Anda di halaman 1dari 141

DISSERTAO MBB-ICC A. B.

LORUSSO 2013











INSTITUTO CARLOS CHAGAS
Mestrado em Biocincias e Biotecnologia







DESENVOLVIMENTO DE UM SISTEMA SEMI-AUTOMATIZADO
PARA NOCAUTES GNICOS EM Trypanosoma cruzi





ANDR BITTENCOURT LORUSSO




Curitiba/PR
2013


INSTITUTO CARLOS CHAGAS
Ps-Graduao em Biocincias e Biotecnologia



ANDR BITTENCOURT LORUSSO

Desenvolvimento de um sistema semi-automatizado para
nocautes gnicos em Trypanosoma cruzi



Dissertao apresentada ao Instituto Carlos Chagas
como parte dos requisitos para obteno do ttulo de
Mestre em Biocincias e Biotecnologia




Orientador: Prof. Dr. Christian Macagnan Probst





CURITIBA/PR
2013
AGRADECIMENTOS

A todas as pessoas que de alguma forma contriburam para que esse projeto se
tornasse realidade.

III


INSTITUTO CARLOS CHAGAS
DESENVOLVIMENTO DE UM SISTEMA SEMI-AUTOMATIZADO
PARA NOCAUTES GNICOS EM Trypanosoma cruzi

RESUMO

DISSERTAO DE MESTRADO

Andr Bittencourt Lorusso

Trypanosoma cruzi, o agente etiolgico da doena de Chagas, possui
aproximadamente 12.000 genes codificadores de protena distintos em seu genoma,
dos quais cerca de 50% so de funo desconhecida. Poucos estudos de
caracterizao funcional de genes foram realizados at o momento, e a ausncia de
um sistema rpido e de alta eficincia para nocautes gnicos em T. cruzi limitou as
aplicaes de estudos em larga escala nesse organismo. Nesse contexto, foi
desenvolvido um sistema semi-automatizado para nocautes gnicos em Trypanosoma
cruzi, projetado para o uso em aplicaes em larga escala. O desenho do projeto
consiste em trs partes: desenvolvimento de um software de predio de primers para
nocaute, construo de cassetes para nocaute gnico utilizando PCR de fuso e
realizao de nocautes sequenciais em Trypanosoma cruzi. O software de predio de
primers, denominado TcruziKO, usa sequncias genmicas de diferentes cepas de T.
cruzi e o software Primer3 para desenhar iniciadores para PCR de alta qualidade para
a construo de cassetes para modificao gnica (nocaute, disrupo ou ruptura, e
insero de etiquetas). Os primers desenhados foram usados no desenvolvimento e
validao de um protocolo simples de PCR de fuso em duas etapas para a construo
de cassetes para nocaute, que foi testado com 21 genes. Construes para 8 genes
IV

contendo o gene de resistncia droga neomicina (neomicina fosfotransferase) foram
transfectados por eletroporao em epimastigotas da cepa Dm 28c de T. cruzi, e para 7
desses tanto a seleo com droga quanto a insero do cassete ocorreram
corretamente. Atravs dessa abordagem, para que diferentes nocautes no mesmo
organismo sejam feitos so necessrios diferentes pares de droga/gene de resistncia,
o que limita o seu uso. Numa tentativa de resolver esse problema, diferentes
estratgias que permitiriam mltiplos nocautes no mesmo organismo foram testadas,
baseadas no uso de cassetes para nocaute reciclveis. O uso de um vetor contendo o
gene pyr5-6 como um marcador de seleo negativo, cuja expresso txica para T.
brucei na presena de cido 5-fluoroortico, demonstrou no ser vivel devido alta
resistncia de T. cruzi ao composto. A eficincia da protena fluorescente eGFP para a
seleo de mutantes nulos por citometria de fluxo tambm foi testada, mas as
estratgias empregadas foram infrutferas para a obteno de parasitas nocautes.
Foram construdos vetores para nocaute com os genes de resistncia a blasticidina e
puromicina, com o intuito de aumentar a gama de nocautes consecutivos que podem
ser feitos no mesmo organismo utilizando a estratgia convencional, e com as
protenas fluorescentes E2-Crimson e VFP, e o uso desses genes como marcadores de
seleo para nocaute ser testado em breve. Como um todo, o trabalho aqui descrito
criou uma base para o desenvolvimento de estudos de nocaute gnico em larga escala.

V


INSTITUTO CARLOS CHAGAS
DESENVOLVIMENTO DE UM SISTEMA SEMI-AUTOMATIZADO
PARA NOCAUTES GNICOS EM Trypanosoma cruzi

ABSTRACT

DISSERTAO DE MESTRADO

Andr Bittencourt Lorusso

Trypanosoma cruzi, the causative agent of Chagas disease, has ~12,000 distinct
protein coding genes, being several of unknown function (~50%). Few studies on gene
caracterization have been conducted so far, and the absence of a fast and highly
effective method for gene disruption in T. cruzi has limited the applications of high
throughput approaches in this organism. In this context, we are developing a semi-
automated system for gene knockouts in T. cruzi, intended for use in large scale
studies. The system design consists of three parts: development of a primer prediction
software, construction of gene knockout cassettes using fusion PCR and sequential
gene knockouts. The primer prediction software (TcruziKO) uses sequence information
from different T. cruzi strains and the software Primer3 to design high quality PCR
primers for the construction of cassetes for gene modification (knockout, disruption and
tagging). The primers designed were used in the development and validation of a
simple two-step fusion PCR for the construction of knockout cassetes, which was tested
with 21 genes. Eight constructions using the neomycin phosphotransferase resistance
gene were transfected through electroporation in T. cruzi Dm 28c epimastigotes, and for
seven of those the selection and insertion of the knockout cassete were succesful. For
different simultaneous knockouts in the same organism, distinct drug/drug resistance
gene pairs have to be used, which is of limited application. To try to solve this problem,
VI

different strategies for unlimited multiple gene knockout were tested, based on the use
of recyclable knockout cassetes. The use of a vector using the gene pyr6-5 as a
negative selection marker, whose expression is toxic to Trypanosoma brucei in the
presence of the compound 5-FOA, has failed due to almost absence of toxicity of the
compound in T. cruzi. The effectivity of the fluorescent protein eGFP for the selection of
knockout mutants with flow citometry was also assessed, but the strategies attempted
failed to obtain knockout parasites. Knockout vectors with blasticidin and puromycin
resistance genes, in order to increase the number of consecutive knockouts that can be
done in the same organism using the classical approach, and with the highly fluorescent
proteins E2-Crimson and VFP were also built, and the use of these genes as selection
markers for knockout can now be assessed. The work here described created a basis
for the deveolpment of high throughput gene knockout studies.

VII

LISTA DE FIGURAS

Figura 1.1: O ciclo de vida de Trypanosoma cruzi .......................................................... 2
Figura 1.2: Vias de reparo de quebra de fita-dupla de DNA por recombinao homloga
........................................................................................................................................ 9
Figura 1.3: Esquema e sequncia de diferentes stios lox ............................................ 13
Figura 1.4: Esquema das reaes do sistema Cre/loxP................................................ 13
Figura 1.5: Esquema da fuso de fragmentos do mesmo gene para a introduo de
mutaes ....................................................................................................................... 16
Figura 1.6: Esquema de PCR de fuso para consturo de cassetes para nocaute .... 17
Figura 4.1: pNEO2 e pHYG2 ......................................................................................... 30
Figura 5.1: Fluxograma geral do software TcruziKO ..................................................... 49
Figura 5.2 Pgina para insero de dados para anlise - TcruziKO ............................ 50
Figura 5.3: Pgina com cobertura de reads e contigs para a regio selecionada -
TcruziKO ....................................................................................................................... 51
Figura 5.4: Formulrios para insero de parmetros para desenho dos iniciadores ... 52
Figura 5.5: Resultado das predies dos 3 tipos de anlise existentes para o mesmo
gene .............................................................................................................................. 57
Figura 5.6: Esquema do banco de dados relacional ..................................................... 58
Figura 5.7: Histograma representando o mapeamento normalizado ............................ 59
Figura 5.8: Digesto e purificao de banda do plasmdeo pNEO2 .............................. 63
Figura 5.9: Clonagem de GFP no backbone de pNEO2 ............................................... 64
Figura 5.10: PCR dos genes E2-Crimson e VFP .......................................................... 64
Figura 5.11: PCR de colnia de pE2-KO e pVFP-KO ................................................... 65
Figura 5.12: Digesto de pGEM-BLAST e pGEM-PURO .............................................. 65
Figura 5.13: PCR de colnia de pBLAST-KO e pPURO-KO ......................................... 66
Figura 5.14: Amplificao de CRE e recombinao em pDONR221 ............................ 67
Figura 5.15: PCR de colnias transformadas com a recombinao de pDONR-CRE em
pTcGW .......................................................................................................................... 67
Figura 5.16: Produtos de PCR das intergnicas....................................................... 68
Figura 5.17: PCR do cassete de NEO a partir de pGFP-KO ......................................... 69
Figura 5.18: Teste da digesto da PCR de AU com exonuclease I .............................. 70
Figura 5.19: PCR de fuso em duas etapas com Pfx DNA polimerase e as regies
intergnicas de A .......................................................................................................... 71
Figura 5.20: Fuso sem iniciadores com diferentes enzimas e propores entre os
produtos ........................................................................................................................ 72
Figura 5.21: Fuses parciais entre intergnicas de A e NEO ........................................ 73
Figura 5.22: Teste de diferentes parmetros para a fuso ............................................ 73
VIII

Figura 5.23: Fuso sem iniciadores das intergnicas de G, I e URA com cassete de
NEO .............................................................................................................................. 74
Figura 5.24: Testes de fuso com relao de nmero de molculas entre as
intergnicas e o cassete de NEO .................................................................................. 75
Figura 5.25: Fuso para os genes A, G, I e URA com diferentes quantidades de ciclos
de PCR .......................................................................................................................... 76
Figura 5.26: Amplificao de produto de fuso com diferentes parmetros .................. 77
Figura 5.27: Amplificao da fuso para A, G, I e URA ................................................ 77
Figura 5.28: PCR de todas as regies intergnicas ...................................................... 79
Figura 5.29: Fuses por PCR ........................................................................................ 80
Figura 5.30: Amplificao das fuses............................................................................ 80
Figura 5.31: Curva de crescimento dos mutantes ......................................................... 82
Figura 5.32: Verificao da integrao de neo nos genomas nocauteados .................. 83
Figura 5.33: Esquema da estratgia utilizada para verificao dos nocautes ............... 83
Figura 5.34: Verificao dos nocautes por PCR ........................................................... 84
Figura 5.35: amplificao por PCR do cassete da GFP a partir de pGFP-KO .............. 85
Figura 5.36: Fuso das intergnicas com o cassete de pGFP-KO ............................... 85
Figura 5.37: amplificao das fuses miosinas-GFP .................................................... 86
Figura 5.38: Amplificao em grande quantidade das fuses selecionadas ................. 86
Figura 5.39: Scatterplot do tamanho e fluorescncia dos eventos pr e ps-sorting de
uma cultura de T. cruzi transfectada com cassete GFP ................................................ 87
Figura 5.40: Histogramas de fluorescncia e tamanho das clulas, ............................. 88
Figura 5.41: Curva de crescimento de T. cruzi Dm28c em meio LIT com diferentes
concentraes de 5-FOA .............................................................................................. 88
Figura 5.42: Curva de crescimento de T. cruzi Dm 28c em HX25M com diferentes
concentraes de 5-FOA .............................................................................................. 89
Figura 5.43: Curva de crescimento de T. cruzi Dm 28c em HX25M sem soro fetal
bovino com alta concentrao de 5-FOA ...................................................................... 90
Figura 6.1: Comparao da eficincia de amplificao de intergnicas com pares de
iniciadores distintos ....................................................................................................... 92
Figura 6.2: Scatterplot comparando nmero normalizado de reads mapeadas com
contedo GC para cada gene de T. cruzi CL Brener .................................................... 97

IX

LISTA DE TABELAS

Tabela 1.1: Nocautes gnicos publicados em Trypanosoma cruzi ............................... 20
Tabela 4.1: Lista de oligonucleotdeos gerados pelo software ...................................... 25
Tabela 4.2: Lista de oligonucleotdeos para construo dos vetores ............................ 26
Tabela 4.3: IDs e cdigo utilizado das miosinas e genes de funo desconhecida
selecionados para o estudo .......................................................................................... 36
Tabela 5.1: Resultado dos testes de predio automatizada de iniciadores ................. 61
Tabela 5.2: Porcentagem de leituras de Dm28c eliminadas com diferentes linhas de
corte .............................................................................................................................. 62
Tabela 5.3: Porcentagem de leituras de Sylvio X10 eliminadas com diferentes linhas de
corte .............................................................................................................................. 62


X

SUMRIO
1 INTRODUO ......................................................................................................... 1
1.1 Trypanosoma cruzi ........................................................................................... 1
1.1.1 Doena de Chagas ...................................................................................... 2
1.1.2 Caractersticas celulares de Trypanosoma cruzi ......................................... 3
1.1.3 Organizao genmica e expresso gnica ................................................ 5
1.1.4 Classificao e variaes intra-especficas em Trypanosoma cruzi ............ 7
1.2 NOCAUTE GNICO ......................................................................................... 8
1.2.1 PCR de fuso ............................................................................................ 15
1.2.2 Nocaute em Trypanosoma cruzi ................................................................ 18
2 OBJETIVOS........................................................................................................... 22
2.1 OBJETIVO GERAL ......................................................................................... 22
2.2 OBJETIVOS ESPECFICOS ........................................................................... 22
3 JUSTIFICATIVA .................................................................................................... 23
4 MATERIAIS E MTODOS ..................................................................................... 24
4.1 LISTA DE MATERIAIS .................................................................................... 24
4.1.1 Organismos utilizados ............................................................................... 27
4.2 SOFTWARE DE PREDIO DE INICIADORES PARA NOCAUTE GNICO 27
4.2.1 Estimativa do nmero de cpias gnicas .................................................. 27
4.2.2 Anlise da eficincia de predio de oligonucleotdeos ............................ 29
4.2.3 Eliminao da redundncia entre leituras e contigs .................................. 29
4.3 CONTRUO DOS VETORES ...................................................................... 29
4.3.1 pNEO2/pHYG2 .......................................................................................... 29
4.3.2 Construo dos vetores para nocaute ....................................................... 30
4.3.2.1 Obteno de pNEO2 sem inserto ....................................................... 30
4.3.2.2 Obteno e digesto dos genes marcadores ...................................... 31
4.3.2.3 Ligao dos produtos ao plasmdeo ................................................... 32
4.3.2.4 Transformao em bactrias por choque trmico ............................... 32
4.3.2.5 PCR de colnia para seleo de clones ............................................. 32
4.3.2.6 Extrao de DNA plasmidial ............................................................... 33
4.3.3 pTcGW-CRE .............................................................................................. 33
XI

4.3.3.1 Amplificao e insero de CRE na plataforma Gateway ................ 33
4.3.3.2 Tcnica de palitagem (toothpick) para seleo dos clones ................. 34
4.3.3.3 Insero na plataforma TcGW ............................................................ 34
4.4 CONSTRUO DOS CASSETES PARA NOCAUTE .................................... 35
4.4.1 Seleo dos genes .................................................................................... 35
4.4.2 Amplificao dos cassetes marcadores..................................................... 36
4.4.3 Dosagem dos produtos e normalizao das concentraes ..................... 37
4.4.4 Purificao dos produtos ........................................................................... 38
4.4.5 PCR de fuso ............................................................................................ 38
4.4.6 Purificao e concentrao do material ..................................................... 39
4.4.6.1 Precipitao de DNA por etanol .......................................................... 39
4.4.6.2 Ultrafiltrao ........................................................................................ 40
4.5 CULTIVO DE PARASITAS ............................................................................. 40
4.5.1 Cultivo dos parasitas em meio axnico ..................................................... 40
4.5.2 Eletroporao ............................................................................................ 40
4.5.3 Seleo dos mutantes ............................................................................... 41
4.5.3.1 G418 ................................................................................................... 41
4.5.3.2 Cell sorting .......................................................................................... 41
4.5.3.2.1 Estratgia de clonagem .................................................................. 42
4.5.3.2.2 Enriquecimento de clulas fluorescentes ........................................ 42
4.5.4 Extrao e purificao de DNA genmico de T. cruzi ............................... 43
4.5.4.1 TELT ................................................................................................... 43
4.5.4.2 Por ligao a membrana de silica-gel ................................................. 44
4.5.5 Criopreservao dos parasitas .................................................................. 44
4.5.6 Curvas de crescimento .............................................................................. 44
4.5.6.1 Anlise de sensibilidade ao 5-FOA ..................................................... 45
4.5.7 Anlise de fluorescncia ............................................................................ 45
4.5.7.1 Microscopia ......................................................................................... 45
4.5.7.2 Citometria de fluxo .............................................................................. 46
5 RESULTADOS ...................................................................................................... 47
5.1 PROGRAMA DE PREDIO DE PRIMERS PARA NOCAUTE ..................... 47
XII

5.1.1 Estimativa do nmero de cpias gnicas .................................................. 58
5.1.2 Anlise da eficincia de predio de oligonucleotdeos ............................ 60
5.1.3 Eliminao de redundncia entre leituras e contigs .................................. 61
5.2 SISTEMA DE NOCAUTES GNICOS ............................................................ 63
5.2.1 Construo dos vetores ............................................................................. 63
5.2.1.1 Construo dos vetores para nocaute ................................................ 63
5.2.1.2 pTcGW-CRE ....................................................................................... 66
5.2.2 Desenvolvimento do protocolo de PCR de fuso ...................................... 68
5.3 NOCAUTES GNICOS .................................................................................. 80
5.3.1 Nocaute com neomicina fosfotransferase.................................................. 80
5.3.2 Nocaute com protenas fluorescentes ....................................................... 84
5.4 TESTE DE SENSIBILIDADE AO CIDO 5-FLUOROORTICO .................... 88
6 DISCUSSO .......................................................................................................... 91
6.1 CONSIDERAES GERAIS SOBRE O PROJETO ....................................... 91
6.2 SOFTWARE DE PREDIO DE INICIADORES PARA NOCAUTE GNICO 92
6.3 NOCAUTE GNICO ....................................................................................... 96
7 CONCLUSO ...................................................................................................... 104
REFERNCIAS .......................................................................................................... 106
1

1 INTRODUO

1.1 Trypanosoma cruzi

Trypanosoma cruzi um protozorio flagelado causador da molstia conhecida
como doena de Chagas. Foi descrito pela primeira vez por Carlos Chagas, em 1909,
que tambm descreveu seu inseto vetor, reservatrios silvestres do parasita e a forma
de transmisso natural da doena (CHAGAS, 1909). Trata-se de um parasita
heterxeno, pertencente ao Super-reino Metakaryota, Reino Protozoa, Infra-reino e Filo
Euglenozoa, Classe Kinetoplastea, Ordem Kinetoplastida (CAVALIER-SMITH, 1993,
2010), que possui dois hospedeiros ao longo de seu ciclo de vida: insetos hematfagos
da subfamlia Triatominae (popularmente conhecidos como barbeiros); e mamferos,
entre eles o ser humano (BRENER, ANDRADE & BARRAL-NETO, 2000).
Entre as fases nos hospedeiros invertebrado e vertebrado, ao longo do seu ciclo
de vida o T. cruzi possui diversas formas. Ao realizar hematofagia em um mamfero
infectado com T. cruzi, o inseto vetor ingere as formas tripomastigotas sanguneas
(principalmente) e amastigotas do protozorio, infectivas e replicativas,
respectivamente. Ao longo do intestino do inseto, essas formas se diferenciam em
epimastigotas formas replicativas no-infectantes que se multiplicam por diviso
binria. Na poro final do trato digestivo (intestino posterior) do inseto, os parasitas se
ligam hidrofobicamente parede intestinal e sofrem um processo chamado de
metaciclognese, atravs do qual se diferenciam nas formas infectantes
tripomastigostas metacclicos. Aps a excreo junto s fezes do triatomneo, o contato
com a ferida da picada ou com mucosas do mamfero gera a infeco. Dentro do
hospedeiro vertebrado, os tripomastigotas metacclicos podem infectar uma gama de
clulas nucleadas, dentro das quais se diferenciam em amastigotas (formas
replicativas), que se replicam at atingirem certa densidade populacional intracelular,
quando ento se diferenciam na forma tripomastigota sangunea que, por sua vez,
tem a capacidade de infectar clulas do hospedeiro, reiniciando o ciclo (TYLER &
ENGMAN, 2001) (Figura 1.1).

2

Figura 1.1: O ciclo de vida de Trypanosoma cruzi

Fonte: modificado de Macedo, Oliveira e Pena (2002).


1.1.1 Doena de Chagas

O desmatamento e colonizao humana de florestas na Amrica Latina que
ocorreu fortemente nos ltimos sculos levou a um maior contato e adaptao dos
triatomneos ao ser humano, levando participao deste como hospedeiro vertebrado
no ciclo de vida desse parasita e infeco por T. cruzi (ARAGO, 1983).
Logo aps a infeco, iniciada a fase aguda da doena, geralmente
caracterizada por reao inflamatria local (e em diferentes tecidos, em casos
extremos) e febre; porm em muitos casos no h sintomas. Formas tripomastigotas
so observadas em grande quantidade na corrente sangunea, e estas so levadas
junto aos macrfagos para diversos tecidos (fgado, bao e tecidos musculares,
principalmente), onde so formados pseudocistos ou ninhos de amastigotas. Na
3

maioria dos casos a doena evolui para a forma crnica indeterminada, assintomtica;
porm em 20 a 30% dos casos ocorre evoluo para formas cardacas - caracterizadas
por insuficincia cardaca, tromboembolismo, arritimia; ou digestivas - megaclon e
megaesfago, principalmente; ou ambas (TANOWITZ et al., 1992; COURA, 2007).
Alm da transmisso atravs do vetor, j foram registradas transmisses por
transfuso sangunea, transmisso vertical (atravs da placenta ou perinatal) e por via
oral (pelo consumo de alimentos contaminados) (COURA, 2007) - essa ltima estando
envolvida em diversos surtos epidmicos recentes (BENCHIMOL BARBOSA, 2006;
DIAS et al., 2008).


1.1.2 Caractersticas celulares de Trypanosoma cruzi

Como em todas as espcies pertencentes ordem Kinetoplastida, uma
caracterstica importante do T. cruzi a presena do cinetoplasto, uma estrutura
peculiar dentro da mitocndria nica do parasita, que nesse protozorio est localizada
prxima base do flagelo. No cinetoplasto dos tripanosomatdeos existe uma rede
complexa com vrias molculas concatenadas de DNA circular, denominada kDNA
(kinetoplast DNA). Essa rede formada por algumas dezenas de maxicrculos e
milhares de minicrculos de DNA, condensados num disco com cerca de 1 m de
dimetro por 0,35 m de altura, posicionado prximo base do flagelo, perpendicular
ao seu eixo (MORRIS et al., 2001). Da famlia tripanossomatidae, o Trypanosoma cruzi
o protozorio que apresenta a rede de kDNA com o maior dimetro (GUILBRIDE &
ENGLUND, 1998).
Os mini e maxicrculos desempenham papis diferentes dentro da mitocndria:
os maxicrculos so anlogos ao DNA mitocondrial de eucariontes pluricelulares,
contendo genes para rRNAs e para protenas da cadeia respiratria; enquanto os
minicrculos codificam RNAs-guia, que atuam sobre os transcritos dos maxicrculos
(BENNE, 1994; STUART et al., 2005). Esses RNAs-guia (gRNA) so extremamente
importantes, pois os transcritos dos maxicrculos necessitam de edio para se
tornarem mRNAs maduros e poderem ser traduzidos em protenas. Essa edio ocorre
4

atravs da adio e remoo de nucleotdeos uridina nos pr-mRNAs dos maxicrculos,
coordenada pelos gRNAs dos minicrculos. Esses gRNAs (mais de 1200 distintos em
toda a rede de kDNA) apresentam uma cauda de uridinas, na sua poro 3, que sero
adicionadas aos pr-mRNAs e serviro como molde, especificando onde sero
adicionados e onde sero removidos esses nucleotdeos no pr-mRNA. At 50% dos
nucleotdeos, em alguns pr-mRNAs, so adicionados dessa forma, para gerar
futuramente o mRNA maduro a partir dos transcritos dos maxicrculos (BENNE, 1994;
LIU et al., 2005; STUART et al., 2005).
Alm do cinetoplasto, outras estruturas celulares peculiares so encontradas
em Trypanosoma cruzi, notavelmente:
- estrutura paraflagelar: se estendendo junto ao flagelo ao longo do axonema
de membros da Ordem Kinetoplastida se encontra uma estrutura trilaminar em forma
de grade composta por trs domnios (proximal, intermedirio e distal), denominada
estrutura paraflagelar ou paraxial (PORTMAN & GULL, 2010). Atravs de nocaute
gnico em Leishmania mexicana (SANTRICH et al., 1997) e RNA antisenso em
Trypanosoma brucei foi demonstrado que protenas da estrutura paraflagelar e a
estrutura em si so essenciais para a motilidade desses parasitas;
- microtbulos subpeliculares: imediatamente sob a membrana celular existe
uma estrutura fibrosa protica (MEYER & PORTER, 1954), denominada de rede de
microtbulos subpelicular. Essa rede constitui a maior parte do citoesqueleto de
tripanossomatdeos, dando rigidez clula e cobrindo quase a totalidade da meia
camada interna da membrana citoplasmtica (DE SOUZA, 1999);
- bolsa flagelar: junto poro da membrana plasmtica onde emerge o flagelo
se encontra uma invaginao, denominada bolsa flagelar (SOUTO-PADRN & DE
SOUZA, 1979). Relacionado ao fato de ser desprovida de microtbulos, esta uma
regio com alta atividade endoctica (SOARES & DE SOUZA, 1991; DE SOUZA, 1999);
- reservossomo: reservossomos so organelas em formato de vesculas,
localizadas na extremidade posterior das formas epimastigotas de Trypanosoma cruzi,
que participam da via endoctica desse organismo atravs do armazenamento e
degradao de protenas endocitadas. Essa organela tem um papel importante para a
diferenciao nas formas tripomastigotas metacclicas pelo fornecimento de
5

aminocidos para os parasitas sob estresse nutricional (SOARES & DE SOUZA, 1988;
SOARES, 1999);
- acidocalcissomo (DOCAMPO et al., 1995): tripanossomatdeos armazenam
clcio, pirofosfato e polifosfato em organelas acdicas denominadas acidocalcissomos.
Tm importncia na manuteno da concentrao de clcio citoplasmtica e na
osmorregulao, bem como na manuteno do pH citoplasmtico atravs de bombas
de prton localizadas na membrana da organela (DOCAMPO & MORENO, 2011); e
- glicossomos: por todo o citoplasma de tripanossomatdeos existem
peroxissomos variantes, denominados glicossomos. Nessa organela esto
compartimentalizadas a maior parte das enzimas da gliclise, o que atribui ao
glicossomo um papel muito importante nessa via, bem como enzimas de outros
processo metablicos, como da via das pentoses fosfato e de metabolismo de cidos
graxos (MICHELS et al., 2006);


1.1.3 Organizao genmica e expresso gnica


Com o sequenciamento da cepa CL Brener de T. cruzi por WGS (Whole
Genome Shotgun) (EL-SAYED et al., 2005a), o tamanho do genoma nuclear diplide
foi estimado entre 106,4 e 110,7 megabases (60 Mb para o haplide), maior do que os
87 Mb projetados por anlise densitomtrica de eletroforeses de DNA genmico em
campo pulsado (CANO et al., 1995). Foram identificados 22.570 genes ao todo, com 12
mil genes distintos estimados, sendo que para apenas 50,8% destes foi possvel
atribuir uma funo putativa baseada em homologia com protenas ou domnios
previamente caracterizados em outros organismos. Uma proporo superior a 50% do
genoma corresponde a regies repetitivas, compostas principalmente por famlias
multignicas, retrotransposon e repeties (EL-SAYED et al., 2005a).
Os genes codificadores de protena de Trypanosoma cruzi, assim como os dos
demais tripanosomatdeos com sequncia genmica determinada (EL-SAYED et al.,
2005a; BERRIMAN et al., 2005; IVENS et al., 2005), esto organizados em grandes
6

clusters de genes em sequncia na mesma orientao (polycistronic gene clusters -
PGCs), como observado pela primeira vez por Myler e colaboradores (1999). Ainda, ao
contrrio do observado nos demais eucariotos, quase no existem ntrons em genes
codificadores de protena em tripanosomatdeos: em Trypanosoma cruzi, por exemplo,
apenas no gene da poli-A polimerase (PAP) foi comprovada a ocorrncia de cis-splicing
(MAIR et al., 2000) e em apenas um outro gene (DEAD/H RNA helicase ATP-
dependente) foi identificado um ntron putativo aps o sequenciamento do genoma (EL-
SAYED et al., 2005a).
A transcrio desses genes feita por RNA polimerase II e policistrnica
(JOHNSON, KOOTER & BORST, 1987; MARTNEZ-CALVILLO et al., 2003), de modo
semelhante ao observado em bactrias, porm no h relao funcional entre as
protenas codificadas pelos genes transcritos na mesma molcula. Como
consequncia, a intensidade com a qual so transcritos genes presentes no mesmo
policstron a mesma; porm, ao contrrio da maioria dos eucariotos, a regulao da
expresso gnica majoritariamente ps-transcricional e no observada correlao
direta do nvel de expresso entre genes cotranscritos (GIBSON, SWINKELS &
BORST, 1988; CLAYTON, 2002; CAMPBELL, THOMAS & STURM, 2003).
De um modo geral, a transcrio dos genes codificadores de protenas iniciada
nas regies de troca de fita (strand switch regions) localizadas entre PGCs, nas
extremidades 5' destes, caracterizadas pela presena de sequncias poli-G ou poli-C
(MARTNEZ-CALVILLO et al., 2003). Nenhuma sequncia promotora conservada para
RNA polimerase II foi identificada nessas regies - em tripanosomatdeos isso apenas
foi observado para o gene codificador da sequncia spliced leader, que ser discutido
abaixo (SAITO, ELGORT & CAMPBELL, 1994). Nessas regies tambm esto
localizados arranjos em tandem de genes que codificam RNAs ribosomais
(MARTNEZ-CALVILLO et al., 2010).
Aps a transcrio de um policstron, o processamento do pr-RNAm feito por
trans-splicing e poliadenilao nas regies intergnicas, resultando na separao do
transcrito em diversas molculas de RNAm (AGABIAN, 1990; LIANG et al., 2003). O
trans-splicing ocorre pela adio de uma molcula de RNA conhecida como mini-xon,
ou spliced leader (SL) (BOOTHROYD & CROSS, 1982; PARSONS et al., 1984), a um
7

stio aceptor de trans-splicing a montante da CDS, que, assim como para o cis-splicing,
consiste num dinucleotdeo AG localizado logo a jusante de uma regio de
polipirimidina (MATTHEWS, TSCHUDI & ULLU, 1994; BENZ et al., 2005). O RNA SL
um sequencia de 39 nt, derivada de molculas de RNA com tamanhos ao redor de 100
nt (MILHAUSEN et al., 1984), transcritas a partir de genes localizados, em geral, em
arranjos de repeties em tandem espalhados pelo genoma (NELSON et al., 1983; EL-
SAYED et al., 2005a; MARTNEZ-CALVILLO et al., 2010). extremidade 5' do SL
adicionado um cap hipermetilado (FREISTADT, CROSS & ROBERTSON, 1988;
PERRY, 1987), ocasionando o capeamento do RNAm atravs do trans-splicing, que
junto poliadenilao geram o RNAm maduro.

