus was first described by Pereira et al when they detected the
bands of bisegmented double stranded RNA by polyacrylamide gel
electrophoresis (PAGE) in feacal samples from children. The virus
particles are of icosahedral symmetry. Picobirnaviruses are unclassified,
non-enveloped, small spherical viruses 35 to 41 nm in diameter. They
have bisegmented dsRNA genome. The genome is of two types and the
types are large profile and small profile. The size of the genomic
segments for the large genome profile is 2.3 to 2.6 kb for segment 1 &
1.5 to 1.9 kb for segment 2. Picobirnavirus with small genome profile
have two genome segments of 1.75 to 1.55 kbp for segment 1 & 2
respectively. Picobirnaviruses are opportunistic diarrhreagenic
pathogens. Other than human Picobirnaviruses has been identified in
other hosts such as rats, guinea pigs, rabbits, horses and sheep.
Picobirnaviruses are also identified in calves causing outbreaks of
diarrhea. Picobirnaviruses belong to the family Picobirnaviridae. They
differ in several important respects from birnaviruse which is another
group of viruses with a bisegmented double stranded RNA genome.
Picobirnaviruses were classified as opportunistic diarrhoeagenic
pathogens. As far a UK based epidemiological study it was said that
human Picobirnaviruses were detected among patients with or without
gastroenteritis. Picobirnavirus strains have been classified into two
genogroups represented by the Chinese strain 1-CHN-97 and the US
strain 4-GA-91 based on RT-PCR experiments. Inference drawn from
various epidemiological data human picobirnavirus infects population
with low immunity.
ROTAVIRUS
A double-capsid particle is shown on the left, and the single (inner)

capsid on its right.
Rotaviruses are the single most important cause of severe diarrheal illness
in infants and young children in both developing and developed
countries. It is a member of Reoviridae family. It was first identified by
Bishop et. al. in 1975. Later Flewett et. al observed Rotavirus particles
under the electron microscope. The name Rotavirus comes from
characteristics wheel-like appearance of the virus particles when viewed
under electron microscope (the name Rotavirus is derived from the Latin
word Rota, meaning “wheel”).
Although diarrheal diseases are one of the most common illnesses in the
age group throughout the world they assume special significance in
developing countries where they constitute a major cause of mortality
among the young. Pediatric diarrhoea remains one of the major causes of
death in young children. This is especially so in Asia, Africa, Latin
America where it causes millions of deaths in the age group 0-5years. A
number of different viruses cause diarrhoea of which the most important
is the family of ROTAVIRUSES. Rotaviruses have been estimated to be
associated with 30-50% of all cases of severe diarrheal disease in man.
Rotaviruses are the single most important cause of severe diarrhoeal
illness in infants and young children in both developed and developing
countries worldwide. Although diarrhoeal diseases are one of the most

common illnesses in this age group throughout the world they assume a
special significance in developing countries where they constitute a major
cause of mortality among the young. Human Rotavirus was first
discovered in Australia by thin section microscopic examination of
duodenal biopsies obtained from children with acute diarrhea and was
observed by electron microscopy soon afterwards in diarrhoeal stool
specimens from various parts of the world. The virus particle is
approx.70nm in diameter and contains eleven segmented double –
stranded RNA as its genome and has an inner and outer capsid but no
envelope.
Rotavirus: Negatively stained Electron Micrograph
Morphology and Morphogenesis:

Rotaviruses have a distinctive morphologic appearance by negative stain
EM. Complete particles measures about 70nm in diameter and have a
distinctive double-layered icosahedral protein capsid that consists of an
outer and an inner layer when viewed by transmission EM. Within the
inner capsid is a third layer, the core that contains the viral genome
consisting of eleven segments of double-stranded RNA [dsRNA]. The
complete particles are also designated smooth particles because the
outermost margin of the outer capsid layer has a well defined, smooth
circular appearance. Particles lacking the outer capsid layer measure
about 55nm in diameter and are designated rough particles because
without the smooth outer layer the capsomeres of the inner capsid
projects to the periphery giving a circular “bristly” appearance. The term
Rota which means wheel was suggested because the sharply defined
circular outline of the outer capsid gives the appearance of the rim of a
wheel placed on short spokes radiating from a wide hub. The viral
particle contains RNA-dependent RNA polymerase and other enzymes
capable of synthesizing capped but non-polyadenylated mRNA
transcripts. Viral replication occurs in the cytoplasm of the infected cell.
Due to the segmented nature of the genome, Rotavirus can undergo
genetic reassortment.
The Rotavirus genome encodes 6 structural and 6 non-structural
proteins with each gene essentially encoding a single polypeptide except
gene 11 which codes for an additional protein from, an out of phase open
reading frame. The proteins that contribute to the structure of the virion
are called viral proteins whereas the proteins that are encoded by the virus
but do not contribute to the structure in the mature virion are called non-
structural proteins. The outer capsid layer is made of two proteins VP7
and VP4. VP7 encoded by one of the gene segments 7,8 and 9 depending
on the rotavirus strain, forms the outermost layer consisting of 780
molecules and VP4 (encoded by genome segment 4) is represented by the
60 spikes (dimers) emanating from the surface. The intermediate layer is
composed of 780 molecules (260 trimers) of a single protein VP6
(encoded segment 6) which represents about 51% of the virion protein.
The inner layer is formed by 120 molecules of VP2 (the gene product of
segment 2) and it encloses the core consisting of VP1, VP3, and the
eleven segments of dsRNA.
Viral structural protein:

VP1:
1. VP1 is one of three proteins comprising the innermost of three viral
layers.
2. It is the RNA-Dependent RNA Polymerase for rotavirus, a core

replication intermediate.
3. Associates with VP2 at its icosahedral vertices.

VP2:
1. This protein is the main structural component of the innermost layer.
2. It associates with VP1 and VP3 at its 12 vertices, and is a replication
intermediate.
VP3:
1. VP3 is a hemagglutinin protein, the third part of the inner core of the
virus.
2. VP3 acts as the mRNA capping enzyme.
3. It also associates with VP2 and is a replication intermediate.
VP4:
1. Along with VP7, VP4 makes up the outer capsid of virus.
2. It contributes 1.5% of total virion protein.
3. It is an 88 kD protein that dimerizes to form 60 spikes on the virus
capsid.
4. VP4 is cleaved at the ‘cleavage site’ by the pancreatic enzyme
trypsin to form VP5 and VP8.
5. VP4 and its cleavage products are associated with cell attachment
[adsorption] as invasion and cleavage is necessary for infectivity.
6. VP4 is antigenic and induces neutralizing antibodies.
7. The specific structure of this protein is used to determine the
rotavirus P genotype, as well as host specificity, virulence and
protective immunity.
8. It has also been associated with heat shock cognate protein, hsc70
during cell entry.
VP5:
1. VP5 is cleaved from the outer capsid protein, VP4, in the presence
of trypsin.
2. It remains bound to virion post cleavage, and can be bound by
neutralizing antibodies made towards VP4.
3. It is membrane associated and functions to permeabilize host cell
membranes to facilitate cell invasion.
VP6:
1. Molecular weight is 41 kD.

