Food and Chemical Toxicology 58 (2013) 408415

Contents lists available at SciVerse ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

Effects of zearalenone on oxidative stress and inammation

in weanling piglets
Daniela E. Marin a,, Gina C. Pistol a, Ionela V. Neagoe b, Loredana Calin a, Ionelia Taranu a
a
b

Laboratory of Animal Biology, National Institute for Research and Development for Biology and Animal Nutrition, Calea Bucuresti No. 1, Balotesti, Ilfov 077015, Romania
National Institute of Pathology Victor Babes , Splaiul Independentei No. 99-101, 050096 Bucharest, Romania

a r t i c l e

i n f o

Article history:
Received 25 March 2013
Accepted 18 May 2013
Available online 28 May 2013
Keywords:
Zearalenone
Swine
Oxidative stress
Inammation

a b s t r a c t
Zearalenone (ZEN) is a non-steroidal estrogenic mycotoxin produced by the fungi of Fusarium genera. Piglets were fed for 18 days with a control or a ZEN (316 ppb) contaminated diet. At the end of the experiment tissue samples were taken for assessment of: lymphocyte proliferation, monocytes and
granulocytes respiratory burst, inammatory cytokine synthesis in blood and liver, expression of genes
involved in oxidative stress or in inammation, plasma biochemical parameters, total antioxidant status
and nitric oxide synthesis. In blood, ZEN increases the respiratory burst of monocytes and the inammatory cytokine (TNF alpha, IL-1 beta, IFN gamma) synthesis, while in liver, ZEN decreases the synthesis of
all inammatory cytokines investigated. In liver and spleen, different effect on the expression of genes
involved in oxidative stress and inammation was observed. While in liver, ZEN decrease the expression
of cyclooxigenase gene, but increase the expression of glutathione peroxydase and catalase genes; in
spleen, ZEN induces a decrease of the superoxide dismutase gene expression together with an increase
of the cyclooxigenase. In conclusion, our results showed that liver, spleen and blood may also be target
tissues in weanling piglets fed ZEN contaminated diet, with different effects on oxidative stress and
inammation.
2013 Elsevier Ltd. All rights reserved.

1. Introduction
Mycotoxins are secondary metabolites produced by fungi
belonging mainly to the following genera: Aspergillus, Penicillium,
Fusarium, Alternaria and Claviceps (Blunden et al., 1991). Until
now, more than 400 secondary metabolites with toxigenic potential have been reported and Food and Agriculture Organization
(FAO) estimates that 25% of the worlds agricultural commodities
are contaminated with mycotoxins (WHO, 1991) with signicant
economic losses (Kabak et al., 2006; Hussein and Brasel, 2001).
Zearalenone (ZEN) is a non-steroidal estrogenic mycotoxin produced by the fungi of Fusarium genera (Richard, 2007; Bennett and
Klich, 2003). ZEN is a contaminant of cereals and plant products
(MacDonald et al., 2005; Engelhardt et al., 2006; Tabuc et al.,
2009). ZEN has a major effect on human and animal health and
raises serious worldwide economic problems (FAO/WHO, 2000).
It was shown that ZEN has strong estrogenic and anabolic activities (Kuiper-Goodman et al., 1987; Pazaiti et al., 2012) causing
serious alterations in the reproductive system of laboratory and
domestic animals (Kuiper-Goodman et al., 1987; Diekman and
Green, 1992). This effect results from the capacity of ZEN to bind

Corresponding author. Tel.: +40 21 351 20 82; fax: +40 21 351 20 80.
E-mail address: daniela.marin@ibna.ro (D.E. Marin).
0278-6915/$ - see front matter 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fct.2013.05.033

the oestrogen receptors (Boyd and Wittliff, 1978; Takemura

et al., 2007) leading to hyperestrogenicity in several animal species, especially pigs (Green et al., 1990; Minervini and Dellaquila,
2008).
Once entered in the body, ZEN is mainly metabolized in the liver (Kiessling and Pettersson, 1978), which seems to be one of the
main targets of the toxin (Jiang et al., 2011; Koraichi et al., 2012).
ZEN was able to induce liver lesions with subsequent development
of hepatocarcinoma (NTP, 1982) and alterations of some enzymatic
parameters of the hepatic function in rats (Maarou et al., 1996),
rabbits (Conkov et al., 2001) and gilts (Wang et al., 2012). This
mycotoxin exhibits also several genotoxic and cytotoxic effects
in vitro (Ayed et al., 2011; Ghdira-Chkir et al., 1999) or ex vivo
(El-Makawy et al., 2001; Ayed et al., 2011) being potentially carcinogenic (NTP, 1982). This considerable cytotoxic and genotoxic potential could be connected with the intracellular oxidative stress
generated by ZEN, since recent reports have demonstrated that
ZEN induces lipid peroxidation (Abid-Esse et al., 2004; Zourgui
et al., 2008), that resulted in induction of oxidative DNA damage
(Hassen et al., 2007; Abbs et al., 2007) and apoptosis (Abid-Esse
et al., 2004).
Beside its reproductive and hepatotoxic effects, ZEN has been
also shown to be immunotoxic (Atkinson and Miller, 1984; Pestka
et al., 1987; Luongo et al., 2008), but its role in inammation was
not fully understood, ZEN working as both suppressor and inductor

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

of the production of inammatory cytokines (Ruh et al., 1998; Salah-Abbs et al., 2008; Marin et al., 2010, 2011).
Inammation and the oxidative stress are tightly correlated, the
pathways that generate the mediators of inammation (e.g. adhesion molecules, interleukins, etc.) being all induced by oxidative
stress (Jenny, 2012; Kim et al., 2012). Despite this, only a few studies (Marin et al., 2010; Busk et al., 2011) investigating the effect of
ZEN on both inammation and oxidative stress have been reported
for swine, the most sensitive animal species to zearalenone and its
metabolites (EFSA, 2004).
In the present study we have investigated the effect of ZEN on
some parameters of oxidative stress and inammation in piglets
after an oral intoxication with zearalenone.
2. Materials and methods
2.1. Reagents
All chemicals, immunological reagents and media components were purchased
from Sigma (SigmaAldrich, Steinheim, Germany) unless otherwise noted.
2.2. Animals and treatments
Ten, 4-week-old, TOPIGS-40 crossbred weanling piglets with an initial average
body weight of 9.5 0.6 kg were studied for 18 days. Animals were cared for in
accordance with the Romanian law 206/2004 for handling and protection of the
animals used for experimental purposes and of EU (Council Directive 98/58/EC)
concerning the protection of farmed animals. The study protocol was approved
by the Ethical Committee of the National Research-Development Institute for Animal Nutrition and Biology, Balotesti, Romania.
The animals were housed in pens, ve animals/group/pen, two groups, one control fed control diet and one experimental fed diet intoxicated with ZEN. Animals
were individually identied by ear tag. The body weight was measured two times
at the beginning (day 0) and at the end of the experiment (day 18) for each animal.
Feed and water were provided ad libitum every day of the experiment. Administered feed was recorded daily for each group and feed intake was calculated by difference between the total administered feed and the feed residues measured at the
end of the experiment. They were fed a maizesoybean-meal-based diet (Taranu
et al., 2011; Table 1) contaminated with 250 ppb pure ZEN. The content of ZEN
was analyzed by high performance liquid chromatography (HPLC) with uorescence detection after clean-up with an immune-afnity column (Inertsil ODS-3V)
and a detection limit of 6 ng/g. Other mycotoxins concentration (DON, FB, T-2/
HT-2, OTA, AF) were analyzed by ELISA using ELISA kit Veratox (Neogen, MI,
48912, USA/Canada) with a detection limit of 100, 50, 25, 1 ppb respectively and
were not detected. ZEN content was 40.92 0.15 ppb in the control diet, respectively 316 ppb 30.9 ppb in the zearalenone contaminated diet. Body weights
and food consumption were recorded twice throughout the experiment (day 0