1.1.4 Classificao e variaes intra-especficas em Trypanosoma cruzi

Grande divergncia intra-especfica observada no grupo T. cruzi, que se reflete
em variaes no s de sequncia como de infectividade entre as cepas (ZINGALES et
al., 1999). Estudos iniciais de filogenia demonstraram a existncia de dois grupos
distintos de T. cruzi, denominados I e II (SOUTO et al., 1996), relacionados em maior
frequncia ao ciclo silvestre e ao ciclo domstico de transmisso, respectivamente.
Anlises de diferentes cepas por RAPD e MLEE revelaram a presena de 5 subgrupos
bem definidos dentro do grupo II, que foram ento chamados de IIa, IIb, IIc, IId e IIe
(BRISSE, BARNAB & TIBAYRENC, 2000). A nomenclatura atualmente aceita
classifica as cepas no mais em grupo I e II, mas em seis DTUs (Discrete Typing Unit),
denominados T. cruzi I a VI, que correspondem aos antigos grupos I, IIb, IIc, IIa, IId e
IIe (ZINGALES et al., 2009).
Com o sequenciamento dos genomas das cepas CL Brener (EL-SAYED et al.,
2005a), do subgrupo TcVI, e Sylvio X10/1 (FRANZN et al., 2011), do subgrupo TcI, foi
possvel analisar mais a fundo as variaes de sequncia entre os diferentes
subgrupos. A cepa CL Brener consiste num hbrido entre os subgrupos TcII e TcIII, e
com o sequenciamento do seu genoma foi verificado que existe uma identidade mdia
de 94,6% entre eles, chegando a 97,8% nas ORFs de genes codificadores de protenas
(EL-SAYED et al., 2005a). Comparando com a cepa Sylvio X10/1, foi observada uma
8

identidade mdia nas regies codificadores de protenas de 97,5% com TcI e de 98,2%
com TcIII - uma evidncia de proximidade filogentica maior entre TcI e TcIII em
relao a TcII (FRANZN et al., 2011). Como ressaltado por Franzn e colaboradores,
a identidade de sequncia entre esses subgrupos de T. cruzi maior do que a
registrada para as subespcies T. brucei brucei and T. brucei gambiense (99,2%)
(JACKSON et al., 2010), porm menor que a identidade entre as espcies Leishmania
major e L. infantum (94%) (PEACOCK et al., 2007).

1.2 NOCAUTE GNICO

Ao longo do ciclo celular, uma clula exposta a diferentes agentes que podem
afetar a estrutura do DNA, causando rompimento em ligaes fosfodister em uma ou
ambas as fitas. Enquanto quebras em uma das fitas, na maioria dos casos, podem ser
reparadas rapidamente pelo simples preenchimento de falhas ou religao de bases
consecutivas, uma quebra de fita dupla (double strand break - DSB) representa uma
ameaa integridade cromossmica, que pode levar morte celular se no for
reparada (CAHILL, CONNOR & CARNEY, 2006).
Duas vias principais de reparo de DSBs esto presentes em procariotos e
eucariotos: juno de extremidades no-homlogas (non-homologous end joining -
NHEJ) e recombinao homloga (homologous recombination - HR). A recombinao
homloga usa uma sequncia homloga que sofreu dano, geralmente da cromtide
irm, como molde para o reparo, motivo pelo qual ela ocorre majoritariamente no final
da fase S e em G2; ao contrrio, a via de NHEJ, que ocorre basicamente pelo
preenchimento de fitas simples que possam existir e ligao das extremidades da DNA,
est ativa ao longo de todo o ciclo celular justamente por no necessitar de outra
sequncia como molde (LIEBER, 2010).
Existem diversas vias de reparo de DNA por recombinao homloga
(mostradas na Figura 1.2), porm todas iniciam da mesma forma: degradao da
extremidade de uma das fitas, resultando em uma extremidade 3' fita-simples (Figura
1.2-2) e a invaso dessa fita na dupla-fita homloga (Figura 1.2-3). A resoluo desse
complexo resultando no reparo da quebra ocorre de diversas formas, sendo que duas
9

delas resultam na cpia de grande parte da sequncia usada como molde para o
cromossomo danificado: (1) a via denominada de BIR (break-induced repair - reparo
induzido por quebra), na qual toda a sequncia utilizada como molde copiada,
daquele ponto em diante (Figura 1.2-6b); e (2) na via de DSBR (double-strand break
repair - reparo de quebra em fita-dupla), com a resoluo da juno atravs de
converso gnica (Figura 1.2-6d) ou cross-over (Figura 1.2-6c)(LI & HEYER, 2008).

Figura 1.2: Vias de reparo de quebra de fita-dupla de DNA por
recombinao homloga

Legenda: A partir da quebra da fita-dupla (1), ocorre a degradao da extremidade de uma das fitas
(2) e invaso da sequncia homloga e anelamente pela fita-simples gerada (3). A sntese da nova
fita iniciada a partir desse anelamento, e a resoluo pode ocorrer de 3 formas distintas: SDSA
(synthesis-dependent strand annealing, 4a-5a-6a), na qual aps os incio da sntese a fita nova volta
a se anelar com a extremidade quebrada; BIR (break-induced repair, 4a-5b-6b), no qual a extenso
na sequncia template continua at o final desta; e DSBR (double-strand break repair, 4b em
diante), na qual formada uma juno Holliday dupla (5c), cuja resoluo pode ocorrer de
diferentes formas, entre elas atravs da ocorrncia de crossover.
Fonte: adaptado de Li e Heyer (2008).
10

Mecanismos de reparo de DNA podem ser usados como ferramenta para a
insero de mutaes em um genoma. A tcnica de gene trapping (FRIEDRICH &
SORIANO, 1991; revisto por SCHNTGEN et al., 2011), por exemplo, usa inseres
por juno no-homloga para introduzir mutaes em um organismo utilizando uma
sequncia contendo um gene reprter e/ou de seleo positiva sem regio promotora,
com stio aceptor de splicing a montante e de poli-adenilao a jusante. Quando ocorre
insero do vetor em um ntron, o fragmento inserido unido por splicing ao xon a
montante durante a transcrio e esta interrompida prematuramente devido ao stio
de poli-adenilao da construo, gerando um transcrito hbrido (SKARNES,
AUERBACH & JOYNER, 1992). Se o gene inserido estiver no mesmo quadro de
leitura, uma protena quimrica - contendo os xons a montante e o gene marcador -
gerada aps a traduo.
Devido alta taxa de inseres por juno no-homloga, se comparada
recombinao homloga, a utilizao dessa tcnica em alguns modelos eucariticos,
como Mus musculus (FRIEDRICH & SORIANO, 1991), Drosophila spp.(OKANE &
GEHRING, 1987) e Danio rerio (BAYER & CAMPOS-ORTEGA, 1992), e a subsequente
seleo de indivduos pela expresso do marcador, gera uma biblioteca de organismos
mutantes, com genes total ou parcialmente inativados, cuja completude depende da
aleatoriedade das posies de insero.
Uma outra abordagem para introduo de mutaes a tcnica de gene
targeting, que usa recombinao homloga para inserir etiquetas, substituir ou deletar
regies especficas do genoma. Usando sequncias de DNA gene especficas unidas a
um gene marcador, possvel introduzir a alterao na regio desejada em uma
populao e selecionar/identificar os mutantes. Quando essa tcnica usada para
suprimir totalmente a expresso de um gene, atravs de substituio ou quebra da sua
regio codificante, ela chamada de nocaute gnico (ROTHSTEIN, 1983).
Um contratempo dessa aplicao a dependncia da taxa de recombinao
homloga do organismo de estudo: em mamferos, por exemplo, de <0,1% a 10% das
inseres ocorrem por recombinao homloga em stios especficos, enquanto o resto
ocorre em posies aleatrias atravs de NHEJ (THOMAS & CAPECCHI, 1987;
CAPECCHI, 1989;). No entanto, em alguns organismos - como Saccharomyces
11

cerevisiae (ORR-WEAVER, SZOSTAK & ROTHSTEIN, 1981) e tripanossomatdeos
(CRUZ & BEVERLEY, 1990) - possvel obter at 100% de clones em que a insero
do fragmento ocorreu por recombinao homloga, ou seja, em uma posio
determinada pela sequncia gene-especfica do vetor. Isso facilita a aplicao da
tcnica nesses organismos, pois diminui ou mesmo abole a necessidade de analisar
diferentes clones para identificar os em que a insero desejada ocorreu.
Originalmente, a introduo num organismo de uma sequncia contendo um
marcador de seleo construdo por clonagem clssica foi a tcnica empregada para a
realizao de nocautes gnicos (ROTHSTEIN, 1983). Porm diferentes metodologias
mais aprimoradas e de maior eficincia foram desenvolvidas com esse intuito.
Tendo como base a necessidade de que haja uma quebra de fita dupla no DNA
alvo para que ocorra a recombinao homloga desejada, Bibikova e colaboradores
(2001) utilizaram enzimas quimricas, contendo domnios zinc finger (que se ligam a
sequncias especficas de 3 nucleotdeos) fusionados ao domnio de clivagem de DNA
da enzima Fok I (KIM, CHA & CHANDRASEGARAN, 1996), capazes de se ligar e clivar
a fita dupla de DNA em regies pr-determinadas, o que ocasionou em um aumento na
taxa de recombinao homloga. Essa tcnica foi, ento, aplicada junto a gene
targetting em Drosophila melanogaster, o que ocasionou em um aumento de at 10
vezes na frequncia de introduo das mutaes (BIBIKOVA et al., 2003).
Metodologias semelhantes j foram aplicadas, com sucesso, em diferentes modelos
biolgicos (revisto por WU, KANDAVELOU & CHANDRASEGARAN, 2007).
Uma das limitaes da abordagem clssica para nocautes a necessidade do
uso de um par de gene de resistncia/droga diferente para cada gene a ser
nocauteado. Uma soluo para esse problema foi proposta por Alani e colaboradores
(1987), para Saccharomyces cerevisiae, ao gerar um cassete para nocaute com o gene
ura3 como marcador de seleo positiva/negativa, flanqueado por duas sequncias
idnticas extradas de Salmonella sp. Aps a integrao do cassete no genoma e
seleo de leveduras Ura
+
, foi possvel obter colnias em que ocorreu recombinao
entre as sequncias repetidas e consequente exciso do gene ura3 por seleo de
leveduras Ura
-
, permitindo que o mesmo cassete seja usado novamente para nocaute
de novos genes. A estratgia, no entanto, depende de o organismo estudado possuir
12

uma alta taxa de recombinao homloga, o que pode limitar muito a aplicao da
tcnica.
Tcnicas alternativas podem ser exploradas para utilizar cassetes de nocaute
reciclveis sem depender da taxa de recombinao do organismo. Cre/loxP
(STERNBERG & HAMILTON, 1981) um sistema de recombinao stio-especfica
derivado do bacterifago P1, que utiliza a enzima Cre recombinase para catalizar a
recombinao entre stios do bacterifago, denominados loxP, que consistem em uma
regio espaadora assimtrica de 8 pb flanqueada por duas repeties idnticas de 13
pb, invertidas entre si (Figura 1.3) (HOESS, ZIESE & STERNBERG, 1982). A regio
espaadora define a direo do stio loxP e como ocorrer a recombinao entre eles
(ABREMSKI, HOESS & STERNBERG, 1983):
- deleo: entre dois stios no mesmo sentido e na mesma molcula de DNA, o
resultado da recombinao a retirada da sequncia entre os stios na forma de uma
molcula de DNA circular, fechada por um stio loxP resultante da recombinao entre
os dois stios originais. No local onde se encontravam os stios originais permanece
apenas um stio loxP, resultante do processo de recombinao (Figura 1.4a);
- inverso: entre dois stios em sentidos opostos na mesma molcula de DNA,
catalisada a inverso do fragmento interveniente (Figura 1.4b);
- translocao: entre stios localizados em cromossomos distintos e na mesma
orientao em relao aos centrmeros, ocorre uma troca recproca das extremidades
dos braos; se estiverem em sentidos opostos, um dos cromossomos se torna
acntrico e o outro se torna dicntrico (QIN et al., 1994) (Figura 1.4c);
- insero: entre um stio em um cromossomo e outro em um plasmdeo, ocorre
a insero da sequencia presente no plasmdeo na posio cromossmica, numa
reao exatamente oposta descrita para deleo.






13

Figura 1.3: Esquema e sequncia de diferentes stios lox

Legenda: os stios lox gerados 66 e 71, que tm alta capacidade de recombinao entre si,
possuem mutaes nas repeties direita e esquerda, respectivamente (letras minsculas na
sequncia). Aps a recombinao entre eles so gerados os stios loxP (stio selvagem) e lox72
(com mutaes nas duas repeties), que tem baixa capacidade de recombinao entre si. As
caixas em vermelho marcam as regies espaadoras assimtricas, idnticas para todos os stios.
Fonte: adaptado de Albert et al. (1995)


Figura 1.4: Esquema das reaes do sistema Cre/loxP

Legenda: Dependendo das posies e orientaes do stios loxP, a enzima Cre
recombinase cataliza tipos diferentes de recombinao entre eles.
Fonte: adaptado de http://cre.jax.org.


Se stios loxP forem introduzidos ao redor de um marcador de seleo em uma
sequncia para gene targeting, aps a insero do cassete na regio desejada este
pode ser retirado pela expresso da enzima Cre recombinase. Isso permite que o
marcador de seleo seja reutilizado futuramente para inserir outras mutaes, como
delees gnicas, no mesmo organismo, abolindo a necessidade de que mltiplos
14

marcadores sejam utilizados (NAGY et al., 1998). Os stios que permanem no genoma
aps a exciso, no entanto, podem ser alvo de recombinaes indesejadas em
experimentos subsequentes, pois foi demonstrado que pode ocorrer recombinao
entre stios loxP localizados a grandes distncias no cromossomo (ZHENG et al., 2000)
ou mesmo em cromossomos diferentes (VAN DEURSEN et al., 1995).
Para diminuir a chance de que ocorra um acmulo de mutaes indesejadas ao
longo de repetidas aplicaes da tcnica no mesmo organismo, stios lox mutados
foram desenvolvidos com o intuito de que, aps a primeira recombinao, os stios
recombinantes gerados possuam baixa taxa de recombinao entre si e com os stios
originais (ALBERT et al., 1995). Essa tcnica foi utlizada com sucesso para causar
mltiplas delees no mesmo organismo, sem que nenhuma recombinao ilegtima
fosse observada (SUZUKI et al., 2005). A nica ressalva em relao ao uso do sistema
se encontra na toxicidade da enzima Cre recombinase, que pode causar mltiplas
mutaes em um organismo se expressa por longos perodos (LOONSTRA et al.,
2001).
Em estudos em Saccharomyces cerevisiae, Suzuki e colaboradores (2011)
inovaram ao usar genes que codificam protenas fluorescentes nos nocautes ao invs
de genes de resistncia ou marcadores metablicos. Na estratgia, denominada
Green Monster, clones de levedura com mltiplas delees gnicas na famlia de
transportadores ABC foram gerados atravs de cruzamento entre populaes contendo
GFP no lugar de um dos genes. Aps diversos ciclos de cruzamento e enriquecimento
da populao GFP-positiva por citometria de fluxo, um mutante nocaute para 16 genes
codificadores de transportadores ABC foi gerado, demonstrando que possvel fazer
mltiplos nocautes sem usar diversos marcadores de seleo, e ainda que existe uma
relao direta entre o grau de fluorescncia e o nmero de GFPs integradas/genes
nocauteados - o que permite que uma mesma protena fluorescente seja usada para
mltiplos nocautes gnicos.
Em relao construo das sequncias para nocaute, podemos organiz-las
em trs abordagens distintas.
Baudin e colaboradores (1993) foram bem sucedidos em nocautear S. cerevisiae
usando um produto de PCR simples, com iniciadores contendo sequncias especficas
15

das regies ao redor do gene alvo de 35 a 51 nucleotdeos, alm de 17 nucleotdeos
homlogos ao marcador HIS3, usado como gene de seleo. Aps a amplificao por
PCR do marcador de seleo e transfeco do produto gerado foram obtidas mltiplas
colnias contendo a alterao genmica esperada, estando a aplicabilidade dessa
tcnica condicionada apenas pela eficincia da maquinaria de recombinao homloga
do organismo em recombinar fragmentos pequenos de DNA.
Para construir cassetes de nocaute com menor limitao de tamanho para as
regies de recombinao pode-se usar a plataforma comercial MultiSite Gateway, da
Invitrogen, que permite que trs fragmentos (dois derivados do genoma do organismo
alvo e um marcador de seleo) sejam unidos em um plasmdeo em apenas uma etapa
de recombinao stio-especfica (IIIZUMI et al., 2006). O cassete pode ser amplificado
em um reao de PCR, ou retirado do plasmdeo com enzimas de restrio, e ser
diretamente transfectado no organismo alvo.
Como discutido em detalhes abaixo, a tcnica de PCR de fuso (HIGUCHI,
KRUMMEL & SAIKI, 1988) pode ser utilizada como uma alternativa a solues
comerciais para este problema, com alta eficincia e rapidez na construo dos
cassetes sem restrio do tamanho das regies de similaridade indutoras da
recombinao.

1.2.1 PCR de fuso

A tcnica de PCR de fuso foi inicialmente desenvolvida com o intuito de gerar
fragmentos de DNA com mutaes stio-especficas afastadas das extremidades da
sequncia, para utilizao em estudos de interao DNA-protena (HIGUCHI,
KRUMMEL & SAIKI, 1988). Para esse fim, dois fragmentos do gene alvo que se
sobrepe na regio do nucleotdeo a ser trocado e que juntos compreendem o gene
inteiro so amplificados por PCR em reaes separadas, ambos contendo a mesma
mutao introduzida por iniciador na regio de sobreposio. possvel, ento, fazer
uma nova reao de PCR com os dois produtos, sem adio de oligonucleotdeos, na
qual a extenso ocorre em direo extremidade 5 do primeiro fragmento e 3 do
segundo, a partir do anelamento das regies em comum entre eles (Figura 1.5). O
16

produto dessa PCR uma molcula de DNA hbrida, resultante da fuso dos dois
fragmentos originais, que corresponde ao gene alvo contendo a mutao desejada.
Da mesma forma com a qual possvel fusionar fragmentos mutados do mesmo
gene, genes hbridos podem ser construdos pela fuso de sequncias distintas
(HORTON et al., 1989), e partindo de produtos de PCR com extremidades
sobreponveis, 3 ou mais fragmentos podem ser unidos na mesma reao em uma
orientao predeterminada (JAYARAMAN et al., 1991), aumentando muito a gama de
possibilidades da tcnica.

Figura 1.5: Esquema da fuso de fragmentos do mesmo gene
para a introduo de mutaes

Legenda: A: os dois fragmentos do mesmo gene so amplificados, usando primers contendo a
mutao desejada; B: os dois produtos so misturados, e aps desnaturao, anelamento e extenso
a sequncia fruto da fuso entre os dois sintetizada. Nessa etapa podem ser adicionados os primers
para amplificar o produto de fuso exponencialmente.
Fonte: adaptado de Higuchi et al. (1988).
17

Dentre as diferentes aplicaes, PCR de fuso usada como uma alternativa
clonagem clssica para a construo de sequncias para gene targeting. Trs reaes
de PCR distintas - de um marcador de seleo e de duas regies ao redor do gene
alvo, no caso de nocaute gnico - so feitas, e a fuso feita em uma quarta reao,
unindo os 3 produtos e utilizando iniciadores mais externos para a amplificao do
produto fusionado final (AMBERG, BOTSTEIN & BEASLEY, 1995; WACH, 1996). Um
esquema da reao mostrado na Figura 1.6.

Figura 1.6: Esquema de PCR de fuso para consturo de cassetes para nocaute

Legenda: (A): a regies ao redor do gene alvo (ORF) so amplificadas a partir do genoma, em duas
reaes separadas, usando primers externos que se anela normalmente a regio (P5' e P3') e
primers internos (P5'L e P3'L) com regies idnticas ao marcador de seleo que ser usado (em
branco, no produtos de PCR). Na fuso, so misturados os dois produtos mais o produto de PCR do
marcador de seleo (M.S.) e os primers externos P5' e P3', que amplificam o cassete completo.
Fonte: adaptado de Wach (1996).


18

Com o intuito de facilitar e acelerar esse tipo de aplicao, Kuwayama e
colaboradores (2002) acrescentaram duas melhorias ao protoco de PCR de fuso, que
tornaram desnecessria a purificao dos produtos de PCR intermedirios: (1) atravs
de incubao dos produtos pr-fuso com a enzima exonuclease I, os
oligonucleotdeos que poderiam atrapalhar o anelamento dos produtos de PCR
(especialmente P5'L e P3'L, que se anelam nos stios de fuso) so degradados; e (2)
domnios de desestabilizao de Tm (melting temperature) ricos em GC so
adicionados extremidade 5' dos iniciadores externos (P5' e P3'), permitindo que a
temperatura de anelamento seja aumentada na amplificao da fuso, o que diminui a
formao de produtos indesejados e diminui a chance de que o DNA genmico ainda
presente na reao, devido ausncia de purificao, seja usado como molde, ao
invs da fuso. Removendo a necessidade de que os produtos sejam purificados, alm
de diminuir o tempo de execuo da metodologia, no h perda de material entre as
etapas, aumentando o rendimento da tcnica, um aprimoramento essencial para a
criao de cassetes de nocautes em uma perspectiva de Lara escala.


1.2.2 Nocaute em Trypanosoma cruzi

No incio da dcada de 1990, Lu e Buck (1991) desenvolveram e otimizaram
uma tcnica para transfeco e expresso transiente de genes exgenos em
Trypanosoma cruzi. Foi construdo um vetor contendo um gene que codifica o transcrito
primrio do spliced leader de Trypanosoma cruzi, fusionado ao gene reprter
bacteriano que codifica a enzima cloranfenicol acetiltransferase. At 96 horas aps a
transfeco do vetor por eletroporao foi possvel detectar atividade da enzima em
extratos das clulas transfectadas.
Com o intuito de obter expresso estvel de genes transfectados, Hariharan e
colaboradores (1993) construiram um vetor contendo stios de trans-splicing e
poliadenilao de T. cruzi, fusionados ao gene da neomicina fosfotransferase (neo),
que garante ao parasita resistncia a determinados aminoglicosdeos (KELLY et al.,
1992). Alm de permitirem o correto processamento do pr-mRNA de neo, por meio
19

das sequncias do genoma do parasita adicionadas ao vetor, ocorreu a insero do
plasmdeo por recombinao homloga e deleo de uma srie contgua de genes.
Simultaneamente, Otsu e colaboradores (1993) conseguiram transfeco e expresso
estvel em T. cruzi pela troca de um domnio repetitivo de um gene antignico por neo,
usando um vetor contendo sequncias que flanqueiam o domnio ligadas ao gene de
resistncia. Os mutantes nos dois trabalhos permaneceram resistentes droga por
meses aps a transfeco, mesmo na ausncia da presso seletiva.
Pouco avano foi feito nos 20 anos seguintes na rea de nocaute gnico em T.
cruzi, com poucos estudos publicados (Tabela 1.1).
Para aumentar as possibilidades do estudo de Trypanosoma cruzi por gentica
reversa, alm de neo, j mencionado, novas drogas e genes de resistncia foram
testados:
- hyg (higromicina fosfotransferase), que confere resistncia droga
higromicina, foi testado e utilizado com sucesso em experimentos de integrao no
genoma (BUCKNER, WILSON & VAN VOORHIS, 1997), nocaute (COOPER, DE
JESUS & CROSS, 1993) e transfeco de plasmdeos (NBREGA et al., 2004);
- pac (puromicina N-acetil-transferase), que confere resistncia droga
puromicina, foi transfectado e mantido de modo estvel como elemento
extracromossmico (NBREGA et al., 2004) e como marcador para nocaute em
Trypanosoma cruzi (WILKINSON et al., 2008);
- bsr (resistncia a blasticidina-S), que d resistncia droga blasticidina, foi
usado com sucesso para nocaute gnico (WILKINSON et al., 2008);
- ble, que confere resistncia a fleomicina, foi transfectado e mantido como
elemento extracromossmico (NOZAKI & CROSS, 1994) e como marcador para
nocaute (CALER et al., 1998); e
- tun, que confere resistncia droga tunicamicina, foi transfectado e
mantido como elemento extracromossmico (NOZAKI & CROSS, 1994) e como
marcador para nocaute (ANNOURA et al., 2005).



