This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elseviers archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Author's personal copy

Protein Expression and Purication 70 (2010) 184190

Contents lists available at ScienceDirect

Protein Expression and Purication

journal homepage: www.elsevier.com/locate/yprep

Rabies glycoprotein fused with B subunit of cholera toxin expressed

in tobacco plants folds into biologically active pentameric protein
Sribash Roy, Antariksh Tyagi, Siddharth Tiwari, Ankit Singh, Samir V. Sawant,
Pradhyumna K. Singh, Rakesh Tuli *
National Botanical Research Institute, Council for Scientic and Industrial Research, Rana Pratap Marg, UP, Lucknow 226001, India

a r t i c l e

i n f o

Article history:
Received 26 August 2009
and in revised form 2 October 2009
Available online 8 October 2009
Keywords:
Cholera toxin
Edible vaccine
Mucosal carrier
Rabies glycoprotein

a b s t r a c t
The pentameric B subunit of cholera toxin (CtxB) is an efcient mucosal adjuvant for vaccines. We report
the expression of a chimeric protein comprising the synthetic cholera toxin B subunit fused at its C-terminal with rabies surface glycoprotein (G protein) in tobacco plants. The 80.3 kDa fusion polypeptide
expressed at 0.4% of the total soluble protein in leaves of the selected transgenic lines. The fusion protein
formed a 403 kDa pentameric protein which was functionally active in binding to GM1 receptor. The
plant-made protein had a higher afnity for GM1 receptor than the native bacterial CtxB. The pentameric
fusion protein was recognized by the anti-cholera toxin as well as anti-rabies antibodies. Its immunoprotective ability against rabies remains to be examined.
2009 Elsevier Inc. All rights reserved.

Introduction
Transgenic plants expressing foreign proteins of industrial and
pharmaceutical value are suggested to be economically viable alternatives to fermentation-based production systems. However, there
is a need to evaluate plants for the expression of a variety of functionally active eukaryotic proteins that undergo complex folding
and post translational modications. One such group of pharmaceutically important proteins is the subunit vaccine antigens. When
expressed in edible plant parts, these have been reported to be
effective as oral and mucosal antigens [13]. The expression level
of these antigens expressed in plants, as nuclear genes is often
low, ranging from 0.001% to 0.3% of total soluble protein (TSP)1
[4]. The low level expression limits the extent of immune response
and the development of an effective plant-based oral vaccine. Strategies like co-administration with an adjuvant [5] and fusion of antigens with an effective carrier molecule, either chemically or
genetically, can increase the immunogenicity of antigens [6,7].
In several studies, cholera toxin B subunit (CtxB) has been used
as a carrier for antigens [811]. CtxB is a homopentameric
(Mr  58,000) protein comprising the polypeptides (Mr  11,600)
arranged in a ring-like conguration. The native pentameric structure of CtxB and its binding to GM1 receptors are crucial for its
function as mucosal carrier and the resultant immunological re-

* Corresponding author. Fax: +91 0522 2205836/2205839.

E-mail address: rakeshtuli@hotmail.com (R. Tuli).
1
Abbreviations used: TSP, total soluble protein; PVDF, polyvinylidene uoride; HRP,
horseradish peroxidase; ALP, alkaline-phosphatase.
1046-5928/$ - see front matter 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.pep.2009.10.002

sponse. Conjugation of antigens with CtxB can reduce the dose required for T-cell activation by more than 10,000-fold as compared
to the free antigen [12]. Rabies virus genome encodes ve major
proteins- nucleoprotein (N), phosphoprotein (P), matrix protein
(M), glycoprotein (G) and RNA-dependent RNA polymerase (L)
[13,14]. The surface glycoprotein (G) plays an important role in viral pathogenesis and functions as a protective antigen [15]. One of
the strategies to control rabies in wild animals is to develop oral
vaccine that can be given as bait in the wild. This requires enhancing immunogenicity and expression of the G protein at high level
in plant tissue. With an aim to enhance immune response and
achieve high level expression of the G protein, plant codon optimized synthetic ctxB and G protein (rgp) genes were fused and
transformed into tobacco plants. The plants expressed the chimeric
CtxB-G protein which was puried from leaves of the transgenic
tobacco plants and analyzed for functional integrity.
Materials and methods
Construction of ctxB and rgp fusion and cloning into plant expression
cassette
We have earlier reported designing and cloning of plant codon
optimized synthetic ctxB gene of Vibrio cholerae O139 strain 1854
[16] and rgp gene of rabies virus glycoprotein [17] and their
expression in tobacco leaves. In this study, a glycineproline hinge
was used at the point of fusion of translational frames of the CtxB
and G proteins. The signal sequence PR-S, of the pathogenesis
induced tobacco protein PR-1a was used to facilitate transport of

Author's personal copy

185

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

the fusion protein to endoplasmic reticulum [18]. The pr-s-ctxB

was PCR amplied using a forward primer (50 ACTCTAGAA
TGAACTTCCTCAAGTCCTTC30 ) with XbaI and a reverse primer
(50 AGGCC CGGGACCGTTAGCCATGGAGATAG30 ) with SmaI site
using pSM31 [16] as the template DNA. The reverse primer was designed to include codons for the glycine-proline hinge at the 30 end
of ctxB. The synthetic G protein gene was PCR amplied using pSA5
[17] as template DNA and a forward primer (50 GGTCCCG
GGCCTAAGTTCCC TATCTACAC30 ) with SmaI site including codons
for the glycineproline of the hinge region. The reverse primer
(50 ACGAGCTCTCATCACAACTCATCCTTCTC30 ) carried a SacI site.
Amplied PCR fragments were digested with the respective
enzymes and triply ligated in the vector, pBI101 containing the
enhanced CaMV35S promoter to obtain pSR1241 with two glycine-proline repeats as hinge at the 3end of ctxB (Fig. 1).