Wheat
Corn
Contaminated corn
Soybean meal
Sunower meal
Powder milk
Gluten
Full fat Soybean
Salt
Monocalcium phosphate
Feed grade limestone
Methionine premix
Lysine premix
Choline premix
Vitamin mineral premixa
Analyzed composition
Crude protein (g/kg)
ZEN (lg/kg)
a

and day 18). Blood samples were aseptically collected in the day 18, by jugular vein
puncture, for oxidative stress, biochemical analysis, cell proliferation and cytokines
production. At the end of the experiment, animals were slaughtered. No alteration
was observed in the morfology of the internal organs. Organs were weighed and
samples of liver, spleen and mesenteric lymph nodes were collected on ice and
stored at 80 C until analyzed.
2.3. Cell proliferation
Peripheral blood mononuclear cells (PBMC) from blood, splenocytes from
spleen and lymphocytes from lymph nodes were isolated as already described by
Taranu et al. (2010). The ability of isolated and mitogen-activated lymphocytes to
proliferate ex vivo was measured by the [methyl-3H]-thymidine proliferation assay.
Cells (1  106 cells/mL), stimulated or not with 10 lg/mL concanavalin A (ConA)
(Type IV, Sigma, Steinheim, Germany), were cultured for 72 h at 37 C and 5% CO2
in 96-well at-bottom tissue culture plates (NUNC, Langelnselbold, Germany). For
the last 18 h of cultivation, cells were labeled with 1 lCi/well of [metyl-3H]-thymidine and than harvested through glass-ber lters (Skatron, Sterling, UK). Incorporation of [methyl-3H]-thymidine was measured with a Canberra-Packard Beta
Counter (PerkinElmer Life and Analytical Science, Downers Grove, IL, USA) and
the results were expressed in counts per minute (cpm).
2.4. Respiratory burst of granulocytes and monocytes
The intracellular production of hydrogen peroxide by peripheral granulocytes
and monocytes was performed by ow-cytometry in whole blood using the uorogenic substrate dihydrorhodamine (DHRA) 123 (BurstTest kit, ORPEGEN Pharma,
Heidelberg, Germany). Briey, ice-cold heparinized blood (100 lL) was activated
with unlabeled opsonised Escherichia coli for 10 min at 37.0 C. DHRA 123 was then
added and incubation continued for another 10 min at 37.0 C. Erythrocytes were
lysed and xed for 20 min at room temperature. Samples were washed twice with
washing solution by centrifugation (5 min, 1200 rpm, 4 C), and supernatant was
discarded. Finally, 200 lL of propidium iodide-PI (DNA staining solution) were
added whilst samples were kept on ice, in a dark place. Cell analysis was done by
ow cytometry using a FACSCanto ow-cytometer (Becton Dickinson, New Jersey,
USA) and the CellQuest software (Becton Dickinson). At least 10,000 events were
analyzed. By manual gating, we rst selected from forward scatter versus side
scatter plot the population of granulocytes. Then we selected single cells and we excluded aggregation artefacts, as dened by PI incorporation. Finally, ow-cytometry
data were expressed as percentage of responsive cells under basal conditions or to a
particular ex vivo stimulus, meaning the percentage of cells with uorescence intensity above a dened threshold (M2). The mean intensity of cellular response was
calculated as geometrical mean of uorescence channel.
2.5. Plasma biochemical parameters
Plasma concentrations of glucose, calcium, phosphorus, iron, magnesium, urea,
glucose, cholesterol, triglycerides, total protein, albumin, total bilirubin, creatinin
and concentrations of alanine aminotransferase (ALAT), aspartate aminotransferase
(ASAT), alkaline phosphatise (AP), gamma glutamyl transferase (GGT) were determined on a BS-130 Chemistry analyzer (Bio-Medical Electronics Co., LTD, China).
2.6. Determination of total antioxidant status

Table 1
Composition of experimental diet (%).
Ingredients

409

Control
15.00
53.31
0.00
3.00
8.00
5.00
2.00
9.00
0.20
1.30
1.60
0.10
0.40
0.09
1.00
164.0
40.92

Contaminated diet
15.00
0.00
53.31
3.00
8.00
5.00
2.00
9.00
0.20
1.30
1.60
0.10
0.40
0.09
1.00
164.0
316

Vitaminmineral premix/kg diet: (018 days): 10,000 UI vit. A; 2000 vit. D; 30

UI vit. E; 2 mg vit. K; 1.96 mg vit. B1; 3.84 mg vit. B2; 14.85 mg pantothenic ac.;
19.2 mg nicotinic ac; 2.94 mg vit. B6; 0.98 mg folic ac.; 0.03 mg vit. B12; 0.06 biotin;
24.5 mg vit. C; 40.3 mg Mn; 100 mg Fe; 100 mg Cu; 100 mg Zn; 0.38 I; 0.23 mg Se.

Total antioxidant status (TAS) assay was based on the absorption of 2, 20-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid cation (ABTS+) as described by Scislowski et al. (2005). Briey, the production of ABTS+ was initiated by adding
450 lM H2O2 in 1 mm quartz microcells containing 12 lL of plasma samples,
0.5 mM ABTS and 48.8 lM metmyoglobin diluted in 5 mM, pH 7.4 phosphate buffer
solution (PBS). Absorbance at 732 nm was measured immediately (A0) and 3 min
after the addition of hydrogen peroxide at 37 C (A3), using a Uvikon 923 doublebeam spectrophotometer (Kontron Instruments, Zurich, Switzerland). Absorbance
of the blank (i.e., containing PBS) was also determined to calculate the inhibition
percentage of the reaction as follows:

%inhibition

A0  A3 blank  A0  A3
 100
A0  A3 blank

Inhibition percentages were converted into trolox equivalent antioxidant

capacity (TEAC), expressed as lmol TEAC/g, using a trolox standard curve ranging
from 0 to 2.5 mM; this represented the capacity of samples to resist oxidation
reactions.
2.7. Determination of nitric oxide concentration
Evaluation of the NO concentration in plasma was realized using the Griess assay, based on transformation of NO
2 into an azo-compound, in the presence of sulphanyl amide and napthylethlene-diamide. In the presence of two coenzymes:
NADPH (0.56 lM) and FAD (70 lM), 200 lL of plasma was reduced by 120 lL nitrate reductase, in a nal volume of 600 lL. 30% of ZnSO4 was added to the system

410

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

in order to favorize the protein precipitation. After a short centrifugation (5 min,

24,000g), 100 lL of sample was mixed with 100 lL Griess reagent, incubated
10 min at 37 C, and read at 550 nm using an ELISA reader and a NaNO2 standard
curve ranging from 0 to 100 lM.