20

Tabela 1.1: Nocautes gnicos publicados em Trypanosoma cruzi
Autores Gene(s)
Nocaute
duplo
vivel?
Marcador
de
Seleo
Alteraes
Observadas
COOPER, DE JESUS & CROSS, 1993 GP72 SIM NEO/HYG Flagelo e extremidade anterior da clula
AJIOKA & SWINDLE, 1996
CUB
(calmodulina-
ubiquitina)
NO NEO/HYG Nocaute duplo letal
CALER et al., 1998 Oligopeptidase B SIM NEO/BLE Comprometimento da infectividade
ALLAOUI et al., 1999 Tc52 NO NEO/HYG
Comprometimento da metaciclognese
com nocaute simples/nocaute duplo letal
MANNING-CELA et al., 2001 LYT1 SIM NEO/HYG
Comprometimento da infectividade
in vitro
CONTE et al., 2003 GT1 SIM NEO/HYG
Leve comprometimento da
diferenciao para
formas infectivas/infectividade in vitro
ANNOURA et al., 2005 DHOD NO HYG/TUN Nocaute duplo letal
(MACRAE et al., 2006) GALE NO NEO/HYG
Alteraes morfolgicas diversas
no nocaute simples /
nocaute duplo letal
BARRIO, VAN VOORHIS &
BASOMBRO, 2007
CUB
(calmodulina
-ubiquitina)
- NEO
Diminuio da virulncia
em camundongos
GLUENZ, TAYLOR & KELLY, 2007 Met-III SIM HYG/PAC Nenhuma
WILKINSON et al., 2008
NTR
(nitroredutase
do tipo I)
SIM BSR/PAC
Aumento da resistncia a
nitrofuranos e nitroimidazis /
comprometimento do crescimento
e de diferenciao in vitro
XU et al., 2009
DHFR-TS
(diidrofolato
redutase-
timidilato sintase)
- NEO/HYG -
XU et al., 2009
ECH-1/ECH-2
(enoil-CoA
hidratase)
- NEO/HYG -
DE SOUZA et al., 2010
KAP3 (protena
associada
ao cinetoplasto)
SIM NEO/HYG Nenhuma
SERPELONI et al., 2011 Sub2 NO NEO/HYG Nocaute duplo letal
CAMPOS & SILVA, 2011 MSH2 NO NEO/HYG
Diminuio da tolerncia a
perxido de hidrognio /
nocaute duplo fatal
PEREZ BRANDAN et al., 2011
DHFR-TS
(diidrofolato
redutase-
timidilato sintase)
NO NEO/HYG
Comprometimento do crescimento
in vitro / diminuio da virulncia
/ nocaute duplo fatal
SNCHEZ VALDZ et al., 2013
CRT
(calreticulina)
NO NEO/HYG
Aumento da sensibilidade ao
sistema complemento / crescimento
e diferenciao comprometidos /
nocaute duplo fatal
Legenda: NEO: neomicina fosfotransferase; HYG: higromicina fosfotransferase;
BSR: blasticidin-S resistance; PAC: puromicina N-acetil-transferase; TUN: gene
de resistncia a tunicamicina; BLE: gene de resistncia a fleomicina.

21

No intuito de desenvolver e validar uma tcnica rpida e eficiente para nocaute
gnico em Trypanosoma cruzi, Xu et al. (2009) testaram diferentes metodologias para
construo de cassetes para nocaute: alm da clonagem clssica, o sistema Gateway
Multi-Site (IIIZUMI et al., 2006) e PCR one-step (BAUDIN et al., 1993) foram usados,
porm apenas o primeiro com sucesso. A ineficcia da recombinao com a segunda
tcnica sugere que a maquinaria para recombinao homloga de T. cruzi incapaz de
recombinar fragmentos pequenos de DNA (87 pb, no caso), mesmo com 100% de
identidade. Apesar de estudos em Trypanosoma brucei terem demonstrado que ocorre
recombinao homloga utilizando regies idnticas inferiores a 50 pb (GAUD et al.,
1997; BARNES & MCCULLOCH, 2007), essa hiptese reforada por estudos em
Leishmania spp. (PAPADOPOULOU & DUMAS, 1997), que demonstraram no ocorrer
recombinao com fragmentos com menos do que 180 pb nesses organismos. Ainda
assim, devido aparente ausncia de maquinaria eficiente de recombinao no-
homloga (revisto por PASSOS-SILVA et al., 2010), a aplicao de nocaute dirigido
promissora em Trypanosoma cruzi.



22

2 OBJETIVOS

2.1 OBJETIVO GERAL

Desenvolver uma estratgia de alta eficincia para nocautes em Trypanosoma
cruzi que possa ser usada em larga escala em estudos de caracterizao funcional de
genes e em anlises micas nesse organismo.

2.2 OBJETIVOS ESPECFICOS

Desenvolver um software para predio automatizada de iniciadores para
nocaute;
Desenvolver um sistema de PCR de fuso para construo de cassetes
para nocaute;
Testar o sistema realizando o nocaute de diferentes genes de
Trypanosoma cruzi;
Testar a viabilidade e construir ferramentas para nocautes sequenciais.


23

3 JUSTIFICATIVA

O protozorio Trypanosoma cruzi infecta 10 milhes de pessoas e estima-se
que outras 25 milhes estejam sob risco de contgio na Amrica Latina. No entanto, j
h sinais de avano para outros continentes como verificado nos Estados Unidos da
Amrica, Canad, Europa e alguns pases do Pacfico Oeste. Estima-se que no ano de
2008, aproximadamente 10.000 pessoas foram a bito devido a esta doena (WHO,
2012). Apesar de existirem drogas para o tratamento da fase aguda da doena, para o
estgio crnico ainda no existe tratamento eficaz, e a complexidade do protozorio
causador dificulta o desenvolvimento de novos tratamentos (BRENER et al., 2000).
Pensando na biologia dos tripanossomatdeos em geral, vrios aspectos
desses parasitas justificam por si s o seu estudo. Organismos que se expe a
ambientes completamente distintos e passam por processos drsticos de diferenciao
celular ao longo do seu ciclo de vida, sem ter qualquer tipo de regulao transcricional
gene-especfica, so modelos nicos para o estudo da regulao ps-transcricional da
expresso gnica (CLAYTON, 2002). A existncia de aspectos peculiares - como a
extensa transcrio policistrnica de genes codificadores de protena, a quase
ausncia de ntrons e o fato de todos os pr-RNAm serem processados por trans-
splicing -, aliada ao desconhecimento da funo de grande parte das protenas desses
organismos, indicam que podem existir diversas vias e maquinarias moleculares ainda
no caracterizadas e que esto ausentes nos organismos modelo padro estudados.
A ausncia de uma tcnica eficaz e padronizada para supresso da expresso
de genes especficos em Trypanosoma cruzi - como o caso da interferncia por RNA,
muito utilizada em T. brucei - dificulta a execuo de estudos pontuais de
caracterizao proteica e inviabiliza aplicaes em larga escala. Alm da
caracterizao de genes de funo desconhecida, que correspondem a cerca de 50%
do genoma do parasita, um esforo conjunto existe no Instituto Carlos Chagas para a
caracterizao e mapeamento de todos os elementos relacionados regulao da
expresso gnica nesse parasita, denominado de projeto Reguloma de Trypanosoma
cruzi, que ser muito beneficiado com o desenvolvimento de um sistema para nocautes
em larga escala nesse organismo.
24

4 MATERIAIS E MTODOS

4.1 LISTA DE MATERIAIS

Meio LB: Triptona 1%, extrato de levedura 5% e NaCl 1%.

Meio LIT (Liver Infusion Tryptose): extrato de levedura 15 g/L, fosfato dibsico de
sdio 11,56 g/L, glicose 2,2 g/L, hemina 0,02 g/L, infuso de fgado 5 g/L, KCl 0,4 g/L,
NaCl 4,4 g/L, soro fetal bovino 10 % (v/v), triptose 5 g/L. O pH ajustado para 7,2 com
HCl.

Mix padro para PCR com AccuPrime Pfx DNA polimerase (Invitrogen): 0,025
U/L de AccuPrime Pfx DNA Polimerase, 1 x AccuPrime Pfx Reaction Mix.

Mix padro para PCR com Taq DNA polimerase: 200 M de cada dNTP
(Invitrogen), MgCl
2
1,5 mM (Invitrogen), tampo Taq DNA polimerase 1x
(Invitrogen) e 0,05 U/L de Taq DNA polimerase (IBMP).

PBS: KCl 2,7 mM, KH
2
PO
4
1,5 mM, Na
2
HPO
4
.7H
2
0 4,3 mM, NaCl 137mM.

Soluo de lise para toothpick: NaOH 50 mM, Glicerol 5%, SDS 0,5%, EDTA 5 mM e
azul de bromofenol 0,025 %.

TBE: Tris base 89 mM, cido brico 89 mM e EDTA 2 mM.

TE: Tris-HCl 10 mM pH 8,0 e EDTA 1 mM.

TELT: Tris-HCl 50 mM pH 8,0, EDTA 62,5 mM pH 9,0, LiCl 2,5 M e Triton X-100 4%.

Tampo de eletroporao para T. cruzi: NaCl 140 mM; HEPES (cido) 25 mM e
Na
2
HPO4 0,74 mM pH 7,5.
25

Tabela 4.1: Lista de oligonucleotdeos gerados pelo software
A_UPS_FOR_0 TAATCGCAGGGTGTTTTACC
A_UPS_FOR_4 GGGGTAATCGCAGGGTGTTTTACC
A_UPS_FOR_8 GGGGGGGGTAATCGCAGGGTGTTTTACC
A_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTAACTTCCAGCGTCCTCTCC
A_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAACAAGCAGAGGACACAAACAGG
A_DOWN_REV_0 GACAACAAGCAGCTGGTCC
A_DOWN_REV_4 GGGGGACAACAAGCAGCTGGTCC
A_DOWN_REV_8 GGGGGGGGGACAACAAGCAGCTGGTCC
G_UPS_FOR_0 AAAAAGGAGAACGAGGAGGC
G_UPS_FOR_4 GGGGAAAAAGGAGAACGAGGAGGC
G_UPS_FOR_8 GGGGGGGGAAAAAGGAGAACGAGGAGGC
G_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTGCAATGCCCAGAAAATTAGC
G_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAACAGGAGTAGTAGCCACGGG
G_DOWN_REV_0 TCTCGTAGTTAAAATGCAGATGG
G_DOWN_REV_4 GGGGTCTCGTAGTTAAAATGCAGATGG
G_DOWN_REV_8 GGGGGGGGTCTCGTAGTTAAAATGCAGATGG
I_UPS_FOR_0 CATTTAAAGAAGGCGTTGCG
I_UPS_FOR_4 GGGGCATTTAAAGAAGGCGTTGCG
I_UPS_FOR_8 GGGGGGGGCATTTAAAGAAGGCGTTGCG
I_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTATTCTAGTCGGCCTCTCTGC
I_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAGTATGAGAAGAAAATTGCTTAGACAGC
I_DOWN_REV_0 ATAATTCGTTTGCTTTTTCTTTTCC
I_DOWN_REV_4 GGGGATAATTCGTTTGCTTTTTCTTTTCC
I_DOWN_REV_8 GGGGGGGGATAATTCGTTTGCTTTTTCTTTTCC
URA_UPS_FOR_8 GGGGGGGGTGGTATTGGTGTCGTTGCC
URA_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTTCAAATTCAGTGCTGATGAGG
URA_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAAATGAATGATGACACGACGG
URA_DOWN_REV_8 GGGGGGGGAGGGGTGAGAAGAATGACCC
B_ UPS_FOR GGGGGGGGGAATGTAACCCACTTTGGCG
B_ UPS _R AGTGCGGAAAGAGAAATGGACGGTGCATTTTCCGTTTCTCTTGTCGATCC
B_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATGTTGTTTTGTTTATTTGTTTCTGTG
B_DOWN_REV GGGGGGGGAACACTAAGGGCCATGATGC
C_ UPS_FOR GGGGGGGGAGAGATGCACTTCCTTTCACA
C_ UPS _REV AGTGCGGAAAGAGAAATGGACGGTGCATTTTGTTGAAGATTGTGATAGGTGATAA
C_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAACAAGAATGGGAAATTTTGGC
C_DOWN_REV GGGGGGGGGGGAAGGGTGAGAAAAGC
D_ UPS_FOR GGGGGGGGAAATGAAAGGAGCGAGAGGG
D_ UPS _REV AGTGCGGAAAGAGAAATGGACGGTGCATTTACGTGAAAAGACAACAGGGG
D_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAGTATGTGTGCAGTGTTGCCC
D_DOWN_REV GGGGGGGGATAAACCCCTTTCAACGACG
E_UPS_FOR GGGGGGGGAAAAAGAACTTCAGGGAGAAGG
E_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTAAAAAGAAAAGAAAAAGTCGGC
E_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATGTTGTCGTTTTTGCTGCTT
E_DOWN_REV GGGGGGGGCCTTGTTGAGCCGTATGCC
F_UPS_FOR GGGGGGGGTCGCATGCATTATCAACTCAG
F_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTGTCCACAATCAAACACAGAAAC
F_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAACCTTTAACATTGGACGCAGG
F_DOWN_REV GGGGGGGGATGAACTCGCCGTCCTCC
H_UPS_FOR GGGGGGGGTGATTGTCTCTGGTGGGAGG
H_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTAGCTGACTCACGTCCTTTCC
H_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAACTTCTCCATTCTGCCTCCC
H_DOWN_REV GGGGGGGGAAAACCACACCGTCATTCG
MYO_1_UPS_FOR GGGGGGGGTTTTCTGCCTTTTAGACATTCG
MYO_1_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTGGATGGGGTAAATTCTTCTCG
MYO_1_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATGAGATGGATGTATCGGAAGG
MYO_1_DOWN_REV GGGGGGGGAAATGCTCTTCTTTTTGACCAGC
MYO_2_UPS_FOR GGGGGGGGGACGGCCGGAAATAACAAG
MYO_2_UPS_REV_S AGTGCGGAAAGAGAAATGGACGGTGCATTTAAAAACAAAATGTATTTACCGCAA
MYO_2_UPS_REV_L AGTGCGGAAAGAGAAATGGACGGTGCATTTTCACTAAACACCTCGCCCAC
MYO_2_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATTGGAGTGTAAATGTTGAGAGAAAA
MYO_2_DOWN_REV GGGGGGGGTGAACTGTCTTGGGGAGAGC
MYO_3_UPS_FOR GGGGGGGGCATGTTCACACAGAAACACACAG
MYO_3_UPS_REV_S AGTGCGGAAAGAGAAATGGACGGTGCATTTTAACTTTAACTCGGGTCGCC
MYO_3_UPS_REV_L AGTGCGGAAAGAGAAATGGACGGTGCATTTGCGGCTCTTTAGACAGTTCAA
26

Tabela 4.1. Continuao.
MYO_3_DOWN_FOR_S ACATTGAACAGAATTTAACATGCCCATCAATTTGGGAGGGAATTTGGG
MYO_3_DOWN_FOR_L ACATTGAACAGAATTTAACATGCCCATCAATAGACGGCGTTGTGAGGTT
MYO_3_DOWN_REV GGGGGGGGCGTTTGCGACGATAAATGAG
MYO_4_UPS_FOR GGGGGGGGCCATTCTTCCATTTCTCATTCC
MYO_4_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTATTGACGAGTCCTCAGGGTC
MYO_4_DOWN_FOR_S ACATTGAACAGAATTTAACATGCCCATCAAGAGAAGAAGGAAGCGCCTTT
MYO_4_DOWN_FOR_L ACATTGAACAGAATTTAACATGCCCATCAAGGGGGTGTAACTTCCTTTCG
MYO_4_DOWN_REV GGGGGGGGGTGCATGCATTTACAATCCG
MYO_5_UPS_FOR GGGGGGGGCCCTTGCATTAATCTTTGCC
MYO_5_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTACGATAAATAAATAAATAAAAAGGCAG
MYO_5_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAAGGTAAGGAGAGAGACGGATAGA
MYO_5_DOWN_REV GGGGGGGGCTTGCCCCACAGAATGAGAT
MYO_6_UPS_FOR GGGGGGGGTTATCCGGGCGATAATTACAA
MYO_6_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTCCTGCCACGGAGAGATGT
MYO_6_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATCACTCTCTCAGAATTTCTCTTTCT
MYO_6_DOWN_REV GGGGGGGGAAAGGTCGTAAGACACCCCC
MYO_7_UPS_FOR GGGGGGGGTGGTCCTCATTTTCTCTTGAGG
MYO_7_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTGTTACGCACCACTCTCTCCC
MYO_7_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAATTACCACCACTTGGGTTTCC
MYO_7_DOWN_REV GGGGGGGGGAGGGTCACCTCGTTTTTAGA
MYO_8_UPS_FOR GGGGGGGGGAAGAGAATTGCGGGAAAGC
MYO_8_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTTTCTCGCTTTTTCTACAATAGAGAT
MYO_8_DOWN_FOR_S ACATTGAACAGAATTTAACATGCCCATCAATCTGCTTAGTGGAACCAGGC
MYO_8_DOWN_FOR_L ACATTGAACAGAATTTAACATGCCCATCAACCGGGTATTTCTCAGGAGATT
MYO_8_DOWN_REV GGGGGGGGGAAAGAGAAAAGCGGAGTGC
MYO_9_UPS_FOR GGGGGGGGGAAAGAGAAAAGACCAGCGG
MYO_9_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTCACTCTCTGTTTTCCGTGTATGA
MYO_9_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAACCGTTTTGTCAAATACAGAAAAA
MYO_9_DOWN_REV GGGGGGGGGGTCCCCACAGTCTCGCT
MYO_10_UPS_FOR GGGGGGGGGGTGTCACCCAACGCTGT
MYO_10_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTAGTCCACCACAACACCAGG
MYO_10_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAGGAAGGGAAAAGGAAGAGGA
MYO_10_DOWN_REV GGGGGGGGATGCACACAGACAGAGCCC
KU_UPS_FOR GGGGGGGGGATGAGGGAGGCGCGTAG
KU_UPS_REV AGTGCGGAAAGAGAAATGGACGGTGCATTTTTTGGCATGCAAATACAAAAA
KU_DOWN_FOR ACATTGAACAGAATTTAACATGCCCATCAAAGCGAATTTGCTGGTGAAAA
KU_DOWN_REV GGGGGGGGTTTATCGCCCCTTCCCTATT




Tabela 4.2: Lista de oligonucleotdeos para construo dos vetores
pNEO2_FOR TGATAGTCGACCGTCCATTTCTCTTTCCGCACTC
pNEO2_REV GATAGGATCCTTGATGGGCATGTTAAATTCTGTTCAATGTAATTGTTG
E2_FOR GGGGGGAAGCTTATGGATAGCACTGAGAACGTCAT
E2_VER GGGGGGGAATTCCTACTGGAACAGGTGGTGGC
VFP_FOR GGGGGGAAGCTTATGAATGTGATTAAGCCAGACATG
VFP_REV GGGGGGGAATTCTTACTTGGCCTGACTCGGCAGCATA
GFP_FOR GGGGGGAAGCTTATGAGCAAGGGCGAGGAGCTG
GFP_REV GGGGGGGAATTCCTACTTGTACAGCTCGTCCATGCC
CRE_GW_FOR GGCTCCACCATGATGTCCAATTTACTGACCGTACACC
CRE_GW_REV TGGGTGGATYCACTAATCGCCATCTTCCAGCAGGC
ATTB_F GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATG
ATTB_R GGGGACCACTTTGTACAAGAAAGCTGGGTGGATCCA


27

4.1.1 Organismos utilizados

Escherichia coli: cepa DH5: (F- recA1 endA1 hsdR17(rk-, mk+) supE44 - thi-1 gyrA96
relA1).
Trypanosoma cruzi: Formas epimastigotas do clone Dm28c (CONTRERAS et al.,
1988).


4.2 SOFTWARE DE PREDIO DE INICIADORES PARA NOCAUTE GNICO

Um software de predio de iniciadores para nocaute gnico em Trypanosoma
cruzi - entitulado TcruziKO - foi feito na linguagem de programao Perl (verso 5.8.8),
utilizando as bibliotecas Bioperl (STAJICH et al., 2002) e GD para gerao de imagens
de representao de contexto genmico e grficos, DBIx::Class para acesso e
gerenciamento de um banco de dados genmico implementado em PostgreSQL, e os
algoritmos BLASTn (ALTSCHUL et al., 1990) e Primer3 (ROZEN & SKALETSKY,
2000). O software possui uma interface web, construda em Perl CGI em um servidor
Apache verso 2.2.3. Todo o desenvolvimento e testes do sistema foram executados
em workstations da Sun Microsystems, com sistema operacional Linux CentOS 5.7.


4.2.1 Estimativa do nmero de cpias gnicas

Leituras do sequenciamento do genoma da cepa Dm28c de T. cruzi,
provenientes de corridas no sistema de sequenciamento 454, da Roche, foram
alinhados contra as CDSs anotadas dos dois hapltipos da cepa CL Brener e dos
contigs no-atribudos utilizando o algoritmo BLASTn. Utilizando valores de e-value (10
-
100
) e porcentagem de identidade (90%) como linhas de corte para o mapeamento, o
nmero de leituras mapeado em cada gene foi contado e normalizado por um valor de
tamanho arbitrrio, seguindo a frmula:


28

Frmula 1: Normalizao do nmero de leituras mapeadas por tamanho


NRi = nmero normalizado de leituras mapeadas no gene i
Ln = constante para normalizao de tamanho
Li = tamanho do gene i
Ri = nmero de leituras mapeadas no gene i

As anlises foram feitas relacionando o nmero de leituras normalizadas
mapeadas por gene com o nmero de genes, para as quais foi utilizado um intervalo de
classe de 1 leitura/gene. A estimativa, para cada gene, feita com base no percentil
em que se encontra o gene na distribuio e no nmero de desvios mdios a partir da
moda (frmulas 2 e 3).

Frmula 2: Clculo do desvio mdio a partir da moda


MDFM = Desvio mdio a partir da moda
NR
i
= Nmero normalizado de leituras mapeadas no gene i
Mo = Moda da distribuio

Frmula 3: Clculo do nmero de desvios mdios a partir da moda


ND
i
= Nmero de desvios mdios a partir da moda para o gene i
MDFM = Desvio mdio a partir da moda
NR
i
= Nmero normalizado de leituras mapeadas no gene i
Mo = Moda da distribuio


29

4.2.2 Anlise da eficincia de predio de oligonucleotdeos

Para analisar a capacidade do software de desenhar iniciadores de PCR para
diferentes genes, um script de acesso automtico ao site foi desenvolvido na linguagem
Perl usando a biblioteca WWW::Mechanize. Tendo como informaes de entrada uma
lista de IDs de genes de T. cruzi cepa CL Brener e parmetros para o software, o
programa executado uma vez para cada gene, da mesma forma que feito atravs
do browser, e os arquivos de entrada e sada do Primer3 so armazenados, a partir
dos quais a eficincia do software avaliada.


4.2.3 Eliminao da redundncia entre leituras e contigs

As leituras do sequenciamento do genoma da cepas Dm28c e Sylvio X10 de T.
cruzi, provenientes de corridas no sistema de sequenciamento 454 (Roche) foram
alinhadas contra contigs montados a partir delas utilizando o algoritmo BLASTn. O
resultado do BLAST foi analisado, e determinados valores de e-value, identidade do
alinhamento e porcentagem da sequncia presente no alinhamento foram usados como
linhas de corte leituras com valores maiores do que os determinados foram
selecionadas e eliminadas do banco de dados do software.


4.3 CONTRUO DOS VETORES

4.3.1 pNEO2/pHYG2

Os plasmdeos pNEO2 e pHYG2 (Figura 4.1) foram cedidos pelo Dr. Stnio
Perdigo Fragoso, do Laboratrio de Biologia Molecular de Tripanossomatdeos, do
Instituto Carlos Chagas. Ambos foram construdos a partir de inseres por clonagem
clssica no vetor pBluescript, que resultaram em plasmdeos contendo a regio
codificante de um gene de resistncia a antibitico (neo - neomicina fosfotransferase -
ou hyg - higromicina fosfotransferase) flanqueado por duas sequncias distintas obtidas
30

de regies no-codificantes do genoma de T. cruzi, situadas entre os genes que
codificam as protenas enolase (Tc00.1047053511529.90) e KAP3
(Tc00.1047053511529.80) - "IR KAP3", na figura 4.1 - e entre duas cpias do gene que
codifica a enzima GAPDH (Tc00.1047053506943.60 e Tc00.1047053506943.50) - "IR
GAPDH".

Figura 4.1: pNEO2 e pHYG2

Legenda: esquema ilustrando os plasmdeos pNEO2 e pHYG2.

4.3.2 Construo dos vetores para nocaute

A partir do plasmdeo pNEO2, cinco outros vetores foram construdos a partir da
substituio da regio codificante de neo por diferentes genes para seleo de
mutantes: os genes de resistncia puro e blast (que conferem resistncia s drogas
puromicina e blasticidina, respectivamente) e os genes que codiicam para protenas
fluorescentes eGFP (ZHANG, GURTU & KAIN, 1996), E2-Crimson (STRACK et al.,
2009) e VFP (ILAGAN et al., 2010).


4.3.2.1 Obteno de pNEO2 sem inserto

Foi feita a digesto do plasmdeo pNEO2 com as endonucleases de restrio
HindIII e EcoRI (New England Biolabs

), em reaes subsequentes nessa ordem, para


retirar a regio codificante do gene neo. Em ambas as reaes foram utilizadas 20 U de
31

enzima com os respectivos tampes para cada 5 g de plasmdeo, e as reaes foram
mantidas a 37C por 18 horas. Entre as digestes, o produto foi purificado utilizando o
kit QIAquick PCR Purification Kit, da da Qiagen (n. 28104), e eludo com gua, para
no que no pudesse haver interferncia entre os tampes das reaes. Ao final, o
estado da digesto do plasmdeo foi verificado em gel de agarose e foi utilizado o
SOLiD Library Size Selection Gel 2%, da Applied Biosystems, para recuperar apenas
a banda que correspondia ao plasmdeo sem neo. A soluo recuperada foi
concentrada usando ultrafiltrao (ver item 4.4.7.2).

4.3.2.2 Obteno e digesto dos genes marcadores

O plasmdeo pEF.myc.ER-E2-Crimson (contendo o gene E2-Crimson) foi
adquirido atravs do site http://addgene.org; o plasmdeo contendo o gene VFP foi
gentilmente cedido pela Dra. Lynne Regan, da Universidade de Yale; o vetor pTcGFPN
(contendo o gene eGFP) foi desenvolvido em nosso laboratrio dentro da plataforma
TcGW (BATISTA et al., 2010); e pGEM-PURO e pGEM-BLAST (contendo os genes
puro e blast, respectivamente) foram cedidos pelo Dr. Stnio Perdigo Fragoso. Os
genes E2-Crimson, VFP e EGFP foram amplificados por PCR utilizando os pares de
iniciadores E2_FOR e REV, VFP_FOR e REV, e GFP_FOR e REV, respectivamente,
que contm os stios de restrio HindIII (no iniciador antergrado) e EcoRI (no
iniciador retrgrado). As PCRs foram feitas utilizando um mix padro para PCR com
AccuPrime Pfx DNA polimerase, 0,3 ng/L de plasmdio na reao final e as
seguintes condies: 94C por 2 minutos; 35 ciclos de desnaturao (94C por 20
segundos), anelamento (55C por 30 segundos) e extenso (68C por 1 minuto por
kilobase); e uma extenso final por 8 minutos a 68C. Os produtos foram purificados
com o kit QIAquick PCR Purification Kit, da da Qiagen, e submetidos a digestes
consecutivas com HindIII e EcoRI, da forma descrita no item 4.3.2.1. Ao final o produto
foi purificado com o mesmo kit e eludo em gua. Para a obteno dos genes puro e
blast, os plasmdeos pGEM-PURO e pGEM-BLAST foram submetidos s mesmas
reaes descritas no item 4.3.2.1 para pNEO2, porm ao final os insertos (puro e blast,
liberados pela digesto) foram recuperados.
32

4.3.2.3 Ligao dos produtos ao plasmdeo

Utilizando a enzima T4 DNA ligase, da USB

, foi feita uma reao de ligao


com 10 U da enzima no tampo apropriado, 6,5 L do inserto (gene submetido
digesto enzimtica), 0,5 L do plasmdeo e q.s.p. 10 L de H
2
0 ultra pura. A reao foi
incubada por 18 horas a 16C e armazenada a 4C at a transformao.


4.3.2.4 Transformao em bactrias por choque trmico

As ligaes foram transformadas em bactrias Escherichia coli cepa DH5
clcio-competentes por choque trmico. A 100 L de cultura bacteriana em um
microtubo de 1,5 mL foram adicionados 10 L de ligao, e a mistura foi mantida no
gelo por 30 minutos. O tubo foi transferido por 2 minutos para um termobloco a 42C e
rapidamente recolocado no gelo por 2 minutos. 1 mL de meio LB sem antibitico foi
adicionado ao tubo, que foi ento incubado a 37C por uma hora sob agitao.
Alquotas de 100 e 200 L da cultura foram espalhadas com auxlio de alas de
Drigalski estreis em placas de gar LB com o antibitico apropriado (100 g/mL de
ampicilina, no caso dos plasmdeos dos itens 4.3.1 e 4.3.2), e as placas foram
incubadas a 37C.