Quantitative analysis of ctxB-rgp transcript by real-time PCR

Total RNA was prepared from the leaves of T 0 transgenic plants
in TRIZOL LS reagent (Invitrogen Life Technologies, USA) according
to manufacturers instructions. One lg RNA was used for the rststrand cDNA synthesis using c-DNA synthesis kit (PE Biosystems
Inc., USA). PCR on cDNA was performed using the forward
50 CCAAGCTTTCTAGATAAACAATGAACTTCCTCAAGTCATT 30 and reverse 50 GGATATAATCTTTCCGGACTGTGGAGT AACGGAGTCCACCCTACCGGT 30 primers. Expression of the ctxB-rgp transcript in
different transgenic lines was quantied by real-time PCR using
TaqMan probe (50 FAM TCCCAGA GATGCAGTCC-NFQ30 ) on ABI
Prism 7700 sequence detection system (TaqMan, PE Biosystems
Inc., USA). The ctxB-rgp transcript was normalized with respect to
ubiquitin transcript as internal control in the same sample. The relative fold expression of the ctxB-rgp gene was estimated in terms of
2DDC T [20]. The DCT was determined by subtracting ubiquitin CT
value from ctxB-rgp CT value in a given sample. The DDCT value
was determined by subtracting the lowest expressing plant (calibrator) DCT from the DCT of each plant.

Plant transformation and analysis

Agrobacterium tumefaciens LBA4404 was transformed with
pSR1241 by electroporation and used for tobacco (Nicotiana tabaccum cv. Petit Havana) transformation using the leaf disc method
[19]. The kanamycin resistant T0 plantlets were transferred to soil
in the green house and grown to maturity. Transgenic plants were
screened for the presence of the ctxB-rgp gene by PCR, using forward 50 ATCGATGTCGACTAACAACTTCCTCAAGTCTT30 and reverse
50 AGATCGTCGACTCATCACAACTCATCCCTCTCGGAC30 primers. Stable integration and copy number of the transgene were established
by Southern hybridization as described in [17]. Hybridization was
performed at 65 C for 16 h, using [aP32] dCTP labeled probe, comprising 570 bp XhoIAgeI fragment at 30 end of the gene. The membrane was exposed to Fuji screen for 24 h and scanned on phosphor
imager (Molecular Imager FX, Bio-Rad, and Hercules, USA).

Transgenic tobacco leaves were analyzed for the presence of

CtxB-G protein by immunoblot analysis. Leaf material (1 g) was
ground in liquid nitrogen and homogenized in 2 ml extraction buffer (50 mM sodium phosphate pH 7.5, 150 mM NaCl, 150 mM sorbitol, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl uoride,
2 mM plant protease inhibitors cocktail from Sigma, USA and
0.08% Triton-X 100. Total soluble protein content was determined
by Bradford assay [21]. Thirty lg TSP of transgenic and non-transgenic plants was electrophoresed on 10% denaturing SDS gel and
transferred to polyvinylidene uoride (PVDF) membrane. The

HindIII

RB
pSM31

Polyacrylamide gel electrophoresis and immunoblot analysis

Pnos

nptII

BglII

XbaI
pr-s

Tnos PECaMV35S

SacI

LB
Tnos

ctxB

SEKDEL
HindIII

RB
Pnos

pSA5

nptII

HindIII

Tnos PECaMV35S

Apa1

pr-s

XhoI SacI

LB
Tnos

rgp

SEKDEL

HindIII

RB
pSR1241

Pnos

nptII

Tnos PECaMV35S

XbaI
pr-s

BglII

ApaI

ctxB

XhoI AgeI SacI

rgp

Hinge of GPGP

LB

Tnos

SEKDEL

2040bp
Fig. 1. Gene constructs showing cloning of the fusion gene ctxB-rgp in pBI101. The pr-s-ctxB and rgp fragments were PCR amplied from pSM31 and pSA5, respectively.
Amplied PCR fragments were digested with respective enzymes and triple ligated in pBI101 to obtain pSR1241 with two glycine-proline repeats as hinge at the 30 end of
ctxB.