Recombinant swine IL-1b, TNF-a, IFN-c IL-10, IL-4 were used as standards and results were expressed as picograms of cytokine/mL, after normalization to the total
protein content of the samples.
2.10. Statistical analysis

2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) and data analysis
Tissue samples were taken from the liver and spleen and stored at 80 C until
RNA extraction. Tissue samples were homogenized in liquid nitrogen using an Ultra-Turrax homogenizer (IKA-Werke GmbH & Co. KG, Germany) and total RNAs
were extracted using Qiagen RNeasy midi kit (QIAGEN GmbH, Germany), according
to the manufacturers recommendations. After extraction, RNA was treated with a
ribonuclease inhibitor (RNasin Plus RNase Inhibitor; Promega Corp., USA). Quantity of extracted total RNA were measured on a Nanodrop ND-1000 spectrophotometer (Thermo Fischer Scientic, USA) and the quality was veried by agarose gel
electrophoresis. In order to quantify the expression levels of selected genes, equal
amounts of cDNA were synthesized using 1 lg of puried RNA and M-MuLV reverse
transcriptase (Fermentas, Thermo Fischer Scientic, USA), as well as oligo(dT) primers (Fermentas, Thermo Fischer Scientic, USA). Fluorescent real-time PCR was used
to evaluate the expression of: catalase (CAT), cyclooxygenase (COX2), glutathione
peroxydase (GPx) 1, superoxide dismutase 1 (SOD), inducible nitric oxide synthase
2 (iNOS). Synthesized cDNA was diluted 1:50 with nuclease-free water and used for
the qRT-PCR together with Maxima SYBR Green/Fluorescein qPCR Master Mix 2X
(Fermentas, Thermo Fischer Scientic, USA) and 0.3 lM of both forward and reverse
primers. Gene-specic primer pairs obtained from Eurogentec (San Diego, USA)
were found in the literature or designed using Primer3 and BLAST, as shown in Table 2. Thermal cycling was carried out with a Rotor Gene-Q Pure Detection (QIAGEN, Hilden, Germany) using the following conditions: 50 C, 2 min; 95 C,
10 min; and 40 cycles at 95 C, 15 s; 60 C, 1 min; 72 C, 30 s and nal elongation
step at 72 C for 10 min). Each gene was measured in triplicate and the formation
of single PCR products was conrmed using melting curves. Negative controls,
which consisted of all of the components of the qPCR mix except cDNA, were used
for all primers. The relative quantication of gene expression changes was recorded
after normalizing for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene
expression computed by using the 2(DD CT) method (Livak and Schmittgen, 2001)
and data were expressed as relative fold increase or decrease from control weanling
piglets.

2.9. Cytokine synthesis

Blood, cultured in 24 well plates, at a density of 5  106 cells/well, was stimulated with 50 ng/mL PMA and 1 lg/mL ionomycine and incubated at 37 C. Fortyeight hours later, culture supernatants were collected. Also, 500 mg of liver samples
for each animal were homogenized in phosphate buffer containing 1% igepal, 0.5%
sodium deoxycholate, 0.1% SDS and complete (EDTA-free) protease inhibitor cocktail tablets. The homogenates were kept 30 min on ice, and then centrifuged at
10,000g at 4 C for 10 min. The supernatants were frozen at 20 C, until analyzed
for cytokine content by ELISA. Total protein content was measured using Bradford
assay. Puried fractions of anti-swine cytokines from: R&D Systems (Minneapolis,
USA): IL-1b (MAB6811), TNF-a (MAB6902), IL-10 (MAB6931), IL-4 (AF654) or Invitrogen (Camarillo, Canada): IFNgamma (ASC4934) were used as capture antibody in
conjunction with biotinylated anti-swine cytokines: IL-1 b (BAF 681), TNF-a (BAF
690), IL-10 (BAF 693), IL-4 (BAF654), IFNc (ASC4839). Streptavidin-HRP (Biosource,
Camarillo, USA) and TMB (tetramethylbenzidine) were used for detection. Absorbance was read at 450 nm using a microplate reader (SUNRISE TECAN, Austria).

ANOVA tests followed by a Fisher PSLD test were used to analyze the differences
in terms of animal performances, plasma biochemistry, antibodies, cytokines synthesis, oxidative burst, expression of genes involved in the oxidative stress, total
antioxidant status, nitric oxide synthesis. The P values lower than 0.05 were considered signicant.

3. Results
3.1. Effect of dietary zearalenone on piglets performances and organ
weight
We rst investigated the effect of dietary treatment on clinical
signs and animal performance. Piglets were fed with control or
ZEN-contaminated diets for a period of 18 days. Control animals
as well as piglets fed ZEN appeared clinically normal during the
whole experiment and no deaths resulted from the ZEN exposure.
Animal performances are reported in Table 3. ZEN does not affect
the body weight, average daily gain, feed intake or feed: gain ratio
of the intoxicated animals. Also, the concentration of 316 ppb of
ZEN has no effect on weight (kg0.75) of liver, kidney, spleen or heart
of the piglets.
3.2. Effect of dietary zearalenone on cell proliferation
The [methyl-3H]-thymidine proliferation assay was used to
determine the proliferation of the PBMC isolated from the blood
of the control or intoxicated animals, cultivated for 72 h at 37 C
and 5% CO2. The results presented in Fig. 1 showed that ZEN induced a decrease of unstimulated PBMC proliferation from
586 144 cpm in cells from control animals to 198 28 cpm in
cells from ZEN animals, which represents a 66.15% decrease from
the control (P = 0.0298). No effects were observed on lymphocytes
from spleen or lymph nodes of the treated group.
3.3. Effect of dietary zearalenone on respiratory burst of granulocytes
and monocytes
To assess the effect of ZEN on the respiratory burst, the
intracellular production of H2O2, induced ex vivo by opsonised
E. coli, was evaluated by ow cytometry in peripheral granulocytes
and monocytes derived from the two control and ZEN contaminated groups (Fig. 2). As expected, E. coli stimulation induced a signicant increase of both monocytes and granulocytes response.

Table 2
Nucleotide sequences of primers for real-time PCR.
No

Gene

Forward primer (from 50 to 30 )

Reverse primer (from 50 to 30 )

Amplicon length (pb)

Genbank no.

References

GAPDH

100

NM_001206359.1

Jiang et al. (2010)

CAT

241

NM_214301.2

Blomberg et al. (2005)

COX2

119

NM_214321.1

Jung et al. (2007)

GPx

62

NM_214201.1

Hostetler et al. (2006)

iNOS

73

NM_001143690.1

Designed with primer 3 and BLAST

SOD

Fw: ACTCACTCTTCTACCTTTGATGCT
R: TGTTGCTGTAGCCAAATTCA
Fw: CTTGGAACATTGTACCCGCT
R: GTCCAGAAGAGCCTGAATGC
Fw: CCCAATTTGTTGAATCATTT
R: TCTCATCTCTCTGCTCTGGT
Fw: GGAGATCCTGAATTGCCTCAAG
R: GCATGAAGTTGGGCTCGAA
Fw: GGAGCCATCATGAACCCCAA
R: GTAGAAGCTCGTCTGGTGGG
Fw: GAGACCTGGGCAATGTGACT
R: CTGCCCAAGTCATCTGGTTT

139

NM_001190422.1

Designed with primer 3 and BLAST

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; CAT: catalase; COX2: cyclooxygenase; GPx: glutathione peroxydase; iNOS: inducible nitric oxyde synthese; SOD:
superoxyde dismutase.