4.3.2.5 PCR de colnia para seleo de clones

Aps 18 horas a 37C, colnias isoladas da placa so transferidas com o auxilio
de palitos de dente estreis para poos de uma placa de PCR de 96 poos. 20 L de
gua ultrapura so adicionados a cada poo e a placa fervida por 10 minutos. Em
uma nova placa, 1 L do contedo de cada poo da placa anterior adicionado a um
novo poo, contendo tampo padro para PCR com Taq DNA polimerase e iniciadores
que se anelam ao fragmento de DNA clonado, em um volume total de 10 l. As
amostras foram incubadas a 94 C por 3 min e submetidas a 35 ciclos de PCR com as
33

seguintes etapas: 94 C por 30 s, 55 C por 30 s, e 72 C por 1 min para cada
quilobase de amplicon esperado, finalizando com uma etapa de extenso a 72 C por
10 min. Os produtos amplificados foram analisados em gel de agarose 1%, utilizando
brometo de etdio para marcar bandas de DNA. A existncia de banda no tamanho
esperado indica a presena do inserto no plasmdeo.


4.3.2.6 Extrao de DNA plasmidial

Para extrair DNA plasmidial em pequena escala, uma colnia foi inoculada em 2
a 5 mL de meio LB com os antibiticos apropriados a 37C por 18 horas. Lise e
purificao do DNA plasmidial foram feitos utilizando o kit QIAprep Spin Miniprep Kit, da
Qiagen, conforme instrues do fabricante. Para os casos em que foi necessrio
maior quantidade de plasmdio, foi utilizado o kit HiSpeed Plasmid Midi Kit, da
Qiagen, que faz a extrao de DNA plasmidial a partir de 50 a 150 mL de cultura.
Nesses casos, um pr-inculo de uma colnia em 1 mL foi feito, e aps 18 horas de
incubao a 37C, a essa cultura foi adicionado o meio de cultura apropriado em q.s.p.
50-150 mL, e s aps uma nova incubao nas mesmas condies a extrao foi
realizada. O DNA purificado foi armazenado a -20C.


4.3.3 pTcGW-CRE

4.3.3.1 Amplificao e insero de CRE na plataforma Gateway

O gene que codifica a enzima Cre recombinase (STERNBERG & HAMILTON,
1981) foi amplificado a partir do plasmdio pBS185CMV-Cre, obtido do site
http://addgene.org, para insero na plataforma pTcGW (BATISTA et al., 2010). Os
genes foram amplificados a partir do plasmdio, numa reao de 15 L com os
iniciadores CRE_GW_FOR e CRE_GW_REV (10 pmol/L), 0,3 ng/L de plasmdio,
utilizando um mix padro para PCR com AccuPrime Pfx DNA polimerase, e as
seguintes condies: 96C por 2 minutos; 15 ciclos de desnaturao (96C por 30
34

segundos), anelamento (55C por 30 segundos) e extenso (68C por 1 minuto por
quilobase). Utilizando a primeira PCR como molde, feita uma nova reao com os
iniciadores ATTB_F e ATTB_R nas seguintes condies: 96C por 2 minutos; 20 ciclos
de desnaturao (96C por 30 segundos), anelamento (59C por 30 segundos) e
extenso (68C por 1 minuto por quilobase). Os produtos de PCR foram purificados
com QIAquick PCR Purification Kit, da da Qiagen.
Aps purificao, os produtos de PCR foram inseridos no plasmdio comercial
pDONR221 (Invitrogen

). A reao foi feita com 5 microlitros de PCR purificada, 1


microlitro de enzima BP clonase II, 150 ng de plasmdeo pDONR221 e T.E. pH 8 em
q.s.p. 10 L, e foi incubada por 16 horas a 25C, seguido de inativao da enzima pela
adio de 0,5 microlitro de proteinase K e incubao por 10 minutos a 37C. A reao,
ento, foi transformada por choque trmico em bactrias DH5 clcio-competentes, e o
plaqueamento foi feito em LB com 25 g/ml de canamicina.


4.3.3.2 Tcnica de palitagem (toothpick) para seleo dos clones

Aps a incubao da placa, colnias foram coletadas com o auxlio de palitos de
dente estreis e transferidas para tubos de micro-centrfuga. A cada um dos tubos
foram acrescentados 10 l do tampo de lise para toothpick, e foram incubados a 65C
por 10 minutos. As amostras foram analisadas por eletroforese em gel de agarose 1%,
usando o plasmdio pDONR221 como controle negativo, com marcao das bandas de
DNA por brometo de etdio. Os plasmdios dos clones positivos foram purificados como
mencionado anteriormente e mandados para sequenciamento.


4.3.3.3 Insero na plataforma TcGW

Para insero do CRE nos vetores de destinao pTcYFPH, pTcGFPH, pTc6HH
e pTc6HN, da plataforma TcGW, um pool de plasmdeos de 4 clones de pDONR221-
CRE foi feito. As reaes foram feitas separadamente para cada vetor, com 1 L da
enzima LR clonase II, 1 L do pool de plasmdeos, 1 L da soluo com o vetor e T.E.
35

pH 8 em q.s.p. 10 L de reao, e incubadas por 16 horas a 25C, seguido de
inativao da enzima pela adio de 0,5 microlitro de proteinase K e incubao por 10
minutos a 37C. O screening de colnias foi feito por PCR de colnia, como descrito
anteriormente, e foi feito extrao de DNA plasmidial das colnias positivas.


4.4 CONSTRUO DOS CASSETES PARA NOCAUTE

4.4.1 Seleo dos genes

Foram selecionados 4 grupos distintos de genes: da famlia das miosinas, de
funo desconhecida, orotidina-5-fosfato descarboxilase/orotato fosforibosiltransferase
("URA" - Tc00.1047053507059.60) e KU70 (Tc00.1047053503643.10). O grupo de
genes de funo desconhecida foi identificado no Pfam (FINN et al., 2010) atravs dos
domnios de funo desconhecida (domains of unknown function - DUFs); dentre todos
os DUFs existentes nos genes de T. cruzi, foram selecionados os dois presentes no
maior nmero de genes distintos: DUF21 e DUF1126. Os IDs dos genes com os
domnios de funo desconhecida e das miosinas selecionados, assim como o cdigo
utilizado para identific-los neste trabalho, esto descritos na Tabela 4.3.
A partir destes oligonucleotdeos, as regies ao redor da regio codificante do
gene alvo ( montante e jusante) foram amplificadas por PCR. Como molde para
PCR foi utilizado DNA genmico de Trypanosoma cruzi Dm28c, extrado por TELT
(descrito no item 4.5.4.1), na concentrao final de 1 ng/L de reao. A reao foi feita
com Taq DNA Polimerase produzida pelo Instituto de Biologia Molecular do Paran,
oligonucleotdeos sintetizados por The Midland Certified Reagent Company

, e demais
reagentes obtidos da Invitrogen. As concentraes utilizadas dos reagentes so as
descritas em mix padro para PCR com Taq DNA polimerase, no item 4.1.




36

Tabela 4.3: IDs e cdigo utilizado das miosinas e genes de funo desconhecida
selecionados para o estudo
ID CDIGO
DUF21
Tc00.1047053510877.90 A
Tc00.1047053507993.200 B
Tc00.1047053509065.150 E
Tc00.1047053511279.20 F
Tc00.1047053508707.300 I
DUF1126
Tc00.1047053506711.10 C
Tc00.1047053508231.180 D
Tc00.1047053506321.300 G
Tc00.1047053510797.30 H
MIOSINAS
Tc00.1047053510943.190 M1
Tc00.1047053511151.100 M2
Tc00.1047053504103.30 M3
Tc00.1047053509663.10 M4
Tc00.1047053511649.80 M5
Tc00.1047053507093.210 M6
Tc00.1047053511523.30 M7
Tc00.1047053507739.110 M8
Tc00.1047053511527.70 M9
Tc00.1047053508961.70 M10

As reaes foram ento realizadas em termocicladores da marca Biocycler,
usando a seguinte configurao: 4 minutos a 94C, seguido de 35 ciclos de
desnaturao (94C por 30 segundo), anelamento (55C por 30 segundos) e extenso
(72C por 45 segundos), e uma extenso final de 5 minutos (72C). Caso necessrio,
PCRs com produtos de tamanhos variados ou sem amplificao foram repetidas com
alterao de temperatura de anelamento e/ou concentrao de oligonucleotdeos na
reao.

4.4.2 Amplificao dos cassetes marcadores

A partir dos plasmdios construdos anteriormente, reaes de PCR os utilizando
como molde foram feitas para obteno de grande quantidade de cassetes marcadores
37

para o nocaute. Utilizando um iniciador que anela na extremidade 5 da intergnica a
montante do cassete (pNEO2-F) e um iniciador que anela na extremidade 3 da
intergnica a jusante (pNEO2-R), foi feita uma reao contendo entre 0,1 e 0,3 ng/L
de plasmdio, utilizando um mix padro para PCR com AccuPrime Pfx DNA
polimerase, nas seguintes condies: 94C por 2 minutos; 35 ciclos de desnaturao
(94C por 20 segundos), anelamento (55C por 30 segundos) e extenso (68C por 2
minutos); e uma extenso final por 8 minutos a 68C.


4.4.3 Dosagem dos produtos e normalizao das concentraes

A quantificao dos produtos de PCR foi feita usando a plataforma Qubit
Fluorometer (Invitrogen) utilizando o kit Quant-iT dsDNA BR Assay, que usado
para dosar concentraes de DNA entre 0,1 e 1000 ng/L, de acordo com as
instrues do fabricante. A seguir foi calculada a massa-molar e molaridade de cada
uma das amostras. Partindo da aproximao de que 1 pmol de uma molcula de DNA
dupla-fita de 1000 pb tem uma massa de 660 ng, a frmula apresentada abaixo foi
utilizada:

Frmula 4: Clculo da molaridade

M = l x 660

c = p/M

M = massa molecular (Da)
l = comprimento da dupla-fita de DNA, em pares de base
c = molaridade (mol/L)
p = concentrao (g/L)


38

A partir da molaridade, a relao do nmero de molculas de cada amplicon
pode ser ajustada para reaes subsequentes.


4.4.4 Purificao dos produtos

Aps a dosagem, foi feita a purificao dos produtos de PCR (tanto regies
intergnicas quanto genes marcadores) atravs da enzima Exonuclease I de
Escherichia coli (adquirida da New Englands Biolab), que degrada molculas de DNA
fita simples a partir da extremidade 3 livre. Segundo o protocolo descrito por
Kuwayama et al. (2002), a enzima adicionada diretamente PCR em uma proporo
de 1 L de enzima (20 U) para cada 10 L de reao (volume final de 11 L a ~1,8
U/L). A reao incubada primeiro a 37C por 40 minutos, seguido da inativao da
enzima a 80C por 30 minutos. No feita nenhuma purificao adicional da PCR,
estando esta pronta para ser usada em reaes subsequentes.


4.4.5 PCR de fuso


Foi feita uma reao de PCR de 20 ciclos para juno das regies intergnicas
ao redor do gene alvo e do cassete de seleo, sem adio de oligonucleotdeos ou
DNA genmico. O produto de PCR do cassete de seleo foi adicionado a uma
concentrao final de 0,5 ng/L na reao, e os demais fragmentos foram adicionados
utilizando uma relao de nmero de molculas de 5:5:1 ou 10:10:1 dos produtos de
PCR da intergnica 5', da intergnica 3' e do cassete de seleo, respectivamente. As
concentraes utilizadas dos demais reagentes (dNTP, MgCL
2
, Taq DNA polimerase e
tampo de reao) so as descritas para o mix padro para PCR com Taq DNA
polimerase, no item 4.1, e as configuraes para o termociclador foram as seguintes:
94C por 2 minutos; 20 ciclos de desnaturao (94C por 30 segundos), anelamento
39

(50C por 30 segundos) e extenso (72C por 3 minutos); e uma extenso final de 10
minutos a 72C.
Para obter grande quantidade de massa do produto fusionado, uma nova reao
de PCR foi feita utilizando 1 L da primeira reao como template em 50 L de uma
reao nova, os iniciadores antergrados da regio intergnica 5 e os iniciadores
retrgrados da regio intergnica 3, e com as seguintes configuraes para o
termociclador: 94C por 2 minutos; 20 ciclos de desnaturao (94C por 30 segundos),
anelamento (65C por 30 segundos) e extenso (72C por 5 minutos); e extenso final
de 10 minutos a 72C. Os demais reagentes foram utilizados nas mesmas
concentraes da PCR anterior, e os iniciadores foram adicionados no dobro da
concentrao descrita para o mix padro para PCR com Taq DNA polimerase. Caso a
amplificao ocorra corretamente, a PCR repetida para se obter aproximadamente
1mL em diversas reaes com 100 L de volume final.


4.4.6 Purificao e concentrao do material

O material total produzido pela PCR de fuso (~1 mL) foi concentrado usando
duas tcnicas distintas: precipitao de DNA por etanol e ultrafiltrao.

4.4.6.1 Precipitao de DNA por etanol

Na precipitao de DNA por etanol, ao material foram adicionados 3 volumes de
etanol absoluto a -20C e 10% do volume de acetato de sdio 3M pH 6, e o material foi
deixado por 30 minutos em gelo seco (-78C). A seguir, foi centrifugado por 10 minutos
a 13.000 g e o sobrenadante foi descartado. O precipitado de DNA foi lavado com
etanol 70% a -20C (adio de 1 mL de etanol 70% por microtubo, 1 minuto de
centrifugao a 13.000 g e descarte do sobrenadante) e deixado a temperatura
ambiente para secar. Por fim, o pellet seco foi rehidratado com gua ultra pura, sua
concentrao de DNA aferida no Qubit Fluorometer (como descrito no item 4.4.4) e
mantido congelado a -20C.

40

4.4.6.2 Ultrafiltrao

A concentrao por ultrafiltrao foi feita utilizando colunas Amicon Ultra-0,5 mL
30K, da Millipore

, seguindo instrues do fabricante com adaptaes:


- para filtrao foram sempre utilizados 12 minutos de centrifugao;
- o protocolo era repetido utilizando a mesma coluna, 500 L de material por vez,
at que todo o volume tivesse passado pelo filtro.
Aps a recuperao, o volume do ultrafiltrado era ajustado com gua ultra pura
para 50 L, sua concentrao de DNA aferida no Qubit Fluorometer (como descrito
no item 4.4.4) e mantido congelado a -20C.


4.5 CULTIVO DE PARASITAS

4.5.1 Cultivo dos parasitas em meio axnico

As culturas axnicas de formas epimastigotas de T. cruzi Dm28c (CONTRERAS
et al., 1988) foram mantidas a 28C em meio LIT. Para obteno de parasitas em fase
logartmica de crescimento, eram realizados repiques a cada trs dias, partindo de um
inculo de 1 x 10
6
parasitas/mL de meio de cultura, e a coleta era feita no terceiro dia,
quando a densidade celular se encontrava entre 2 e 3 x 10
7
clulas/mL.


4.5.2 Eletroporao

A transfeco dos parasitas foi feita pela tcnica de eletroporao, usando o
equipamento GenePulser

Apparatus e cubetas estreis de eletroporao Gene


Pulser/Micro Pulser

0,2 cm, ambos da Bio-Rad. A partir de uma cultura de T. cruzi em


meio LIT em fase logartmica de crescimento, um pellet com 5x10
8
parasitas obtido
por centrifugao (4.000g a 4C), as clulas so lavadas uma vez e ressuspendidas no
tampo de eletroporao para T. cruzi estril.
41

A cada cubeta de eletroporao, previamente resfriada a 4C, so adicionados
400 L da suspenso de parasita, junto a 50 L da soluo com DNA obtida
anteriormente (exceto para o controle negativo da transfeco), e a cubeta colocada
no gelo por 10 minutos. Com as configuraes de 500 F e 450 volts, dois pulsos
seguidos so dados no eletroporador em cada cubeta, e a suspenso de parasitas
ento inoculada em 10 mL de meio LIT suplementado com 10.000 U de penicilina e
estreptomicina a 10 g/ml, para prevenir a proliferao de bactrias.


4.5.3 Seleo dos mutantes

4.5.3.1 G418

Para os nocautes em que o gene neo (neomicina fosfotransferase) foi utilizado
como marcador da integrao (cassete do pNEO2), a droga G418 foi adicionada
cultura 24 horas aps a transfeco, numa concentrao final de 500 g/mL. Entre 3 e
4 dias aps a transfeco foi feito o primeiro repique, com 2,5 mL da cultura em 7,5 mL
de meio LIT estril com a mesma concentrao de droga. A partir da foram feitos
repiques semanais na proporo de 1/10 v/v (1 mL da cultura anterior adicionado em 9
mL de meio novo com G418), at que no se observasse mais crescimento nos dois
ltimos repiques da cultura do controle negativo da transfeco. Nesse ponto, a
concentrao final de G418 no meio foi reduzida para 250 g/mL, o DNA genmico foi
extrado para anlise e amostras da cultura foram armazenadas em nitrognio lquido
para o caso de serem necessrias futuramente.

4.5.3.2 Cell sorting

Para os nocautes utilizando GFP como gene marcador, o citmetro de fluxo
FACSAria II, da BD Biosciences, foi utilizado para analisar a cultura e selecionar os
parasitas (por cell sorting) com maior probabilidade de estarem expressando a protena
fluorescente.
42

A partir de uma cultura em fase exponencial de crescimento, entre 5x10
7
e 1x10
8

parasitas foram separados do meio por centrifugao (3.000 g) e lavados com 10 mL
de tampo PBS estril contendo penicilina, estreptomicina e gentamicina. Aps nova
centrifugao a 3.000 g, o sobrenadante foi descartado, os parasitas ressuspendidos
novamente em tampo de lavagem estril, a uma concentrao final de 1x10
7

clulas/mL, e a suspenso levada para ser analisada no citmetro de fluxo.
A partir desse ponto, duas metodologias distintas foram utilizadas, aqui
denominadas de estratgia de clonagem e enriquecimento de clulas fluorescentes.


4.5.3.2.1 Estratgia de clonagem

Em 24 e 48 horas aps a transfeco, culturas transfectadas com eGFP e uma
cultura submetida ao eletroporador sem adio de DNA (controle negativo) foram
analisadas por citometria. Dentre a populao identificada por tamanho e
granulosidade como epimastigotas de Trypanosoma cruzi, foram selecionados para cell
sorting os eventos que apresentassem fluorescncia verde maior que a maior
fluorescncia verde observada em 100 mil eventos do controle negativo (aqui
denominados de eventos positivos). Dessa subpopulao, foi feito sorting de uma
clula por poo em placa de 96 poos contendo meio LIT, com os antibiticos
penicilina, estreptomicina e gentamicina. De 24 a 96 clulas por cultura foram
selecionadas, dependendo da frequncia de eventos positivos na populao.
Aps 2 a 3 semanas de incubao da cultura a 28C possvel observar
turbidez, indicando crescimento do clone isolado. As culturas com crescimento visvel
foram, ento, preparadas para anlise por microscopia de fluorescncia e citometria de
fluxo, de acordo com metodologia descrita no item 4.4.7.


4.5.3.2.2 Enriquecimento de clulas fluorescentes

Aps 48 horas da transfeco, culturas transfectadas com eGFP e uma cultura
submetida ao eletroporador sem adio de DNA (controle negativo) foram analisadas
43

por citometria. Dentre a populao identificada por tamanho e granulosidade como
epimastigotas de Trypanosoma cruzi, uma subpopulao com tamanho inferior
mediana foi selecionada, e dentre esse eventos, os 5% mais fluorescentes foram
selecionados para cell sorting (aqui denominados de eventos positivos). Dentre os
eventos positivos, foi feito sorting de 1x10
5
clulas por poo em placa de 24 poos
contendo 1 mL de meio LIT, com os antibiticos penicilina, estreptomicina e
gentamicina (para diminuir a chance de contaminao bacteriana). Foram feitos dois
poos por transfectante (para todos eles, incluindo o controle negativo): um contendo
os eventos positivos e outro contendo 1x10
5
clulas da subpopulao de tamanho
menor, mencionada anteriormente, como controle negativo do enriquecimento de
clulas fluorescentes.
Para verificao da pureza do cell sorting, foi feito sorting das populaes
positivas em poos vazios, e essa amostra foi imediatamente analisada no citmetro de
fluxo. Os resultados dessa anlise (denominada ps-sorting) foram comparados com
os dados da populao pr-sorting atravs de grficos gerados pelo software FlowJo.
O cell sorting para enriquecimento foi repetido uma vez por semana durante
quatro semanas aps a transfeco.

4.5.4 Extrao e purificao de DNA genmico de T. cruzi

4.5.4.1 TELT

Formas epimastigotas de T. cruzi Dm28c (1x10
7
) em fase logartmica de
crescimento foram coletadas por centrifugao a 7.000 x g por 5 min, lavadas em PBS
e ressuspendidas em 350 l de tampo TELT. Aps 5 minutos de incubao
temperatura ambiente foi adicionado um volume de fenol/clorofrmio e o material foi
centrifugado a 13.000 x g por 5 min. Essa etapa foi repetida at que a amostra
estivesse lmpida. A seguir, a fase aquosa foi recolhida, o DNA precipitado com 2
volumes de etanol absoluto e coletado por centrifugao a 13.000 x g por 10 minutos.
O pellet de DNA presente foi ento lavado com etanol 70%, seco e ressuspendido em
tampo TE contendo RNAse a 20 g/ml (MEDINA-ACOSTA & CROSS, 1993). A
soluo obtida foi conservada a 4C.
44


4.5.4.2 Por ligao a membrana de silica-gel

O kit DNeasy Plant Mini Kit, da Qiagen

foi utilizado para extrao de DNA


genmico de T. cruzi, de acordo com instrues do fabricante com adaptaes:
- Pela ausncia de necessidade de desfazer tecido, partiu-se diretamente da
etapa de lise celular; e
- Ao invs de utilizar massa de clulas como medida, foram utilizadas entre 1 e
3x10
8
clulas lavadas em PBS por coluna.
A soluo obtida foi mantida em TE a 4C.

4.5.5 Criopreservao dos parasitas

Para preservar cepas mutantes de T. cruzi, 400 L de culturas em fase
logartmica de crescimento foram transferidos para criotubos estreis, junto com 500 L
de soro fetal bovino, obtido da BD Biosciences, e 100 L de glicerol, ambos estreis.
Os criotubos foram deixados por 2 horas a -20C, depois mantidos por 18 horas a -
70C, e finalmente armazenados em nitrognio lquido (-196C).
Para recuperao das culturas congeladas, os tubos foram rapidamente
descongelados em banho-maria a 37C e transferidos para estufas a 28C. O
transporte a partir dos freezers foi feito em gelo-seco. Depois de descongelados, todo o
contedo de cada tubo (1 mL) foi transferido para garrafas com 10 mL de meio LIT
suplementado com 10.000 U de penicilina e estreptomicina a 10 g/mL, que foram
ento incubadas a 28C. Aps 24 horas de incubao foi adicionado G418 s culturas
(250 g/mL), e aps 3 a 4 dias (dependendo da turbidez do meio) foi feita a primeira
passagem, seguindo o protocolo descrito no item 4.5.1.

4.5.6 Curvas de crescimento

Formas epimastigotas de Trypanosoma cruzi foram inoculadas em meio LIT a
uma densidade celular de 1x10
6
clulas/mL a 28C. Diariamente, alquotas foram
retiradas e a quantidade de clulas por mL aferida no contador automtico de clulas
45

Beckamn/Coulter

at que as culturas atingissem a fase estacionria de crescimento.


Os valores por dia por cultura foram utilizados para gerar grficos comparativos das
curvas de crescimento entre as diferentes culturas.


4.5.6.1 Anlise de sensibilidade ao 5-FOA

Foram feitas curvas de crescimento, seguindo o protocolo descrito em 4.5.6,
utilizando formas epimastigotas de T. cruzi Dm28c em LIT contendo diferentes
concentraes de cido 5-fluoroortico (5-FOA), obtido da Gibco

, diludo em DMSO.
Tendo como base ensaios em Trypanosoma brucei (SCAHILL, PASTAR & CROSS,
2008), foram utilizadas as concentraes de 1, 2,5, 5, 10 e 50 g/mL de 5-FOA. Testes
com concentraes de 10, 50 e 500 g/mL tambm foram feitos utilizando o meio
quimicamente definido HX25M (AZEVEDO, DE & ROITMAN, 1977) suplementado com
10 M de putrescina (DE PAULA LIMA et al., em preparao). Em todos os testes
foram utilizadas culturas sem adio de droga e apenas com a adio de DMSO como
controles negativos.

4.5.7 Anlise de fluorescncia

4.5.7.1 Microscopia

Uma lmina com oito campos limitados por teflon foi preparada pela adio de
20 l de poli-L-lisina por campo, seguido de incubao a 37C por dez minutos. Aps
este perodo, as lminas foram lavadas com gua ultra-pura e secas na estufa a 37C
por mais 10 minutos.
A partir de culturas de T. cruzi em fase de crescimento exponencial, 1x10
6
parasitas de cada cultura a ser analisada foram separados por centrifugao (4.000 g
por 5 minutos), lavados, ressuspensos em PBS e adicionados aos campos de placas
previamente preparadas. Aps, foram adicionados 30 l de paraformaldedo a cada
poo e as placas foram incubadas por 5 a 10 minutos temperatura ambiente para a
fixao dos parasitas. Aps, o paraformaldedo foi descartado e a lmina foi lavada
46

com PBS 1x. Realizada a lavagem, foi adicionado a cada campo 10 l de n-propil-
galato e as lminas foram lacradas utilizando lamnula de microscopia e selador
(esmalte).
As lminas foram observadas ao microscpio de fluorescncia (Nikon), e a
presena ou ausncia de fluorescncia foi verificada por comparao a parasitas
sabidamente no-fluorescentes.

4.5.7.2 Citometria de fluxo

A anlise de fluorescncia por citometria foi realizada em um citmetro de fluxo
FACSAria II, da BD Biosciences. A partir de cultura de T. cruzi em fase de crescimento
exponencial, 1x10
6
parasitas foram separados por centrifugao (4.000 g por 5
minutos), lavados com 2 mL de PBS, centrifugados novamente e ressupendidos em 1
mL de PBS. A suspenso foi transferida para um tubo de ensaio de 10 mL compatvel
com o equipamento e a amostra foi analisada no citmetro. Uma cultura sem protena
fluorescente exgena foi usada como controle negativo, para que pudesse ser traado
o padro de fluorescncia natural do parasita para a frequncia determinada. A partir
desse dado, s populaes com intensidade de fluorescncia maior do que a
observada para o controle foram consideradas positivas para fluorescncia.


47

5 RESULTADOS


5.1 PROGRAMA DE PREDIO DE PRIMERS PARA NOCAUTE

O software TcruziKO (disponvel em http://omics.icc.fiocruz.br/TcruziKO) foi
construdo com o objetivo de desenhar iniciadores de PCR de alta qualidade
automaticamente para a construo de ferramentas para modificao genmica por
recombinao homloga em Trypanosoma cruzi. Oligonucleotdeos podem ser gerados
para 3 tipos de edio de sequncia em um gene especfico: substituio gnica,
disrupo (ruptura) gnica e insero de etiquetas (gene tagging). Em todos os casos
so gerados 2 pares de iniciadores: para a substituio gnica (1) so gerados
iniciadores que amplificam regies ao redor da regio codificante do gene alvo, que
depois podero ser unidas a um gene ou cassete marcador que ir entrar no lugar da
CDS do gene selecionado; para a ruptura gnica (2), os iniciadores so desenhados de
forma que os amplicons preditos contenham parte da CDS alvo, causando uma quebra
na sua sequncia aps a insero; e na insero de etiquetas (3) os dois pares de
iniciadores so desenhados flanqueando uma das extremidades da regio codificante
do gene, de forma que no haja espao entre os dois amplicons preditos, para que
nenhuma sequncia do genoma seja perdida aps a insero.
Para aumentar a qualidade e a eficincia dos iniciadores, foram implementadas
duas estratgias:
- Atravs do algoritmo BLASTn (ALTSCHUL et al., 1990), regies conservadas
entre o genoma referncia utilizado para Trypanosoma cruzi (CL Brener) (EL-SAYED et
al., 2005a) e um dos outros genomas disponveis - Sylvio X10 (FRANZN et al., 2011),
CL14 e Dm28c - so identificadas. O contig ou leitura do clone selecionado que melhor
alinhar contra a regio que ser utilizada para o desenho de primers no genoma
referncia (regies intergnicas a montante e a jusante, CDS do gene alvo ou de genes
flanqueantes) selecionado, e regies identificadas pelo alinhamento como sendo no-
idnticas so mascaradas. Como consequncia, apenas regies conservadas entre os
genomas selecionados so levadas em considerao para predio de iniciadores;
48

- Para selecionar o melhor par de iniciadores de PCR, o software Primer3
(ROZEN & SKALETSKY, 2000) utilizado para gerar todos os oligonucleotdeos que
podem ser feitos a partir das sequncias providas e selecionar o melhor par, levando
em considerao os seguintes parmetros: tamanho dos oligos e do amplicon predito;
Tm e contedo GC mnimo e mximo; e tendncia de formao de dmeros, hairpin ou
de ligao entre os iniciadores do par. Todos os oligonucletdeos que tiverem algum
parmetro fora dos limites estabelecido so descartados, e os demais so
apresentados ao usurio ordenados de acordo com a pontuao obtida - quanto mais
prximo do ideal, maior a pontuao do par.
Como descrito na te;







49

Figura 5.1, o programa inicia na aba "Run Analysis", direita no menu da pgina inicial,
onde feita a insero dos dados pelo usurio relativos anlise que ser realizada (


50

Figura 5.2). Alm do ID do gene, so selecionados os genomas que sero alinhados ao
de CL Brener e os parmetros do alinhamento. A partir dessas informaes, uma srie
de passos so executados pelo software:
- Alm de informaes gerais do gene selecionado (como descrio, tamanho,
posies de incio e de fim no cromossomo), sequncia e posio dos genes do
cromossomo onde se encontra o gene selecionado so recuperados do banco de
dados. Uma subsequncia compreendendo do primeiro nucleotdeo da regio
codificante do gene situado imediatamente a montante do gene alvo ao ltimo
nucleotdeo do gene imediatamente a jusante extrada;
- Essa subsequncia , ento, alinhada contra todas as sequncias genmicas
selecionadas (contigs e/ou leituras das cepas), previamente organizadas em um banco
de dados local, usando BLASTn, e o resultado analisado automaticamente;







51

Figura 5.1: Fluxograma geral do software TcruziKO




52

Figura 5.2 Pgina para insero de dados para anlise - TcruziKO


- Essa subsequncia , ento, alinhada contra todas as sequncias genmicas
selecionadas (contigs e/ou leituras oriundos das cepas selecionadas), previamente
organizadas em um banco de dados local, usando BLASTn, e o resultado analisado
automaticamente;
- Com as informaes extradas do resultado do BLAST gerada uma imagem
representando o contexto genmico do gene alvo, todos os contigs alinhados nas
posies em relao subsequncia extrada, e um grfico representando a cobertura
das leituras mapeadas na regio (Figura 5.3A) apresentada ao usurio na prxima
pgina, junto s informaes gerais sobre o gene.




