Anda di halaman 1dari 43

CHAPTER 8 GENE

EXPRESSION

Gene
expression
Other
RNAs

mRNA coded by ribosome--> translation

Prokaryotes

STEP1
INITIATIONOFTRANSCRIPTION

Figure 8.11

signma protein recognize gene & bring pol, where transcription starts & goes to right D
- RNA pol

Prokaryotic

STEP2
ELONGATION

Prokaryotic

Double stranded DNA helix


A A G-G-G-C-C-C-G-A-C

U
A
T

GACTTAGCGTGCATAGCA 3'
||||||||||||||||||
CTGAATCGCACGTATCGA 5'

A
A
T

G-G-G-C-C-C-G-A-C3'
| | | | | | | | |
C-C-C-G-G-G-C-T-G

G
A

complementary, antiparallel
elongation

5'

UU

UA

CC

AU

GU

UU

AA
A

GG
GC
C

CG
U

CU
AC
U

UA
A

CU

5' TTTACCATGTTTAAAGGGCCCGACTACTTAACT
|||||||||||||||||||||||||||||||||
3' AAATGGTACAAATTTCCCGGGCAGATGAATTGA

mRNA

This diagram is full of very important information. It shows a mRNA


molecule being transcribed from a double stranded DNA molecule. The
transcription machinery is not shown.
Notice that:
1. The DNA template strand is being read in the 3' to 5' direction.
2. The RNA molecule is being synthesized in the 5' to 3' direction.
3. The mRNA is antiparallel and complementary to the DNA strand that is
being read.
4. About 12 nucleotides of the mRNA are H-bonded to the DNA strand.
Actually, it is just such H-bonding that enables the transcription machinery to
choose the correct ribonucleotides when synthesizing an RNA molecule.
Ribonucleotides are chosen based on their ability to H-bond or base pair to the
DNA template.
transcription 5'-3', add ribosome nucleotides from 5' to 3', melt DNA in front while travelingcom

STEP3
TERMINATION
Helicase breaks H bond

Prokaryotic

Translation

CU

UA
A

CU

GACTTAGCGTGCATAGCA 3'
||||||||||||||||||
CTGAATCGCACGTATCGA 5'

A
A
T

G-G-G-C-C-C-G-A-C3'
| | | | | | | | |
C-C-C-G-G-G-C-T-G

AA

AG

GG

CC

AU

GU

UU

ribosomes

UA

nascent
protein

CC
C

GU
C

UA

UU

The process of
reading the
genetic code in
the messenger
RNA (mRNA)
and using that
information to
synthesize the
polypeptide
(protein) that is
specified in the
mRNA.

A A G-G-G-C-C-C-G-A-C

5' TTTACCATGTTTAAAGGGCCCGACTACTTAACT
|||||||||||||||||||||||||||||||||
3' AAATGGTACAAATTTCCCGGGCAGATGAATTGA

Prokaryotic
!

mRNA

5'

PROKARYOTIC

Double stranded DNA helix

5'

3'

3'

5'

Note the
direction of
information
flow.

Note
polarity

ribonucleotides

Transcription

mRNA

5'

3'

mRNA

5'

3'
amino acids

Translation

protein
protein

N = amino

protein

C = carboxy

protein

to make protein

Translation of Prokaryotic polycistronic mRNA


Initiation
Elongation
Termination
Initiation Elongation Termination

N
N

3'

5'
Protein added

R added

mRNA region of!


the first gene (cistron)

R assemble

Multiple gene--> 1 message, same protein


Ribosomes fall off & split 2 component parts

Pro: turn on lac operon for lactose


Euk: every gene has its own transcription, produces its own mRNA

mRNA region of!


the second gene (cistron)

Genetic code

The Genetic Code: 61


triplet codons represent 20
amino acids;

3 triplet codons signify


stop.

64 codons:

61 codons specific 20 amino acids


3 stop codons

How is the genetic code read?

Thecodonsarereadthreenucleo?desinarowwithnogapsandwith
nopunctua?onbetweenthecodons

Met

Asn

Asn

Asn

Ala

no overlapping codons

Thecodeisdegenerate.
Thecodonsaredecodedby
tRNAintheconnesofa
ribosome.