411

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

Table 3
Effect of dietary zearalenone on piglets performances and organ weight.
Treatments

Performances
Initial weight (kg)
Final weight (kg)
Average daily gain (kg/animal/day)
Feed intake (kg/animal/day)
Feed: Gain (kg:kg)

P-value

Control

Zearalenone

9.4 0.20
16.0 0.50
0.367 0.02
0.681 0.03
1.87 0.08

9.5 0.20
15.7 0.70
0.344 0.04
0.716 0.12
2.17 0.23

0.80
0.75
0.58
0.41
0.25

39.2 1.1
7.69 0.3
2.77 0.1
6.15 0.3

41.0 1.9
7.50 0.3
2.49 0.1
5.70 0.3

0.44
0.75
0.22
0.37

Metabolic organ weight (g)

Liver
Kidney
Spleen
Heart
Results are expressed as mean SD, n = 5.

Mycotoxin-contaminated feed signicantly increased the percentage of responsive monocytes cells in both unstimulated (27.25 in
ZEN versus 9.77% in control) and stimulated conditions (62.54 versus 46.08% in the control). As can be seen in Fig. 2, ZEN was not
able to increase the percentage of responsive granulocytes stimulated or not with E. coli.
3.4. Effect of dietary zearalenone on selected blood biochemical
parameters in piglets
Biochemistry analysis was also performed in the plasma of animals receiving the control or ZEN supplemented diets. As can be
seen in Table 4, ZEN treatment resulted in a slightly increase of
the concentration of triglycerides and iron, while no effect was observed for cholesterol, total protein, albumin, total bilirubin, creatinin, phosphorus, calcium, magnesium. Compared with the
control, the ingestion of the mycotoxin contaminated feed induced a signicant decrease of activity of ALAT (18.35% decrease;
P = 0.004), associated with a slight decrease of activity of GGT
(26.9% decrease; P = 0.182) and of the glucose concentration
(21.31% decrease; P = 0.056).

Fig. 2. Effect of zearalenone on respiratory burst of granulocytes and monocytes.

The intracellular production of hydrogen peroxide by peripheral granulocytes and
monocytes was performed by ow-cytometry in whole blood using the uorogenic
substrate DHR 123. Data are means SD for four to ve animals/group.  Indicate
signicant differences (P < 0.05) between control and ZEN treated group.

the results are presented in Table 5. ZEN does not affect the antioxidant status, no differences being observed between groups. The
nitric oxide synthesis slightly increased after the ZEN intoxication,
with a concentration of 91.4 8.87 in the treated group compared
with 81.5 11.9 in the control group, but the difference was not
signicant (P = 0.174).

3.5. Effect of dietary zearalenone on total antioxidant status and nitric

oxide synthesis
Total antioxidant status and nitric oxide synthesis assays were
performed in the plasma of control or intoxicated animals and

3.6. Effect of dietary zearalenone on expression prole of genes

involved in the oxidative stress and inammation
The effect of mycotoxins on expression prole of genes involved
in the oxidative stress and inammation was assessed in liver and
Table 4
Effect of dietary zearalenone on selected blood biochemical parameters in piglets.
Treatments

Fig. 1. Effect of zearalenone on the lymphocyte proliferation. The ability of isolated

and mitogen stimulated lymphocyte to proliferate ex vivo was measured by
[methyl-3H]-thymidine proliferation assay. Data are means SD for four to ve
animals/group.  Indicate signicant differences (P < 0.05) between control and ZEN
treated group.

Glucose (mg/dL)
Cholesterol (mg/dL)
Triglycerides (mg/dL)
Total protein (g/dL)
Albumin (g/dL)
Total bilirubin (mg/dL)
Creatinin (mg/dL)
Urea (mg/dL)
Phosphorus (mg/dL)
Calcium (mg/dL)
Magnesium (mg/dL)
Iron (lg/dL)
Alanine aminotransferase (IU/L)
Aspartate aminotransferase (IU/L)
Alkaline phosphatase (IU/L)
Gamma glutamyl transferase (IU/L)

P-value

Control

Zearalenone

122 12.2
56.3 12.1
40.5 10.6
5.30 0.30
3.20 0.10
0.05 0.01
1.19 0.09
1.00 0.00
9.86 1.04
13.2 0.69
2.54 0.76
1216 43
37.7 3.55
51.8 5.21
184 35.8
34.8 11.3

96.0 23.8
58.0 15.7
54.1 13.7
5.24 0.83
3.07 0.40
0.09 0.01
1.14 0.26
1.00 0.00
9.29 1.43
12.9 1.60
3.12 1.43
1264 55
30.8 1.59
49.2 3.97
162 28.0
25.4 8.77

Results are expressed as mean SD, n = 5.

0.056
0.853
0.118
0.746
0.513
0.385
0.690

0.489
0.671
0.445
0.191
0.004
0.410
0.329
0.182

412

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

Table 5
Effect of dietary zearalenone on different plasma parameters involved in the oxidative
stress.
Treatments

Total Antioxidant Status (lM TEAC/g

tissue)
Nitric oxide (lM/L)

Pvalue

Control

Zearalenone

1.13 0.05

1.15 0.06

0.562

81.5 11.9

91.4 8.87

0.174

Results are expressed as mean SD, n = 5.

pro- and anti-inammatory cytokine synthesis in the liver of the

intoxicated animals by 1.89; 2.11; 2.21; 2.39 and 2.02 times for
IL-1b; TNF-a, IFN-c, IL4, and IL-10 respectively, as compared with
the control, which was signicant for IFN-c. By contrast, in blood,
ZEN increases signicantly the synthesis of TNF-a by 1.8 and tends
to increase the IFN-c and IL-1b synthesis by 1,78 and 1.23 respectively, but the increase was not statistically signicant (Fig. 5). In
blood, ZEN did not affect the synthesis of IL-10 and tended to decrease the synthesis of IL-4 (P = 0.143).

4. Discussion
spleen samples from control or treated animals using quantitative
Real-Time PCR and the results are showed in Fig. 3. In liver, ZEN induced an increase by 2.6 times for GPx (P = 0.028) and 3.25 times
for catalase expression (P = 0.080), while no effect was observed
for SOD expression. On the other hand, ZEN induced a decrease
of the expression of genes involved in inammation, with a fold
change decrease of 0.21 for COX2 (P = 0.0015) and of 0.59 for iNOS
(P = 0.224). In spleen, ZEN induced a signicant decrease of the
SOD expression (P = 0.049), while an increase was observed for
the genes involved in the inammation with a fold change of
3.29 for COX2 (P = 0.128) and of 2.38 for iNOS (P = 0.209).
3.7. Effect of dietary zearalenone on cytokine synthesis in blood and
liver
We next examined the ability of ZEN and its metabolites to
modulate the synthesis of cytokines involved in the inammatory
response in blood or in liver of the control or treated animals. As
shown in Fig. 4, ZEN intoxication induced a decrease of the

Fig. 3. Effect of zearalenone on the expression of genes involved in the oxidative

stress and inammation. Fluorescent real-time PCR was used to evaluate the
expression of CAT, COX2, GPx, SOD, iNOS genes. Data are means SD for four to ve
animals/group.  Indicate signicant differences (P < 0.05) between control and ZEN
treated group.