53

Figura 5.3: Pgina com cobertura de reads e contigs para a regio selecionada -
TcruziKO
A

B

Legenda: A: resultado com a cobertura de reads e contigs para a regio do gene selecionado.
B: histograma relacionando nmero normalizado de reads/gene pelo nmero de genes, apresentado
junta a imagem A. A linha vertical em azul indica onde o gene em questo se encontra na distribuio.

Alm de verificar a cobertura de leituras e contigs das cepas selecionadas da
regio (que essencial, pois dela depende o desenho de iniciadores), os alinhamentos
podem ser visualizados em detalhe no formato padro do BLAST, como exemplificado
direita da Figura 5.3A. Tambm disponibilizado um grfico comparando a cobertura
54

de leituras do gene selecionado com a de todos os genes da cepa CL Brener (Figura
5.3B), a fim de fornecer informaes ao usurio que permitam uma estimativa do
nmero de cpias do gene no genoma (discutido em detalhes no item 5.1.1).
Na parte de baixo da pgina esto os formulrios onde devem ser inseridas
informaes para customizao do desenho de iniciadores para nocaute gnico,
disrupo gnica ou insero de etiquetas (
Figura 5.4). Alm de opes gerais, como permitir que o programa utilize leituras,
alm de contigs, para a predio de iniciadores (primeira caixa de seleo de cada
formulrio), existem parmetros diferentes para cada tcnica, e estes so explicados
detalhadamente na sequncia:

Figura 5.4: Formulrios para insero de
parmetros para desenho dos iniciadores

Legenda: cada box um formulrio para insero de parmetro para
predio de iniciadores para cada metodologia distinta.
A
B
C
55

- nocaute gnico (Figura 5.4A): por definio, o programa est configurado para
desenhar iniciadores apenas nas regies intergnicas; porm isso pode ser alterado
selecionando uma das outras opes na primeira coluna da tabela. Isso permitir ao
programa desenhar iniciadores ou na regio codificante do gene alvo ou nos genes
flanqueantes, alm de tambm utilizar as regies intergnicas. Na coluna da direita
existem dois parmetros (PCR product min. size e PCR product max. size) que
controlam as distncias mnima e mxima entre os iniciadores dos pares que sero
desenhados. No entanto, a distncia mxima real fica sendo determinada como o valor
estipulado ou o tamanho da regio selecionada para predio (regies intergnicas, por
exemplo) - o que for menor -, e o algoritmo sempre tentar desenhar um par de
iniciadores com a maior distncia possvel entre eles, resultando no maior produto
possvel. O ltimo parmetro da coluna da direita define a distncia mxima entre o
amplicon predito e a regio codificante do gene alvo, o que particularmente
importante em regies do cromossomo com longas regies intergnicas ou com falhas
de sequenciamento.
- disrupo gnica (Figura 5.4B): ao contrrio do nocaute gnico, na disrupo
o algoritmo por definio desenhar os iniciadores apenas dentro da CDS do gene. Se
isso no for o desejado, o usurio pode marcar a caixa de seleo logo acima da tabela
para informar ao programa que regies alm da CDS (incluindo outros genes) tambm
esto inclusas. Alm dos parmetros de tamanho mnimo e mximo, que funcionam da
mesma forma descrita para nocaute, o ltimo parmetro da tabela define a
porcentagem do gene que deve estar inclusa nos produtos de PCR preditos, que
representa porcentagem do gene que permanecer no cromossomo aps a
recombinao;
- insero de etiquetas (Figura 5.4C): alm dos limites de tamanho, como j foi
mencionado anteriormente, na primeira coluna da tabela h dois botes de opo, para
definir se o desenho dos iniciadores ser feito na extremidade 5 (N-terminal tag) ou 3
(C-terminal tag) da CDS do gene alvo.
Aps a submisso dos dados pelo boto Run Primer3 (em qualquer uma das
trs opes), feita uma anlise preliminar de todas os alinhamentos encontrados, e
estes so classificados e agrupados de acordo com a sua posio em relao CDS
56

do gene alvo, regies intergnicas e CDSs dos genes flanqueantes. Independente da
tcnica selecionada, apenas o alinhamento de melhor qualidade e que melhor cobrir a
regio na qual ser feito o desenho de iniciadores ser utilizado para identificar regies
conservadas e no-conservadas entre as cepas - essa anlise preliminar feita para
diminuir o nmero de alinhamentos que tero que ser avaliados posteriormente.
Para o nocaute gnico, toda a parte de desenho dos iniciadores feita
separadamente para cada uma das intergnicas, seguindo uma srie de passos:
- seleo de alinhamento representativo: so selecionados os grupos de
alinhamentos localizados total ou parcialmente na regio intergnica em questo, e
estes so avaliados de acordo com a porcentagem de cobertura. Se houver
alinhamentos que englobem a regio intergnica inteira, s estes so avaliados, e o
alinhamento com maior score selecionado; caso contrrio, a anlise passa para os
alinhamentos com cobertura parcial, e o com maior cobertura ou, em caso de empate,
com maior score selecionado. Ao fim de todo o processo, caso o algoritmo no tenha
sido capaz de selecionar um alinhamento, a predio para a intergnica em questo
encerrada e gerada uma mensagem de erro;
- tratamento de regies no-conservadas: para garantir que os iniciadores
sejam desenhados em regies conservadas entre a cepa selecionada e CL Brener,
regies acusadas pelo alinhamento como no conservadas e regies no cobertas pelo
alinhamento so mascaradas. Para isso, o alinhamento parseado, a sequncia de CL
Brener presente no alinhamento extrada e modificada pela substituio de regies
no-idnticas (mismatches) ou de insero/deleo (gaps) por Ns. Nucleotdeos em
regies da sequncia original que estejam fora do alinhamento tambm so
substitudos por Ns, que so interpretados pelo Primer3 como sendo regies de baixa
qualidade que no devem ser utilizadas para o desenho de oligonucleotdeos;
- tratamento de regies de sobreposio com CDS: se no houver nenhuma
restrio, toda a regio includa no alinhamento ser considerada para o desenho de
iniciadores - inclusive regies codificantes. De acordo com a opo selecionada no
formulrio, regies codificantes so identificadas (do gene alvo e flanqueantes, s do
gene alvo ou s flanqueantes) dentro do alinhamento e mascaradas, para restringir a
regio que ser utilizada pelo Primer3 para predio;
57

- ajuste final do tamanho da regio de predio: na ltima etapa antes da
execuo do Primer3, o tamanho da regio comparado com os dois limites de
tamanho estabelecidos. Se a regio for menor do que o tamanho mnimo, a predio
encerrada e uma mensagem de erro gerada; se for maior do que o tamanho mximo,
a regio de predio cortada na extremidade oposta a do gene, para que os pares de
iniciadores gerados estejam mais prximos do gene alvo; e
- predio de iniciadores: a sequncia com as regies mascaradas, os limites
da regio em que os iniciadores devem ser preditos e o tamanho do amplicon so
passados ao Primer3. A informao de tamanho passada como um intervalo entre
dois valores, dentro dos quais a distncia entre os iniciadores do par gerado devem
estar. Esse intervalo passado inicialmente como sendo do tamanho mximo real
(depois dos ajustes descritos acima) menos 50 pb at o tamanho mximo real - por
exemplo, se o tamanho mximo for de 450 pb, o intervalo passado como de 400 a
450 pares de base. Caso o Primer3 no tenha conseguido gerar um par de qualidade
nesse intervalo, o limite inferior reduzido em 10 pares de base (390 a 450 pb, no
exemplo acima), e isso repetido at que: (1) sejam preditos pares de iniciadores com
qualidade pelo Primer3, ou (2) o limite inferior se torne menor do que o tamanho
mnimo previamente estipulado. No primeiro caso, os pares de iniciadores gerados,
bem como toda a informao relativa qualidade deles (tamanho, Tm, contedo GC,
tendncia a anelar com si mesmo ou com o outro iniciador do par) armazenada pelo
software e apresentada futuramente ao usurio; enquanto no segundo caso, a predio
encerrada e uma mensagem de erro gerada.
A lgica para a predio de iniciadores para as outras tcnicas basicamente a
mesma, porm com algumas modificaes: na disrupo (1) a seleo do alinhamento
feita com base na cobertura da CDS do gene alvo, e no nas intergnicas; (2) as
regies mascaradas so as regies intergnicas, a no ser que tenha sido permitido o
seu uso pelo usurio; e (3) a CDS do gene alvo divida ao meio, aps o
mascaramento das regies no-conservadas, e um par de iniciadores feito para cada
metade (na predio para o par da direita, a metade esquerda est mascarada, e vice-
versa); enquanto na insero de etiquetas (1) so avaliados os alinhamentos
localizados na extremidade em que ser feita a insero da etiqueta, e estes so
58

avaliados pela cobertura tanto do gene quanto da regio intergnica adjacente; (2)
alm dos nucleotdeos no-conservados, nenhuma regio mascarada - a restrio de
regio existe para os iniciadores adjacentes ao limite entre o gene e a regio
intergnica (um de cada par), que tem sua extremidade 5 fixada extremidade do
gene; e (3) devido restrio da posio de alguns dos iniciadores, parmetros menos
restritivos so passados ao Primer3 para aumentar a taxa de sucesso de predio.
Os iniciadores gerados por qualquer uma das tcnicas so submetidos a
alinhamento pelo BLASTn contra a sequncia original do loco do gene alvo, e a
imagem desse alinhamento apresentada ao usario na pgina de resultados (junto
com todos os dados dos iniciadores gerados anteriormente), para ilustrar onde os
iniciadores devero se anelar na PCR (
59

Figura 5.5).
Para organizar todos os dados necessrios para o funcionamento do software
TcruziKO, dois bancos de dados foram implementados: um banco de dados de
arquivos fasta e um relacional.
O banco de dados de arquivos fasta contm a informao de sequenciamento
disponvel dos genomas das cepas CL14 (41.372 contigs), Sylvio X10 (1.688.475
leituras e 7.455 contigs) e Dm28c (5.789.962 leituras e 32.761 contigs), totalizando 7,3
GB de dados. Esses arquivos so utilizados exclusivamente pelo BLAST, para anlise
de conservao entre cepas, e para isso so armazenados no formato gerado pela
ferramenta formatdb, do pacote de softwares do BLAST. As sequncias das cepas
CL14 e Dm28c foram cedidas pelo Laboratrio Nacional de Cincia da Computao -
LNCC, e as sequncias de Sylvio X10 foram cedidas pelo Dr. Bjrn Andersson, do
Instituto Karolinska.
O banco de dados relacional, implementado em PostgreSQL, contm
informaes extradas do banco de dados TriTrypDB (ASLETT et al., 2010) sobre a
cepa CL Brener. Alm das sequncias dos contigs e informaes bsicas sobre os
genes anotados (mostradas ao usurio na primeira tela de resultados), relaes de
semelhana de sequncia entre os genes esto presentes na forma de conjuntos de
genes parlogos ou alelos (aqui denominados "supragenes") - identificados por alinha-

60

Figura 5.5: Resultado das predies dos 3 tipos de anlise
existentes para o mesmo gene



Legenda: resultados da predio de primers para o mesmo gene
para nocaute (A), disrupo (B) e insero de etiqueta (C).
A
B
C
61

mentos mltiplos e BLAST (PAVONI, PROBST et al., em preparao). Todos os dados
relacionados ao mapeamento de leituras para a estimativa do nmero de cpias
gnicas (discutida no item 5.1.1) tambm esto presentes no banco de dados. Um
esquema do banco de dados est representado na

Figura 5.6.


Figura 5.6: Esquema do banco de dados relacional

Legenda: gene: possui informaes gerais da anotao de cada gene e localizao no genoma;
chromosome: onde todas as sequncias esto armazenadas,a partir das quais subsequncias
dos genes so extradas; supragene: tabela relacionando genes a grupos de genes parlogos;
mapping_454: informaes especficas para cada gene dos mapeamentos feitos para
estimativa do nmero de cpias gnicas; e mapping_general_info: informaes gerais de cada
mapeamento feita, incluindo parmetros usados para o algoritmo e dados gerais da distribuio.

5.1.1 Estimativa do nmero de cpias gnicas

62

A partir da anlise do mapeamento das reads do sequenciamento de T. cruzi
Dm28c em todos os genes da cepa CL Brener, foi gerado um histograma relacionando
o nmero normalizado de leituras/gene com o nmero de genes (Figura 5.7).
Figura 5.7: Histograma representando o mapeamento normalizado

Legenda: o histograma foi feito com uma tamanho de intervalo (bin size) de 1 read/kb,
relacionando o nmero de reads mapeadas (eixo X) pelo nmero de genes em cada
intervalo (eixo Y). Foi aplicado um smoothing retangular para melhorar a visualizao.


Utilizando 1000 pb como valor de tamanho para normalizao, a mdia de
mapeamentos por gene por kb foi de 557,2, com um desvio padro de 1.866,8, e a
moda ficou em 105. Tendo como base a moda, e partindo do pressuposto de que a
maioria dos genes em Trypanosoma cruzi so cpia nica, a distribuio foi dividida em
classes com o tamanho da moda, centradas ao redor de mltiplos da moda (classe 1
ao redor de 105, 2 ao redor de 210, 3 ao redor de 315, etc). Pela classe na qual o gene
se encontra, possvel ter uma idia aproximada do provvel nmero de cpias do
gene no genoma: um gene com 100 mapeamentos normalizados, por exemplo, muito
provavelmente cpia nica, enquanto um gene com 450 mapeamentos (classe 4 -
63

367,5 a 472,5 mapeamentos), provavelmente tenha entre 3 e 5 cpias no genoma.
importante, no entanto, que essa informao seja analisada cuidadosamente, como
ser discutido no item 6.


5.1.2 Anlise da eficincia de predio de oligonucleotdeos


Para o teste de eficincia do software, o script de teste automatizado foi
executado tendo como lista de entrada todos os genes que esto anotados como
codificadores de protena no genoma de T. cruzi cepa CL Brener (n = 23.311).
Utilizando os valores de 10
-100
e 500 como linhas de corte de e-value e score,
respectivamente, e os contigs montados de Trypanosoma cruzi clone Dm28c para
comparao, o programa foi executado com diferentes valores para tamanho mnimo
de produto de PCR. O teste foi feito, tambm, tendo como base os supragenes
(conjuntos de parlogos) ao invs dos genes; para isso foram analisados e
considerados os melhores resultados dentro de cada supragene (por exemplo,
havendo um para foram desenhados genes para as duas intergnicas, o sucesso foi
considerado para o supragene como um todo), e a porcentagem de sucesso foi
indicada em relao ao nmero total de supragenes (Tabela 5.1, linha "Supragenes X
Contigs").
A eficincia de predio foi testada tambm contra uma amostra menor dos
genes anotados (n = 1.000), incluindo apenas genes cpia nica (2 alelos), e afastados
de extremidades de contigs e de falhas de sequenciamento. Para esses genes, alm
das anlises com apenas os contigs, o programa foi executado incluindo as leituras de
sequenciamento de Dm28c, em todas as condies mencionadas anteriormente.
Devido ao tamanho menor das leituras, em comparao aos contigs, as linhas de corte
de e-value e de score foram alterados para 10
-50
e 300, respectivamente. Os resultados
dos testes dos 1.000 genes utilizando contigs e leituras, bem como dos testes com
todos os genes, esto na Tabela 5.1.


64






Tabela 5.1: Resultado dos testes de predio automatizada de iniciadores
Tamanho mnimo 200 pb 250 pb 300 pb 400 pb
Sucesso Completo Parcial Completo Parcial Completo Parcial Completo Parcial
Genes X Contigs 45,6% 42,1% 37,7% 44,8% 29,8% 46,4% 19,4% 44,5%
Supragenes X Contigs 60,3% 33,8% 49,4% 40,1% 39,4% 44,7% 25,6% 46,1%
Subset X Contigs 53,4% 37,8% 39,6% 45,7% 31,5% 45,2% 19,0% 41,9%
Subset X Leituras+Contigs 64,6% 30,3% 51,0% 38,1% 41,1% 41,8% 24,9% 42,1%

Tamanho mnimo 500 pb 750 pb 1000 pb

Sucesso Completo Parcial Completo Parcial Completo Parcial

Genes X Contigs 13,1% 40,1% 6,9% 28,7% 3,74% 21,3%

Supragenes X Contigs 16,7% 43,9% 8,3% 30,2% 4,87% 21,8%

Subset X Contigs 11,8% 34,4% 2,9% 22,1% 1,60% 13,0%

Subset X Leituras+Contigs 12,5% 36,5% 2,9% 20,4% 1,80% 13,2%

Legenda: sucesso "Completo" se refere porcentagem de genes com primers para as duas regies
intergnicas, enquanto "Parcial" se refere aos genes com primers para apenas uma das intergnicas.
Subset: grupo de 1000 genes selecionados para testes contra reads (ver texto).


5.1.3 Eliminao de redundncia entre leituras e contigs

Para reduzir a redundncia de sequncia entre leituras e contigs de Dm28c, as
5.789.962 leituras obtidas foram alinhadas aos 32.761 contigs utilizando um limite de e-
value de 10
-30
. Linhas de corte de 90 e 95% de identidade e porcentagem da leitura no
alinhamento (cobertura) foram testadas para definir quais as leituras que seriam
eliminadas do banco de dados. O mesmo foi feito com os 1.688.475 leituras e 7.455
contigs da cepa Sylvio X10. A comparao do nmero de leituras que seriam
eliminadas em cada situao est apresentada nas Tabela 5.2, para Dm 28c, e Tabela
5.3, para Sylvio X10.
65






Tabela 5.2: Porcentagem de leituras de Dm28c
eliminadas com diferentes linhas de corte


Tabela 5.3: Porcentagem de leituras de Sylvio X10
eliminadas com diferentes linhas de corte


Os valores de 90% de identidade e 90% de cobertura da leitura foram escolhidos
como linhas de corte em ambos os casos, e o teste de predio de oligonucleotdeos
em larga escala, com as mesmas condies utilizadas anteriormente no teste de menor
estringncia para Dm28c, foi repetido com o banco de dados leituras reduzido. Houve
66

uma reduo de ~30% no tempo de execuo, sem nenhuma perda na capacidade de
predio de iniciadores pelo programa.

67

5.2 SISTEMA DE NOCAUTES GNICOS

5.2.1 Construo dos vetores

5.2.1.1 Construo dos vetores para nocaute

O plasmdeo pNEO2 foi digerido com as enzimas HindIII e EcoRI, conforme
descrito em materiais e mtodos, e o fragmento referente ao plasmdeo sem a regio
codificante de NEO (backbone) foi purificado (Figura 5.8). O produto resultante dessa
purificao foi utilizado em todas as ligaes descritas nesse item.

Figura 5.8: Digesto e purificao de banda do plasmdeo pNEO2

Legenda: (A) eletroforese da digesto de pNEO2 com HindIII e EcoRI. A banda de maior peso
molecular consiste no backbone do vetor. (B) banda de maior peso molecular da digesto de
pNEO2, purificada com Gel Size Selection, conforme descrito em materiais e mtodos.


Para construo de pGFP-KO, a regio codificante de eGFP foi amplificada a
partir de pTcGFPN (Figura 5.9A) e digerida com HindIII e EcoRI. A digesto foi
purificada e submetida ligao com o backbone de pNEO2. A ligao foi diretamente
transformada em bactrias E. coli DH5 e o screening de colnias foi feito por PCR de
colnia com os iniciadores GFP-F e R. Das colnias positivas foi feito extrao do
plasmdio, e a presena do fragmento integrado foi verificada por PCR com os
68

iniciadores pNEO2-F e pNEO2-R (Figura 5.9B) e confirmada por sequenciamento.
Somente clones sem nenhuma mutao foram utilizados para os experimentos de
nocaute. O mesmo protocolo foi feito para VFP e E2-Crimson (
Figura 5.10 e Figura 5.11).


Figura 5.9: Clonagem de GFP no backbone de pNEO2

Legenda: A: amplficao do gene EGFP por PCR a partir de pTcGFPN; B: PCR de colnia de
vrios clones com os primers pNEO2-F e R para verificao da correta insero do inserto.

Figura 5.10: PCR dos genes E2-Crimson e VFP

Legenda: M: marcador molecular; E2: PCR de E2-Crimson; VFP: PCR de VFP.
69

Figura 5.11: PCR de colnia de pE2-KO e pVFP-KO

Legenda: PCR de colnia de clones que cresceram aps a transformao com primers
especficos para os genes clonados. E2 e VFP indicam colnias das transformaes de E2-
Crimson eVFP, respectivamente. M: marcador molecular.

As clonagens de PURO e BLAST foram feitas por subclonagem no backbone de
pNEO2 a partir dos insertos clonados em pGEM. Os vetores pGEM-BLAST e pGEM-
PURO foram digeridos com HindIII e EcoRI (
Figura 5.12), e as bandas de menor peso molecular (marcadas em vermelho na figura)
foram purificadas.

Figura 5.12: Digesto de pGEM-BLAST e pGEM-PURO

Legenda: B e P so os plasmdeos pGEM-BLAST e pGEM-PURO, respectivamente, e Bd e Pd so os
plasmdeos aps a digesto com HindIII e EcoRI. As bandas das digestes marcadas em vermelho
correspondem s regies codificantes de BLAST e PURO excisadas dos vetores aps a digesto.
70



As bandas purificadas foram submetidas a ligao com o backbone de pNEO2,
que foi diretamente transformada em E. coli DH5. O screening das colnias foi feito
por PCR de colnia com os primers pNEO2-F e R (
Figura 5.13), e os clones selecionados foram sequenciados.

Figura 5.13: PCR de colnia de pBLAST-KO e pPURO-KO

Legenda: as canaletas marcadas por BLAST e PURO correspondem a PCRs de colnias
que cresceram aps as transformaes das ligaes do backbone de pNEO2 aos
fragmentos de restrio menores de pGEM-BLAST e PURO, respectivamente.


5.2.1.2 pTcGW-CRE

O gene Cre foi amplificado e recombinado em pDONR221 (Figura 5.14), e para
quatro colnias foi feita a extrao de DNA plasmidial. Com um pool dos plasmdeos
das quatro colnias foi feita a recombinao com os vetores de destinao do pTcGW
(pTcYFPH, pTcGFPH, pTc6HH e pTc6HN), e foi feita PCR de colnia para verificao
dos clones (Figura 5.15). Foi feita extrao de DNA plasmidial dos clones positivos, e o
material purificado foi armazenado a -20C.
71


Figura 5.14: Amplificao de CRE e recombinao em pDONR221

Legenda: A: PCR purificada do gene CRE (M: marcador molecular; CRE: produto de PCR);
B: verificao da insero de CRE em pDONR221 por diferena de tamanho dos
plasmdeos (C pDONR221, e as demais canaletas so clones ps-recombinao).

Figura 5.15: PCR de colnias transformadas com a recombinao de pDONR-CRE
em pTcGW

Legenda: os nomes sobre as canaletas indicam qual o plasmdeo de destinao utilizado.
M: marcador molecular

72


5.2.2 Desenvolvimento do protocolo de PCR de fuso

O protocolo para construo de sequncias para nocaute gnico em
Trypanosoma cruzi por PCR de fuso - descrito detalhadamente no item 4.4 - foi
desenvolvido a partir da metodologia descrita por Kuwayama e colaboradores (2002).
O incio da validao e desenvolvimento do protocolo foi feito com os genes
Tc00.1047053510877.90 (A), Tc00.1047053506321.300 (G) e
Tc00.1047053508707.300 (I), que codificam protenas de funo desconhecida, e
Tc00.1047053507059.60 (URA), que codifica a protena orotidina-5-fosfato
descarboxilase/orotato fosforibosiltransferase, utilizando o cassete de seleo do
plasmdeo pNEO2.
Foi feito o desenho dos iniciadores para nocaute com o software TcruziKO, para
amplificar as regies intergnicas flanqueando as CDSs dos genes, utilizando contigs e
leituras de T. cruzi clone Dm28c e um tamanho mnimo de amplicon predito de 250
pares de base. A
Figura 5.16 a imagem de uma eletroforese em gel de agarose dos produtos das PCRs
das intergnicas.

Figura 5.16: Produtos de PCR das intergnicas

Legenda: produtos de PCR das intergnicas 5' (U) e 3' (D) dos genes A, G, I e URA.
73

Ajustes finos para melhorar a pureza das PCRs foram feitos, como alteraes na
concentrao de DNA genmico e dos oligonucleotdeos, e na temperatura de
anelamento.
A partir do plasmdeo pNEO2 foi feita a amplificao por PCR do cassete de
resistncia, como descrito anteriormente, com os primers pNEO2_FOR e pNEO2_REV.
O produto foi analisado em gel de agarose 0,8% (
Figura 5.17).

Figura 5.17: PCR do cassete de NEO a partir de pGFP-KO


Todos os produtos foram purificados com exonuclease I, para remoo dos
oligonucleotdeos. Possvel degradao dos produtos de PCR pela enzima foi
verificada atravs de testes com tempos de incubao mais longos a 37C. Os
produtos purificados pela enzima foram analisados antes e aps digesto por
eletroforese em gel de agarose (Figura 5.18).




74


Figura 5.18: Teste da digesto da PCR de AU com exonuclease I

Legenda: os nmeros sobre as canaletas indicam o tempo de incubao a 37C com exonuclease.

Inicialmente, foi testada a fuso com os produtos do gene A e com os iniciadores
com 0, 4 e 8Gs, em duas etapas, de forma muito semelhante descrita por Kuwayama
e colaboradores (2002): 5 L da PCR purificada com exonuclease de cada intergnica
do mesmo gene eram misturadas no mesmo tubo, ao qual era adicionado 1 L da PCR
purificada do cassete de NEO e 0,1 L de Pfx polimerase. Na primeira etapa, 20 ciclos
de PCR, com 55C de temperatura de anelamento e 2 minutos de extenso eram
feitos. Depois, 2 pmol de cada um dos iniciadores externos das intergnicas
(*UPS_FOR e *DOWN_REV) foram adicionados reao, e mais 20 ciclos foram
feitos. Devido ao fato de os iniciadores utilizados para amplificao da fuso terem 8
Gs adicionado s suas extremidades 5', a segunda etapa foi feita com 65C de
temperatura de anelamento e 4 minutos de tempo de extenso. O resultado da PCR de
fuso mostrado na Figura 5.19.
Apesar de ter aparecido banda na altura esperada, devido baixa eficincia na
obteno do produto final, optou-se por otimizar separadamente cada uma das duas
etapas da PCR de fuso.
Para analisar a fuso sem iniciadores, foram feitos testes preliminares utilizando
Taq DNA polimerase, AccuPrime Pfx, e um mix comercial completo (cedido pelo
Instituto de Biologia Molecular do Paran) com Taq DNA polimerase. Para poder testar
diferentes propores de volume entre as PCRs das intergnicas e a PCR do cassete
de NEO, optou-se por, ao invs de utlizar a mesma reao de PCR em que foram
amplificadas as regies intergnicas, fazer uma nova PCR qual seriam adicionados
os produtos das intergnicas e do cassete de NEO em diferentes propores.
75


Figura 5.19: PCR de fuso em duas etapas com Pfx DNA
polimerase e as regies intergnicas de A

Legenda: Produtos da PCR de fuso do cassete de NEO com intergnicas de A, ampificadas com
primers com 0, 4 e 8Gs(A0, A4 e A8, respectivamente) na extremidade 5'. A banda na altura marcada
pela seta representa o tamanho esperado para a fuso. M: marcador de massa molecular.