2. Contributes 51% of the total virion protein.
3. Immunodominant sites of VP6 have been localized in the four
regions on VP6 (amino acid residue 32 to 64; 155 to 167; 208 to
294; 308 to 396 ;)
4. Amino acid residues 172, 305, 315 & region 296 to 299 were
reported as contributing to subgroup epitopes.
5. VP6 is a structural component that comprises the middle capsid.
6. The specificity of this protein is used to determine the A-G
groupings of rotaviruses, and I, II sub-groupings of Group A
rotaviruses.
7. It has also been linked to the enterotoxin NSP4.
VP7:
1. Contributing 30% of the virion protein.
2. This 37 kD glycoprotein makes up the smooth portion of the outer
capsid.
3. It contains three potential sites for N-linked glycosylation. [viz.
NIS]
4. It can induce neutralizing antibodies and determines the G
serotype.
5. It has been classified into 15 distinct G- genotypes.

6. Comparison of amino acid sequence of all 15 genotypes indicates
that there are nine regions that are highly divergent. Each of these
regions is highly conserved among Rotavirus strains within the
same genotypes/serotypes.
7. It is also a highly variable portion of the virus, capable of
reassortment and possible crossover with animal strains of the
virus.
8. VP7 also has associations with heat shock cognate protein (hsc
70), and some integrins, both related to viral entry of the cell.
VP8:
1. VP8 is the second cleavage product of VP4.
2. Like VP5, remains virion associated post cleavage and is bound by
VP4 neutralizing antibodies.
3. It functions to bind sialic acid and acts as the virus hemagglutinin.
Figure showing the different structural proteins. Indicating the

Positions of VP4, VP6, VP7and VP1.
Viral non-structural protein:

NSP1:
1. NSP1 binds Interferon Regulatory Factor 3 and may inhibit
interferon response during rotavirus infection.
NSP2:
1. In conjunction with NSP5, NSP2 is involved in synthesis and
packaging of viral RNA and creation of viroplasms.
2. NSP2 is a replication intermediate and having two domains which
are separated by deep cleft.
NSP3:
1. NSP3, a 36kD protein, binds viral mRNA at the 3’ end and
promotes viral protein synthesis.
2. It also represses host cell protein synthesis.
3. This protein is a possible target for a new class of antivirals.
NSP4:
1. NSP4 has been seen to act as an enterotoxin and cause diarrhea
during infection.
2. There is also correlation between VP6 virus subgroup and NSP4
genotype.
NSP5:
1. This phosphoprotein works with NSP2 in RNA synthesis and
packaging, and to induce viroplasms. It is also a replication
intermediate.
NSP6:
1. Little information is available on NSP6; it is associated with NSP5
and its function.
Genome:
1. Genome contains segmented dsRNA (11 segments).
2. Total genome size is 18.5 kb.

3. Containing RNA dependent RNA polymerase.
4. Containing other enzymes for producing capped RNA.
5. Capable of genetic reassortment.
6. AU rich (58%-67%) genome.

7. Each positive (+ve) sense RNA segment starts with a 5΄-guanidine
followed by a set of conserved sequence that is part of 5΄-
noncoding sequence.
8. Next to the 5΄-noncoding sequence an open reading frame (ORF)
coding for protein product is present.
9. ORF ends with stop codon followed by another set of noncoding
sequence which contains a subset of conserved terminal 3΄
sequence. It contains two 3΄ terminal cytidines. Almost all mRNAs
end with the consensus sequence - 5΄UGU GACC 3΄.
10. The length of the 5΄ and 3΄ noncoding sequence varies for different
genes.
Electrophoresis of the genomes of reovirus type 3 (REO), human

rotavirus (HR), calf rotavirus (CR), and the orbivirus D'Aguilar
(DAG) on 7.5% polyacrylamide gels. Migration wasfrom top to
bottom.
11. No polyadenylation signal is found at the 3΄ end of the gene. All

11 mRNA share common cis-acting signals because they all
replicate by the same polymerase and these signals are likely to
be formed by secondary structures rather than by primary
sequence. In addition each mRNA must also contain a signal that
is unique to it alone because the 11 mRNA must be distinguished
from one another during packaging. Generally, the conserved
terminal sequence in genome segments contain cis acting signals
important for transcription, RNA translation, RNA transport,
replication, assembly or encapsidation of the viral genome

segments.
Figure shows the 11 segments of dsRNA along with the

corresponding encoded protein and protein position at the Rotavirus
capsid.
Replication in host cell:

Attachment/ entry into host cell:
Rotavirus entry into cells appears to be a multistep process that requires
both VP4 and VP7. Recent studies indicate that rotaviruses can initiate
infection by two either of the modes- I) sialic acid dependent pathway
and II) sialic acid independent pathway. Sialic acid dependent virus
initiates infection of polarized intestinal epithelial cells efficiently only by
the apical membrane, whereas sialic acid independent virus can
efficiently infect polarized cells by either the apical or basolateral
surfaces. These results indicate that sialic acid dependent and sialic acid
independent rotavirus are likely to use different receptors, although
studies in non-polarized cells have suggested that they may share a
second receptor. Further studies indicate that infectious virus pretreated
with trypsin apparently gain entry into cells by direct penetration of
particles through the cell membrane into the cell cytoplasm. In contrast,
non-trypsin treated particles were taken up by phagcytosis and such
virion are seen to sequester into lysosomes, 20 minutes after virus
attachment to the cell membrane. Experimental result shows that trypsin

activated rotavirus is internalized with a half-time of 3 to 5 minutes,
whereas non-activated virus disappears from the cell surface with a half
time of 30 to 50 minutes. Endocytosis inhibitor (for example-
cytochalasin D or the vacular protein-ATPase inhibitor bafilonycin A1)
also does not block Rotavirus entry. These results indicate that neither
endocytosis nor an intraendosomal acidic pH or a proton gradient is
required for rotavirus entry into cells.
Replication:The rotavirus replication cycle may be viewed as having

three subsequent major stages: I) translation and synthesis of the viral
proteins; II) replication, genome packaging and DLP assembly; III)
budding of the newly formed DLPs into ER and assembly of the outer
layer to form mature TLPs. The positive strand RNA transcripts encode
the rotavirus proteins and functions as a template for production of
negative strand to make the progeny dsRNA. Recent studies with siRNA
have indicated that there are likely to be separate pools of mRNA for the
distinct functions (Silvestri et al. 2004).
Figure showing the general scheme for replication of rotavirus

The process by which 11 segments of dsRNA get encapsidated into each
virion remains unclear. Each mRNA has to occupy different vertices to
associate with a transcription enzyme complex; as per the current model