The contamination of cereals with zearalenone is a worldwide

problem due to the capacity of the fungus that can synthesize
ZEN to grow in any climacteric conditions (Dll and Dnicke,
2011). Indeed, surveys realized in Europe since 2004 indicated that
ZEN contamination in feed compound and feed raw materials ranged between 0.4 and 14,580 ppb, with more than 20% positive
samples (Streit et al., 2012). ZEN contamination of food and feed
was often associated with important effects on human and animal
health (FAO/WHO, 2000).
In our trial, diets contaminated or not with ZEN were fed to pigs
for 18 days, in order to investigate the effect of ZEN on some
parameters of oxidative stress and inammation in piglets after
an intoxication with zearalenone.
First we have investigated the effect of ZEN on piglets performances. Even though pigs, and especially young gilts, seem to be
the most sensitive animal species to ZEN effects, our results
showed that ZEN does not affect the body weight, average daily
gain, feed intake or feed: gain ratio of the intoxicated animals.
Other studies carried out in weanling gilts and boars showed that
overall growth and feed intake among treatments were not affected by the presence of ZEN in the diet (James and Smith,
1982; Young and King, 1986; Speranda et al., 2006; Jiang et al.,
2011). Unlike other mycotoxins, known for their capacity to affect
animal performances (deoxynivalenol, aatoxins, etc.), ZEN has

Fig. 4. Effect of zearalenone on the cytokine synthesis in liver. 500 mg of liver

samples for each animal were homogenized in phosphate buffer containing 1%
igepal, 0.5% sodium deoxycholate, 0.1% SDS and complete (EDTA-free) protease
inhibitor cocktail tablets and cytokine concentration was assessed in the supernatant. Data are means SD for four to ve animals/group.  Indicate signicant
differences (P < 0.05) between control and ZEN treated group.

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

Fig. 5. Effect of zearalenone on the cytokine synthesis in blood. Cytokine synthesis

was assessed in blood, after stimulation with 50 ng/mL PMA and 1 lg/mL
ionomycine and incubation for 48 h at 37 C. Data are means SD for four to ve
animals/group.  Indicate signicant differences (P < 0.05) between control and ZEN
treated group.

lower effects on these parameters, but when ZEN was administered together with other Fusarium mycotoxins they were able to
decrease the body weight in swine (Tiemann et al., 2006).
Also, 316 ppb of ZEN was not able to affect the weight of liver,
kidney, spleen or heart of the piglets which was in accord with
other results on the relative weight of the heart, liver, lung, kidney
and spleen in female pigs (75-day-old) treated for 21 days with
2 ppm ZEN (Wang et al., 2012). By contrast, other studies showed
that the relative weight of liver and kidney increased linearly in
postweaning gilts (21-day-old) treated for 18 days with 1.1 to
3.2 ppm ZEN (Jiang et al., 2012). These apparent contradictory results could maybe be explained by the different age of the animals
and the different number of the animals used in the two experiments. However, both studies have shown increase of the relative
weight of the reproductive organs (including uterus and vagina)
after the different ZEN treatment (Jiang et al., 2011), showing once
more that the rst effect of ZEN is on the reproductive system.
In swine, ZEN was already described as a toxin capable to decrease the in vitro cell proliferation of blood cells subsets (Marin
et al., 2010; Marin et al., 2011) or of porcine granulosa cells (Zhu
et al., 2012). This effects was conrmed in the present study, where
ZEN decreased the cell proliferation in blood, but not in spleen or
lymph nodes. According to our results, it seems that blood lymphocytes are more exposed to the ZEN action, as compared with the
splenocytes or lymphocytes from lymph nodes. In other toxicological studies, parallel assessment of the lymphocyte proliferation in
blood and immune organs (spleen) indicate a compartmentalization of the response with different effects (Waclavicek et al.,
2009; Taranu et al., 2010). In addition, other studies showed that
T-lymphocyte proliferations varied between the different immune
organs or tissues used according to their source, suggesting that Tlymphocyte proliferation is tissue/matrix dependent (Frouin et al.,
2010). A dose-dependent reduction of the lymphocyte proliferation
induced by ZEN was also observed in rats (Atkinson and Miller,
1984), humans (Forsell and Pestka, 1985; Vlata et al., 2006) or in
a monkey cell line (Bouaziz et al., 2012). It was suggested that
the decrease of cell proliferation induced by ZEN could be the result of the cell arrest in G2/M phase and the formation of DNA-adducts (Abid-Esse et al., 2003). Indeed, some studies showed that
ZEN induces DNA fragmentation and blockade of cell cycle characterized by an increase in the number of cells in the G2/M phase
(Abid-Esse et al., 2003; Minervini et al., 2006).

413

Oxidative stress results in damage to cellular structures and has

been linked to many diseases, including cancer (Marin and Taranu,
2012). Recent studies have shown that ZEN enhances ROS formation and causes oxidative damage (Yu et al., 2011). The oxidative
stress caused by ZEN may be one of the underlining mechanisms
for ZEN induced cell injury and DNA damage, which eventually
lead to tumorigenesis (Abid-Esse et al., 2009). We have shown
in the current study that ZEN treatment induced in liver an increase of the expression of two enzymes involved in the oxidative
stress, GPx and CAT Fig. 3. To our knowledge, this is the rst
study that investigates the expression of genes involved in the oxidative stress after the ZEN treatment in swine. These antioxidant
enzymes are involved in the conversion of hydrogen peroxide, a
powerful and potentially harmful oxidizing agent, into water and
molecular oxygen (Liska, 1998). ZEN induces also an increase in
GPx activity in the duodenal mucosa and kidney tissues (Grekov
et al., 2012) in chickens fed a ZEN contaminated diet, and of the
catalase activity in Vero cells or in mice testis (Salah-Abbs et al.,
2009; Abid-Esse et al., 2012). These results could be explained
as an attempt of the organism to defend itself against the ROS generation induced by ZEN.
On the other hand, it seems that in spleen the capacity of the
organism to defend is surpassed, as resulted from a decrease of
the SOD synthesis leading to impossibility to realize an adequate
response to the oxidative stress triggered by ZEN. SOD are a class
of enzymes that catalyze the dismutation of superoxide into oxygen and hydrogen peroxide, representing an important antioxidant
defense in nearly all cells exposed to oxygen (Liska, 1998). Higher
concentrations (1.13.2 ppm) of ZEN in the diet were also able to
reduce SOD activity in spleen of post-weaning gilts (Jiang et al.,
2011) or in liver and serum of weanling piglets (Jiang et al.,
2012). The down regulation in SOD gene expression and the reduction of the SOD activity could lead to the accumulation of superoxide anions within mitochondria, leading to oxidative stress,
impairing in this way some vital cellular functions (Marczuk-Krynicka et al., 2003).
ZEN was described to be both suppressor and inductor of
inammation (Ruh et al., 1998; Salah-Abbs et al., 2008; Marin
et al., 2010, 2011). Our results indicated also a different action of
ZEN on the inammatory cytokine synthesis in liver and spleen,
and on the expression of genes involved in inammation, COX2
and iNOS. In liver, ZEN induced an important reduction of the
inammatory cytokine synthesis (IL-1b, TNF a and IFN-c)
Fig. 4. This effect was correlated with a similar decrease of the
expression of genes involved in inammation, COX2 and iNOS as
showed in Fig. 3.
The same effect was also observed even for anti-inammatory
cytokines (IL-10 and IL-4) suggesting that, in liver, ZEN is rather
hepatotoxic than immunotoxic. Indeed, ZEN was able to induce
apoptosis (Abbs et al., 2007) and genotoxicity (Salah-Abbs
et al., 2009) in hepatic cells resulting in development of hepatocarcinoma (NTP, 1982). The hepatotoxic effects were associated with a
depreciation of the hepatic function, as indicated by the decrease
in the activity of hepatic enzymes (Table 4). Administration of
40 mg/kg ZEN to Balb/c mice resulted also in signicant decreases
in the levels of alkaline phosphatase, lactate dehydrogenase, alanine and aspartate aminotransferases in the liver, suggesting hepatic damage (Salah-Abbs et al., 2009).
In blood and spleen of the intoxicated piglets, ZEN induced
pro-inammatory effects. Thus, an inammatory response was
observed in the blood of ZEN treated piglets, as suggested by the
increase of the synthesis of inammatory cytokines (IL-1b, TNF-a
and IFN-c  Fig. 5) associated with an increase of the H2O2 production by monocytes and of the NO synthesis in plasma. This increase
was correlated with an increase of iNOS gene expression in spleen,
together with an increase of the expression of COX2 gene,