Author's personal copy

186

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

membranes were incubated with anti-cholera antibody (Sigma,

USA) and equine anti-rabies serum (Haffkine Bio-pharmaceutical
Corporation Ltd, India) for 2 h. After three washes with TBST, the
membranes were further incubated with horseradish peroxidase
(HRP) conjugated anti-rabbit IgG and alkaline-phosphatase (ALP)
conjugated anti-horse IgG (Sigma, USA) for 2 h at room temperature for CtxB and G proteins, respectively, and developed by HRP
(Promega life science, USA) or ALP (Bio-Rad, USA) color development kit. For detection of the pentameric form of CtxB-G protein,
6% SDSPAGE gel was used and the un-boiled samples were loaded
without adding DTT in sample-loading buffer [22]. The gel was run
at constant 30 V, blotted into PVDF membrane for at least 5 h and
developed as described above.
Quantication of CtxB-G protein in plant and assay of immunological
activity
GM1-ELISA was performed to quantify the expression level of
pentameric form of the CtxB-G protein in tobacco leaves as reported in Mishra et al. [16] with minor modications. The 96-well
microtiter plates (Greiner, Germany) were coated with 3.0 lg/ml
GM1 made in sodium bicarbonate coating buffer pH 9.6 (15 mM
Na2CO3, 35 mM NaHCO3) and incubated over night at 4 C. As control, BSA (3.0 lg/ml) in bicarbonate buffer was coated in some
wells. The wells were blocked with 300 ll of 1% BSA in phosphate
buffered saline Tween 20 (PBST; 0.01 M Na2HPO4, 0.003 M
KH2PO4, 0.1 M NaCl, pH 7.4, 0.05% Tween 20, v/v) for 1 h. Total soluble leaf protein and bacterial CtxB (Sigma, USA) were diluted serially, added into the wells in triplicate and incubated for 1 h,
followed by 2 h incubation with rabbit anti-cholera toxin antibody
at 1:4000 dilution in PBST containing 0.25% BSA followed by 2 h
incubation with mouse anti-rabbit IgG alkaline-phosphatase conjugate at 1:30,000 dilution in PBST containing 0.25% BSA. The
plates were developed with p-nitrophenyl phosphate substrate.
The reaction was terminated by the addition of 3 M NaOH. The
plates were read at 405 nm and the CtxB expression level was
quantied on a linear standard curve. All estimates were made
on the basis of three independent experiments.
Assay of the immunological activity of CtxB-G protein against
rabies was performed as described above except that the antibody
against a custom synthesized G peptide was used as the primary
antibody in 1:4000 dilution. Indirect ELISA was performed to check
immunological activity against rabies antibody. Microtiter plates
were coated with plant-CtxBG protein crude extract and incubated at 4 C overnight. The plates were blocked with 1% BSA in
PBST for 1 h at 37 C. After washing three times with PBST, the peptide antibody against G protein and equine anti-rabies antibody
were added at 1:4000 dilution and incubated for 2 h at 37 C.
The plates were further incubated with ALP conjugated anti-rabbit
and anti-horse IgG in 1:8000 dilution for 2 h at 37 C and developed as described above.
In order to assess relative binding afnity of CtxB-G protein for
GM1 receptors, microtiter plates were coated with various concentrations of GM1 and incubated at 4 C overnight. The plant derived
CtxB, CtxB-G leaf extract, bacterial CtxB (Sigma, USA) or BSA (negative control) were added to the wells at 3 lg/ml and incubated
overnight at 4 or 37 C. The plates were developed following Mishra et al. [16].
Purication of CtxB-G protein and pentamerization
Purication of CtxB-G protein was carried out as described in
Mishra et al. [16]. Briey, Rabbit anti-CtxB IgG was coupled to
CNBr-activated Sepharose 4B following manufacturers instructions (Amersham Biosciences, Sweden). The rabibit anti-CtxB IgG
(20 mg) was dissolved in coupling buffer (0.1 M NaHCO3 pH 8.3