of genome organization, it is unlikely that the dsRNA genome segments
are encapsidated into preformed empty capsids as in some of the
bacteriophages. Instead, the encapsidation could be concurrent with the
capsid assembly as proposed by Pesavento et al. 2003. In this model, the
capsid assembly begins with the association of 12 units, each unit
consisting of pentamers of VP2 dimers in complex with a transcription
enzyme complex (VP1-VP3) and a genome segment, to form the SLP and
provide a scaffold for the subsequent assembly of VP6 trimers leading to
the assembly of a DLP. Replication, genome packaging and assembly of
the DLP occur in perinuclear, nonmembrane-bound, electron dense
inclusions called viroplasms, which appear 2-3 hours after infection.
Several in vivo and in vitro studies have strongly implicated two of the
nonstructural proteins NSP2 and NSP5, not only in formation of
viroplasm, but also in genome replication and packaging (Aponet et al.
1996; Gallegos and Patton 1989; Petrie et al. 1984).
Maturation:
Maturation and release represent the final step of the rotavirus replication
cycle. Once formed, DLPs bud from the viroplasms into the proximally
localized ER (Estes2001). The mechanism of acquiring outer layer
consisting of VP7 and VP4 is not clear. This budding process is
facilitated by the NSP4, which has a binding site for VP6 (Au et al. 1989,
1993; Tian et al. 1996). Both NSP4 and VP7 are synthesized on the ER
associated ribosomes and co-translationally inserted into the ER
membrane. Recent studies using RNA interference have shown that
accumulation of rotavirus proteins and indeed, DLPs and TLPs, are
blocked by silencing the expression of the NSP4 gene
(Lopez et al. 2005). This result indicates that NSP4 may have previously
unexpected functions related to virus maturation. A likely possibility is
that assembly of VP4 onto viral particles may take place at the plasma
membrane shortly before particles release and that VP4 may be involved
in the early stage of release. VP4 is synthesized on free plasma membrane
of the infected cells (Nejmeddine et al. 2000; Sapin et al. 2002). Virus
released by cell lysis or by nonclassic vesicular transport in polarized
epithelial cells.
Classification of Rotavirus:
Classification of Rotavirus is based on antigenic and genetic structure
derived from VP6 (group A-E), VP7 and VP4 surface proteins. The VP7
serotype is designated as G (VP7 is glycoprotein) and VP4 serotypes as P
(VP4 is protease enzyme). Most human Rotaviruses belong to group A.
The Rotaviruses have been divided into groups, subgroups and
serotypes based on the types of proteins that constitute their outer and
inner capsid. There are seven groups identified A, B, C, D, E, F and G.
Groups A, B and C Rotaviruses are those currently found in both human
and animals. The viruses of group D, E, F and G have been found only in
non human sources till date. Group A Rotaviruses have clearly been
established as causing significant diarrhoeal disease in the young. Group
B Rotaviruses have been associated with annual epidemics of severe
diarrhea primarily in adults. The group A Rotavirus is further divided into
four different types of subgroups [1] SGI, [2] SGII, [3] SGI & SGII, [4]
non SGI-non SGII, depending on the nature of the VP6 protein present in
the inner capsid and into 26 P-genotypes based on the variable nature of
VP4 protein in the outer capsid.
The major antigenic properties of Rotavirus group, subgroups and

genotypes are determined by the viral capsid proteins. Rotavirus has
seven major groups (A-G); most human strains belong to group A,
although group B and C have occasionally been associated with human
illness. The product of the 6th gene of group A Rotaviruses encodes VP6
which is the most abundant viral protein and the major determinant of
group reactivity -the target of common diagnostic assays and contains the
antigen that is used to further classify Rotaviruses into subgroups I and II.
The outer capsid proteins VP7 is the glycoprotein or G- protein (encoded
by gene 7, 8 or 9 depending on the strain) and VP4 the protease- cleaved
o r P -protein (encoded by gene segment 4) determine the genotype
specificity and form the basis of the binary classification (G and P type)
of Rotaviruses. Both G and P proteins induce neutralizing antibodies and
may be involved in protective immunity. Fifteen G genotypes of
Rotavirus or 10 G serotypes which occur in humans, have been defined
by gross – neutralization studies with polyclonal animal serum samples;
these serotypes correlate with antigenic specificity of the VP7
glycoprotein. The characterization of P serotypes has been difficult

because adequate reagents are not available. Eight P serotypes of human
Rotaviruses have been characterized. Additional VP4 gene variants have
been identified, so ultimately the number of P serotypes may exceed 20.
Theoretically 80 different strains of Rotavirus could result from different
combinations of known 10G and 8P serotypes of human Rotaviruses. For
vaccine development purposes, it is fortunate that only four common
strains (G1, G2, G3 and G4) of Rotavirus predominate globally.
Epidemiology of Rotavirus:
Until the discovery of the Rotaviruses only a small proportion of severe
diarrhoeal illness of infants and young children could be linked to an
etiologic agent. However as data from epidemiologic studies in the
developed and developing countries have accumulated, it has become
clear that Rotaviruses are the major etiologic agents of serious diarrhoeal
illness in infants and children under 2 year of age throughout the world.
In developing countries, Rotaviruses are the major cause of life –

threatening diarrhea in infants and young children. The burden of
Rotavirus diarrhoeal disease in infants and young children under 5 years
of age in developing countries has been estimated to be 130 million cases;
over 18 million of these were considered moderately severe or severe. In
addition it has been estimated 8,73,000 infants and children under 5 years
old die from Rotavirus diarrhoeal illness each year in developing
countries. Thus during the first 5 years of life in the developed countries
almost every child will experience an episode of Rotavirus diarrhea but
the consequence will be quite different in the developing countries: 1 of 8
will develop moderately severe illness and 1 in 160 will die.
In developed countries the widespread distribution of Rotaviruses

in the community is indicated by the universal acquisition of serum
antibodies to these viruses at an early age. For example in the
Washington D.C area over 90% of infants and young children acquire
Rotavirus antibodies by the end of the third year of life a pattern similar
to that observed for respiratory syncytial and para influenza type 3
viruses.
Epidemiology of Rotavirus in India:

It is estimated that close to 100,000 annual deaths are caused by rotavirus
in India, that is, 1 in every 250 children born in India will die from
rotavirus by the age of 5 years. India accounts for 17 per cent of the world
estimated rotavirus associated deaths (Indan J Pediatr 2001; 68: 855-62.).
A number of studies have been conducted on the prevalence of childhood
rotavirus diarrhea in various parts of the country in which rotavirus was
detected in 5 - 71 percent of the hospitalized children less than 5 years of
age with acute gastroenteritis (Emerg Infect Dis 1998; 4: 561-70; Indan J
Pediatr 2001; 68: 855-62; J Diarrhoeal Dis Res 1992; 10: 21-4.). The
prevalence of childhood rotavirus in the north Indian cities of Delhi,
Chandigarh and Aligarh has been reported to vary from 6-45 per cent (J
Diarrhoeal Dis Res 1992; 10: 21-4; J Diarrhoeal Dis Res 1993; 11: 14-8;
Indian J Med Res 1997; 106: 508-12.). In the western states of India, in
Pune, rotavirus was detected in 28-30 per cent of children 5 yr of age
with acute diarrhea (Indian J Med Res 1999; 109: 131-5.) In eastern
India, in Kolkata the incidence of rotavirus associated diarrhea varied
from 5-22 per cent (Trans R Soc Trop Med Hyg 1991; 85: 796-8; Indian J
Med Res 1984; 80: 620-2.). On the other hand, in Manipur the incidence
was as high as 41 per cent (Indan J Pediatr 2001; 68: 855-62).
Esti
mated global distribution of the 800,000 annual deaths due to
rotavirus diarrheas. Each point signifies five hundred deaths
(Emerging Infectious Diseases Volume 4 Number 4 Oct-Dec 1998.)
Rotaviruses infection and diarrheal disease:

Mode of transmission:
Rotavirus infection is highly contagious. The transmission of Rotavirus is
mainly through the fecal oral route. There has not been enough evidence
to show any air borne transmission. Children can transmit the virus when
they forget to wash their hands after using the toilets or before eating.
Touching a surface that has been contaminated with Rotavirus and then
touching the mouth area can result in infection. Person to person spread
through contaminated hands is probably the most important means by
which Rotaviruses are transmitted in close communities such as pediatric
and geriatric wards, day care centers and family homes.
Infected food handlers may contaminate foods which do not
require cooking such as salad fruits etc. Rotaviruses are quite stable in the
environment and have been found in estuary sample at levels as high as
1-5 infections particles/gallon, sanitary measures adequate for bacteria
and parasites seem to be ineffective in endemic control of Rotavirus as
similar incidence of Rotavirus infection is observed in countries with high
and low health standards.
Mode of infection:
Rotaviruses tend to affect gastrointestinal epithelial cells that are at the tip
of the villus. Following infection, the cells at the villus tip die and the
villus becomes denuded which result in shortening and stunting of the
villi. In the underlying lamina propria, mononuclear cell information is
observed. Their triple protein coat makes them very resistant to the
normally prohibitive pH of the stomach and also digestive enzymes
(lipase and protease) in the gastrointestinal tract.
Symptoms:
Symptoms usually begin within 2 days after exposure with the rotavirus
and it shows following symptoms-
1. Anorexia.
2. Low grade fever.
3. Watery, bloodless diarrhea.
4. Vomiting.
5. Abdominal cramps.
Symptoms generally persist for three to nine days.
Rotavirus infection can be associated with severe dehydration in infants
and children.
Symptoms of dehydration included-
1. Lethargy.
2. Dry and cool skin.
3. Dry or sticky mouth.
4. Absence of tears when crying.
5. Sunken eye or sunken fontanelle (the soft spot on the head of infants)
6. Extreme thirst.
Laboratory diagnosis:
Different diagnostic methods are in use for the detection of Rotavirus
which differs in sensitivity and are based on different ideas. Rotaviruses
can be identified easily by Electron microscopy. Direct EM examination
of stool samples can reveal the presence of Rotavirus. Rotavirus can be
detected by commercial assays like Latex Agglutination (LA), Reverse
Passive Haemagglutination assay (RPHA), Solid Phase Agglutination
of coated erythrocytes (SPACE). Detection of Rotavirus is also done by
PAGE followed by silver staining in some laboratories in addition or as
an alternative to EIA. But PAGE lacks sensitivity that is it requires a
minimum of 3 to 4 ng of viral RNA for the detection. So the widely used
method is ELISA which is more sensitive than PAGE. The latest
techniques like Dot Blot Hybridization using radio labeled cDNA
probes and Reverse Transcriptase Polymerase Chain reaction (RT-
PCR) are now being used as confirmatory test for detecting Rotavirus in
stool samples from patients with acute gastroenteritis.
Treatment:
Rotavirus gastroenteritis is a self limiting illness lasting for only a few
days. For persons with healthy immune system, treatment is non- specific
and consists of oral rehydration therapy to prevent dehydration.
Fortunately most people develop an immune response that is eventually
adequate to clear the virus from the body. A majority of patients affected
are infants; for them the disease state can be dangerous. About 1 in 40
children with Rotavirus gastroenteritis will require hospitalization for
administration of intravenous fluids. The most common symptom is
diarrhea and this alone can cause severe dehydration and electrolytic
imbalance. Antidiarrheal medicines are recommended.
In developing nations treatment for dehydration is oral rehydration
therapy (ORT). ORTs are available in packets and can be prepared at
home. The ingredients consist of one liter of water, one level teaspoon of
salt, and eight level teaspoons of sugar. Proper measurement is important
because too much sugar (more than 3%) can worsen diarrhea due to
osmotic effects.
Contents of oral rehydration salts (ORS) recommended by

WHO:
Reduced osmolarity ORS (1 liter):
Sodium chloride 02.60 gm
Glucose, anhydrous 13.50 gm
Potassium chloride 01.50 gm
Trisodium citrate, dehydrate 02.90 gm
Total weight 20.50 gm

Reduced osmolarity ORS (1 liter):
Sodium 75.00 mMol
Chloride 65.00 mMol
Glucose, anhydrous 75.00 mMol
Potassium 20.00 mMol
Citrate 10.00 mMol
Total osmolarity 245.00 mMol
Rotavirus vaccines:
From the hospital based epidemiological studies on Rotavirus lead to the
urgency of development of a vaccine effective against Rotaviral
gastroenteritis. The basic aim of the Rotavirus vaccines is preventing
children worldwide from being infected by Rotavirus during the first two
years of life, when Rotavirus disease can be most serious and takes its
greatest toll. Studies suggest that the effectiveness of Rotavirus vaccines
will depend in large part on its ability to stimulate intestinal -IgA
antibodies and other forms of local immunity. The recent strategies taken
for the development of Rotavirus vaccines range from cell culture
cultivation of strains obtained from human or animals to the application
of recently developed molecular biologic techniques. A rotavirus vaccine
(RotaShield) was released for general use in 1998-1999. Despite
promising initial results, vaccination was withdrawn because of a causal

relationship between the vaccine and several cases of intussusceptions.
The risk was observed 3-14 days following administration of the first
dose of the RotaShield vaccine in infants older than 3 months. In 2006,
two vaccines against Rotavirus infection were shown to be safe and
effective in children: Rotarix by GlaxoSmithKline and RotaTeq by
Merck. Both are taken orally and contain disabled live virus. In February
2006, the U.S. Food and Drug Administration approved RotaTeq for use
in the United States.
Detection of Rotavirus
In acute gastroenteritis
Cases
Objective of work
Detection of Rotavirus in acute gastroenteritis is the specific area of my
work. Hereafter the illustrations of the techniques by which Rotavirus
detection is done are being given followed by the inference drawn at end
of the experiments.
Materials and methods

Screening of Rotavirus by PolyAcrylamide Gel

Electrophoresis (PAGE) Technique:
RNA Extraction for PAGE:
1. 150µl of processed sample was taken and 50µl SDS/Na-Acetate
was added followed by 200µl phenol-chloroform-isoamyl alcohol
mixture [note - phenol-chloroform-isoamyl alcohol mixture was
shaken properly before use].
2. That mixed sample was vortexed and centrifuged at 10,000 rpm
for 10 minutes.
3. Upper transparent layer containing RNA (three layers were
formed) was taken out for gel loading.
Phenol-Chloroform mixture:
Solution I:
Redistilled phenol 50.00 gm
8-hydroxy quinoline 00.05 gm
Double distilled water 20.00 ml
Then solution I was mixed with Chloroform and Isoamyl alcohol as
following volume to prepare the
Phenol-Chloroform mixture.
Chloroform 41.60 ml
Isoamyl alcohol 01.74 ml
Solution I 65.00 ml
[Note – the final mixture must be shaken properly before every time it is
used]
SDS/Na-acetate solution (pH-5.0):

Solution I:
17N Glacial Acetic acid 01.15 ml

Double distilled water volume up to 200 ml
Solution II:
Sodium acetate (Na+CH3COO-) 01.15 gm
Double distilled water volume upto 140 ml

The 60ml solution I (0.1M glacial acetic acid solution) was mixed with
140 ml of solution II and pH was adjusted to 5.0. 2.00 gm of SDS was
added to that mixture and mixed properly. The final solution was the
SDS/Na-acetate solution. [Note – pH adjustment is prior to SDS
addition.]
Gel Casting for PAGE:

1. Glass plates, spacer and comb was properly cleaned by using
soap and then dried into a drier.
2. Glass plates and spacer was properly placed and fixed in the
casting strand. [Note- fixing of glass plates and spacer must be
done carefully so that no leakage of gel can happen as well as
glass plate does not break]
3. 7.5 % acrylamide gel solution was prepared and then poured into
casting plates and appropriate comb was fixed in the gel.
4. Comb was removed after gel got solidified and the gel plates
were fixed with the electrode equipment part of the apparatus.
Acrylamide solution:
Acrylamide 30.00 gm
N,N’-methylene bisacrylamide (MBA) 00.80 gm
Separation gel buffer (4X):

Tris HCl 18.17 gm

The pH was adjusted to 8.8 with 12 N HCl (about 2.75 ml was required).
Finally the volume was adjusted to 100 ml with double distilled water.
Ammonium persulphate solution (2% APS):

Ammonium persulfate (APS) 02.00 gm
7.5% polyacrylamide gel composition (for 46 ml):

Separation gel buffer 11.25 ml
Acrylamide solution 11.25 ml
TEMED 200 µl
2% APS 600 µl
Sample Loading and Running the Gel:

1. Approximately 120µl sample RNA (collected from the extraction) was
taken and mixed with 40µl bromophenol blue (gel loading buffer) and
loaded into the gel well. A positive control (contained Rotavirus RNA)
also was loaded.
2. The whole setup was transferred into the reservoir containing 1X
trisglycine running buffer (pH-8.3) and connected with its power
pack.
3. 14mA current was set for 1 gel plate or at 28mA current was set for
2 gel plates and it was run for 16-18 hours.
Tris-Glycine reservoir buffer (10X):

TRIZMA 32.20 gm
Glycine 188.00 gm
The pH was adjusted to 8.3 with 12N HCl. Finally the volume was
adjusted upto 1000 ml with double distilled water.(this buffer was diluted
to 1X for working solution)
Stacking gel buffer (4X):

TRIZMA 06.06 gm
The pH was adjusted to 6.8 with 12N HCl (about 03.95 ml was required).
Finally the volume was adjusted to 100 ml with double distilled water.
Gel loading buffer for PAGE (Bromophenol blue solution):

Stacking gel buffer (4X) 07.50 ml
Glycerol 02.50 ml
Bromophenol blue 10.00 mg
Staining of the Gel:

1. After gel running was completed (almost after 18 hours) the gel
was carefully removed from the glass plates, cut at the bottom-left
for orientation.
2. Then the gel was stained by silver staining. The staining process
was composed of three parts – a) fixation b) staining c) developing.
3. Fixation- was the first step of staining where the gel was kept in
fixing solution for 30 minutes
Fixing solution (400 ml):
Ethanol (C2H5OH) 40.00 ml
Acetic acid (CH3COOH) 20.00 ml

[Ethanol: acetic acid: double distilled water = 2: 1: 17]
4. Silver staining- after the completion of fixation process, the gel

was then Kept in silver nitrate staining solution for 30 minutes.
Silver stain solution (0.011M; 400 ml):

Silver nitrate (AgNO3) 00.74 gm
5. Developing- after the staining, the gel was washed with double
distilled water (few drops of developing solution was also added) for 3
to 4 times. Then the gel was kept in only developing solution [N. B-
developing solution must be prepared freshly.]
6. Developing solution (500 ml):
Sodium hydroxide (NaOH) 15.00 gm
Formaldehyde (38 %) 02.00 ml
6. Stabilizing- after colour developed the gel kept in stabilizing

solution.
Stabilizing solution (5%; 200 ml):

Acetic acid (CH3COOH) 10.00 ml
7. The gel photograph was taken by gel doc equipment.
Ethanol precipitation method:

(For concentration of RNA)
Step 1:
150µl of sodium acetate – SDS buffer
+
450µl of viral suspension
+
600µl of phenol-chloroform
Mixed thoroughly and vortexed for 5 mins
Centrifuged at 10,000 rpm for 15 mins
Viral RNA supernatant

Step 2:
300µl viral RNA
+
30µl sodium acetate
+
Ethanol (3 times volume) [chilled] 990µl
Kept at -20°c for overnight
Centrifuge at 10,000 rpm for 15 mins
Discard supernatant
Add 70% ethanol (1ml)
Centrifuge at 10,000rpm for 15 mins
Gently decant supernatant and slightly tap on a tissue paper
Dry in speed vaccum centrifuge
Dissolve in 50µl of Tdw

Kept in 4°c for 5 mins
Kept in water bath 56°c for warming
Loading in gel
RNA Extraction for Reverse Transcription by Using

QIAGEN Kit:
1. 200µl of processed suspension was taken from each sample.
2. 580µl of AVL buffer (from kit) was added.
3. Mixed by vortexing for 15 seconds and incubated at room
temperature for 10 minutes and centrifuged briefly.
4. 560µl of ethanol (96 to100 %) was added to the mixture and mixed
by vortexing and centrifuged briefly.
5. Then 630µl of the solution was carefully applied to the QIAamp
spin column in a 2ml collection tube.
6. Centrifuged at 8,000 rpm for 1 minute. [Step 5 and 6 was repeated
to complete the total volume]
7. Then QIAamp spin column was placed into a clean 2 ml collection
tube and discarded the filtrate.
8. 500µl of buffer AW1 was then added and centrifuged at 8,000rpm
for 1 minute and the filtrate was discarded.
9. 500µl of buffer AW2 was added and centrifuged at 14,000rpm for
3 minutes.
10. Another round of centrifugation was carried out at 14,000 rpm for
1 minute to remove the traces of alcohol (in AW2 buffer) from the
column.
11. The QIAamp spin column was then placed in a fresh 1.5 ml
eppendrof tube and 60µl of buffer AVE was added; incubated at
room temperature for 1minute and centrifuged at 8,000 rpm for 1
minute.
12. The filtrate was extracted RNA sample which was used for RT
PCR.
Figure: showing the diagram of RNA extraction by using QIAamp Kit.

Reverse Transcription of Extracted RNA Sample:

1. Eppendorf was marked with proper sample number and its gene
type VP7 gene or VP4 gene.
2. Extracted dsRNA was heated at 56 ºC for 5 minutes in water bath.
3. Then DMSO and each RNA sample was separately added in VP7
and VP4 marked eppendorf corresponding to its sample number.
VP7 amplification primer SC1 and SC2 (VP7-F and VP7-R primer
can also be used) was added in each VP7 marked eppendorf
whereas VP4 amplification primer RH I (random hexamer I) was
added in each VP4 marked eppendorf. [The amount of addition is
given in the following table]
For VP7:
DMSO 01.25 µl
RNA sample 04.00 µl
SC1 (primer) 00.50 µl
SC2 (primer) 00.50 µl
Total 06.25 µl
For VP4:
DMSO 01.25 µl
RNA sample 04.00 µl
RH I (primer) 01.00 µl
Total 06.25 µl
4. After addition it was mixed by vortexing and then briefly
centrifuged.
5. The mixture was then taken for heat shock in PCR machine at 98
ºC for 5 minutes. Then snap-chilled in ice bath for 5 minutes.
6. Next buffer, dNTPs, DTT and reverse transcriptase enzyme (SSII
RT) was added according to the following table-
1st strand buffer 02.00 µl
0.1M DTT 01.00 µl
10mM dNTPs 00.50 µl
SS II RT (enzyme) 00.25 µl
Total 03.75 µl
[Total volume became 6.25 µl + 3.75 µl = 10 µl]