414

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

suggesting that ZEN was responsible for the induction of an inammatory status at least at the level of spleen and blood. Indeed, Kostro et al. (2012) showed that during the ZEN intoxication,
metabolism of arachidonic acid increased, mainly due to enzymes
of the cyclooxygenase group, which are responsible for the increase of the concentration of prostaglandin F2a and thromboxane
B2. ZEN was already described as responsible for inammation of
the reproductive organs: vulva and vagina (Mitak et al., 2002),
prostate gland (Zinedine et al., 2007), ovaries (Jiang et al., 2010)
and our results showed that ZEN could be also an inductor of the
inammation in immune organs, as spleen.
In conclusion, our results showed that in liver, ZEN has mainly
hepatotoxic effects associated with a depreciation of the hepatic
function and secondary an immunotoxic effects through the decrease of the inammatory response. In spleen and blood, ZEN
was responsible for the induction of an inammatory status and
it was responsible for the impossibility to realize an adequate response to the oxidative stress triggered by ZEN. Taken together,
our results showed that besides genital organs, liver, spleen and
blood may also be target tissues in weanling piglets fed diets containing 316 ppb ZEN for 18 days, with different effects concerning
oxidative stress and inammation.
Conict of Interest
The authors declare that there are no conicts of interest.
Acknowledgements
This work was nanced through the Project PNII: 2008-2011,
Parteneriate 5122 and PNII: 2011-2014, IDEI 101 and Nucleu
Project: 09-38 0104 granted by the Romanian Ministry of Research
and Technology. The authors want to thanks to Dr Denys Durand
and Dr. Dominique Bauchart and to all the team for their kindness
and help in measuring the nitric oxide and total antioxidant status
concentrations. The authors thank Dr. Olga Starodub for her help
with the English corrections.
References
Abbs, S., Ouanes, Z., Salah-Abbs, J.B., Abdel-Wahhab, M.A., Oueslati, R., Bacha, H.,
2007. Preventive role of aluminosilicate clay against induction of micronuclei
and chromosome aberrations in bone-marrow cells of Balb/c mice treated with
Zearalenone. Mutat. Res. 631, 8592.
Abid-Esse, S., Baudrimont, I., Hassen, W., Ouanes, Z., Mobio, T.A., Anane, R., Creppy,
E.E., Bacha, H., 2003. DNA fragmentation, apoptosis and cell cycle arrest induced
by zearalenone in cultured DOK, Vero and Caco-2 cells: prevention by Vitamin
E. Toxicology 192, 237248.
Abid-Esse, S., Ouanes, Z., Hassen, W., Baudrimont, I., Creppy, E., Bacha, H., 2004.
Cytotoxicity, inhibition of DNA and protein syntheses and oxidative damage in
cultured cells exposed to zearalenone. Toxicol. In Vitro 18, 467474.
Abid-Esse, S., Bouaziz, C., Golli-Bennour, E.E., Ouanes, Z., Bacha, H., 2009.
Comparative study of toxic effects of zearalenone and its two major
metabolites alpha-zearalenol and beta-zearalenol on cultured human Caco-2
cells. J. Biochem. Mol. Toxicol. 23, 233243.
Abid-Esse, S., Zaied, C., Bouaziz, C., Salem, I.B., Kaderi, R., Bacha, H., 2012.
Protective effect of aqueous extract of Allium sativum against zearalenone
toxicity mediated by oxidative stress. Exp. Toxicol. Pathol. 64, 689695.
Atkinson, H.A., Miller, K., 1984. Inhibitory effect of deoxynivalenol, 3acetyldeoxynivalenol and zearalenone on induction of rat and human
lymphocyte proliferation. Toxicol. Lett. 23, 215221.
Ayed, Y., Ayed-Boussema, I., Ouanes, Z., Bacha, H., 2011. In vitro and in vivo
induction of chromosome aberrations by alpha- and beta-zearalenols:
comparison with zearalenone. Mutat. Res. Genet. Toxicol. Environ. Mutagen.
726, 4246.
Bennett, J.W., Klich, M., 2003. Mycotoxins. Clin. Microbiol. 16, 497516.
Blomberg, L.A., Long, E.L., Sonstegard, T.S., Van Tassell, C.P., Dobrinsky, J.R., Zuelke,
K.A., 2005. Serial analysis of gene expression during elongation of the periimplantation porcine trophectoderm (conceptus). Physiol. Genomics. 20, 188
194.
Blunden, G., Roch, O.G., Rogers, D.J., Coker, R.D., Bradburn, N., John, A.E., 1991.
Mycotoxins in food. Med. Lab. Sci. 48, 271282.