containing 0.5 M NaCl). Two grams of CNBr- activated Sepharose

4B was suspended in 1 mM HCl and washed for 15 min on a sintered glass lter. Approximately 200 ml of 1 mM HCl was added
in several aliquots per g of dried powder. The coupling solution
containing the rabbit anti-CtxB IgG was mixed with the medium
in a stoppered vessel and rotated over night at 4 C. Excess ligand
was washed away with ve volumes (w/v) of the coupling buffer.
The slurry was transferred to 0.1 M TrisCl buffer, pH 8.0, allowed
to stand for 2 h and then, washed with at least three cycles of ve
volumes of each buffers with alternating pH (0.1 M acetate buffer,
pH 4.0 containing 0.5 M NaCl followed by a wash with 0.1 M Tris
Cl, pH 8.0 containing 0.5 M NaCl). The Sepharose coupled with the
anti-CtxB IgG was loaded onto a column and pre-equilibrated with
buffer (50 mM sodium phosphate pH 7.5, 150 mM NaCl, 2 mM
dithiothreitol, 1 mM phenylmethylsulfonyl uoride, 0.08% TritonX 100). Tobacco leaf (10 g) was grounded in liquid nitrogen and
homogenized in 20 ml extraction buffer as described above. The
extract was centrifuged for 10 min at 5000g. The supernatant
was again centrifuged for 15 min at 13,000g. The claried tobacco
leaf extract (22 ml) was loaded onto the column. The wash through
was re-loaded for maximum binding of the CtxB-G protein. The
column was washed with six volumes of wash buffer (50 mM sodium phosphate pH 7.5, 150 mM NaCl, and 2 mM dithiothreitol).
The CtxB-G protein was eluted with glycineCl buffer pH 2.8 and
neutralized to pH 7.4 by collection of the drops in 1/10th volume
of 1 M trisCl pH 9.5. The eluted CtxB-G protein fraction (20 ml)
was dialyzed against buffer (0.1 M trisCl pH 7.5, 0.4 M NaCl and
2 mM EDTA). The dialysis bag containing the protein was kept on
sucrose bed for concentrating the protein, with intermittent
changes of sucrose. The concentrated CtxB-G protein (1 lg/ll)
was incubated overnight at 37 C to allow pentamerization.
Results
Insertion events and the expression of CtxB-G in transgenic tobacco
Six independently transformed kanamycin resistant tobacco
plants were veried for the presence of ctxB-rgp gene by PCR
amplication of the genomic DNA (Fig. 2A). The expected DNA
fragment of 1.9 kb was observed in all the six plants (lanes 1
6) whereas genomic DNA of the non-transgenic plant gave no
amplication (lane NT). The quantitative analysis of ctxB-rgp transcript carried out by real-time PCR showed the highest transcript
level (1600-fold) in plant #1 as compare to that in the least
expressing transgenic plant #6 (Fig. 3). The transgenic plant #1
showing the highest expression of ctxB-rgp was further analyzed
by Southern hybridization for determining the copy number of
the transgene insertion. The transgenic plant #1 contained single
copy of the transgene inserted into its genome (Fig. 2B).
Expression of functional CtxB-G protein in plant leaves
The level of pentameric form of CtxB-G protein expressed in
transgenic tobacco lines was determined by monosialoganglioside-dependent enzyme linked immunosorbent assay (GM1-ELISA)
of total leaf protein. The highest expression level was observed in
plant #1 where the CtxB-G expressed at 0.4% of TSP in leaves. This
was followed by expression at 0.21% in the plant #3 (Fig. 4A).
Immunological activity of the fusion protein CtxB-G was checked
by performing both GM1-ELISA and indirect ELISA (Fig. 4B). Peptide antibodies against the G protein as well as equine anti-rabies
antibodies were used as primary antibodies in both the assays. The
binding of the CtxB-G protein to GM1 receptors in GM1-ELISA
established that the chimeric protein expressed in tobacco leaves
was in pentameric form. That the chimeric protein was immuno-

Author's personal copy

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

6 NT

187

bp
2027
1584
1375

Fig. 2. Detection of synthetic ctxB-rgp gene in T0 transgenic tobacco plants by PCR (A) and Southern hybridization analysis of the transgenic (lane 1) and non-transgenic (lane
2) plants (B). Genomic DNA was isolated from transgenic and wild-type plant leaf. PCR was performed using gene specic primers. The PCR products were separated on 1.0%
agarose gel. M, EcoR1/HindIII digested k DNA markers, PCR products with DNA template from six independent T0 transgenic (lanes 16) and non-transgenic (NT) plants. For
Southern hybridization, genomic DNA from T0 transgenic plant #1 was digested with XhoI, electrophoresed in 0.8% agarose gel and blotted onto Hybond N+ membrane. Since
the fragment between T-borders has one XhoI site, the number of fragments hybridizing with 570 bp rgp probe from 30 region of the gene represents copy number of the
insert. A single band (lane 1) indicates the presence of single copy in the genome.

GM1, the order of binding afnity was: plant-CtxB > CtxB-G > bacterial CtxB at both the temperatures. Thus, the plant-expressed
CtxB showed higher afnity towards GM1 as compared to the bacterial CtxB and CtxB-G. The CtxB-G showed higher afnity towards
GM1 as compared to bacterial CtxB but lower afnity than plantexpressed CtxB at both the temperatures.
Purication of CtxB-G protein and pentamerization

Fig. 3. Quantitative analysis of ctxB-G transcript in transgenic lines by real-time

PCR. The relative levels of the transcript (Y-axis) with respect to the least expressing
plant (#6) in (X-axis) are shown. Error bar represents SD values based on the three
replicates.

logically active against both CtxB and the rabies antibodies was
established by indirect ELISA using both the antibodies.
The transgenic plants (#1, 2 and 3) showing high expression of
the CtxB-G protein were selected for analysis on immunoblot. As
expected, a 403 kDa (66 kDa glycosylated G + 14.6 kDa glycosylated CtxB polypeptide pentamer) protein was observed in the
non-reduced and un-boiled sample when detected by both CtxB
(Fig. 5A) and G protein antibodies (Fig. 5B). No band was detected
in the non-transgenic plants. The highest expression of CtxB-G protein was noticed in plant #1 (Fig. 6A, lane1 and Fig. 6B, lane 1).This
is consistent with the results of real-time PCR and ELISA. Under the
denaturing conditions, a band of 80.6 kDa, representing the
monomeric fusion polypeptide was detected using equine anti-rabies antibodies (Fig. 5C).
Binding afnity of the tobacco-expressed proteins to GM1 receptors
Functionality of CtxB and its fusion derivatives was correlated
with the ability to bind to GM1 ganglioside.The binding afnity
of the plant derived CtxB, CtxB-G and bacterial CtxB to GM1 was
determined by GM1-ELISA carried out at 4 or 37 C (Fig. 6). Within
the linear range of binding at variable molar concentrations of