7. After addition it was mixed by gentle vortexing and briefly
centrifuged.
Then the RT (reverse transcription) was done according to the
following condition-
RT condition:
Temperature Time
25 ºC 10 minutes
42 ºC 50 minutes
72 ºC 15 minutes
04 ºC hold
a b c d e f
˘ ˘ ˘ ˘ ˘ ˘
1 cycle
35 cycles 1 cycle
Temp^
Time›
a=94ºC, 3 mins; b= 94ºC, 45 secs; c=50ºC, 45 secs; d=72ºC, 1 mins 20
secs; e=72ºC, 7 mins; f=4ºC, kept refrigerated in hold
8. After RT was completed the cDNA (of the RNA sample) was
amplified by polymerase chain reaction (PCR).
Polymerase Chain Reaction of the cDNA Product:

1. PCR buffer, MgCl2, dNTPs, H2O was added in each eppendorf.
2. For each sample’s VP7 gene amplification, VP7 gene cDNA and
VP7 gene primer SC1 and SC2 was added separately.
3. For each sample’s VP4 gene amplification, VP4 gene cDNA and
VP4 gene primer Con 2 and Con 3 was added separately.
4. Then the Taq DNA polymerase was added in each eppendorf and
mixed by vortexing and briefly centrifuged.
[Amount of addition is given as follows].
For VP7:
10 X PCR buffer 05.00 µl
50mM MgCl2 01.50 µl
Distilled water 30.00 µl
cDNA 10.00 µl
SC 1(forward) 01.00 µl
SC 2(reverse) 01.00 µl
Taq DNA polymerase 00.50 µl
Total 50.00 µl
For VP4:
10 X PCR buffer 05.00 µl
50mM MgCl2 01.50 µl
Distilled water 30.00 µl
cDNA 10.00 µl
Con 2(reverse) 01.00 µl
Con 3(forward) 01.00 µl

Taq DNA polymerase 00.50 µl
Total 50.00 µl
5. Then the PCR reaction was continued. VP7 and VP4 gene
amplification required different PCR condition (conditions are given as
follows). Total
35 cycles of amplification was done.
PCR
Condition for VP7 gene amplification:
Temperature Time
95 ºC 03:00 minute
Start of cycle
94 ºC 00:30 minute
48 ºC 00:30 minute
72 ºC 01:10 minute
Repeat these three steps of cycle for 35 times

72 ºC final extension 07:00 minute
04 ºC hold
Condition for VP4 gene amplification:
Temperature Time
95 ºC 03:00 minute
Start of cycle
94 ºC 00:30 minute
48 ºC 00:30 minute
72 ºC 01:00 minute
Repeat the three steps of cycle 35 times
72 ºC final extension 07:00 minute

04 ºC hold
Primer Sequence 5’ to 3’
SC1[+] 5’GGTCCACATCTTACAATTCTAATCTAG3’
SC2[-] 5’GGCTTTAAAAGAGAGAATTTCCGTCTGG3’
Con3[+] 5’TGGCTTCGCCATTTTATAGACA3’
Con2[-] 5’ATTTCGGACCATTTATAACC3’
Agarose gel electrophoresis of PCR amplicon:

1. Gel casting- 02.00 gm of agarose was measured and mixed into 100
ml 0.5X TBE buffer. Heating was done to dissolve the agarose, and then
it was cooled to approx 450C.
2. 03.00 µl of EtBr solution (10 mg/ml) was added to it and it was shaken
well for mixing. Then it was poured into casting tray (appropriate comb
already placed) and it was solidified.
3. After gel got solidified, comb was removed and gel was put into
electrophoresis apparatus chamber containing 0.5X TBE buffer.
4. Gel loading- 10.00µl of each sample was mixed with 03.00µl of gel
loading dye solution and loaded in gel. 00.60µl of 100bp DNA ladder or
1kb DNA ladder (mixed with gel loading dye) also loaded.
5. Gel running- after loading, it was connected with its power pack and
run at 100 volt (for almost 1 hour). After running was complete, the gel
photograph was taken by gel doc equipment.
0.5M Ethylenediaminetetra-acetic acid (EDTA) solution (pH-8.0):
EDTA 186.10 gm
Sodium Hydroxide (NaOH) 20.00 gm
Finally the total volume was adjusted to 1000 ml with double distilled
water.
Tris-Borate-EDTA (TBE) buffer (5X):
The prepared 0.5M EDTA solution was used to prepare TBE buffer by
mixing with tris base and boric acid as follows:.
Tris base 54.00 gm
Boric acid 27.50 gm
0.5M EDTA solution (pH-8.0) 20.00 ml

Double distilled water volume up to 1000 ml
Ethidium Bromide (EtBr) solution (10mg/ml):
Ethidium bromide 20.00 mg
Gel loading dye (Bromophenol Blue) solution (6X):
Glycerol 11.50 ml
0.5M EDTA solution (pH-8.0) 02.00 ml
Bromophenol blue (BPB) one pinch
Purification of PCR products and Sequencing:
[1] Purification of PCR products:
[a] Added 5 volumes of buffer PB (150µl) to 1 volume of PCR product

(~30µl) and mixed. Buffer PB allowed efficient binding of PCR
products as small as 100bp and quantitative removal of primers
up to 40 nucleotides.
[b] QIAquick spin column is placed in the 2ml collection tube

provided. The sample was added to the column membrane and
centrifuged at 13,000rpm for 1 minute.
[c] Flow through was discarded. Next 750µ l of buffer PE was added to
the spin column and centrifuged at 13,000rpm for 1 minute. This
step efficiently removed unwanted primers, salts, enzymes, and

unincorporated nucleotides as flow through.
[d] Additional spin at 13,000rpm for 1 minute removed residual

buffer PE.
[e] Added 30µ l of EB (Elution buffer; 10mM Tris-Cl; pH: 8.5) to the
membrane of the spin column. The column was kept for 2 minutes
above a new 1.5ml eppendorf tube and then centrifuged at
13,000 rpm for 1 minute to ensure the elution of the PCR
amplicon.
[2] Quantization of the purified products:
Each purified product was quantitated using a GeneQuant pro

UV/vis spectrophotometer (Amersham, Pharmacia Biotech, UK).
Approximately 200ng of the purified product (6µ l ) was taken for
sequencing PCR.
[3] Sequencing PCR:
6µ l of the purified product was taken for sequencing PCR with 2µ l

of Big Dye Terminator ready reaction mix (ABI Prism Big Dye Terminator
Cycle Sequencing Ready Reaction Kits. Version 3.1) 1µ l of Big Dye
sequencing Buffer (5X stock conc.), 1µ l of Forward primer, stock 10
pmo1) /Reverse primer Stock 10 pmol) to a total volume of 10µ l . The
sequencing PCR reaction was carried out with an initial denaturation
step at 95o C for 5 minutes, 25 cycles of step [1] denaturation at 96o C for
10 seconds, step [2] annealing at 50o C for 5 seconds and step [3]
extension at 60o C for 4 minutes with a final hold at 4o C.
[4] Precipitation of the PCR products:

Precipitation of the Sequencing PCR products was carried out following

instructions in the ABI Prism Big Dye Terminator Cycle sequencing kit
version 3.1, with slight modification in reaction conditions. The steps
were as follows:
[1] To the 10µ l of sequencing PCR product, added 2µ l of 3M sodium

acetate, 2µ l of 125mM EDTA, and 50µ l of absolute ethanol;
vortexed and incubated in ice for 15 minutes.
[2] The reaction tubes were centrifuged at 13,000rpm for 20 minutes.