Bouaziz, C., Bouslimi, A., Kadri, R., Zaied, C., Bacha, H., Abid-Esse, S., 2012. The
in vitro effects of zearalenone and T-2 toxins on Vero cells. Exp. Toxicol. Pathol.
(Epub ahead of print).
Boyd, P.A., Wittliff, J.L., 1978. Mechanism of Fusarium mycotoxin action in
mammary gland. J. Toxicol. Environ. Health 4, 18.
Busk, .L., Ndossi, D., Verhaegen, S., Connolly, L., Eriksen, G., Ropstad, E., Srlie, M.,
2011. Relative quantication of the proteomic changes associated with the
mycotoxin zearalenone in the H295R steroidogenesis model. Toxicon 58, 533
542.
Conkov, E., Laciakov, A., Pstorov, B., Seidel, H., Kovc, G., 2001. The effect of
zearalenone on some enzymatic parameters in rabbits. Toxicol. Lett. 121, 145
149.
Diekman, M.A., Green, M.L., 1992. Mycotoxins and reproduction in domestic
livestock. J. Anim. Sci. 70, 16151627.
Dll, S., Dnicke, S., 2011. The Fusarium toxins deoxynivalenol (DON) and
zearalenone (ZON) in animal feeding. Prev. Vet. Med. 102, 132145.
EFSA (European food Safety Authority), 2004. Opinion of the scientic panel on
contaminants in the food chain on a request from the commission related to
zearalenone as undesirable substance in animal feed. EFSA J. 89, 135.
El-Makawy, A., Hassanane, M.S., Abd Alla, E.-S.A.M., 2001. Genotoxic evaluation for
the estrogenic mycotoxin zearalenone. Reprod. Nutr. Dev. 41, 7989.
Engelhardt, G., Barthel, J., Sparrer, D., 2006. Fusarium mycotoxins and ochratoxin A
in cereals and cereal products: results from the bavarian health and food safety
authority in 2004. Mol. Nutr. Food Res. 50, 401405.
FAO/WHO Expert Committee on Food Additives (JECFA), 2000. Safety evaluation of
certain food additives and contaminants. WHO food additive series 44,
zearalenone. World Health Organisation, Geneva, Switzerland, pp. 393482.
Forsell, J.H., Pestka, J.J., 1985. Relation of 8-ketotrichothecene and zearalenone
analog structure to inhibition of mitogen-induced human lymphocyte
blastogenesis. Appl. Environ. Microbiol. 50, 13041307.
Frouin, H., Mnard, L., Measures, L., Brousseau, P., Fournier, M.T., 2010. Lymphocyteproliferative responses of a grey seal (Halichoerus grypus) exposed to heavy
metals and PCBs in vitro. Aquat. Mammals 36, 365371.
Ghdira-Chkir, L., Maarou, K., Creppy, E.E., Bacha, H., 1999. Cytotoxic and
genotoxic effects of zearalenone: prevention by vitamin E. J. Toxicol. Toxin
Rev. 18, 355368.
Green, M.L., Diekman, M.A., Malayer, J.R., Scheidt, A.B., Long, G.G., 1990. Effect of
prepubertal consumption of zearalenone on puberty and subsequent
reproduction of gilts. J. Anim. Sci. 68, 171178.
Grekov, L., Borutov, R., Faix, S., Plach, I., Cobanov, K., Kokov, B., Leng, L.,
2012. Effect of lignin on oxidative stress in chickens fed a diet contaminated
with zearalenone. Acta Vet. Hung. 60, 103114.
Hassen, W., Ayed-Boussema, I., Azqueta Oscoz, A., de Cerain Lopez, A., Bacha, H.,
2007. The role of oxidative stress in zearalenone-mediated toxicity in Hep G2
cells: oxidative DNA damage, gluthatione depletion and stress proteins
induction. Toxicology 232, 294302.
Hostetler, C.E., Michal, J., Robison, M., Ott, T.L., Kincaid, R.L., 2006. Effect of selenium
intake and fetal age on mRNA levels of two selenoproteins in porcine fetal and
maternal liver. J. Anim. Sci. 84, 23822390.
Hussein, H.S., Brasel, J.M., 2001. Toxicity, metabolism, and impact of mycotoxins on
humans and animals. Toxicology 167, 101134.
James, L.J., Smith, T.K., 1982. Effect of dietary alfalfa on zearalenone toxicity and
metabolism in rats and swine. J. Anim. Sci. 55, 110118.
Jenny, N.S., 2012. Inammation in aging: cause, effect, or both? Discov. Med. 13,
451460.
Jiang, S.Z., Yang, Z.B., Yang, W.R., Yao, B.Q., Zhao, H., Liu, F.X., Chen, C.C., Chi, F., 2010.
Effects of feeding puried zearalenone contaminated diets with or without clay
enterosorbent on growth, nutrient availability, and genital organs in postweaning female pigs. AsianAust. J. Anim. Sci. 23, 7481.
Jiang, S.Z., Yang, Z.B., Yang, W.R., Gao, J., Liu, F.X., Broomhead, J., Chi, F., 2011. Effects
of puried zearalenone on growth performance, organ size, serum metabolites,
and oxidative stress in postweaning gilts. J. Anim. Sci. 89, 30083015.
Jiang, S.Z., Yang, Z.B., Yang, W.R., Wang, S.J., Wang, Y., Broomhead, J., Johnston, S.L.,
Chi, F., 2012. Effect on hepatonephric organs, serum metabolites and oxidative
stress in post-weaning piglets fed puried zearalenone-contaminated diets
with or without Calibrin-Z. J. Anim. Physiol. Anim. Nutr. (Berl.) 96, 11471156.
Jung, K., Park, H.J., Kim, Y.H., Hong, J.P., 2007. Expression of tumor necrosis factoralpha and cyclooxygenase-2 mRNA in porcine split-thickness wounds treated
with epidermal growth factor by quantitative real-time PCR. Res. Vet. Sci. 82,
344348.
Kabak, B., Dobson, A.D., Var, I., 2006. Strategies to prevent mycotoxin contamination
of food and animal feed: a review. Crit. Rev. Food Sci. Nutr. 46, 593619.
Kiessling, K.H., Pettersson, H., 1978. Metabolism of zearalenone in rat liver. Acta
Pharmacol. Toxicol. (Copenh) 43, 285290.
Kim, Y.J., Kim, E.H., Hahm, K.B., 2012. Oxidative stress in inammation-based
gastrointestinal tract diseases: challenges and opportunities. J. Gastroenterol.
Hepatol. 27, 10041010.
Koraichi, F., Videmann, B., Mazallon, M., Benahmed, M., Prouillac, C., Lecoeur, S.,
2012. Zearalenone exposure modulates the expression of ABC transporters and
nuclear receptors in pregnant rats and fetal liver. Toxicol. Lett. 211, 246256.
Kostro, K., Dudek, K., Lisiecka, U., Majer-dziedzic, B., Aleksiewicz, R., Lutnicki, K.,
2012. Concentrations of proinammatory mediators of the arachidonic acid
cascade in serum of sheep with natural zearalenone intoxication. Bull. Vet. Inst.
Pulawy 56, 7581.
Kuiper-Goodman, T., Scott, P.M., Watanabe, H., 1987. Risk assessment of the
mycotoxin zearalenone. Regul. Toxicol. Pharmacol. 7, 253306.