Partindo de 1 L de cada intergnica para 33 L de volume final de PCR, foram
testadas as propores de 1/1/1, 1/1/5 e 1/1/10 entre os produtos da intergnica a
montante, da intergnica a jusante e do cassete de NEO, respectivamente. O resultado
da fuso sem iniciadores descrita mostrado na figura Figura 5.20.
A banda mais forte presente em todos os produtos de fuso provavelmente
uma fuso parcial, entre o cassete de NEO e uma das regies intergnicas, devido ao
seu tamanho um pouco inferior ao esperado para a fuso completa (um pouco menos
de 2000 pb, contra os ~2300 esperados para a fuso). Isso foi confirmado fazendo o
mesmo protocolo de fuso, porm adicionando apenas uma das intergnicas e NEO s
reaes (Figura 5.21). A banda da fuso completa, no entanto, visvel, principalmente
no produto da fuso na proporo 1/1, utilizando Taq DNA polimerase (seta no centro
do gel, na Figura 5.20).
76


Figura 5.20: Fuso sem iniciadores com diferentes enzimas e
propores entre os produtos

Legenda: Produtos da PCR de fuso do cassete de NEO com intergnicas do gene A,
utilizando 3 conjuntos de reagentes diferentes (indicados no topo) e trs propores de
volume entre as intergnicas e o cassete de NEO (1/1, 1/5 e 1/10, indicados logo acima das
canaletas). A cabea de seta em preto direita marca a altura de uma banda de provvel
fuso parcial, entre NEO e apenas uma das intergnicas, presente em todas as PCRs. A
seta no meio do gel indica uma provvel banda da fuso completa entre os produtos.

Como a banda de fuso completa apareceu em maior destaque com uma menor
quantidade de NEO em relao s intergnicas, e utilizando Taq DNA polimerase,
optou-se por continuar com essa enzima e testar reaes de fuso com excesso de
produto das intergnicas em relao a NEO. Foi testada, ento, a eficincia com 5/5/1
de proporo entre intergnicas a montante, a jusante e o cassete de NEO,
respectivamente. No mesmo teste, apresentado na figura Figura 5.22, foi testada a
fuso com 50C de temperatura de anelamento, como indicado por Kuwayama e
colaboradores (2002), que demonstrou gerar um produto de fuso mais limpo (quarta
canaleta aps o marcador, Figura 5.22), e foi comprovada a importncia de purificar
previamente os produtos com exonuclease I.
77


Figura 5.21: Fuses parciais entre intergnicas de A e NEO

Legenda: Produtos de PCR de fuso com diferentes combinaes entre as intergnicas e NEO. M: marcador de
massa molecular; CTRL: reao AU+AD+NEO sem adio de Taq ou incubao no termociclador. AU, AD e NEO
representam as intergnicas a montante de A (A upstream), a jusante de A (A downstream) e o cassete de NEO,
respectivamente, utilizadas em diferentes combinaes (indicadas acima do gel) nas quatro ltimas canaletas da
direita. Nas reaes em que esto presentes, foram adicionados 0,5 L das regies intergnicas e 5 L de NEO
para 33 L de PCR. A seta direita aponta a altura esperada para a banda de fuso parcial.

Figura 5.22: Teste de diferentes parmetros para a fuso

Legenda: Fuso sem iniciadores para o gene A com diferentes condies. CTRL+: fuses feitas
anteriormente, com produto do tamanho esperado; CTRL-: fuses parciais, com uma das intergnicas e
NEO; 50 e 55C: temperaturas e anelamento utilizadas nas fuses; (1) uso (+) ou no (-) de exonuclease
78

I para purificao dos produtos antes da fuso; (2) proporo entre intergnicas e NEO, respectivamente,
na fuso. AU+NEO e AD+NEO foram usados na proporo 5/1, e M o marcador molecular.
Com o estabelecimento de um protocolo funcional de fuso para o gene A, os
genes G, I e URA foram reinseridos nos testes e utilizados para validao da
metodologia. Usando a proporo de volumes de 5:5:1, como descrito anteriormente,
foi feita a fuso sem iniciadores das intergnicas com o cassete de NEO (Figura 5.23).

Figura 5.23: Fuso sem iniciadores das intergnicas de G, I e URA
com cassete de NEO

Legenda: Produtos de PCR de fuso entre as intergnicas de G, I e URA com cassete de
NEO. A cabea de seta direita marca a altura esperada de uma banda de fuso. AU+NEO e
AD+NEO so os controles de fuso parcial de A utilizados anteriormente.

Com base na concentrao de DNA dos produtos das intergnicas e de NEO foi
calculado o nmero de molculas de DNA em cada produto, e a partir disso foi possvel
estabelecer a relao ideal entre os produtos para que a fuso ocorra da melhor forma
possvel. Para testar essa idia, a quantidade do produto de NEO foi reduzida
(aproximadamente metade do volume utilizado at o momento) para uma concentrao
final de 0,5 ng do cassete de NEO por L da reao de fuso, e 2, 5 e 10 vezes mais
molculas de cada intergnica foram utilizadas. A reduo da quantidade de NEO
utilizada teve que ser feita para permitir que fossem usadas quantidades maiores das
79

PCRs das intergnicas sem que fosse necessrio concentr-las. O resultado desse
teste mostrado na Figura 5.24, para os genes A e G.

Figura 5.24: Testes de fuso com relao de nmero de molculas entre as
intergnicas e o cassete de NEO

Legenda: Produtos de fuses entre as intergnicas de A e D com cassete NEO. (1) gene para
o qual foram feitas as fuses; (2) nmero de ciclos de desnaturao, anelamento e extenso
utilizados; e (3) relao entre o nmero de molculas das intergnicas e de NEO,
respectivamente. A marcao das bandas de DNA foi feita com o reagente SYBR Gold, mais
sensvel, ocasionando o aparecimento de diversas bandas adicionais.

As reaes de fuso utilizando 10 vezes mais molculas das intergnicas, em
geral, foram as que demonstraram maior eficincia na gerao do produto de fuso.
Em mdia, 10 L de cada intergnica (a montante e a jusante) para uma reao de 50
L foram usados, e essa aproximao foi utilizada sem perda significativa da eficincia
para os experimentos de fuso com todos os genes selecionados, como ser
demonstrado abaixo. O teste tambm demonstrou que com 20 ciclos de PCR obtido
uma quantidade maior do produto esperado sem que haja aumento da formao de
bandas indesejadas. O uso de 30 ciclos, no entanto, pode gerar produtos indesejados
80

de maior massa tamanho, sem que haja aumento visvel do produto de fuso, como
demonstrado na
Figura 5.25.

Figura 5.25: Fuso para os genes A, G, I e URA com diferentes
quantidades de ciclos de PCR

Legenda: Fuses para os genes A, G, I e URA. (1) Nmero de ciclos de PCR utilizados; e (2)
gene para o qual foi feita a fuso. A marcao das bandas de DNA foi feita com o reagente
SYBR Gold - por isso o aparecimento de diversas bandas adicionais. Seta: tamanho esperado
para o produto de fuso. Cabea de seta: banda insepecfica de tamanho maior do que o
projetado para a fuso, ao final de um rastro aparente com um maior nmero de ciclos de PCR.

Aps a obteno de um protocolo adequado para a fuso dos produtos, foi
iniciada a otimizao da amplificao do produto de fuso com os iniciadores externos.
Apenas com as intergnicas do gene A, foi testada a amplificao da fuso com 1 L
do produto de fuso em 50 L de uma nova reao de PCR com Taq DNA polimerase,
20 ciclos de PCR, 55 e 65C de temperatura de anelamento, e concentraes de 0,1
(utilizada nas PCRs para amplificao das regies intergnicas e de NEO), 0,2 e 0,5
pmol/L de cada iniciador externo (Figura 5.26).
Como pode ser observado, no houve perda de eficincia na PCR com uma
temperatura de anelamento de 65C, e por favorecer amplificaes mais especficas
devido a uma maior estringncia, essa temperatura foi utilizada nas amplificaes das
81

fuses para os demais genes. A utilzao do dobro da concentrao padro de primers
utilizada nas demais PCRs tambm demonstrou promover uma maior amplificao do
produto desejado. O mesmo protocolo foi repetido com sucesso para os genes G, I e
URA (Figura 5.27).

Figura 5.26: Amplificao de produto de fuso com diferentes parmetros

Legenda: Amplificao da fuso entre intergnicas de A e NEO. 55C e 65C:
temperaturas de anelamento utilizadas; CTRL: fuses parciais (AU+NEO e AD+NEO) e o
produto de fuso utilizado para amplificao da fuso (F); 0,1, 0,2 e 0,5: concentraes
de cada primer na reao, em pmol/L; e M: marcador de massa molecular.

Figura 5.27: Amplificao da fuso para A, G, I e URA
82


Legenda: Amplificao das fuses das intergnicas de A, G, I e URA com NEO. (1) proporo da
fuso sem iniciadores utilizada na reao de amplificao da fuso; (2) gene para o qual a fuso foi
feita, com a exceo de M, que o marcador molecular. A seta direita marca a altura das bandas
de fuso. Nessa situao especfica a amplificao da fuso para A no teve o resultado esperado.


O protocolo validado, ento, foi testado com os demais genes selecionados,
listados em "Materiais em Mtodos". Ao todo, 21 genes foram selecionados e 25
construes diferentes foram usadas. Para os genes M2, M3, M4 e M8, devido ao
tamanho pequeno de uma ou ambas regies intergnicas flanqueantes, foram
desenhados pares de iniciadores que amplificam regies menores do que o mnimo
previamente estipulado (250 pb, denominados S) e pares que amplificam regies de
tamanho normal, porm que se sobrepe regio codificante do gene alvo
(denominados L).
O protocolo inteiro foi repetido com todos os genes para testar a eficincia do
processo como um todo. Foi feita uma primeira amplificao de todas as regies
intergnicas com 55C de temperatura de anelamento (Figura 5.28). As poucas PCRs
sem amplificao ou com mltiplas bandas foram repetidas com pequenas alteraes,
e ao final obteve-se amplficao com sucesso para 96% (24/25) das construes -
apenas para o gene C no foi possvel obter produto com qualidade para as fuses.
Figura 5.28: PCR de todas as regies intergnicas
83


Legenda: amplificao de todas das intergnicas de todos os genes
com as condies padro, descritas em Materiais e Mtodos.

Utilizando um cassete de pNEO2 previamente purificado, foram feitas as fuses
para todos os genes (
84

Figura 5.29), e todas as fuses foram amplificadas em pequeno volume (Figura 5.30).
Aps anlise das amplificaes por eletroforese em gel de agarose, 17 dos 24 produtos
(70,8%) foram considerados satisfatrios para transfeco (marcados em vermelho na
figura). Desses, oito (M3S, M3L, M5, M6, M7, M8S, M8L e M9) foram selecionados e
amplificados em grande quantidade (1 mL) para a transfeco. A concentrao por
ultrafiltrao teve uma recuperao de ~95%, obtendo em mdia 29 g por produto,
concentrados em 50 L.







85

Figura 5.29: Fuses por PCR

Legenda: os smbolos sobre as canaletas indicam com as
intergnicas de qual gene foram feitas as fuses.

Figura 5.30: Amplificao das fuses

Legenda: amplificaes das fuses mostradas na
86

Figura 5.29. Os smbolos sobre as canaletas indicam quais fuses foram
utilizadas para a amplificao.

5.3 NOCAUTES GNICOS

5.3.1 Nocaute com neomicina fosfotransferase

Os cassetes para nocaute produzidos foram transfectados em culturas de
Trypanosoma cruzi Dm 28c, conforme protocolo descrito anteriormente, e foi feita a
seleo dos parasitas por resistncia a G418.
Aps 27 dias da transfeco, foi observado ausncia total de crescimento do
controle negativo, e 7 dos 8 transfectantes desenvolveram resistncia droga; a
cultura do M8S no apresentou crescimento visvel no mesmo perodo de tempo. Foi
feita a extrao de DNA e congelamento das culturas para preservao dos mutantes
aps duas passagens em intervalos de 3 dias com 1x10
6
clulas/mL. Aps novo
repique das culturas na ausncia de G418, foi iniciada uma curva de crescimento
simples, em comparao a um controle negativo, para verificar se haveria alguma
alterao drstica de crescimento (

87

Figura 5.31), a qual no foi evidenciada.
A presena do cassete de pNEO2 nos genomas dos parasitas foi verificada por
PCR, com os DNAs genmicos dos mutantes e os iniciadores utilizados originalmente
para amplificar o cassete a partir do plasmdio (

88


Figura 5.32). A verificao da substituio da regio codificante dos genes alvo pelos
cassetes para nocaute foi feita tambm por PCR, utilizando iniciadores internos ao
cassete de pNEO2 combinados com iniciadores externos sequncia introduzida no
genoma (





Figura 5.33 e
89

Figura 5.34).



90

Figura 5.31: Curva de crescimento dos mutantes

Legenda: curva de crescimento a partir de 1x10
6
clulas/mL das cepas nocaute
para miosinas (M*), com uma cultura selvagem como controle (WT).


0 1 2 3 4 5 6 7
0,0E+000
2,0E+007
4,0E+007
6,0E+007
8,0E+007
1,0E+008
1,2E+008
M3S
M3L
M5
M6
M7
M8L
M9
WT
91


Figura 5.32: Verificao da integrao de neo nos genomas nocauteados

Legenda: PCRs com os primers pNEO2-F e R, contra DNAs genmicos do parasita selvagem (WT)
e dos mutantes +/- para as miosinas - designados pelos cdigos apresentados no item 4






Figura 5.33: Esquema da estratgia utilizada para verificao dos nocautes

Legenda: foram desenhados pares de iniciadores (elipses UPS e DOWN) em que um dos oligos se anela na
sequncia do cassete marcador inserido e o outro se anela na regio prxima ao gene alvo. Amplificao por PCR
com DNA genmico dos nocautes utilizando estes iniciadores (e a no amplificao em genoma do parasita
selvagem) um indicativo de que houve integrao e substituio do gene alvo pelo cassete se seleo.


92

Figura 5.34: Verificao dos nocautes por PCR

Legenda: WT e KO indicam qual o DNA que foi usado (de parasitas selvagens e nocautes para o gene indicado
acima, respectivamente); UPS e DOWN se referem regio amplificada, conforme indicado na





Figura 5.33; e os cdigos no topo dos gis indicam para qual gene/mutante foi feita a anlise.


5.3.2 Nocaute com protenas fluorescentes

O protocolo de fuso desenvolvido foi testado com o cassete de pGFP-KO e as
intergnicas dos genes nocauteados previamente com neo: M3S, M3L, M5, M6, M7,
M8L e M9. O cassete de pGFP-KO foi amplificado com os primers pNEO2_FOR e
pNEO2_REV (Figura 5.35), foi feita a fuso com os produtos de PCR das intergnicas (
93




Figura 5.36) e amplificao da fuso (Figura 5.37), como descrito anteriormente. As
quatro melhores fuses (marcadas em vermelho nas



Figura 5.36 e Figura 5.37) foram amplificadas em grande quantidade (
Figura 5.38) e concentradas, com um rendimento mdio de 35,8 g.

Figura 5.35: amplificao por PCR do cassete da GFP a partir de pGFP-KO


Legenda: PCR do cassete de pGFP-KO com os primers pNEO2-FOR e pNEO2-REV, utilizando um mix
padro para PCR com AccuPrime Pfx DNA polimerase




Figura 5.36: Fuso das intergnicas com o cassete de pGFP-KO
94


Legenda: fuso por PCR das intergnicas das miosinas (cujos cdigos esto sobre as
canaletas do gel) com o cassete amplificado de pGFP-KO.

Figura 5.37: amplificao das fuses miosinas-GFP

Legenda: as fuses entre o cassete da GFP e as intergnicas das miosinas foram amplificadas por PCR.

Figura 5.38: Amplificao em grande quantidade das fuses selecionadas

Legenda: para as fuses selecionadas foi repetido o protocolo de amplificao da fuso para 1 mL de
volume total de PCR. M5, M6, M7 e M8 so os cdigos das miosinas para as quais a fuso foi
amplificada, e a primeira e ltima canaletas so marcadores moleculares.

95

As fuses do cassete de pGFP-KO com IRs dos genes M5, M6, M7 e M9 foram
transfectadas nos mutantes previamente nocauteados com neo e foi feita a seleo de
clones por fluorescncia, como descrito anteriormente.
No teste com uma clula por poo, foi feito cell sorting em 24 e 48h e aps 3
semanas foi possvel observar turbidez em 24 de 384 poos (6,3%). A anlise por
microscopia ptica com fluorescncia de cada uma das culturas viveis foi
inconclusiva, ento foi feita uma anlise por citometria de fluxo para verificar se em
alguma das culturas houve um aumento na fluorescncia mdia. No entanto, nenhuma
das culturas apresentou fluorescncia maior do que a observada para o controle
negativo. Em 24 horas foi observado um maior nmero de clulas com alta
fluorescncia durante o processo de seleo por FACS, em relao a 48 horas, mas a
observao dessa clulas ao microscpio ptico revelou que grande parte desses
eventos se tratava, na realidade, de artefatos ou grumos de pequenas clulas - motivo
pelo qual foram utilizadas posteriormente apenas as clulas menores que a mediana
no experimento de enriquecimento.
Foi, ento, dado incio ao teste de enriquecimento de clulas fluorescentes. O
teste tambm foi feito a partir da transfeco dos mutantes
+/-
para M5, M6, M7 e M9
com sequncias de fuso entre intergnicas dos genes e o cassete de seleo de
pGFP-KO. 48 horas aps a transfeco foi feito o primeiro cell sorting, de 10
5
clulas
por poo para cada cultura. Foi utilizado o gate indicado na figura Figura 5.39, que
dentre todos os eventos com tamanho menor do que mediana de FSC engloba os 5%
mais fluorescentes.
Nos quatro enriquecimentos consecutivos foi observado o mesmo padro pr e
ps-sorting demonstrado na Figura 5.39, o que indica que no houve enriquecimento da
populao fluorescente dentro da populao total ao longo do experimento.
Histogramas das fluorescncias e de tamanho das clulas pr e ps-sorting so
mostrados na Figura 5.40, para melhor caracterizar o perfil.

Figura 5.39: Scatterplot do tamanho e fluorescncia dos eventos pr e ps-
sorting de uma cultura de T. cruzi transfectada com cassete GFP
96


Legenda: os ponto em laranja representam os eventos pr-sorting e os pontos em azul representam os
eventos ps-sorting. O retngulo dentro da rea do grfico representa o gate utilizado para selecionar os
eventos para cellsorting.
Figura 5.40: Histogramas de fluorescncia e tamanho das clulas,
pr e ps-sorting

Legenda: a curva da populao pr-sorting mostrada em laranja, e a ps-sorting em azul. A:
histograma da fluorescncia. B: histograma do tamanho celular.

5.4 TESTE DE SENSIBILIDADE AO CIDO 5-FLUOROORTICO

Para verificar a sensibilidade das formas epimastigotas de Trypanosoma cruzi
Dm28c ao cido 5-fluoroortico, foi feito uma curva preliminar de crescimento em meio
LIT, sem replicatas, com as concentraes de 0,5, 1, 2,5, 5 e 10 g/mL de 5-FOA
(Figura 5.41). Aps 3 dias, as culturas estabilizaram com aproximadamente 1x10
8
parasitas/mL de meio, e nenhuma alterao morfolgica pode ser observada nos
parasitas ao microscpio ptico.

97

Figura 5.41: Curva de crescimento de T. cruzi Dm28c em meio LIT com
diferentes concentraes de 5-FOA

Legenda: As curvas foram iniciadas com 1x10
7
clulas/mL. A legenda da direita indica a concentrao (em g/mL)
de 5-FOA em cada cultura, e "CTRL" indica o controle negativo, ao qual no foi adicionada a droga.

Testes com concentraes superiores de 5-FOA (10 e 50 g/mL) foram feitos
utilizando o meio quimicamente definido HX25M, suplementado com putrescina e soro
fetal bovino (

Figura 5.42). As curvas foram iniciadas com 1x10
7
parasitas/mL, e a estabilizao do
crescimento ocorreu entre o 4 e o 5 dia de cultivo. Tambm no foram observadas
diferenas morfolgicas entre o controle negativo e as culturas com droga.

Figura 5.42: Curva de crescimento de T. cruzi Dm 28c em HX25M
com diferentes concentraes de 5-FOA

0,0E+00
2,0E+07
4,0E+07
6,0E+07
8,0E+07
1,0E+08
1,2E+08
0 1 2 3
dias
CTRL
0,5
1
2,5
5
10
0,0E+00
2,0E+07
4,0E+07
6,0E+07
8,0E+07
1,0E+08
1,2E+08
0 1 2 3 4 5
dias
CTRL
10
50
98

Legenda: As curvas foram iniciadas com 1x10
7
clulas/mL. A legenda da direita indica a concentrao (em g/mL)
de 5-FOA em cada cultura, e "CTRL" indica o controle negativo, ao qual no foi adicionado droga. Cada ponto no
grfico corresponde mdia entre duas rplicas biolgicas.

Um ltimo teste foi feito com 500 g/mL de 5-FOA em HX25M sem adio de
soro fetal bovino, partindo de uma concentrao inicial de 1x10
6
clulas/mL de meio de
cultura (
Figura 5.43). Aps o 7 dia de cultivo houve estabilizao do crescimento das culturas, e
nenhuma alterao morfolgica foi observada entre os controles e a cultura com droga.
Portanto, diferentemente do que foi observado para Trypanosoma brucei, a
presena do gene URA no parasita no apresenta toxicidade ao 5-FOA, o que
impossibilita a sua utilizao como marcador de seleo negativa, etapa essencial para
o desenvolvimento de um sistema de nocautes sequenciais baseados no sistema
Cre/lox.

Figura 5.43: Curva de crescimento de T. cruzi Dm 28c em HX25M sem soro fetal
bovino com alta concentrao de 5-FOA

Legenda: As curvas foram iniciadas com 1x10
6
clulas/mL. Alm do controle negativo
("CTRL"), foi utilizado um controle com 1% de DMSO, que corresponde
0,0E+00
2,0E+07
4,0E+07
6,0E+07
8,0E+07
1,0E+08
1,2E+08
0 1 2 3 4 5 6 7
dias
DMSO 1%
CTRL
500 g/mL
99

porcentagem de DMSO adicionada junto ao 5-FOA cultura teste (500 g/mL). Cada
ponto no grfico corresponde mdia entre duas rplicas biolgicas.

100

6 DISCUSSO

6.1 CONSIDERAES GERAIS SOBRE O PROJETO

O trabalho aqui descrito foi idealizado e projetado dentro dos projetos
"Reguloma de Trypanosoma cruzi", atualmente conduzido no Instituto Carlos Chagas /
Fiocruz-PR, que tem como objetivo caracterizar todos os elementos relacionados a
regulao da expresso gnica em T. cruzi, bem como as relaes entre eles; e
Genmica funcional de Trypanosoma cruzi, tambm conduzido no Instituto Carlos Chagas
/ Fiocruz-PR, cujo objetivo caracterizar funcionalmente de maneira inicial as protenas desse
parasita e o seu funcionamento molecular sistmico.
No laboratrio de Genmica Funcional do Instituto, onde foi conduzido o
presente estudo, so utilizadas abordagens em larga escala com o intuito de fomentar
a base de dados do projeto Reguloma. O ORFeoma de T. cruzi, uma das principais
ferramentas, atualmente em fase final de construo, utilizado para caracterizao
funcional de protenas diversas e, atravs da tcnica de duplo-hbrido em levedura,
para o estudo do interatoma protico de T. cruzi (PRETI, 2012). Com microarranjo de
DNA (PAVONI, 2005; PROBST, 2005) e RNA-Seq (KESSLER, 2010; FRANCISCO,
2011) so feitas anlises globais da expresso gnica de T. cruzi pela identificao e
quantificao (ou semi-quantificao) de molculas de RNA poli-A - e o mesmo feito
para as protenas do parasita com protemica shotgun (DE GODOY et al., 2012;
MARCHINI et al., 2011).
Com o objetivo de obter uma maior gama de variaes na expresso gnica do
parasita e, dessa forma, obter uma quantidade de dados que possibilite a identificao
de covariao da expresso e, consequentemente, de mdulos de genes corregulados,
as anlises globais de expresso gnica so feitas com a exposio ou submisso do
parasita a diversas condies ou agentes. Foram projetadas, originalmente, trs
classes de condies: (1) simulao in vitro de condies naturalmente encontradas
pelo parasita durante o seu ciclo de vida, como diferentes tipos de estresse, processos
de diferenciao celular, infeco de clulas, etc.; (2) exposio a condies/agentes
artificiais, como drogas anti-chagsicas e inibidores enzimticos; e (3) alteraes
genmicas, como insero ou deleo de sequncias. Dentro do ltimo tipo
101

mencionado, h a necessidade de tcnicas padronizadas e de alta eficincia para que
abordagens como nocaute gnico possam ser utilizadas em aplicaes em larga escala
em Trypanosoma cruzi. Nesse contexto, e como ferramenta para a caracterizao
funcional em larga escala de protenas, conforme mencionado anteriormente, foi criada
a idia de desenvolver e padronizar um sistema escalonvel para nocautes, que possa
ser utilizado em abordagens "micas" para o estudo de Trypanosoma cruzi.


6.2 SOFTWARE DE PREDIO DE INICIADORES PARA NOCAUTE GNICO

O software TcruziKO foi desenvolvido com o intuito de facilitar e aumentar a taxa
de sucesso na construo de cassetes para nocaute de genes especficos de
Trypanosoma cruzi. Inicialmente, um algoritmo muito mais simples foi idealizado e
desenvolvido, que utilizava a sequncia genmica de T. cruzi CL Brener, informaes
da posio dos genes nos cromossomos e uma lista de IDs de genes para gerar
oligonucleotdeos que se anelassem e amplificassem as regies intergnicas dos
genes selecionados. Porm, aps a primeira leva de iniciadores ficou claro que seria
necessrio um aprimoramento do software para aumentar a eficincia. A
Figura 6.1 mostra o resultado das PCRs para amplificao das intergnicas de genes,
com iniciadores desenhados pelo primeiro software e pelo atual TcruziKO.