Flow through was discarded.
[3] Now 70µ l of 70% ethanol was added to the pellet, centrifuged at
13,000 for 20 minutes. Flow through was discarded.
[4] The tubes were then vacuum dried in Eppendorf concentrator

(Model 5310), parafilm wrapped and kept at –20o C.
[5] Reconstitution Using HiDi Formamide and sequencing:
The precipitated product was treated with a denaturant,

HiDiFormamide (P/N 431120; ABI Prism), before loading onto the
sequencer. For each pellet, 19µ l of HiDiFormamide was added and
incubated at 95oC for 2 minutes. The samples were then snap chilled on
ice and kept on ice for 5 minutes, vortexed and then pulsed down. They
were then kept on ice until loading onto the automated sequencer (16
capillary DNA Sequencer (Model 3100) Applied Biosystems, HITACHI
(Version 3.1 Data Extraction Software).
Sequence analysis
After completion of sequencing PCR, the sample is loaded in an
automated sequencer machine (Model 3100 genetic analyzer). A
chromatogram is obtained at the end of the process which is retrieved in
a note pad file. The sequence is read using software called sequencher
program (Gene codes corporation version 4.0.5). The sequence
obtained is compared with other cognate sequences in the database of
GenBank using BLAST (basic local alignment search tool) program
(Altschul et.al, 1997). The amino acid sequence obtained and
transformed into probable proteins by software called DNASIS program
(version 2.1). CLUSTALW (version 1.81) program was used for multiple
alignments of all the sequences (Higgins et al 1994).
DNASIS;
DNASIS (version) is a general DNA/RNA and protein analysis package. It

has been developed by Hitachi software engineering company ltd. The
list of features is given below.
Features:
DNA/RNA analysis Protein analysis
Custom plasmid map drawing Secondary structure

prediction
Circular and linear restriction map Chou – fasman & chou

– fasman rose
Customized enzymes tablets and Robson

selection criteria
Primer design Coiling structure

graphics
RNA folding Hydrophobicity
ORF analysis Amino acid content
Contig manager (automatic and Isoelectric point

manual fragment assembly, contig calculation
editor, consensus sequence)
Fully featured sequence editor, Molecular weight

digitzer interface determination
Multiple sequence alignment Higgins Reverse translation of

algorithms DNA
Phylogenetic trees, dot matrix plots. Database searching
Database searching Sequence editor
Trace display of ABI, SCF formats
BLAST (Basic local alignment system tool):
BLAST 2.0 (Basic local alignment system tool) the core of NCBI’s BLAST
service is otherwise called as “Gapped BLAST”. It is widely used tool for
finding matches to a query sequence within a large sequence database,
such as GenBank EMBL and DDBJ etc. the BLAST algorithm was written
for balancing speed and increased sensitivity for distant sequence
relationship instead of relying on global alignments (commonly seen in
multiple sequence alignment programs).BLAST emphasizes regions of
local alignment to detect relationships among sequence which shares
only isolated regions of similarity (Altschul et al, 1990). Therefore BLAST
is more than a tool to view sequences aligned with each other or to find
homology, but a program to locate regions of sequence similarity with a
view to comparing structure and function.
The BLAST search pages allows one to select from several different
programs.
Program Description
Blast p Compares an amino acid query sequence against a

protein sequence database.
Blast n Compares a nucleotide query sequence against a

nucleotide sequence database
Blast x Compares a nucleotide query sequence translated in

all reading frames against a protein sequence
database. You could use this option to find potential
translation products of an unknown nucleotide
sequence.
T blast n Compares a protein query sequence against a

nucleotide sequence database dynamically translated
in all reading frames
T blast x Compares the six frame translation of a nucleotide

query sequence against the six frame translation of a
nucleotide sequence database
CLUSTALW:
ClustalW is a widely used system for aligning any

number of homologous nucleotide or protein sequences. For multi-
sequence alignments, ClustalW uses progressive alignment methods. In
these, the most similar sequences, that is, those with the best alignment
score are aligned first. Then progressively more distant group of
sequences are aligned until a global alignment is obtained. This heuristic
approach is necessary because finding the global optimal solution is
prohibitive in both memory and time requirements. ClustalW performs
very well in practice. The algorithm starts by computing a rough distance
matrix between each pair of sequences based on pairwise sequence
alignment scores. These scores are computed using the pairwise
alignment parameters for DNA and Protein sequences. Next, the
algorithm uses the neighbor-joining method with midpoint rooting to
create a guide tree, which is used to generate a global alignment. The

guide tree serves as a rough template for clades that tend to share
insertion and deletion features. This generally provides a close-to-
optimal result, especially when the data set contains sequences with
varied degrees of divergence, so the guide tree is less sensitive to noise.
Parameters for Pairwise and Multiple Sequence Alignment (for both

DNA and Protein):
Gap Opening Penalty:
There is a penalty for opening a gap in the alignment.

Increasing this value makes the gap less frequent.
Gap Extension Penalty:
There is a penalty for extending a gap by one residue.

Increasing this value will make the gap shorter. Terminal gaps are not
penalized.
Results and discussion

Stool samples from children with acute gastroenteritis were collected

and were screened. After screening both short and long patterns of
Rotavirus was obtained. The experiments distinctly show the dsRNA
patterns of Rotavirus.
Results of Rotavirus screening by polyacrlamide gel

electrophoresis:
Screening of Rotavirus by PAGE is a rapid method of detection; in the
following table the screening results of the test samples and their
electropherotypes are mentioned.
Date of lane no. Rotavirus Electropherotypes
screening results
Experiment
Gel1 Gel2
5/9/07 10 Positive Rota long Gr A

1,2,3,4, 5-6, 789, 10,11
13 Positive ”
8 Positive ”
6/9/07 3 Positive ”
4 Positive ”
14 Positive Rota long Gr C
1,2,3,4, 5-6, 789, 10,11
11/9/07 14 Faint Rota Rota long Gr A
1,2,3,4, 5-6, 789, 10,11
1 Faint Rota ”
12/9/07 11 Positive ”
12 Positive ”
13 Positive ”
12/9/07 14 Positive Rota long Gr A
1,2,3,4, 5-6, 789, 10,11
13/9/07 2 Faint Rota ”
3 Faint Rota ”
14/9/07 7 ” ”
10 ” ”
18 ” ”
26/9/07 19 ” ”
18 ” ”
5/10/07 2 ” ”
8/10/07 16 ” ”
11/10/07 1 ” ”
27/10/07 19 Positive ”
10 positive Rota short Gr A
1,2,3,4,5,6(wider)7,8,9,10,
11
ROTA
2,3
5,6
10
11
Figure showing the polyacrylamide gel after silver nitrate staining.

7-8-9
Figure analysis: In this gel photograph we can see distinctly visible 11

bands of Rotavirus dsRNA. Here all the bands are separate except 7 & 8
which are fused.
10
11
ROTA
2,3,
5,6
SHORT
L0NG
7-8-9
Figure showing the polyacrylamide gel after silver nitrate staining.

