Anda di halaman 1dari 30

tugas mata kuliah biologi molekuler

I
PENDAHULUAN
1.1. Latar Belakang
Infertilitas merupakan suatu keadaan yang menyebabkan kegagalan konsepsi
pada pasangan yang telah menikah lebih dari satu tahun, yang tidak menghasilkan
keturunan meskipun tidak mengikuti program keluarga berencana. Sekitar 10% dari
pasangan suami-istri mengalami infertilitas. Faktor peyebab infertilitas berasal dari
suami, istri, atau keduanya. Faktor lain dari kedua belah pihak sebesar 30-40%.
Menurut penelitian yang dilakukan Lim dan Ratnam, faktor penyebab yang berasal
dari suami sebesar 33%, sedangkan hasil penelitian WHO pada 1989 sebesar 40%.
Penelitian yang dilakukan Arsyad terhadap 246 pasangan infertil di Palembang
menunjukkan infertilitas yang disebabkan faktor pria sebesar 48,4%. Setengah dari
kasus infertilitas pria tersebut disebabkan oleh rendahnya motilitas sperma
(asthenozoospermia) dan atau jumlah sperma (oligoszoopermia), dan kelainan
morfologis sperma (teratozoospermia).2,3 Kriteria yang digunakan oleh WHO tahun
1999, tentang fertilitas pria.
Mitokondria adalah tempat terjadinya respirasi sel melalui reaksi enzimatik
fosforilasi oksidatif (OXPHOS) menghasilkan suatu energi dalam bentuk Adenosine
Triphosphate (ATP). Matriks di dalam mitokondria yang berfungsi sebagai respirasi
sel disebut Deoxyribonucleic Acid (DNA), DNA mitokondria tersebut dikenal dengan
sebutan mtDNA. Di dalam mtDNA banyak terdapat gen dan juga terdapat daerah
yang tidak menyandi (noncoding region) pada mtDNA disebut daerah gelung-D (Dloop), yang merupakan tempat awal terjadinya proses replikasi dan transkripsi.
Kecepatan mutasi mtDNA pada D-loop adalah 1020 kali DNA inti (DNA), sehingga
urutan DNA pada daerah D-loop ini sangat variatif (Horai and Hayasaka, 1990;
Wallace, 1992; Brown and Wallace, 1993). Akibat adanya mutasi mtDNA di samping
mengakibatkan menurunnya ATP, akan diperoleh Reactive Oxygen Species (ROS)
antara lain hidrogen peroksida yang tinggi. Sedangkan sifat dari hidrogen peroksida

adalah oksidator, yang mana pada konsentrasi yang tinggi akan mengoksidasi lipid,
protein dan DNA.
Sasaran oksidasi ROS adalah lipid, protein dan DNA (Sies and Menck, 1992).
Pada oksidasi DNA, nukleotida guanin adalah nukleotida yang rawan terhadap
oksidasi ROS. Hasil oksidasi guanin adalah 8-hidroksideoksiguanosin (8-OH-dG).
Dengan teroksidasinya guanin pada untai DNA, maka untai DNA akan kehilangan
nukleotida guanin. Jumlah hilangnya guanin tergantung kadar ROS, hal ini
menyebabkan keadaan yang disebut mutasi DNA. Akibatnya dapat menyebabkan
kerusakan mtDNA dan nDNA (Ozawa, 1995). Kerusakan pada nDNA akan
mengganggu proses pembelahan sel pada spermatogenesis, dan pada mitokondria
mengganggu rantai respirasi sel yang dapat menurunkan energi sel (Sohal and Brunk,
1992).
Saat ini lebih dari 100 mutasi titik (point mutation) pada mitokondria telah
ditemukan dan berhubungan dengan penyakit-penyakit manusia, namun baru
beberapa mutasi mtDNA yang dilaporkan terjadi pada spermatozoa. Apabila hal ini
terjadi pada spermatozoa dikawatirkan dapat menyebabkan menurunnya motilitas
spermatozoa dikarenakan motilitas spermatozoa sangat membutuhkan ATP (RuizPesini et al., 1998).
Dari beberapa paparan di atas dapat diduga bahwa 8-hidroksideoksiguanosin
(8-OH-dG) dan hidrogen peroksida di dalam sperma dapat dijadikan sebagai salah
satu indikator mutasi DNA pada sperma (infertilitas pria), sehingga pada bahasan ini
akan dibahas mengenai pengukuran kedua senyawa tersebut.