Figura 6.1: Comparao da eficincia de amplificao de intergnicas
com pares de iniciadores distintos

Legenda: PCRs das intergnicas dos genes com DUFs, utilizando primers feitos pela primeira verso do
programa, sem anlise de conservao entre cepas (canaletas mpares), e primers feitos pelo TcruziKO
(canaletas pares). Nas canaletas entre linhas pontilhadas vermelhas consecutivas foram usados primers
para as mesmas regies. M: marcador de massa molecular.
102

Apesar de haver uma melhora significativa na taxa de sucesso de amplificao
numa primeira tentativa nas condies padro, ainda no houve 100% de eficincia
com os iniciadores feitos pela nova verso do programa. Nos testes de eficincia de
predio para um grande nmero de genes tambm no houve 100% de eficincia,
pois para ~65% dos genes foi possvel fazer os dois pares de iniciadores, na melhor
das condies. Sobre essas questes importante ressaltar alguns pontos:
- baixo contedo GC: regies intergnicas de T. cruzi apresentam contedo GC
inferior (47%) ao das regies codificantes (53,4%) (EL-SAYED et al., 2005a), e mesmo
o contedo GC mdio bastante inferior ao de outros tripanossomatdeos, como o de
Leishmania major (51% contra 60%) (EL-SAYED et al., 2005b), o que dificulta o
desenho de iniciadores com Tm alta nessas regies (SANTALUCIA, 1998). Ainda, em
muitas situaes em que o software capaz de gerar pares de iniciadores, eles so de
tamanho maior do que o ideal e apresentam baixo contedo GC na extremidade 3', o
que pode comprometer o anelamento do oligonucleotdeo numa regio desejada;
- baixa complexidade/repeties: foi observada uma alta quantidade de
homopolmeros e repeties consecutivas de dmeros nas regies intergnicas, o que
pode levar a dificuldades na predio de iniciadores eficientes;
- tamanho das regies intergnicas: analisando o tamanho mdio das regies
intergnicas entre genes ortlogos e sintnicos de T. cruzi, T. brucei e Leishmania
major, observado um tamanho de 561 pb para T. cruzi, o que quase 3 vezes menor
do que o tamanho mdio observado para L. major (1431 pb) e consideravelmente
menor do que o para T. brucei (721 pb) (EL-SAYED et al., 2005b). Como comentado
anteriormente, no se sabe ao certo o tamanho mnimo necessrio para que ocorra
recombinao homloga entre dois fragmentos no genoma de Trypanosoma cruzi;
porm, tendo como base o fato de que fragmentos com menos de 100 pb no so
capazes de recombinao em T. cruzi (XU et al., 2009) e sabendo do tamanho mnimo
de ~180 pares de base para que ocorra recombinao em Leishmania sp.
(PAPADOPOULOU & DUMAS, 1997), foi adicionada uma margem de segurana e
adotado um tamanho mnimo de 250 pb para realizao dos experimentos de nocaute.
Devido ao tamanho pequeno das regies intergnicas, no entanto, em algumas
situaes, notavelmente para algumas miosinas, para as quais foram feitas duas
103

contrues, no foi possvel utilizar esse tamanho como mnimo para o desenho nas
intergnicas, e em diversos casos observados no teste de predio em larga escala o
tamanho mnimo o principal parmetro que impossibilitou o desenho de iniciadores;
- existncia de diversas falhas no sequenciamento: com a montagem recente
dos 32.746 contigs da cepa CL Brener em 41 cromossomos por hapltipo, baseada em
inferncias por sintenia com outros tripanossomatdeos e nas bibliotecas genmicas
em BAC (WEATHERLY, BOEHLKE & TARLETON, 2009), diversos intervalos foram
inseridos na juno entre contigs, e nessas regies representadas por poli-Ns nos
cromossomos o desenho de iniciadores no possvel.
- baixa conservao nas regies intergnicas: existe grande variao intra-
especfica no clado Trypanosoma cruzi, e a conservao ainda menor nas regies
intergnicas. Entre os hapltipos Esmeraldo e No-Esmeraldo da cepa CL Brener, por
exemplo, h uma divergencia mdia de 5,4% entre as sequncias, porm a diferena
de apenas 2,2% nas CDSs (EL-SAYED et al., 2005a). Essa dissimilaridade entre cepas
pode gerar excesso de mascaramento nas sequncias usadas como base para
desenho de iniciadores pelo programa, diminuindo a chance de sucesso na predio.
Porm, mesmo considerando o aumento da dificuldade em utilizar as
intergnicas para desenho de iniciadores e para os experimentos de nocaute em geral,
optou-se por fazer dessa forma pois diminui a chance de que uma mutao inserida por
falha no processo de amplificao com um efeito indesejado ocorra. Ao utilizar
iniciadores que se anelam a um gene adjacente, por exemplo, ocorrer a recombinao
de parte da regio codificante desse gene com a parte correspondente do cassete de
nocaute, e se nessa houver alguma mutao, ela ser introduzida no gene em questo,
e qualquer fentipo aberrante detectado nesse mutante, pela possibilidade de ser
consequncia da mutao inserida, no poder ser diretamente associado ao nocaute.
A utilizao de iniciadores que se anelem na CDS do gene alvo, que foi a
alternativa escolhida nos casos da intergnica ser muito pequena, no tem o risco de
causar alteraes para outros genes; no entanto, como pode ser visto no trabalho
descrito por Otsu e colaboradores (1993), a parte da CDS incorporada sequncia de
nocaute permancer no cromossomo (ser trocada por ela mesma na recombinao) e
o marcador de seleo ser inserido dentro da regio codificante do gene alvo,
104

gerando um gene hbrido que poder codificar uma protena aberrante, composta pela
extremidade N-terminal da protena original e com o marcador de seleo na poro C-
terminal. Da mesma forma, qualquer alterao de fentipo observada (ou ausncia de
alterao) no poder ser atribuda diretamente ao nocaute. Utilizando o cassete de
pNEO2, como feito no presente trabalho, regies intergnicas so inseridas junto ao
gene de resistncia no lugar do gene alvo, o que dificulta ou mesmo impede a
formao de um transcrito hbrido por adicionar stios aceptor de trans-splicing e de
poliadenilao extremidade 5' do gene de resistncia.
Uma parte importante de anlise feita para o programa foi a estimativa de
nmero de cpias gnicas para todos os genes anotados de CL Brener. Como j
sabido, uma grande parte do genoma de T. cruzi composto por genes de grandes
famlias multignicas, e este - junto a demais repeties presentes - representa um dos
grandes obstculos para a correta montagem do genoma deste organismo (EL-SAYED
et al, 2005a). A sobreposio das leituras de sequenciamento para os genes dessas
famlias pode subestimar o nmero real de membros das famlias, pois cpias
separadas do mesmo gene podem acabar colapsadas no mesmo gene aps a
montagem. Alm de diminuir a qualidade da montagem, isso gera uma dificuldade
adicional para a aplicao de nocaute gnico em genes dessas famlias, pois
necessrio saber o nmero de cpias existentes de determinado gene para que todas
elas sejam removidas/rompidas e, considerando que no atual estado da arte
necessrio um par gene de resistncia/droga distinto para cada cpia nocauteada, a
partir de um determinado nmero de cpias muito difcil realizar o nocaute completo.
Para verificar se o nocaute de determinado gene vivel, foi feita uma
estimativa do nmero de cpias de cada gene anotado no genoma de CL Brener com
base no nmero de leituras mapeadas de Dm28c por quilobase de regio codificadora
do gene. Isso possvel partindo do princpio de que um gene com um maior nmero
de cpias no genoma sequenciado um maior nmero de vezes, considerando que
fragmentao e seleo dos fragmentos para sequenciamento sejam aleatrias. No
entanto, existe um bias de sequenciamento em relao ao contedo GC de cada gene,
observado claramente aps o mapeamento: quanto maior o contedo GC de uma
subpopulao, maior o nmero mdio de leituras mapeadas nos seus integrantes, o
105

que se torna bastante evidente ao redor da moda (Figura 6.2). No foi feito
normalizao do nmero de mapeamentos levando em conta esse fato, e por esse
motivo o dado no deve ser interpretado como o nmero real de cpias de determinado
gene no genoma, mas como uma base para estimar se o gene possui vrias cpias no
genoma ou no.


6.3 NOCAUTE GNICO

Aps o desenvolvimento do software, foi iniciada a parte de definio e
validao de uma metodologia para construo dos cassetes para nocaute. Pensando
na necessidade de um mtodo rpido, barato e escalonvel, a tcnica de PCR de fuso
foi selecionada. Entre os diversos protocolos existentes, o proposto por Kuwayama e
colaboradores (2002) apresentava uma caracterstica importante para a aplicao em
larga escala: ausncia de purificao dos produtos de PCR pelo uso de eletroforese em
gel. Atravs da degradao dos iniciadores das primeiras reaes com exonuclease I -
que apresenta atividade na soluo utilizada para PCR - e adio de um domnio de
desestabilizao da Tm rico em GC na extremidade 5' dos iniciadores que iro
amplificar a fuso, aumentando a especificidade da ligao dos iniciadores no produto
de fuso, o uso de kits de purificao ou metodologias manuais dispensado, o que
gera um aumento na velocidade e escalonabilidade do procedimento. Em nossa
abordagem, visando reduzir o tamanho da regio incorporada para aumentar a Tm, e
consequentemente o custo da sntese dos oligonucleotdeos, optamos por inserir
trechos de poli-G, de 4 ou 8 nucleotideos, sendo que essa ltima opo se mostrou
eficiente.
Comparando s outras alternativas existentes para resolver o mesmo problema,
como clonagem clssica e sistema MultiSite Gateway (PETERSEN & STOWERS,
2011), a PCR de fuso apresenta algumas vantagens:
- em relao a ambas: ao contrrio das tcnicas de clonagem, PCR de fuso
no utiliza diretamente plasmdeos ou bactrias, o que diminui drasticamente tempo e
106

estrutura necessrios, ao mesmo tempo em que aumenta a escalonabilidade do
processo por no necessitar de screening de colnia;

Figura 6.2: Scatterplot comparando nmero normalizado de reads mapeadas com
contedo GC para cada gene de T. cruzi CL Brener

Legenda: cada ponto no grfico representa um gene, posicionado de acordo com seu contedo GC (Y) e
o log de base 10 do nmero de reads mapeadas por 1000 pb (X). Ao redor da moda (linha pontilhada em
azul) observado com mais clareza um desvio na distribuio do nmero de reads mapeadas em
relao ao contedo GC, representado pela curva de tendncia para aquela regio, em amarelo.
107

- em relao clonagem clssica: por no necessitar de diversas etapas de
digesto com enzimas de restrio e ligao, alm de purificao dos produtos entre
cada uma das etapas, a PCR de fuso uma tcnica muito mais rpida para
construo de cassetes para nocaute do que a clonagem clssica;
- em relao ao sistema MultiSite Gateway: o sistema MultiSite Gateway
uma tcnica comercial que oferece muitas vantagens em relao ao uso da clonagem
clssica, em termos de eficincia, e por permitir que trs fragmentos distintos sejam
unidos em posies especficas de um vetor na mesma reao, o que permite que
cassetes para nocaute sejam construdos rapidamente. Alm disso, a tcnica tem uma
eficincia muito alta, mesmo para gerao de sequncias grandes (> 15 kb), que a
principal deficincia da PCR de fuso. No entanto, o protocolo necessita da utilizao
de dois mix de enzimas para recombinao, produzidos apenas pela empresa que
desenvolveu o sistema, o que acarreta num incremento muito grande no custo por
reao.
Para desenvolver o sistema, foram selecionados 21 genes de T. cruzi.
Considerando uma das propostas iniciais do trabalho, que era de gerar nocautes
mltiplos no mesmo organismo, foram selecionados dois grupos de genes: um de
genes de funo desconhecida, contendo os domnios conservados sem funo
definida DUF21 e DUF1126, do Pfam, que so de interesse para estudos de
caracterizao funcional; e a famlia das miosinas, j estudada no laboratrio de
genmica funcional, que interessante para a realizao de nocautes mltiplos
combinados, pois j se sabe que o nocaute de apenas um dos integrantes da famlia
em T. cruzi vivel e no apresenta alteraes de fentipo (ROCHA, em preparao).
Dois outros genes foram selecionados pensando na criao de um mutante de T. cruzi
Dm 28c mais apto para nocautes:
- URA: o gene que codifica a protena orotidina-5-fosfato descarboxilase/orotato
fosforribosiltransferase, aqui chamado de URA, uma das enzimas do final da via de
sntese de pirimidinas em Trypanosoma cruzi (HAMMOND & GUTTERIDGE, 1980),
usada como marcador de seleo positiva e negativa em leveduras (BOEKE,
LACROUTE & FINK, 1984), foi utilizado com sucesso como marcador de seleo
negativa em Trypanosoma brucei (SCAHILL, PASTAR & CROSS, 2008). Foi
108

selecionado para o trabalho, pois a gerao de um mutante de T. cruzi Ura
-
permitiria
que esse gene fosse usado como marcador de seleo negativa nesse organismo, da
mesma forma descrita para T. brucei; e
- KU70: foi demonstrado que o nocaute da protena KU70, uma pea importante
da maquinaria de reparo de quebra de fita-dupla de DNA por juno de extremidades
no-homlogas em eucariotos (revisto por LIEBER, 2010), leva a um aumento na taxa
de recombinao homloga em relao recombinao inespecfica em Aspergillus
nidulans (NAYAK et al., 2006) e em Neurospora crassa (NINOMIYA et al., 2004), o que
facilita a realizao de experimentos de nocaute e insero nesse organismos, sem
causar diminuio da viabilidade dos mutantes. Esse gene foi selecionado para o
trabalho pela possibilidade de que o resultado observado para os demais organismos
ocorra em T. cruzi.
Duas estratgias foram elaboradas inicialmente para a realizao dos nocautes:
a metodologia clssica, em que utilizado um marcador diferente para cada gene
nocauteado; e uma metodologia escalonvel, baseada no uso de cassetes reciclveis.
A primeira estratgia baseada nos vetores pNEO2 e pHYG2, j utilizados
previamente, e para incrementar o uso futuro dessa estratgia foram criado os vetores
pBLAST2 e pPURO2, que consistem no vetor pNEO2 com o gene de resistncia
trocado por bsr (blasticidin resistance gene) e pac (puromicina N-acetil-transferase),
respectivamente. A segunda estratgia - que acabou sendo pouco explorada, como
ser explicado abaixo - consiste na utilizao de um cassete que possa ser
selecionado pela presena no genoma (seleo positiva) e, aps a retirada, pela
ausncia (seleo negativa), permitindo o seu uso repetidas vezes para o nocaute de
diferentes genes no mesmo organismo.
O protocolo foi desenvolvido e testado para a primeira estratgia com os genes
selecionados e o cassete de seleo de pNEO2, que d resistncia droga G418 para
o mutante gerado. A tcnica de PCR fuso teve uma eficincia final, sem repeties, de
~68%, chegando prxima a 100% aps anlise caso a caso e repetio das PCRs
negativas com pequenas alteraes. Apesar de o processo ter tido uma boa eficincia,
durante o desenvolvimento do protocolo foi muitas vezes observada uma baixa
reprodutibilidade entre experimentos idnticos:
109

- variaes drsticas de resultado entre termocicladores distintos foram
observadas desde o incio dos experimentos, e por esse motivo o protocolo foi
desenvolvido inteiramente no mesmo tipo de equipamento, como descrito em materiais
e mtodos;
- PCRs feitas em placas de 96 poos muitas vezes apresentaram resultados
distintos conforme posio da placa, partindo de uma mesma reao de PCR -
provavelmente um reflexo da heterogeneidade de temperatura ao longo dos blocos dos
termocicladores usados;
- reaes de fuso a princpio idnticas tinham resultados completamente
diferentes sob as mesmas condies, refletindo a falta de robustez da tcnica frente a
variaes imperceptveis entre experimentos; e
- apesar da tcnica ter funcionado com o vetor pGFP-KO, contrudo no trabalho
a partir de pNEO2, o mesmo no ocorreu com o outro vetor selecionado para essa
primeira estratgia, pHYG2. As reaes de fuso e amplificao da fuso geraram
rastros sem banda definida repetidas vezes - motivo pelo qual no foi utilizado nesse
trabalho.
Ao final do protocolo, na amplificao em grande quantidade da fuso, na
maioria dos casos houve um rendimento entre 20 e 50 g de produto para cada gene,
porm mesmo com rendimento inferior a 10 g ocorreu a correta recombinao do
fragmento. A respeito do tamanho dos fragmentos, importante ressaltar a importncia
dos experimentos de nocaute da miosina M8 com as construes M8S, com regies
para recombinao de 204 e 576 pb, e M8L, com regies para recombinao de 504 e
576 pb: o nocaute com a construo M8S foi o nico que no funcionou, e M8L foi
capaz de nocautear com sucesso o mesmo gene. Outro ponto importante foi a
transfeco da construo M3S, que com regies de recombinao de apenas 279 e
269 pb foi capaz de se recombinar no local esperado com sucesso. Apesar de serem
situaes pontuais, ressaltam a importncia de que sejam utilizadas regies de
recombinao com mais de 250 pares de base, e indicam que o tamanho do fragmento
a ser recombinado um parmetro mais importante do que a quantidade de material
transfectado para o sucesso do nocaute em T. cruzi.
110

A segunda estratgia idealiza foi definida com base no trabalho publicado por
Scahill e colaboradores (2008), em que um cassete com marcadores para seleo
positiva e negativa utilizado para nocautear um gene em Trypanosoma brucei, e o
sistema CRE/lox utilizado para retirar o cassete do cromossomo aps integrao e
seleo. O gene HSVTK (Herpes Simplex Virus Thymidine Kinase) utilizado como
marcador de seleo negativa pelo fato de conferir clula sensibilidade droga
antiviral ganciclovir (LEBOWITZ, CRUZ & BEVERLEY, 1992), incua ao parasita
selvagem; no entanto, o par HSVTK/ganciclovir demonstrou no afetar as formas
epimastigotas de T. cruzi (BUCKNER, WILSON & VOORHIS, VAN, 1997), tornando a
abordagem impraticvel nesse organismo.
Outra estratgia para seleo negativa proposta pelos autores, que consiste
na reintroduo do gene PYR5-6 (URA) do parasita selvagem, em um mutante nulo
para esse gene, em conjunto com a droga 5-FOA, de forma semelhante comumente
utilizada em leveduras com o gene ura3. Para a aplicao dessa abordagem em T.
cruzi, no entanto, duas etapas eram necessrias: (1) verificao da sensibilidade do
parasita Ura
+
ao 5-FOA, e (2) gerao de um parasita Ura
-
. Com base nas
concentraes definidas como letais para T. brucei (SCAHILL, PASTAR & CROSS,
2008), foram feitos testes com diferentes concentraes da droga em diferentes meios
de cultura, at uma concentrao 500 vezes superior a concentrao definida como
IC
50
e quase 100 vezes maior do que a concentrao que mata rapidamente formas
sanguneas de T. brucei, mas nenhum dficit grave de crescimento foi detectado.
Na ausncia de um marcador de seleo negativa para o cassete reciclvel, foi
cogitada a possibilidade de usar protenas fluorescentes substituindo os dois
marcadores de seleo. Antes de testar essa estratgia aliada ao sistema CRE/lox, no
entanto, era necessrio verificar se seria possvel isolar parasitas nocauteados com
GFP atravs de cell sorting no citmetro de fluxo. Para isso, foi construdo o vetor
pGFP-KO, que consiste basicamente no vetor pNEO2 com a regio codificante de
eGFP no lugar de neo, cujo cassete foi fusionado s intergnicas das miosinas
previamente nocauteadas e o produto transfectado nos parasitas hemizigticos, com
um dos alelos selvagens j nocateaudos com o cassete NEO2, na tentativa de obter o
duplo nocaute.
111

Considerando a possibilidade de o nocaute duplo ser deletrio de alguma forma
para a clula, optou-se por fazer o cell sorting em at 48 horas aps a transfeco, com
o intuito de diminuir a prevalncia das clulas GFP
-
em relao s GFP
+
na populao
transfectada.
Na estratgia single cell de captura dos parasitas, a qual foi realizada primeiro, a
maior parte das clulas isoladas no cresceu no meio de cultura, provavelmente por
danos causados s clulas pela eletroporao. Tambm foi verificado que grande parte
dos eventos com alta fluorescncia (principalmente em 24 horas) eram grandes grumos
de debris celular ou clulas menores sobrepostas, o que diminuiu muito a chance de
que um clone real fosse isolado. Finalmente, os parasitas que cresceram aps a
seleo apresentaram perfil de fluorescncia para GFP idnticos a parasitas selvagens,
indicando que eram na verdade parasitas sem a ocorrncia de insero do cassete
GFP que apresentaram fluorescncia intrnseca maior do que o extremo de uma
amostra da cultura controle, e no os poucos parasitas transfectados que no foram
passiveis de serem recuperados na seleo por citometria celular.
Para aumentar a chance de que fossem isolados parasitas, e no artefatos, com
maior fluorescncia, partiu-se do pressuposto de que os mutantes estariam distribudos
aleatoriamente ao longo da curva de tamanho celular, e dentro desta s foram
selecionados os eventos de tamanho inferior mediana para o cell sorting de
enriquecimento. Comparando a populao pr e ps-sorting era observado de fato um
enriquecimento nos parasitas de tamanho menor, porm apenas um aumento muito
pequeno na fluorescncia mdia, que no se manteve aps o crescimento da cultura
ao longo dos quatro cell sortings consecutivos - indicando no haver enriquecimento
de mutantes GFP
+
.
Em ambos os experimentos de transfeco com GFP, devido baixa proporo
de clulas em que a mutao desejada ocorreria em relao populao selvagem, e
ausncia de presso seletiva para que a populao mutante prevalecesse, os poucos
eventos GFP
+
ficaram mascarados pelo excesso de eventos GFP
-
. Sucesso j foi
obtido em usar GFP como marcador para nocaute e seleo por citometria de fluxo em
S. cerevisiae (SUZUKI et al., 2011). Aps repetidos ciclos de captura e cultivo das
clulas mais fluorescentes da populao foi possvel obter mutantes nocautes para
112

famlias completas de genes; no entanto, a funcionalidade do protocolo dependeu da
insero (junto a GFP) de um gene de resistncia droga. A adio de um marcador
de seleo ao cassete de pGFP-KO pode permitir que o mesmo seja feito com T. cruzi.

113

7 CONCLUSO


Neste trabalho foi iniciado o desenvolvimento de um sistema para nocautes
gnicos em larga escala baseado em PCR de fuso, com vrios resultados obtidos no
processo:
- o software desenvolvido - TcruziKO - foi bem sucedido em gerar iniciadores
para amplificar regies intergnicas de T. cruzi com maior eficincia, em comparao a
iniciadores gerados apenas com o software Primer3;
- a tcnica de PCR de fuso desenvolvida teve uma eficincia final mdia de
~70% sem serem feitas alteraes caso a caso para otimizao, tonando-a vivel para
aplicaes em larga escala;
- todos os cassetes gerados por PCR de fuso com NEO com regies de
recombinao com mais de 250 pb foram capazes de gerar mutantes nocautes para
genes especficos corretamente aps a transfeco;
- os testes com o cido 5-fluoroortico demonstram que a droga invivel para
ser utilizada junto ao gene que codifica a enzima orotidina-5-fosfato descarboxilase/
orotato fosforibosiltransferase como marcador de seleo negativa em Trypanosoma
cruzi Dm 28c. No momento no existe um par gene/droga que possa ser utilizado como
marcador negativo para T. cruzi; e
- utilizando eGFP como gene marcador, numa estratgia alternativa ao uso de
um gene de seleo negativa, no foi possvel obter clulas recombinantes com
nenhuma das estratgias empregadas.
De maneira geral, o presente projeto tinha dois objetivos primrios distintos: a
criao de um sistema para a produo de nocautes em T. cruzi de forma eficiente e
rpida, para a sua utilizao em um cenrio de larga escala; e o estabelecimento de
um sistema de nocautes mltiplos sequenciais, baseado em um marcador de seleo
negativa e na utilizao do sistema Cre/lox. O primeiro objetivo foi alcanado
plenamente, com o desenvolvimento do software TcruziKO e no estabelecimento do
protocolo de PCR de fuso; o segundo objetivo no foi alcanado, primariamente pela
impossibilidade do gene URA ser utilizado como marcador de seleo negativa, e pela
114

ineficincia da eGFP ser um substituto. No entanto, diversos elementos foram criados
para esse objetivo: criao de um vetor visando expressar Cre em T. cruzi,
incorporao dos stios loxP nos vetores contendo os marcadores positivos e a criao
de vetores contendo genes fluorescentes de maior intensidade. Alm disso, a
incorporao de outros genes de resistncia uma alternativa para a criao de
nocautes duplos de genes, o que geralmente o mais utilizado em um cenrio de
deleo de genes redundantes.
De qualquer forma, a pesquisa desenvolvida no presente projeto criou uma base
para que nocautes possam ser utilizados em projetos em larga escala futuramente em
T. cruzi. Diversos pontos permaneceram em aberto, e novas idias foram criadas a
partir dos resultados obtidos. Na continuao, como perspectivas para a linha de
pesquisa, esto:
- publicao do software TcruziKO, ainda no primeiro semestre de 2013;
- melhoria do protocolo de fuso, para um aumento da robustez e da
reprodutibilidade;
- teste do protocolo de fuso com os demais marcadores;
- teste da viabilidade de seleo de nocautes por citometria de fluxo, seguindo o
mesmo protocolo testado, porm utilizando as protenas com intensidade de
fluorescncia maior, recm adicionadas ao sistema (E2-Crimson, VFP) ao invs de
eGFP;
- construo de vetores para nocaute contendo dois marcadores de seleo: um
gene que codifica protena fluorescente e um gene de resistncia, com e sem stios lox,
e teste do vetor construdo para nocautes mltiplos sequenciais em T. cruzi;
- testes de transfeco transiente de pTcGW-CRE para verificao do nvel de
expresso e toxicidade em T. cruzi; e
- incorporao do sistema MultiSite Gateway plataforma, como uma
alternativa de alta eficincia PCR de fuso para construo de cassetes para
nocaute;
115

REFERNCIAS

ABREMSKI, K.; HOESS, R.; STERNBERG, N. Studies on the properties of P1 site-
specific recombination: evidence for topologically unlinked products following
recombination. Cell, v. 32, n. 4, p. 1301-11, abr. 1983.
AGABIAN, N. Trans splicing of nuclear pre-mRNAs. Cell, v. 61, n. 7, p. 1157-60, 29 jun.
1990.
AJIOKA, J.; SWINDLE, J. The calmodulin-ubiquitin (CUB) genes of Trypanosoma cruzi
are essential for parasite viability. Molecular and biochemical parasitology, v. 78, p.
217-225, 1996.
ALANI, E.; CAO, L.; KLECKNER, N. A Method for Gene Disruption That Allows
Repeated Use of USR3 Selection in the Construction of Multiply Disrupted Yeast
Strains. Genetics, v. 116, n. 4, p. 541-545, 1 ago. 1987.
ALBERT, H. et al. Site-specific integration of DNA into wild-type and mutant lox sites
placed in the plant genome. The Plant journal: for cell and molecular biology, v. 7,
n. 4, p. 649-59, maio. 1995.
ALLAOUI, A. et al. Intracellular growth and metacyclogenesis defects in Trypanosoma
cruzi carrying a targeted deletion of a Tc52 protein-encoding allele. Molecular
microbiology, v. 32, n. 6, p. 1273-1286, 1999.
ALTSCHUL, S. F. et al. Basic local alignment search tool. Journal of molecular
biology, v. 215, n. 3, p. 403-10, 5 out. 1990.
AMBERG, D. C.; BOTSTEIN, D.; BEASLEY, E. M. Precise gene disruption in
Saccharomyces cerevisiae by double fusion polymerase chain reaction. Yeast
(Chichester, England), v. 11, n. 13, p. 1275-80, out. 1995.
ANNOURA, T. et al. The origin of dihydroorotate dehydrogenase genes of
kinetoplastids, with special reference to their biological significance and adaptation to
anaerobic, parasitic conditions. Journal of molecular evolution, v. 60, n. 1, p. 113-27,
jan. 2005.
ARAGO, M. B. [Domiciliation of Triatominae or pre-adaptation to anthropophily and
ornithophily?]. Revista de sade pblica, v. 17, n. 1, p. 51-5, fev. 1983.
ASLETT, M. et al. TriTrypDB: a functional genomic resource for the Trypanosomatidae.
Nucleic acids research, v. 38, n. Database issue, p. D457-62, jan. 2010.
116

AZEVEDO, H. P. DE; ROITMAN, I. Growth of the Y strain of Trypanosoma cruzi in an
HX25-modified defined medium. The Journal of parasitology, v. 63, n. 3, p. 485, jun.
1977.
BARNES, R. L.; MCCULLOCH, R. Trypanosoma brucei homologous recombination is
dependent on substrate length and homology, though displays a differential
dependence on mismatch repair as substrate length decreases. Nucleic acids
research, v. 35, n. 10, p. 3478-93, jan. 2007.
BARRIO, A. B.; VOORHIS, W. C. VAN; BASOMBRO, M. A. Trypanosoma cruzi:
attenuation of virulence and protective immunogenicity after monoallelic disruption of
the cub gene. Experimental parasitology, v. 117, n. 4, p. 382-9, dez. 2007.
BATISTA, M. et al. A high-throughput cloning system for reverse genetics in
Trypanosoma cruzi. BMC microbiology, v. 10, n. 1, p. 259, jan. 2010.
BAUDIN, A et al. A simple and efficient method for direct gene deletion in
Saccharomyces cerevisiae. Nucleic acids research, v. 21, n. 14, p. 3329-30, 11 jul.
1993.
BAYER, T. A.; CAMPOS-ORTEGA, J. A. A transgene containing lacZ is expressed in
primary sensory neurons in zebrafish. Development (Cambridge, England), v. 115, n.
2, p. 421-6, jun. 1992.
BENCHIMOL BARBOSA, P. R. The oral transmission of Chagas disease: an acute
form of infection responsible for regional outbreaks. International journal of
cardiology, v. 112, n. 1, p. 132-3, 10 set. 2006.
BENNE, R. RNA editing in trypanosomes. European journal of biochemistry / FEBS,
v. 221, n. 1, p. 9-23, 1 abr. 1994.
BENZ, C. et al. Messenger RNA processing sites in Trypanosoma brucei. Molecular
and biochemical parasitology, v. 143, n. 2, p. 125-34, out. 2005.
BERRIMAN, M. et al. The genome of the African trypanosome Trypanosoma brucei.
Science (New York, N.Y.), v. 309, n. 5733, p. 416-22, 15 jul. 2005.
BIBIKOVA, M. et al. Enhancing gene targeting with designed zinc finger nucleases.
Science (New York, N.Y.), v. 300, n. 5620, p. 764, 2 maio. 2003.
BOEKE, J. D.; LACROUTE, F.; FINK, G. R. A positive selection for mutants lacking
orotidine-5-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Molecular & general genetics: MGG, v. 197, n. 2, p. 345-6, jan. 1984.
117