The CtxB-G protein expressed in transgenic tobacco lines was

puried using immunoafnity column. The summary of recovery
at different steps of purication of CtxB-G is shown in Table 1.
Quantication of the eluted protein by ELISA showed that about
31% of CtxB-G was recovered using single step afnity purication.
The recovery suggested 93% purity (Table 1), which is also evident
on the denaturing gel electrophoresis (Fig. 7A). The pentameric
nature of CtxB-G was evident from its receptor binding in GM1ELISA, as explained earlier. It was further substantiated by nondenaturing SDSPAGE analysis. The protein was suspended in buffer without DTT and loaded onto a 6% denaturing SDS gel. In the
non-reduced and un-boiled samples, one major protein band was
formed at position corresponding to molecular mass of 403 kDa
(Fig. 7B). This agreed with the predicted size of the pentameric
form of CtxB-G protein. No major bands corresponding to lower
multimeric forms were noticed even when the gel was run for
2 h instead of 5 h (data not shown).
Discussion
Rabies virus surface glycoprotein (G protein) is immuno-protective against rabies [15]. In an earlier study from our group, a synthetic gene coding the G protein was expressed in tobacco plants.
The plant derived G protein, given by intra-peritoneal route, induced protective immunity in mice against intracerebral lethal
challenge with live rabies virus [17]. The non-glycosylated G protein prepared from bacterial cells does not give protective immunity [23,24]. The G protein expressed in yeast is glycosylated but
gives protection only against intra-muscular and not intracerebral
virus challenge [25]. This may be due to difference in glycosylation
of G protein expressed in Saccharomyces cerevisiae from those
required for effective protection against the viral challenge. In another study, a chimeric peptide containing antigenic determinants
from the rabies virus G protein (amino acids 253275) and the
nucleoprotein (amino acids 404418) was expressed in tobacco
plants as translational fusions with alfalfa mosaic virus (AlMV)
coat protein. The recombinant A1MV virus particles puried from
the transiently infected plants gave protective immunity in mice

Author's personal copy

188

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

0.45

0.8

0.35

0.7

0.3
0.25
0.2
0.15
0.1

Plant # 1
NT plants

0.9

0.4

CtxB-G (Absorbance)

CtxB-G ( %TSP)

0.6
0.5
0.4
0.3
0.2

0.05

0.1

Ab1
Ab2
Indirect ELISA

#1 # 3

T0 plants

Ab1
Ab2
GM1-ELISA

Fig. 4. CtxB-G protein expression in leaf in T0 transgenic tobacco plants #1 and #3 by GM1-ELISA (A) and assay of immunological activity of CtxB-G protein against rabies
antibodies by indirect and GM1-ELISA (B). The expression level of CtxB-G protein is given as %TSP. In indirect ELISA and GM1-ELISA for plant # 1, the plates were developed
using peptide anti-G (Ab1) and equine anti-rabies (Ab2) antibody. NT, non-transgenic plants.

B
M

kDa
403

NT

NT

kDa

NT

205
130
95
72
55

250

80.6 kDa

36
28
Fig. 5. Western blot analysis of transgenic plants under non-denaturing conditions using anti-cholera antibody (A), anti-rabies antibody (B) and under denaturing condition
using anti-rabies antibody (C). Crude protein (30 lg) prepared from the leaves of non-transgenic (NT) and transgenic T0 plants #1, 2 and 3 was loaded along with molecular
weight markers (M).

0.5
0.45
Bacterial CtxB

0.4

A 405 nm

0.35

plant CtxB

0.3

at 370C

CtxB-G

0.25

BSA

0.2

CtxB-G

0.15

plant CtxB

0.1

bacterial CtxB

0.05

at 40C

BSA

0
0

10

GM1 concentration (M)

Fig. 6. GM1 binding analysis of the plant-CtxB, CtxB-G and the bacterial CtxB. Binding afnity of the proteins to GM1 was determined by GM1-ELISA at 4 or 37 C. Microtiter
plates, precoated with different concentrations of GM1, were treated with different proteins at 3 lg/ml concentration. BSA was taken as negative control. To detect the
amount of the bound proteins, the wells were incubated with anti-CtxB antibody and ALP conjugated secondary antibody, followed by the addition of substrate. The
absorbance at 405 nm plotted on Y-axis shows the amount of CtxB bound at increasing concentrations of GM1 receptor.

after intra-muscular challenge with the rabies virus [26]. The fusion of CtxB with G protein studied here is expected to provide

CtxB as a receptor specic carrier. This may reduce the dose required for oral mucosal uptake of CtxB-G. The approach may en-

Author's personal copy

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

Table 1
Purication of recombinant CtxB-G from tobacco leaves.
Fraction

Total
protein
(lg)

CtxBG
(lg)

Recovery
(%)

Purity
(%)

Supernatant after centrifugation

Antibody afnity column

45,100
60

180
56

100
31

0.4
93

The above values are based on the purication initiated with 10 g fresh leaves. Total
protein was calculated by Bradford assay, CtxB-G was determined by ELISA.