BAB II
DASAR TEORI
2.1 Mitokondria
Mitokondria adalah organela yang terletak di dalam sitoplasma sel eukariota.
Struktur organela ini berupa kantung yang selaputi oleh dua membran yaitu membran
luar dan membran dalam, selain itu memiliki dua kompartemen yaitu matriks
mitokondria (yang diselimuti langsung oleh membran dalam) dan ruang antar
membran.
Membran luar mengandung sejumlah protein transpor (yang disebut porin) dan
enzim-enzim yang terlibat dalam biosintesis lipid dan metabolisme mitokondria.

Gambar 1. Struktur Mitokondria.


Keterangan :

Mitokondria diselaputi oleh dua membran yaitu membran luar dan membran dalam.
Membran dalam membentuk struktur yang melipat ke dalam disebut krista. Mitokondria
memiliki dua kompartemen yaitu matriks dan ruang antar membran. Membran luar dapat
dilalui ion atau molekul kecil, sedangkan membran dalam bersifat impermeabel. Pada
membran dalam terdapat kompleks protein rantai respirasi, ATP sintase dan transporter
membran. Ruang matriks mengandung enzim, ribosom, DNA mitokondria.

Membran dalam memiliki struktur melekuk, melipat ke bagian matriks


mitokondria, yang dikenal sebagai krista. Struktur melekuk ini sangat membantu dalam
meningkatkan

luas

permukaan

membran

dalam

sehingga

meningkatkan

kemampuannya menghasilkan ATP. Struktur yang melekuk ini juga membantu


mempercepat komponen matriks mencapai membran dalam. Membran dalam dan
matriks mitokondria terkait erat dengan aktivitas utama mitokondria yaitu terlibat
dalam pembentukan energi, oksidasi asam lemak dan siklus Krebs. Matriks
mitokondria mengandung protein (sekitar 67% dari seluruh protein mitokondria),
enzim, DNA mitokondria dan ribosom (Lodish et al., 2000; Artika, 2003).
Jumlah mitokondria di dalam sel tergantung dari jumlah kebutuhan sel akan
energi. Sel dengan kebutuhan energi yang besar mengandung banyak mitokondria,
misalnya oosit yang mengandung 100.000 mitokondria, sedangkan pada spermatozoa
matang, jumlah mitokondria sekitar 22-28 (St. John et al., 2005). Oosit membutuhkan
energi yang banyak terutama untuk pembelahan setelah dibuahi spermatozoa.
Sedangkan pada spermatozoa matang, energi yang dibutuhkan hanya dipakai untuk
pergerakan atau motilitas dalam rangka membuahi ovum.

Gambar 2. Spermatozoa manusia.


Keterangan : Spermatozoa dengan tudung akrosom, nukleus, selubung mitokondria dan
mitokondria yang tersusun heliks di daerah midpiece (A). Penampang melintang
bagian spermatozoa, mulai bagian kepala, leher dan ekor (B). Gambar skematik
penampang longitudinal spermatozoa yang didasari mikrografi elektron (C)
(Holstein et al., 2003).

Pada spermatozoa, mitokondria terletak pada daerah midpiece, terdiri atas 11-13
gira (masing-masing girus ada 2 mitokondria) yang tersusun secara heliks, melingkari
bagian pusat midpiece ekor (Zamboni, 1991; Holstein et al., 2003).
Mitokondria yang tersusun heliks ini bertanggung jawab menyediakan energi
bagi motilitas spermatozoa (Hirata et al., 2002). Gangguan pada mitokondria, baik
struktur maupun genomnya dapat mengganggu motilitas sperma. Mundy et al. (1995)
membuktikan bahwa pada subjek astenozoospermia, daerah midpiece yang berisi
mitokondria secara bermakna lebih pendek dibanding subjek normal. Sedangkan
menurut Cardullo dan Baltz (1991) ada korelasi antara volume mitokondria, panjang
sperma dan frekuensi gerak flagela. Menurunnya motilitas dapat disebabkan oleh
gangguan gen-gen yang terlibat dalam pembentukan ekor dan fungsi axonema ekor
spermatozoa (Moore dan Reijo-Pera, 2000).
2.2 Fungsi Fosforilasi Oksidatif Mitokondria
Fungsi mitokondria dalam sel adalah menghasilkan energi dalam bentuk ATP
(adenosine triphosphate). Sebagian besar ATP dihasilkan melalui proses fosforilasi
oksidatif. Energi yang dihasilkan ini digunakan sel untuk homeostatis, regulasi,
pembelahan, motilitas dan kematian (Wallace, 1999; St. John et al., 2005; May
Panloup et al., 2006).
Fosforilasi oksidatif merupakan reaksi kondensasi molekul ADP dengan Pi
(phosphate inorganic, Pi) menjadi ATP menggunakan energi yang dihasilkan dari
rantai respirasi (Saraste, 1999; Lehtonen, 2002). Fosforilasi oksidatif melibatkan
perpindahan elektron dari senyawa NADH dan suksinat, keduanya merupakan substrat
yang akan melepaskan elektronnya untuk reaksi transduksi energi ke molekul oksigen
sebagai akseptor elektron terakhir dan membentuk H2O.