6 codons classify Leu

Glu

Glu

Ala

Asp

tRNAs
tRNA single RNA chain folded into 2d cloverleaf
tRNA: small RNA molecules participate in translation of mRNA
not part of ribosome, have extensive 2nd structure
produced by INTRAmolecular base pairing btw nucleotides
-tRNA contains many highly modified &
unusual nucleotides
- following transcription, tRNA contains only
standard set of 4 nucleotides
- Unusual nucleotides are produced by
post-transcription enzymatic modifications
- tRNA has 4 stems & 3 loops (4th loop is
called Variable Loop) locate btw TUC stem
& anticodon stem
- D loop is named for modified nitrogenous base
found within it, dihydrouracil
- TUC loop is named for 4 invariant nucleotides
found within it (thymidylate, pseudouridylate,
cytidylate, guanylate)

XCCA- amino acid acceptor site, X-any


nucleotides, C-cytidylate, A-adenylate

from Atkinson Molecular Biology course 1993-2009

Anticodon: bp with codon and covalent attach tRNA,


brought along with mRNA to correct amino acid
(decode genetic code)

Threonine

tRNA is covalently attached to amino acid


threonine

Th

re
on

in

-tRNA thr docdes one of codon specify Threonine


- Codons for threonine: ACU, ACC, ACA, ACG
- tRNA decodes ACU codon
- 3 nucleotides are complementary (bp H
bond & antiparallel
to codon ACU

- ACU: starts from 5' to 3', decoded by anticodon UGA

-Pro: 30-40 different tRNA


-Euk: 50 different tRNA

- Wobble base pairing: a little bit change


of nucleotides Inosine
- genetic code is degenerated by
synonymous codons

Wobble base pairing: non-standard type of base


pairing that occurs between 3rd nucleotides in CODON
& 1st nucleotides in ANTICODON
--> enable single tRNA to recognize more than 1 codon
for particular amino acid.
-

Inosine

Flip it for illustrative purposes.

-CGA (3rd position)


-CGG: ex of wobble bp

- tRNA (charged) carrying amino acid (activated)


is aminoacyl tRNA synthetase; charging tRNA
consume energy in form of ATP. Energy from ATP
is conserved in bond btw amino acid & tRNA
- Last 3 nucleotides on 3' end of tRNA is 5' CCA 3'
-

tRNA

From this slide I only


want you to be sure to
learn at least three
things.
1) that the tRNA carries
an amino acid whose
codon that it decodes.
2) that the amino acid is
covalently attached to
the 3 end of the tRNA.
3) that when a tRNA is
carrying an amino acid,
the tRNA is said to be
charged.

Ribosomesarethesiteofpolypep?desynthesis.
Ribosomes
arecomplex
structures
composedof
RNAand
protein.

Fig. 8.23
8-38

Mechanismoftransla?on

IN PROKARYOTES

Ini?a?onsetsstageforpolypep?de
synthesis.

AUG is only condon classify Met, CAN BE INSIDE Met


AUGstartcodonat5endofmRNA
- Bacteria use fMet on initiation tRNA (1st amino acid
Nformylmethionine(fMet)onini?a?on incorporated)
tRNA

Firstaminoacidincorporatedinbacteria

Elonga?onduringwhichaminoacidsareaddedtogrowing
polypep?de add amino acid as ribosomes move 5' 3' d
Ribosomesmovein53direc?onrevealingcodons.
Addi?onofaminoacidstoCterminus
215aminoacidspersecond

Termina?onwhichhaltspolypep?desynthesis
Nonsensecodonrecognizedat3endofreadingframe
Releasefactorproteinsandhaltpolypep?desynthesis

nonsense=stop

Initiation
Fig. 8.25 a

Elongation

- Addition of amino acids to C terminus polypeptide


- Chaged tRNA ushered into A site by elongation factors
- Elongation 5'- 3' d, left to right
- 5' message represent the amino term
- As protein grows, we dont add amino acids but TRANSFER amino acid to protein,
transfer the entire protein to AA (buildiing another building??)
-3' carboxylic term

Termina?onoftransla?on
- Simultaneous synthesis of many copies of polypeptide from single mRNA

Fig. 8.25 c

Pleasereviewtheseclassesofmuta?on
Muta?onsinagenescodingsequencecanalterthegeneproduct.
Missensemuta?onsreplaceoneaminoacidwithanother.
Nonsensemuta?onschangeanaminoacidspecifyingcodontoastopcodon.
FrameshiTmuta?onsresultfromtheinser?onordele?onofnucleo?deswithin
thecodingsequence.
Silentmuta?onsdonotalteraminoacidspecied.

How was the genetic code


cracked?