A
kDa
205

S
403

97
66

205

45
97
Fig. 7. SDSPAGE analysis of the afnity puried CtxB-G protein. Puried protein
(200 ng) was loaded for silver staining (A). The puried protein was pentamerized
in vitro and checked on silver stained gel following non-denaturing SDSPAGE (B).
M, molecular weight markers and S, puried protein sample.

hance the immuno-protective ability of G protein given through

oral/mucosal epithelium or in the form of an edible vaccine.
In our study, the native signal peptide of CtxB was replaced by
the tobacco PR-S signal peptide [18], which efciently transports
proteins into the endoplasmic reticulum of plant cells. The addition
of the ER retention signal at the C-terminus has been suggested to
enhance the accumulation of recombinant proteins in transgenic
plants [27,28]. The glycineproline hinge provides exibility to
independently folding domains of the chimeric protein and allows
their folding with little steric hindrance. The fusion proteins carrying CtxB either at the N-terminus [2931] or the C-terminus
[32,33] or even internally within the CtxB sequence [34,35] have
been produced and characterized earlier. Gonzalez et al. [31] reported that a CtxB fusion protein carrying 18 amino acid N-terminal extension retained activity with respect to pentamerization
and GM1 binding. In another study [29], it was shown that the
afnity of the chimeras for GM1 was inversely proportional to
the size of the peptide fused to the N-terminus of CtxB. Our results
show that the G- protein, in spite of being about ve fold larger
than the CtxB, allowed the latter to pentemerize in the fusion
and bind to the GM1 receptors. The fusion protein retained antigenicity of both the component proteins.
The expression of CtxB-G protein in different transgenic plants
showed wide variation, i.e. 0.0020.4% of TSP in leaf. This is consistent with the transcript level noticed by real-time PCR. The variation in expression is understandably due to integration of the
transgene at different positions in the genome of independent
transgenic lines [36]. We have earlier reported a high level expression of synthetic G protein in the selected tobacco lines, i.e. at
0.38% of TSP [17]. In another study, the chimeric rabies virus peptide fused to the N-terminus of AlMV CP was reported to accumulate at levels reaching 0.4 0.07 mg/g of fresh spinach leaf tissue
[26].
GM1-ELISA using the peptide antibody against the G protein
and the equine anti-rabies antibody established that the pentamer-

189

ic fusion protein maintained immunologically active G protein domains. However, the absorbance values of CtxB-G protein in GM1ELISA were lower than the absorbance values in indirect ELISA for
the two antibodies. This is be due to higher binding of CtxB to GM1
receptors coated on the ELISA plates as compared to its binding to
the plates in indirect ELISA.
The binding assay showed that a pentameric CtxB was formed
with functionally correct folding and assembly of the chimeric
CtxB-G expressed in tobacco leaves. These results suggest that
the folding of the fusion protein was driven by CtxB though this
is the smaller (14.6 kDa) partner in the 80.6 kDa chimeric protein.
Earlier, we reported that the plant-synthesized CtxB shows a higher afnity for binding to GM1 as compared to the bacterial CtxB
[16]. The glycosylation of the plant-expressed CtxB was predicted
to facilitate functionally more favorable folding of the CtxB in tobacco cells. Here we show that the binding afnity of CtxB-G protein to GM1 was lower than that of CtxB expressed in tobacco
leaves. This may be due to the bulky nature of the G protein in
CtxB-G protein pentamer (403 kDa) which may cause steric hindrance to the binding of CtxB to GM1 receptor as compared to
the binding of CtxB pentamer (73 kDa). The G protein has three potential N-linked glycosylation sites at Asn37, Asn247 and Asn319
positions [37]. The chaperones, other folding enzymes [38,39]
and the glycosylation in plant cells may lead to an increase in afnity of the CtxB for GM1 receptors as compared to the non-glycosylated bacterial CtxB. The binding afnity of the three proteins to
GM1 was higher at 37 C than at 4 C. Maximum binding of the
cholera toxin to GM1 is reported to occur within 1 h at 370C
[40]. Though the binding assay was carried out using crude extract
of the proteins, binding curves, nevertheless, demonstrate that the
three pentemeric proteins bound GM1 with different afnities.
This study describes the expression and assembly of the CtxB-G
protein fusion in transgenic tobacco plants. The assembly of CtxBG protein monomers into biologically active pentamers in transformed tobacco leaf tissue suggests that CtxB-G protein antigen expressed in plants may show efcient internalization through the
mucosal receptors. This may enhance immunogenic ability of the
CtxB-G protein fusion against rabies following oral and mucosal
immunization. Differences in binding constants of the CtxB expressed in different cellular systems suggest the need to examine
the folding and functional behavior of proteins obtained from heterologous expression systems.
Acknowledgments
We greatly acknowledge the nancial support provided by
Council for Scientic and Industrial Research and to the Department of Science and Technology for J.C. Bose Fellowship to Rakesh
Tuli. We thank Shadma Ashraf for the construct of the rgp and S.
Mishra for the ctxB genes, reported earlier.
References
[1] C.J. Arntzen, High-tech herbal medicine: plant-based vaccines, Nat. Biotechnol.
15 (1997) 221222.
[2] X.L. Jiang, Z.M. He, Z.Q. Peng, Y. Qi, Q. Chen, S.Y. Yu, Cholera toxin B protein in
transgenic tomato fruit induces systemic immune response in mice, Trans. Res.
16 (2007) 169175.
[3] N. Tomonori, T. Hidenori, Y. Yoshikazu, Y. Lijun, M. Takehiro, M. Mio, M. Ushio,
N. Akiko, U. Akihiro, H. Takachika, M. Shigeto, T. Kunisuke, T. Fumio, K. Hiroshi,
Rice-based mucosal vaccine as a global strategy for cold chain and needle free
vaccination, Proc. Natl. Acad. Sci. USA 104 (2007) 1098610991.
[4] J. Yu, W.H. Langridge, Novel approaches to oral vaccines: delivery of antigens
by edible plants, Curr. Infect. Dis. Rep. 2 (2000) 7377.
[5] W. Tao, C. Jian-Ping, L. Hong, Z. Ke-Qian, Z. Lei, Y. Chun-Lei, T. Da-Chang, Coexpression and immunity of Legionella pneumophila mip gene and
immunoadjuvant ctxB gene, Acta Biochim. Biophys. Sin. 37 (2005) 199204.
[6] K. Jin, H. So-Chon, Y. Moon-Sik, J. Yong-Suk, Expression of synthetic
neutralizing epitope of porcine epidemic diarrhea virus fused with synthetic