D.E. Marin et al. / Food and Chemical Toxicology 58 (2013) 408415

Liska, D.J., 1998. The detoxication enzyme systems. Altern. Med. Rev. 3, 187198.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25,
402408.
Luongo, D., De Luna, R., Russo, R., Severino, L., 2008. Effects of four Fusarium toxins
(fumonisin B(1), alpha-zearalenol, nivalenol and deoxynivalenol) on porcine
whole-blood cellular proliferation. Toxicon 52, 156162.
Maarou, K., Chekir, L., Creppy, E.E., Ellouz, F., Bacha, H., 1996. Zearalenone induces
modications of haematological and biochemical parameters in rats. Toxicon
34, 535540.
MacDonald, S.J., Anderson, S., Brereton, P., Wood, R., Damant, A.J., 2005.
Determination of zearalenone in barley, maize and wheat our, polenta, and
maize-based baby food by immunoafnity column cleanup with liquid
chromatography: interlaboratory study. AOAC Int. 88, 17331740.
Marczuk-Krynicka, D., Hryniewiecki, T., Piatek, J., Paluszak, J., 2003. The effect of
brief food withdrawal on the elevation of free radicals and other parameters of
oxidative status in the liver. Med. Sci. Monit. 9, 131135.
Marin, D.E., Taranu, I., 2012. Overview on aatoxins and oxidative stress. Toxin Rev.
31, 3243.
Marin, D.E., Taranu, I., Burlacu, R., Tudor, D.S., 2010. Effects of zearalenone and its
derivatives on the innate immune response of swine. Toxicon 56, 956963.
Marin, D.E., Taranu, I., Burlacu, R., Manda, G., Motiu, M., Neagoe, I., Dragomir, C.,
Stancu, M., Calin, L., 2011. Effects of zearalenone and its derivatives on porcine
immune response. Toxicol. In Vitro 25, 19811988.
Minervini, F., DellAquila, M.E., 2008. Zearalenone and reproductive function in farm
animals. Int. J. Mol. Sci. 9, 25702584.
Minervini, F., Giannoccaro, A., Fornelli, F., DellAquila, M.E., Minoia, P., Visconti, A.,
2006. Inuence of mycotoxin zearalenone and its derivatives (alpha and beta
zearalenol) on apoptosis and proliferation of cultured granulosa cells from
equine ovaries. Reprod. Biol. Endocrinol. 4, 62.
Mitak, M., Gojmerac, T., Cvrtila, D., Cvetnic, Z., 2002. Effect of atrazine and
zearalenone on the number of receptor binding sites for 3H-estradiol in the rat
uterus cytosol. Vet. Med. Czech 47, 1216.
NTP, 1982. Technical Report on the Carcinogenesis Bioassay of Zearalenone in F344/
n Rats and B6c3f1 Mice (feed study).
Pazaiti, A., Kontos, M., Fentiman, I.S., 2012. ZEN and the art of breast health
maintenance. Int. J. Clin. Pract. 66, 2836.
Pestka, J.J., Tai, J.H., Witt, M.F., Dixon, D.E., Forsell, J.H., 1987. Suppression of immune
response in the B6C3F1 mouse after dietary exposure to the Fusarium
mycotoxins deoxynivalenol (vomitoxin) and zearalenone. Food Chem. Toxicol.
25, 297304.
Richard, J.L., 2007. Some major mycotoxins and their mycotoxicoses an overview.
Int. J. Food Microbiol. 119, 310.
Ruh, M.F., Bi, Y., Cox, L., Berk, D., Howlett, A.C., Bellone, C.J., 1998. Effect of
environmental estrogens on IL-1b promoter activity in a macrophage cell line.
Endocrine 9, 207211.
Salah-Abbs, J.B., Abbs, S., Houas, Z., Abdel-Wahhab, M.A., Oueslati, R., 2008.
Zearalenone induces immunotoxicity in mice: possible protective effects of
radish extract (Raphanus sativus). J. Pharm. Pharmacol. 60, 761770.
Salah-Abbs, J.B., Abbs, S., Abdel-Wahhab, M.A., Oueslati, R., 2009. Raphanus sativus
extract protects against zearalenone induced reproductive toxicity, oxidative
stress and mutagenic alterations in male Balb/c mice. Toxicon 53, 525533.
Scislowski, V., Bauchart, D., Gruffat, D., Laplaud, P.M., Durand, D., 2005. Effect of
dietary n-6 and n-3 polyunsaturated fatty acids on peroxidizability of
lipoproteins in steers. Lipids 40, 12451256.

415

Speranda, M., Liker, B., Speranda, T., Seric, V., Antunovic, Z., Grabarevic, Z.,
Sencic, ., Grguric, D., Steiner, Z., 2006. Haematological and biochemical
parameters of weaned piglets fed on fodder mixture contaminated by
zearalenone with addition of clinoptilolite. Acta Vet. Beograd. 56, 121
136.
Streit, E., Schatzmayr, G., Tassis, P., Tzika, E., Marin, D., Taranu, I., Tabuc, C., Nicolau,
A., Aprodu, I., Puel, O., Oswald, I.P., 2012. Current situation of mycotoxin
contamination and co-occurrence in animal feedfocus on Europe. Toxins
(Basel) 4, 788809.
Tabuc, C., Marin, D., Guerre, P., Sesan, T., Bailly, J.D., 2009. Molds and
mycotoxin content of cereals in southeastern Romania. J. Food Prot. 72,
662665.
Takemura, H., Shim, J.Y., Sayama, K., Tsubura, A., Zhu, T., Shimoi, K., 2007.
Characterization of the estrogenic activities of zearalenone and zeranol
in vivo and in vitro. J. Steroid Biochem. Mol. Biol. 103, 170177.
Taranu, I., Marin, D.E., Burlacu, R., Pinton, P., Damian, V., Oswald, I.P., 2010.
Comparative aspects of in vitro proliferation of human and porcine lymphocytes
exposed to mycotoxins. Arch. Anim. Nutr. 64, 383393.
Taranu, I., Marin, D.E., Manda, G., Motiu, M., Neagoe, I., Tabuc, C., Stancu, M.,
Olteanu, M., 2011. Assessment of the potential of a boron-fructose additive in
counteracting the toxic effect of Fusarium mycotoxins. Br. J. Nutr. 106, 398
407.
Tiemann, U., Brssow, K.P., Kchenmeister, U., Jonas, L., Kohlschein, P., Phland, R.,
Dnicke, S., 2006. Inuence of diets with cereal grains contaminated by graded
levels of two Fusarium toxins on selected enzymatic and histological parameters
of liver in gilts. Food Chem. Toxicol. 44, 12281235.
Vlata, Z., Porichis, F., Tzanakakis, G., Tsatsakis, A., Krambovitis, E., 2006. A study of
zearalenone cytotoxicity on human peripheral blood mononuclear cells.
Toxicol. Lett. 165, 274281.
Waclavicek, M., Stich, N., Rappan, I., Bergmeister, H., Eibl, M.M., 2009. Analysis of
the early response to TSST-1 reveals Vbeta-unrestricted extravasation,
compartmentalization of the response, and unresponsiveness but not energy
to TSST-1. J. Leukoc. Biol. 85, 4454.
Wang, D.F., Zhang, N.Y., Peng, Y.Z., Desheng, Q., 2012. Interaction of zearalenone and
soybean isoavone in diets on the growth performance, organ development and
serum parameters in prepubertal gilts. J. Anim. Physiol. Anim. Nutr. (Berl). 96,
939946.
World Health Organisation (WHO), 1991. Mycotoxins. Fact Sheet No. 5. Basic Food
Safety for Health Workers.
Young, L.G., King, G.J., 1986. Low concentrations of zearalenone in diets of boars for
a prolonged period of time. J. Anim. Sci. 63, 11971200.
Yu, J.Y., Zheng, Z.H., Son, Y.O., Shi, X., Jang, Y.O., Lee, J.C., 2011. Mycotoxin
zearalenone induces AIF- and ROS-mediated cell death through p53- and
MAPK-dependent signaling pathways in RAW264.7 macrophages. Toxicol. In
Vitro 25, 16541663.
Zhu, L., Yuan, H., Guo, C., Lu, Y., Deng, S., Yang, Y., Wei, Q., Wen, L., He, Z., 2012.
Zearalenone induces apoptosis and necrosis in porcine granulosa cells via a
caspase-3- and caspase-9-dependent mitochondrial signaling pathway. J. Cell
Physiol. 227, 18141820.
Zinedine, A., Soriano, J.M., Molto, J.C., Manes, J., 2007. Review on the toxicity,
occurrence, metabolism, detoxication, regulations and intake of zearalenone:
an oestrogenic mycotoxin. Food Chem. Toxicol. 45, 118.
Zourgui, L., El Golli, E., Bouaziz, C., Bacha, H., Hassen, W., 2008. Cactus (Opuntia
cus-indica) cladodes prevent oxidative damage induced by the mycotoxin
zearalenone in Balb/C mice. Food Chem. Toxicol. 46, 18171824.