10
Figure analysis: In this gel photograph we can see distinctly visible 11

11
bands of Rotavirus dsRNA as ‘long’ and ‘short’ electropherotype. Here
some of the bands are separate while 2-3, and 7-8-9 are fused in some
of the lanes.
Results of agarose gel electrophoresis:

All the PCR products of the positive sample were analyzed through
agarose gel electrophoresis for determining the genotype.
For VP4 gene:
1 2 3 4 5 6
Figure showing the EtBr stained PCR product in
agarose gel
Lane 1 & lane 6 contains 1kb+ ladder, lane 2, 3, 4 & 5contains PCR
product of VP4 gene. All showed bands above 850 bp (actual VP4
gene product is 876 bp). This is a representative gel figure. All
Positive samples showed similar band for VP4 gene amplification
VP7 gene:
1 2 3 4 5 6
Figure showing EtBr stained PCR product in agarose gel
Lane 1 & lane 6 the 1kb+ DNA ladder. Lane 2, 3, 4 & 5 contains PCR
product of VP7. All showed bands near 1 kb (actual VP7 Gene product is
881 bp). This is a representative gel figure. All Positive samples showed
similar band for VP7 gene amplification.
Figure showing phylogenetic tree based on the deduced

amino acid sequence of the VP4 encoding gene of
different strains of Group A rotaviruses. [P- genotype].
The Group C rotavirus [Bristol strain] has been defined
as the outgroup to construct the bootstrapped
phylogenetic tree by the neighbor joining method.
Appendix
Reagents used
Reagent Company
Agarose powder Sigma
Ammonium persuphate Sigma
Acrylamide Sigma
Acetic acid glacial 5% Anala R merck india
Bromophenol blue Sigma
Boric acid Sigma
chloroform Sigma
Calcium chloride Merck India
Ethidium bromide Sigma
Ethanol Bengal chemical
EDTA Sigma
Formaldehyde Sigma
Glycine Sigma
Glycerol Sigma
Glacial acetic acid Anala R merck india
Hydrochloric acid Merck India
8 hydroxy quinoline Sigma
Isoamyl alcohol Sigma
Isopropanol Sigma
Sodium dodecyl sulphate Sigma
Magnesium chloride Sigma
Methylene bisacrlamide Sigma
Potassium chloride Sigma
Redistilled phenol Sigma
Sodium chloride Sigma
Sodium hydroxide 98% Sigma & Aldrich
Sodium acetate Sigma
Sodium dihydrogen orthophosphate Anala R merck india
Silver nitrate Sigma ultra
Tris-base Merck
TEMED Sigma
Kits used
Name of kit Company
QIAmp Viral RNA minikit QIAGEN
QIAquick purification kit QIAGEN
Big dye terminator cycle ABIprism
sequencing
HiDi formamide ABIprism
Instruments used
Name Company
Refrigerated centrifudge Kubota
Biofuge stratos Heraeus
Vaccum centrifudge 5301 Eppendrop concentrator
High speed micro-centrifudge
Model- MX-301
Powerpac basic Biorad
Vortex Maxi mixII
Electrophoretic bath Biorad
3100 genetic analyzer(for sequencing) Applied biosystems
GeneAmp PCR system 9700 Applied biosystems
Master cycler Eppendrop
Thermal cycler PTC-200 Biorad
Thermo magnetic stirrer MGH-320 Sibata
Gel doc Biorad
Water bath NTB-221 Eyela
References
References
1. Fields virology volume -1 fourth edition
2. Fields virology volume -2 fourth edition
3. Virology a practical approach edited by B.W.J Mahy
4. Diarrhoeal diseases current status, research trends and field
studies editor D. Raghunath, R. Nayak. The third Sir Dorabji
Tata symposium
5. Electron microscope in Diagnostic Virology A practical guide
and atlas Frances W.Doane and Nan Anderson
6. Bhattacharya, R., Sahoo, G.C., Nayak, M.K., Saha, D.R., Sur,
D., Naik, T.N., Bhattacharya, S.K., Krishnan, T., 2006.
Molecular epidemiology of human picobirnaviruses among
children of a slum community in Kolkata, India. Infect. Genet.
Evol., April 6 (Equb ahead of print) PMID : 16616879
(PubMed – as supplied by publisher).
7. www.oligo.net/dnasis.htm
8. www.ncbi.nlm.nih.gov/
9. www.cdc.gov/nicdod/dvrd/renb/gastro/rotavirus
10. http://mhcs.health.nsw.gov.au
11. http://digestive.niddk.nig.gov/index.htm
12. http://pathmicro.med.sc.edu/book/welcome.htm
13. http://wikimediafonudation.org/
14. http://www.answer.com/topic/diarrhea

Supratim&#39;s Report

Diunggah oleh

Informasi Dokumen

Deskripsi Asli:

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Supratim&#39;s Report

Diunggah oleh

Hak Cipta:

Format Tersedia

This watermark does not appear in the registered version - http://www.clicktoconvert.

Detection of Rotavirus in acute

A Dissertation work submitted to Barkatullah University,

Supervised by: Submitted by:

I dedicate this work

I thank Dr. Shaswati Bhattacharya Head of the

Place: Supratim Biswas

O.D. Optical density

1. Some capsid is icosahedral in shape. An icosahedron is a regular

· a high fever of 102°F (38.9°C) or above

Gastroenteritis is not an anatomical or structural defect, nor is it an

· Picobirnavirus a novel group of viruses recently detected in

Electron microscopic image of Adenovirus

Electron microscopic image of calicivirus

Classification: The two groups of human

A double-capsid particle is shown on the left, and the single (inner)

countries worldwide. Although diarrhoeal diseases are one of the most

Rotavirus: Negatively stained Electron Micrograph

Morphology and Morphogenesis:

Viral structural protein:

2. It is the RNA-Dependent RNA Polymerase for rotavirus, a core

3. Associates with VP2 at its icosahedral vertices.

1. Molecular weight is 41 kD.

5. It has been classified into 15 distinct G- genotypes.

Figure showing the different structural proteins. Indicating the

Viral non-structural protein:

2. Total genome size is 18.5 kb.

6. AU rich (58%-67%) genome.

Electrophoresis of the genomes of reovirus type 3 (REO), human

11. No polyadenylation signal is found at the 3΄ end of the gene. All

replication, assembly or encapsidation of the viral genome

Figure shows the 11 segments of dsRNA along with the

Replication in host cell:

attachment to the cell membrane. Experimental result shows that trypsin

Replication:The rotavirus replication cycle may be viewed as having

Figure showing the general scheme for replication of rotavirus

associate with a transcription enzyme complex; as per the current model

The major antigenic properties of Rotavirus group, subgroups and

glycoprotein. The characterization of P serotypes has been difficult

In developing countries, Rotaviruses are the major cause of life –

In developed countries the widespread distribution of Rotaviruses

Epidemiology of Rotavirus in India:

Rotaviruses infection and diarrheal disease:

Contents of oral rehydration salts (ORS) recommended by

Total weight 20.50 gm

promising initial results, vaccination was withdrawn because of a causal

Materials and methods

Screening of Rotavirus by PolyAcrylamide Gel

SDS/Na-acetate solution (pH-5.0):

17N Glacial Acetic acid 01.15 ml

Double distilled water volume upto 140 ml

Gel Casting for PAGE:

Separation gel buffer (4X):

Double distilled water 80.00 ml

Ammonium persulphate solution (2% APS):

Double distilled water volume upto 100 ml

7.5% polyacrylamide gel composition (for 46 ml):

Sample Loading and Running the Gel:

Tris-Glycine reservoir buffer (10X):

Stacking gel buffer (4X):

Gel loading buffer for PAGE (Bromophenol blue solution):

Staining of the Gel:

Double distilled water 340.00 ml

Supratim's Report

Supratim's Report