Author's personal copy

190

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]
[16]

[17]

[18]

[19]

[20]
[21]

[22]

S. Roy et al. / Protein Expression and Purication 70 (2010) 184190

B subunit of Escherichia coli heat-labile enterotoxin in tobacco plants, Protein
Expr. Purif. 46 (2006) 1622.
S. Hamid, B. Soren, W. Dale, P.S. Jacob, H.S. Jan, L. Machel, Genetic fusion of
human insulin B-chain to the B-subunit of cholera toxin enhances in vitro
antigen presentation and induction of bystander suppression in vivo,
Immunology 106 (2002) 237245.
M.T. Dertzbaugh, C.O. Elson, Comparative effectiveness of the cholera toxin B
subunit and alkaline phosphatase as carriers for oral vaccines, Infect. Immun.
61 (1993) 4855.
M.T. Dertzbaugh, D.L. Peterson, F.L. Macrina, Cholera toxin B-subunit gene
fusion: structural and functional analysis of the chimeric protein, Infect.
Immun. 58 (1990) 7079.
H. Song, L. Zhou, W. Fang, Y. Li, X.H. Fang, X. Li, M. Wu, B. Qiu, High-level
expression of codon optimized foot-and mouth disease virus complex epitopes
and cholera toxin B subunit chimera in Hansenula polymorpha, Biochem.
Biophys. Res. Commun. 315 (2004) 235239.
N. Lycke, J. Holmgren, Strong adjuvant properties of cholera toxin on gut
mucosal immune responses to orally presented antigens, Immunology 59
(1986) 301308.
A.G. Chandy, K. Eriksson, M. Lebens, I. Nordstrom, E. Schon, J. Holmgren,
Cholera toxin B subunit as a carrier molecule promotes antigen presentation
and increases CD40 and CD86 expression on antigen-presenting cells, Infect.
Immun. 69 (2001) 57165725.
D.G. Coslett, B.P. Hollow, J.K. Obijeski, The structural proteins of rabies virus
and evidence for their synthesis from separate monocistronic RNA species, J.
Gen. Virol. 49 (1980) 161180.
K. Conzelmann, J.H. Cox, L.G. Schneider, H. Thiel, Molecular cloning and
complete nucleotide sequence of the attenuated rabies virus SAD19, Virology
175 (1990) 485499.
T.J. Wiktor, E. Gyorgy, D. Schlumberger, F. Sokol, H. Koprowski, Antigenic
properties of rabies virus components, J. Immunol. 110 (1973) 269276.
S. Mishra, D.K. Yadav, R. Tuli, Ubiquitin fusion enhances cholera toxin B
subunit expression in transgenic plants and the plant-expressed protein binds
GM1 receptors more efciently, J. Biotechnol. 127 (2006) 95108.
S. Ashraf, P.K. Singh, D.K. Yadav, Md. Shahnawaz, S. Mishra, S.V. Sawant, R. Tuli,
High level expression of surface glycoprotein of rabies virus in tobacco leaves
and its immunoprotective activity in mice, J. Biotechnol. 119 (2005) 114.
P.C. Sijmons, B.M. Dekker, B. Schrammeijer, T.C. Verwoerd, P.J. Van Den Elzen,
A. Hoekema, Production of correctly processed human serum albumin in
transgenic plants, Biotechnology 8 (1990) 217221.
R.B. Horsch, J.E. Fry, N.L. Hoffmann, D. Eicholtz, S.G. Rogers, R.T. Fraley, A
simple and general method for transferring genes into plants, Science 227
(1985) 12291231.
K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR & the 2-DDCT method, Methods 25 (2001) 402408.
M.M. Bradford, A rapid and sensitive method for quantitation of microgram
quantities of protein utilizing the principles of protein dye binding, Anal.
Biochem. 72 (1976) 248254.
A.P.M. Areas, M.L.S. Oliveira, E.N. Miyaji, L.C. C Leite, K.A. Aires, W.O. Dias, P.L.
Ho, Expression and characterization of cholera toxin B- pneumococcal surface
adhesion A fusion protein in Escherichia coli: ability of CTB-psaA to induce
immune response in mice, Biochem. Biophy. Res. Commun. 321 (2004) 192
196.