Experimental demonstration that a genes nucleotide


sequence is collinear the amino acid sequence of the
encoded polypeptide.
Charles Yanofsky E. coli genes for a subunit of tryptophan
synthetase.
Identified a huge # of mutations. Trp- mutants in trpA.
Fine structure recombination mapping used to determine the
position of the mutations in the gene.
Examined a huge number of recombinants
Sequenced the encoded proteins.
Correlated the position of the mutations within the gene to the
changed amino acids.
8-6

Genetic map
1. He wants to know the distance/how far apart 2 genes are/ same or dif
genes--> measure RF

4. Take product of mutant and


make protein (but not working)
--> purify and sequence it
When sequecing it, find wrong
amino acid (15)--> STOP

not number, just


names

49 Glu--> Val, Gln or Met (change of one codon)

5. The gene is co-linear the sequence of AA- begin of gene is begin of protein ??

Showed that gene is co-linear with the


amino acid sequence of the protein.
XO btw codons

21 recombinant has no mutation-> wild type gene,


.1 recombinant has mutation

3. He can detect
recombination bc 2 mutants
can cross over and give fully
functional Trp 8-7

Fig. 8.4

genetic map

He wants to know the distance/how far apart 2 genes are/ same or dif genes--> measure RF

1 recombinant has no mutation-> wild type gene,


1 recombinant has mutation

Acodoniscomposedofmorethanone
nucleo?de.
Dierentpointmuta?onscanaectsameaminoacid.
Eachcodoncontainsmorethanonenucleo?de.

Eachnucleo?deispartofonlyasinglecodon.
Inferredbecauseeachpointmuta?onalteredonlyone
aminoacid.
He can detect recombination bc 2 mutants can cross over and give fully functional Trp Then he takes product of each mutant
genes --> protein --> sequence it
8-8

CrickandBrennerpropose
thattheeachwordis3
nucleo?deslongandtheyare
readcon?nuouslywithout
anypunctua?on. insertion & deletion
Thebeginningoftransla?on
establishesthereading
(forward & backward)
frame.
3 reading frames
Phenotypiceectof
frameshiTmuta?onsis
usuallyveryseverelossof
proteinfunc?on.

Fig. 8.6

Solve: homologous
recombinaton to put them
together

restore a frameshift

-----G--------------x
----------------A---------G---------A---insert G, remove A

Take out 3 nucleotides--> no frameshift


//
2 //
--> frameshift

Fig. 8.6

(b) Consequences of exposure to proflavin


riiB+ wild-type
Exposure to proflavin
FC0
rIIB
Exposure to proflavin
FC0

FC7

Original
mutation

Second
mutation

rIIB+ revertant

Fig. 8.5b

10

(c) rIIB+ revertant X wild type yields rIIB recombinants.


FC0

rIIB

Fig. 8.5c

FC0

FC7

rIIB

FC7

Fig. 8.5d

(d) Different sets of mutations generate either a mutant


or a normal phenotype.
Proflavin-induced
mutations
( + ) insertion ( ) deletion

Phenotype

or
+

Mutant

or
++

Mutant

or

or
++++
or
+++++

Mutant

Wild type

or

or
+++
or
++++++

Wild type

12

What
does
each
codon
specify?

(a) Poly- U mRNA encodes polyphenylalanine.


5'

Phe Phe
Phe ...C
Analyze radioactive
polypeptides synthesized

N... Phe

Synthetic
mRNA

3'

Phe

Phe

Phe

Invitro translational
system plus radioactive
amino acids

Fig. 8.7

Keydiscoveries
ThemRNAandproteinarecolinear.The5endof
mRNAcorrespondstotheamino(N)terminusof
theproteinANDthe3endofthemRNA
correspondstothecarboxy(C)terminusofthe
protein.
Thegene?ccodeisdegenerate>20aminoacids
but61codonsforaminoacidsand3stop
codons.
Thegene?ccodeisuniversal.
invitrotransla?onexperiments

Summary
Codonconsistofatripletcodoneachofwhichspeciesanaminoacid.
Codeshowsa5to3direc?on.

Codonsarenonoverlapping.
Codeincludesthreestopcodons,UAA,UAG,andUGAthatterminate
transla?on.
Codeisdegenerate.
Fixedstar?ngpointestablishesareadingframe.
AUG

UAGinanini?a?oncodonwhichspeciesreadingframe.

53direc?onofmRNAcorrespondswithNterminustoCterminusof
polypep?de.
Muta?onmodifythemessageencodedinsequence
FrameshiTmuta?onschangereadingframe.
Missensemuta?onschangecodonofaminoacidtoanotheraminoacid.
Nonsensemuta?onschangeacodonforanaminoacidtoastopcodon.
8-15

Operon

lacZ, lacY, lacA