BOOTHROYD, J. C.; CROSS, G. A. Transcripts coding for variant surface glycoproteins
of Trypanosoma brucei have a short, identical exon at their 5 end. Gene, v. 20, n. 2, p.
281-9, dez. 1982.
BRENER, Z.; ANDRADE, Z.; BARRAL-NETO, M. Trypanosoma cruzi e a Doena de
Chagas. Rio de Janeiro: Guanabara Koogan, 2000.
BRISSE, S.; BARNAB, C.; TIBAYRENC, M. Identification of six Trypanosoma cruzi
phylogenetic lineages by random amplified polymorphic DNA and multilocus enzyme
electrophoresis. International journal for parasitology, v. 30, n. 1, p. 35-44, jan. 2000.
BUCKNER, F. S.; WILSON, A J.; VOORHIS, W. C. VAN. Trypanosoma cruzi: use of
herpes simplex virus-thymidine kinase as a negative selectable marker. Experimental
parasitology, v. 86, n. 3, p. 171-80, jul. 1997.
CAHILL, D.; CONNOR, B.; CARNEY, J. P. Mechanisms of eukaryotic DNA double
strand break repair. Frontiers in bioscience: a journal and virtual library, v. 11, p.
1958-76, jan. 2006.
CALER, E. V et al. Oligopeptidase B-dependent signaling mediates host cell invasion by
Trypanosoma cruzi. The EMBO journal, v. 17, n. 17, p. 4975-86, 1 set. 1998.
CAMPBELL, D. A.; THOMAS, S.; STURM, N. R. Transcription in kinetoplastid protozoa:
why be normal? Microbes and infection / Institut Pasteur, v. 5, n. 13, p. 1231-40,
nov. 2003.
CAMPOS, P.; SILVA, V. Trypanosoma cruzi MSH2: Functional analyses on different
parasite strains provide evidences for a role on the oxidative stress response.
Molecular and , v. 176, n. 1, p. 8-16, 2011.
CANO, M. I. et al. Molecular karyotype of clone CL Brener chosen for the Trypanosoma
cruzi genome project. Molecular and biochemical parasitology, v. 71, n. 2, p. 273-8,
maio. 1995.
CAPECCHI, M. R. Altering the genome by homologous recombination. Science (New
York, N.Y.), v. 244, n. 4910, p. 1288-92, 16 jun. 1989.
CAVALIER-SMITH, T. Kingdom protozoa and its 18 phyla. Microbiological reviews, v.
57, n. 4, p. 953-94, dez. 1993.
CAVALIER-SMITH, T. Kingdoms Protozoa and Chromista and the eozoan root of the
eukaryotic tree. Biology letters, v. 6, n. 3, p. 342-5, 23 jun. 2010.
CHAGAS, C. Nova tripanosomiaze humana. Estudos sobre a morfologia e o ciclo
evolutivo do Schizotrypanum cruzi n. gen., n. sp., ajente etiolojico de nova entidade
mrbida do homem. Memrias do Instituto Oswaldo Cruz, v. 1, p. 159-218, 1909.
118

CLAYTON, C. E. Life without transcriptional control? From fly to man and back again.
The EMBO journal, v. 21, n. 8, p. 1881-8, 15 abr. 2002.
CONTE, I. et al. The interplay between folding-facilitating mechanisms in Trypanosoma
cruzi endoplasmic reticulum. Molecular biology of the cell, v. 14, n. September, p.
3529-3540, 2003.
CONTRERAS, V. T. et al. Biological aspects of the Dm 28c clone of Trypanosoma cruzi
after metacyclogenesis in chemically defined media. Memrias do Instituto Oswaldo
Cruz, v. 83, n. 1, p. 123-33, 1988.
COOPER, R.; JESUS, A R. DE; CROSS, G. A. Deletion of an immunodominant
Trypanosoma cruzi surface glycoprotein disrupts flagellum-cell adhesion. The Journal
of cell biology, v. 122, n. 1, p. 149-56, jul. 1993.
COURA, J. R. Chagas disease: what is known and what is needed--a background
article. Memrias do Instituto Oswaldo Cruz, v. 102 Suppl , n. August, p. 113-22, 30
out. 2007.
CRUZ, A.; BEVERLEY, S. M. Gene replacement in parasitic protozoa. Nature, v. 348,
n. 6297, p. 171-173, 1990.
DEURSEN, J. VAN et al. Cre-mediated site-specific translocation between
nonhomologous mouse chromosomes. Proceedings of the National Academy of
Sciences of the United States of America, v. 92, n. 16, p. 7376-80, 1 ago. 1995.
DIAS, J. P. et al. Acute Chagas disease outbreak associated with oral transmission.
Revista da Sociedade Brasileira de Medicina Tropical, v. 41, n. 3, p. 296-300, jun.
2008.
DOCAMPO, R. et al. Intracellular Ca2+ storage in acidocalcisomes of Trypanosoma
cruzi. The Biochemical journal, v. 310 ( Pt 3, p. 1005-12, 15 set. 1995.
DOCAMPO, R.; MORENO, S. N. J. Acidocalcisomes. Cell calcium, v. 50, n. 2, p. 113-
9, ago. 2011.
EL-SAYED, N. M. et al. The genome sequence of Trypanosoma cruzi, etiologic agent of
Chagas disease. Science (New York, N.Y.), v. 309, n. 5733, p. 409-15, 15 jul. 2005.
EL-SAYED, N. M. et al. Comparative genomics of trypanosomatid parasitic protozoa.
Science (New York, N.Y.), v. 309, n. 5733, p. 404-9, 15 jul. 2005.
FRANCISCO, E. L. Anlise do padro de decaimento do transcriptoma de
Trypanosoma cruzi. [s.l.] Universidade Federal do Paran, 2011.
119

FRANZN, O. et al. Shotgun sequencing analysis of Trypanosoma cruzi I Sylvio X10/1
and comparison with T. cruzi VI CL Brener. PLoS neglected tropical diseases, v. 5, n.
3, p. e984, jan. 2011.
FRANZN, O. et al. Shotgun sequencing analysis of Trypanosoma cruzi I Sylvio X10/1
and comparison with T. cruzi VI CL Brener. PLoS neglected tropical diseases, v. 5, n.
3, p. e984, jan. 2011.
FREISTADT, M. S.; CROSS, G. A.; ROBERTSON, H. D. Discontinuously synthesized
mRNA from Trypanosoma brucei contains the highly methylated 5 cap structure,
m7GpppA*A*C(2'-O)mU*A. The Journal of biological chemistry, v. 263, n. 29, p.
15071-5, 15 out. 1988.
FRIEDRICH, G.; SORIANO, P. Promoter traps in embryonic stem cells: a genetic
screen to identify and mutate developmental genes in mice. Genes & development, v.
5, n. 9, p. 1513-23, set. 1991.
GAUD, A et al. Polymerase chain reaction-based gene disruption in Trypanosoma
brucei. Molecular and biochemical parasitology, v. 87, n. 1, p. 113-5, jul. 1997.
GIBSON, W. C.; SWINKELS, B. W.; BORST, P. Post-transcriptional control of the
differential expression of phosphoglycerate kinase genes in Trypanosoma brucei.
Journal of Molecular Biology, v. 201, n. 2, p. 315-325, maio. 1988.
GLUENZ, E.; TAYLOR, M. C.; KELLY, J. M. Trypanosoma cruzi metacyclic-specific
protein Met-III associates with the nucleolus and contains independent amino and
carboxyl terminal targeting elements. International journal for parasitology, v. 37, p.
617-625, 2007.
GODOY, L. M. F. DE et al. Quantitative proteomics of Trypanosoma cruzi during
metacyclogenesis. Proteomics, v. 12, n. 17, p. 2694-703, ago. 2012.
GUILBRIDE, D. L.; ENGLUND, P. T. The replication mechanism of kinetoplast DNA
networks in several trypanosomatid species. Journal of cell science, v. 111 ( Pt 6, p.
675-9, mar. 1998.
HAMMOND, D. J.; GUTTERIDGE, W. E. Enzymes of pyrimidine biosynthesis in
Trypanosoma cruzi. FEBS letters, v. 118, n. 2, p. 259-62, 8 set. 1980.
HARIHARAN, S.; AJIOKA, J.; SWINDLE, J. Stable transformation of Trypanosoma
cruzi: inactivation of the PUB12. 5 polyubiquitin gene by targeted gene disruption.
Molecular and biochemical parasitology, v. 57, p. 15-30, 1993.
HIGUCHI, R.; KRUMMEL, B.; SAIKI, R. A general method of in vitro preparation and
specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic
Acids Research, v. 16, n. 15, p. 7351-7367, 1988.
120

HOESS, R. H.; ZIESE, M.; STERNBERG, N. P1 site-specific recombination: nucleotide
sequence of the recombining sites. Proceedings of the National Academy of
Sciences of the United States of America, v. 79, n. 11, p. 3398-402, jun. 1982.
HORTON, R. M. et al. Engineering hybrid genes without the use of restriction enzymes:
gene splicing by overlap extension. Gene, v. 77, n. 1, p. 61-68, abr. 1989.
IIIZUMI, S. et al. Simple one-week method to construct gene-targeting vectors:
application to production of human knockout cell lines. BioTechniques, v. 41, n. 3, p.
311-316, set. 2006.
ILAGAN, R. P. et al. A new bright green-emitting fluorescent protein--engineered
monomeric and dimeric forms. The FEBS journal, v. 277, n. 8, p. 1967-78, abr. 2010.
IVENS, A. C. et al. The genome of the kinetoplastid parasite, Leishmania major.
Science (New York, N.Y.), v. 309, n. 5733, p. 436-42, 15 jul. 2005.
JACKSON, A. P. et al. The genome sequence of Trypanosoma brucei gambiense,
causative agent of chronic human african trypanosomiasis. PLoS neglected tropical
diseases, v. 4, n. 4, p. e658, jan. 2010.
JAYARAMAN, K. et al. Polymerase chain reaction-mediated gene synthesis: synthesis
of a gene coding for isozyme c of horseradish peroxidase. Proceedings of the
National Academy of Sciences of the United States of America, v. 88, n. 10, p.
4084-8, 1991.
JOHNSON, P. J.; KOOTER, J. M.; BORST, P. Inactivation of transcription by UV
irradiation of T. brucei provides evidence for a multicistronic transcription unit including
a VSG gene. Cell, v. 51, n. 2, p. 273-81, 23 out. 1987.
KELLY, J. M. et al. A shuttle vector which facilitates the expression of transfected genes
in Trypanosoma cruzi and Leishmania. Nucleic acids research, v. 20, n. 15, p. 3963-9,
11 ago. 1992.
KESSLER, R. L. Transcriptmica de Trypanosoma cruzi em resposta a inibidores
da sntese de esteris. [s.l.] Universidade Federal do Paran, 2010.
KIM, Y. G.; CHA, J.; CHANDRASEGARAN, S. Hybrid restriction enzymes: zinc finger
fusions to Fok I cleavage domain. Proceedings of the National Academy of Sciences
of the United States of America, v. 93, n. 3, p. 1156-60, 6 fev. 1996.
KUWAYAMA, H. et al. A novel PCR-mediated method for one-tube generation of a
gene disruption construct. Biotechnology Letters, v. 24, n. 16, p. 1307-1312, 2002.
121

LEBOWITZ, J. H.; CRUZ, A.; BEVERLEY, S. M. Thymidine kinase as a negative
selectable marker in Leishmania major. Molecular and biochemical parasitology, v.
51, n. 2, p. 321-5, abr. 1992.
LI, X.; HEYER, W.-D. Homologous recombination in DNA repair and DNA damage
tolerance. Cell research, v. 18, n. 1, p. 99-113, jan. 2008.
LIANG, X. -H. et al. trans and cis Splicing in Trypanosomatids: Mechanism, Factors,
and Regulation. Eukaryotic Cell, v. 2, n. 5, p. 830-840, 10 out. 2003.
LIEBER, M. R. The mechanism of double-strand DNA break repair by the
nonhomologous DNA end-joining pathway. Annual review of biochemistry, v. 79, n.
D, p. 181-211, jan. 2010.
LIU, B. et al. Fellowship of the rings: the replication of kinetoplast DNA. Trends in
parasitology, v. 21, n. 8, p. 363-9, ago. 2005.
LOONSTRA, A. et al. Growth inhibition and DNA damage induced by Cre recombinase
in mammalian cells. Proceedings of the National Academy of Sciences of the
United States of America, v. 98, n. 16, p. 9209-14, 31 jul. 2001.
LU, H.-Y.; BUCK, G. A. Expression of an exogenous gene in Trypanosoma cruzi
epimastigotes. Molecular and biochemical parasitology, v. 44, p. 109-114, 1991.
MACEDO, A. M.; OLIVEIRA, R. P.; PENA, S. D. J. Chagas disease: role of parasite
genetic variation in pathogenesis. Expert reviews in molecular medicine, v. 4, n. 05,
p. 1-16, 13 mar. 2002.
MACRAE, J. I. et al. The suppression of galactose metabolism in Trypanosoma cruzi
epimastigotes causes changes in cell surface molecular architecture and cell
morphology. Molecular and biochemical parasitology, v. 147, n. 1, p. 126-36, maio.
2006.
MAIR, G. et al. A new twist in trypanosome RNA metabolism: cis-splicing of pre-mRNA.
RNA (New York, N.Y.), v. 6, n. 2, p. 163-9, fev. 2000.
MANNING-CELA, R. et al. LYT1 protein is required for efficient in vitro infection by
Trypanosoma cruzi. Infection and , v. 69, n. 6, p. 3916-3923, 2001.
MARCHINI, F. K. et al. Profiling the Trypanosoma cruzi phosphoproteome. PloS one, v.
6, n. 9, p. e25381, jan. 2011.
MARTNEZ-CALVILLO, S. et al. Transcription of Leishmania major Friedlin
chromosome 1 initiates in both directions within a single region. Molecular cell, v. 11,
n. 5, p. 1291-9, maio. 2003.
122

MARTNEZ-CALVILLO, S. et al. Gene expression in trypanosomatid parasites. Journal
of biomedicine & biotechnology, v. 2010, p. 525241, jan. 2010.
MATTHEWS, K. R.; TSCHUDI, C.; ULLU, E. A common pyrimidine-rich motif governs
trans-splicing and polyadenylation of tubulin polycistronic pre-mRNA in trypanosomes.
Genes & development, v. 8, n. 4, p. 491-501, 15 fev. 1994.
MEDINA-ACOSTA, E.; CROSS, G. A. Rapid isolation of DNA from trypanosomatid
protozoa using a simple mini-prep procedure. Molecular and biochemical
parasitology, v. 59, n. 2, p. 327-9, jun. 1993.
MEYER, H.; PORTER, K. R. A study of Trypanosoma cruzi with the electron
microscope. Parasitology, v. 44, n. 1-2, p. 16-23, maio. 1954.
MICHELS, P. A. M. et al. Metabolic functions of glycosomes in trypanosomatids.
Biochimica et biophysica acta, v. 1763, n. 12, p. 1463-77, dez. 2006.
MILHAUSEN, M. et al. Identification of a small RNA containing the trypanosome spliced
leader: a donor of shared 5 sequences of trypanosomatid mRNAs? Cell, v. 38, n. 3, p.
721-9, out. 1984.
MORRIS, J. C. et al. Replication of kinetoplast DNA: an update for the new millennium.
International journal for parasitology, v. 31, n. 5-6, p. 453-8, 1 maio. 2001.
MYLER, P. J. et al. Leishmania major Friedlin chromosome 1 has an unusual
distribution of protein-coding genes. Proceedings of the National Academy of
Sciences of the United States of America, v. 96, n. 6, p. 2902-6, 16 mar. 1999.
NAGY, A. et al. Dissecting the role of N-myc in development using a single targeting
vector to generate a series of alleles. Current biology: CB, v. 8, n. 11, p. 661-4, 21
maio. 1998.
NAYAK, T. et al. A versatile and efficient gene-targeting system for Aspergillus nidulans.
Genetics, v. 172, n. 3, p. 1557-66, mar. 2006.
NELSON, R. G. et al. Sequences homologous to the variant antigen mRNA spliced
leader are located in tandem repeats and variable orphons in trypanosoma brucei. Cell,
v. 34, n. 3, p. 901-9, out. 1983.
NINOMIYA, Y. et al. Highly efficient gene replacements in Neurospora strains deficient
for nonhomologous end-joining. Proceedings of the National Academy of Sciences
of the United States of America, v. 101, n. 33, p. 12248-53, 17 ago. 2004.
NOZAKI, T.; CROSS, G. A. Functional complementation of glycoprotein 72 in a
Trypanosoma cruzi glycoprotein 72 null mutant. Molecular and biochemical
parasitology, v. 67, n. 1, p. 91-102, set. 1994.
123

NBREGA, O. T. et al. HygR and PurR plasmid vectors for episomal transfection of
Trypanosoma cruzi. Memrias do Instituto Oswaldo Cruz, v. 99, n. 5, p. 513-516,
ago. 2004.
ORR-WEAVER, T. L.; SZOSTAK, J. W.; ROTHSTEIN, R. J. Yeast transformation: a
model system for the study of recombination. Proceedings of the National Academy
of Sciences of the United States of America, v. 78, n. 10, p. 6354-8, out. 1981.
OTSU, K.; DONELSON, J. E.; KIRCHHOFF, L. V. Interruption of a Trypanosoma cruzi
gene encoding a protein containing 14-amino acid repeats by targeted insertion of the
neomycin phosphotransferase gene. Molecular and biochemical parasitology, v. 57,
n. 2, p. 317-30, fev. 1993.
OKANE, C. J.; GEHRING, W. J. Detection in situ of Genomic Regulatory Elements in
Drosophila. Proceedings of the National Academy of Sciences, v. 84, n. 24, p. 9123-
9127, 15 dez. 1987.
PAPADOPOULOU, B.; DUMAS, C. Parameters controlling the rate of gene targeting
frequency in the protozoan parasite Leishmania. Nucleic acids research, v. 25, n. 21,
p. 4278-86, 1 dez. 1997.
PARSONS, M. et al. Trypanosome mRNAs share a common 5 spliced leader
sequence. Cell, v. 38, n. 1, p. 309-16, ago. 1984.
PASSOS-SILVA, D. G. et al. Overview of DNA Repair in Trypanosoma cruzi,
Trypanosoma brucei, and Leishmania major. Journal of nucleic acids, v. 2010, p.
840768, jan. 2010.
PAVONI, D. P. Caracterizao genmica funcional das formas infectivas do
Trypanosoma cruzi. [s.l.] Instituto Oswaldo Cruz, 2005.
PEACOCK, C. S. et al. Comparative genomic analysis of three Leishmania species that
cause diverse human disease. Nature genetics, v. 39, n. 7, p. 839-47, jul. 2007.
PEREZ BRANDAN, C. et al. Knockout of the dhfr-ts gene in Trypanosoma cruzi
generates attenuated parasites able to confer protection against a virulent challenge.
PLoS neglected tropical diseases, v. 5, n. 12, p. e1418, dez. 2011.
PERRY, K. L. Trypanosome mRNAs Have Unusual ``Cap 4' Structures Acquired by
Addition of a Spliced Leader. Proceedings of the National Academy of Sciences, v.
84, n. 23, p. 8190-8194, 1 dez. 1987.
PETERSEN, L. K.; STOWERS, R. S. A Gateway MultiSite recombination cloning toolkit.
PloS one, v. 6, n. 9, p. e24531, jan. 2011.
124

PORTMAN, N.; GULL, K. The paraflagellar rod of kinetoplastid parasites: from structure
to components and function. International journal for parasitology, v. 40, n. 2, p. 135-
48, fev. 2010.
PRETI, H. Anlise do interatoma de protenas ligadoras de RNA em Trypanosoma
cruzi. [s.l.] Universidade Federal do Paran, 2012.
PROBST, C. M. Descrio da metaciclognese de Trypanosoma cruzi pelo uso de
microarranjos de DNA. [s.l.] Instituto Oswaldo Cruz, 2005.
QIN, M. et al. Cre recombinase-mediated site-specific recombination between plant
chromosomes. Proceedings of the National Academy of Sciences of the United
States of America, v. 91, n. 5, p. 1706-10, 1 mar. 1994.
ROTHSTEIN, R. J. One-step gene disruption in yeast. Methods in enzymology, v.
101, p. 202-211, jan. 1983.
ROZEN, S.; SKALETSKY, H. Primer3 on the WWW for general users and for biologist
programmers. Methods in molecular biology (Clifton, N.J.), v. 132, p. 365-86, jan.
2000.
SAITO, R. M.; ELGORT, M. G.; CAMPBELL, D. A. A conserved upstream element is
essential for transcription of the Leishmania tarentolae mini-exon gene. The EMBO
journal, v. 13, n. 22, p. 5460-9, 15 nov. 1994.
SANTALUCIA, J. A unified view of polymer, dumbbell, and oligonucleotide DNA
nearest-neighbor thermodynamics. Proceedings of the National Academy of
Sciences, v. 95, n. 4, p. 1460-1465, 17 fev. 1998.
SANTRICH, C. et al. A motility function for the paraflagellar rod of Leishmania parasites
revealed by PFR-2 gene knockouts. Molecular and biochemical parasitology, v. 90,
n. 1, p. 95-109, 1 dez. 1997.
SCAHILL, M. D.; PASTAR, I.; CROSS, G. A M. CRE recombinase-based positive-
negative selection systems for genetic manipulation in Trypanosoma brucei. Molecular
and biochemical parasitology, v. 157, n. 1, p. 73-82, jan. 2008.
SCHNTGEN, F. et al. High throughput gene trapping and postinsertional modifications
of gene trap alleles. Methods (San Diego, Calif.), v. 53, n. 4, p. 347-55, abr. 2011.
SERPELONI, M. et al. An essential nuclear protein in trypanosomes is a component of
mRNA transcription/export pathway. PloS one, v. 6, n. 6, p. e20730, jan. 2011.
SKARNES, W. C.; AUERBACH, B. A; JOYNER, A L. A gene trap approach in mouse
embryonic stem cells: the lacZ reported is activated by splicing, reflects endogenous
125

gene expression, and is mutagenic in mice. Genes & Development, v. 6, n. 6, p. 903-
918, 1 jun. 1992.
SOARES, M. J. The reservosome of Trypanosoma cruzi epimastigotes: an organelle of
the endocytic pathway with a role on metacyclogenesis. Memrias do Instituto
Oswaldo Cruz, v. 94 Suppl 1, p. 139-41, jan. 1999.
SOARES, M. J.; SOUZA, W. DE. Cytoplasmic organelles of trypanosomatids: a
cytochemical and stereological study. Journal of submicroscopic cytology and
pathology, v. 20, n. 2, p. 349-61, abr. 1988.
SOARES, M. J.; SOUZA, W. DE. Endocytosis of gold-labeled proteins and LDL by
Trypanosoma cruzi. Parasitology research, v. 77, n. 6, p. 461-8, jan. 1991.
SOUTO, R. P. et al. DNA markers define two major phylogenetic lineages of
Trypanosoma cruzi. Molecular and biochemical parasitology, v. 83, n. 2, p. 141-52,
20 dez. 1996.
SOUTO-PADRN, T.; SOUZA, W. DE. Cytochemical analysis at the fine-structural level
of trypanosomatids stained with phosphotungstic acid. The Journal of protozoology,
v. 26, n. 4, p. 551-7, nov. 1979.
SOUZA, F. S. P. DE et al. Knockout of the gene encoding the kinetoplast-associated
protein 3 (KAP3) in Trypanosoma cruzi: effect on kinetoplast organization, cell
proliferation and differentiation. Molecular and biochemical parasitology, v. 172, n. 2,
p. 90-8, ago. 2010.
SOUZA, W. DE. A short review on the morphology of Trypanosoma cruzi: from 1909 to
1999. Memrias do Instituto Oswaldo Cruz, v. 94 Suppl 1, p. 17-36, jan. 1999.
STAJICH, J. E. et al. The Bioperl toolkit: Perl modules for the life sciences. Genome
research, v. 12, n. 10, p. 1611-8, out. 2002.
STERNBERG, N.; HAMILTON, D. Bacteriophage P1 site-specific recombination. I.
Recombination between loxP sites. Journal of molecular biology, v. 150, n. 4, p. 467-
86, 25 ago. 1981.
STRACK, R. L. et al. A rapidly maturing far-red derivative of DsRed-Express2 for whole-
cell labeling. Biochemistry, v. 48, n. 35, p. 8279-81, 8 set. 2009.
STUART, K. D. et al. Complex management: RNA editing in trypanosomes. Trends in
biochemical sciences, v. 30, n. 2, p. 97-105, fev. 2005.
SUZUKI, N. et al. New multiple-deletion method for the Corynebacterium glutamicum
genome, using a mutant lox sequence. Applied and environmental microbiology, v.
71, n. 12, p. 8472-8480, 2005.
126

SUZUKI, Y. et al. Knocking out multigene redundancies via cycles of sexual assortment
and fluorescence selection. Nature methods, v. 8, n. 2, p. 159-64, fev. 2011.
SNCHEZ VALDZ, F. J. et al. Trypanosoma cruzi carrying a monoallelic deletion of
the calreticulin (TcCRT) gene are susceptible to complement mediated killing and
defective in their metacyclogenesis. Molecular immunology, v. 53, n. 3, p. 198-205,
mar. 2013.
TANOWITZ, H. B. et al. Chagas disease. Clinical microbiology reviews, v. 5, n. 4, p.
400-19, out. 1992.
THOMAS, K. R.; CAPECCHI, M. R. Site-directed mutagenesis by gene targeting in
mouse embryo-derived stem cells. Cell, v. 51, n. 3, p. 503-12, 6 nov. 1987.
TYLER, K. M.; ENGMAN, D. M. The life cycle of Trypanosoma cruzi revisited.
International journal for parasitology, v. 31, n. 5-6, p. 472-81, 1 maio. 2001.
WACH, A. PCR-synthesis of marker cassettes with long flanking homology regions for
gene disruptions in S. cerevisiae. Yeast (Chichester, England), v. 12, n. 3, p. 259-65,
15 mar. 1996.
WEATHERLY, D. B.; BOEHLKE, C.; TARLETON, R. L. Chromosome level assembly of
the hybrid Trypanosoma cruzi genome. BMC genomics, v. 10, n. 1, p. 255, jan. 2009.
WHO. Chagas disease (American trypanosomiasis).
WILKINSON, S. R. et al. A mechanism for cross-resistance to nifurtimox and
benznidazole in trypanosomes. Proceedings of the National Academy of Sciences
of the United States of America, v. 105, n. 13, p. 5022-7, 1 abr. 2008.
WU, J.; KANDAVELOU, K.; CHANDRASEGARAN, S. Custom-designed zinc finger
nucleases: what is next? Cellular and molecular life sciences: CMLS, v. 64, n. 22, p.
2933-44, nov. 2007.
XU, D. et al. Evaluation of high efficiency gene knockout strategies for Trypanosoma
cruzi. BMC microbiology, v. 9, p. 90, jan. 2009.
ZHANG, G.; GURTU, V.; KAIN, S. R. An enhanced green fluorescent protein allows
sensitive detection of gene transfer in mammalian cells. Biochemical and biophysical
research communications, v. 227, n. 3, p. 707-11, 23 out. 1996.
ZHENG, B. et al. Engineering mouse chromosomes with Cre-loxP: range, efficiency,
and somatic applications. Molecular and cellular biology, v. 20, n. 2, p. 648-55, jan.
2000.
127

ZINGALES, B. et al. Epidemiology, biochemistry and evolution of Trypanosoma cruzi
lineages based on ribosomal RNA sequences. Memrias do Instituto Oswaldo Cruz,
v. 94 Suppl 1, p. 159-64, jan. 1999.
ZINGALES, B. et al. A new consensus for Trypanosoma cruzi intraspecific
nomenclature: second revision meeting recommends TcI to TcVI. Memrias do
Instituto Oswaldo Cruz, v. 104, n. 7, p. 1051-4, dez. 2009.