[23] R.F. Lathe, M.P. Kieny, D. Schmitt, P. Curtis, J.P. Lecocq, M13 bacteriophage
vectors for the expression of foreign proteins in Escherichia coli: the rabies
glycoprotein, J. Mol. Appl .Genet. 2 (1984) 331342.
[24] E.S. Norton, J.F. Obijeski, D.V. Goeddel, Rabies virus glycoprotein analogs:
biosynthesis in Escherichia coli, Science 219 (1983) 614620.
[25] S.R. Klepfer, C. Debouck, J. Uffelman, P. Jacobs, A. Bollen, E.V. Jones,
Characterization of rabies glycoprotein expressed in yeast, Arch. Virol. 128
(1993) 269286.
[26] V. Yusibov, D.C. Hooper, S.V. Spitsin, N. Fleysh, R.B. Kean, T. Mikheeva, D. Deka,
A. Karasev, S. Cox, J. Randall, H. Koprowski, Expression in plants and
immunogenicity of plant virus-based experimental rabies vaccine, Vaccine
20 (2002) 31553164.
[27] H.S. Masson, D.M.K. Lam, C.J. Arntzen, Expression of hepatitis B surface antigen
in transgenic plants, Proc. Natl. Acad. Sci. USA 89 (1998) 11745
11749.
[28] J.A. Napier, G. Richard, P.R. Sherwry, Trafcking and stability of heterologous
proteins in transgenic plants, Meth. Biotechnol. 3 (1998) 189202.
[29] M.T. Dertzbaugh, C.O. Elson, Reduction in oral immunogenicity of cholera
toxin B subunit by N-terminal peptide addition, Infect. Immun. 61 (1993) 384
390.
[30] J. Sanchez, S. Johansson, B. Lowenadler, A. Svennerholm, J.M. Holmgren,
Recombinant cholera toxin B subunit and gene fusion proteins for oral
vaccination, Res. Microbiol. 141 (1990) 971979.
[31] R.A. Gonzalez, J. Sanchez, J. Holmgren, S. Lopez, C.F. Arias, Immunological
characterization of a rotavirus-neutralizing epitope fused to the cholera toxin
B subunit, Gene 133 (1993) 227232.
[32] C.H. Shi, C. Cao, J.S. Xhing, J. Li, Q.J. Ma, Gene fusion of cholera toxin B subunit
and HBV PreS2 epitope and the antigenicity of fusion protein, Vaccine 13
(1995) 933.
[33] T. Zhang, E. Li, S.L. Stanley Jr., Oral immunization with the dodecapeptide
repeat of the serine-rich Entamoeba histolytica protein (SREHP) fused to the
cholera toxin B subunit induces a mucosal and systemic anti-SREHP antibody
response, Infect. Immun. 63 (1995) 13491355.
[34] M. Backstrom, J. Holmgren, F. Schodel, M. Lebens, Characterization of an
internal permissive site in the cholera toxin B-subunit and insertion of
epitopes from human immunodeciency virus-1, hepatitis B virus and
enterotoxigenic Escherichia coli, Gene 165 (1995) 163168.
[35] M. Backstrom, M. Lebens, F. Schrodel, J. Holmgren, Insertion of a HIV-1neutralizing epitope in a surface-exposed internal region of the cholera toxin B
subunit, Gene 149 (1994) 211217.
[36] C. Peach, J. Velten, Expression variability (position effect) of CAT and GUS
reporter genes driven by linked divergent T-DNA promoters, Plant Mol. Biol.
17 (1991) 4960.
[37] A. Anilionis, W.H. Wunner, P.J. Curtis, Structure of the glycoprotein gene in
rabies virus, Nature 294 (1981) 275278.
[38] A.J. Parodi, Role of N-oligosaccharide endoplasmic reticulum processing
reactions in glycoprotein folding and degradation, Biochem. J. 348 (2000) 1
13.
[39] E.S. Trombetta, A. Helenius, Lectins as chaperones in glycoprotein folding, Curr.
Opin. Struct. Biol. 8 (1998) 587592.
[40] J. Holmgren, V. Elwing, P. Fredman, L. Svennerholm, Polystyrene adsorbed
gangliosides for investigation of the structure of the tetanus toxin receptor,
Eur. J. Biochem. 106 (1980) 371379.