Gambar 3. Fosforilasi oksidatif pada membran dalam mitokondria.


Keterangan : Elektron ditransfer melalui NADH masuk ke dalam kompleks I (CI) dan ditranspor ke
koenzim Q (Q). Beberapa elektron dari oksidasi asam organik ditransfer melalui
kompleks II (CII) langsung ke Q. Elektron-elektron tersebut kemudian ditransfer ke
kompleks III (CIII), ke sitokrom c (cyt c) dan dilanjutkan ke kompleks IV (CIV),
kemudian direduksi menjadi air. Transfer elektron disertai transpor proton dari matrik ke
ruang membran dalam mitokondria (inner membrane space, IMS). Transpor proton
menyebabkan gradien potensial yang menimbulkan energi, yang dipakai untuk
membentuk ATP (Lehtonen, 2002).

Proses fosforilasi oksidatif melibatkan lima kompleks enzim rantai respirasi


(Gambar 3) yang bertanggung jawab dalam memproduksi ATP yaitu: kompleks I
(NADH

ubikuinon

oksidoreduktase),

kompleks

II

(suksinat

ubikuinon

oksidoreduktase), kompleks III (ubikuinon ferositokrom c oksidoreduktase), kompleks


IV (ferositokrom c oksidase) dan kompleks V (ATP sintase). Secara bersama-sama
kelima kompleks tersebut membentuk rantai transpor elektron. Elektron dari kompleks
I dan II (berasal dari reaksi oksidasi NADH oleh kompleks I dan oksidasi suksinat oleh
kompleks II) ditransfer ke ubikuinon (koenzim Q, CoQ), kemudian ditransfer lagi ke
kompleks III tereduksi. Elektron dari kompleks III ditransfer ke sitokrom c, kemudian
sitokrom c ini dioksidasi kompleks IV. Elektron yang dihasilkan kompleks IV
digunakan untuk mengubah O2 menjadi H2O (Shoffner dan Wallace, 1995; Saraste,
1999; Lehtonen, 2002).
Transfer elektron antara kompleks I, III dan IV disertai transpor proton dari
matriks ke ruang antar membran dengan menggunakan energi bebas yang dilepaskan
oleh masing-masing kompleks. Pemindahan proton ini mengakibatkan akumulasi
proton pada ruang antar membran sehingga menimbulkan suatu gradien potensial
proton. Keadaan ini dimanfaatkan oleh kompleks V untuk mensintesis ATP dari ADP
dan Pi dengan menggunakan energi yang dilepaskan saat proton berpindah dari ruang

antar membran ke matriks (Shoffner dan Wallace, 1995; Saraste, 1999; Lehtonen,
2002).

2.3 Genom Mitokondria : Organisasi MtDNA dan Haplogroup


Selain genom yang terletak di inti, manusia memiliki DNA di luar inti yang
terdapat dalam mitokondria. DNA mitokondria (mtDNA) berbentuk lingkaran heliks
tertutup yang terdapat di dalam matrik, urutan nukleotidanya telah diketahui secara
lengkap (Andersons et al., 1981) dan dapat diakses melalui GenBank Accesion:
M63933. Terdapatnya genom di dalam matriks, menyebabkan mitokondria mampu
melakukan replikasi mtDNA dan mengekspresikan gennya (sintesis protein) yang
dikatalisis oleh enzim dan diatur oleh faktor protein yang dikode oleh DNA nukleus
(nDNA). Replikasi mtDNA bergantung pada gen dari nDNA yang disebut nuclearencoded polymerase gamma atau PLOG dan mitochondrial transcription factor A
(MTFA).
Di dalam mtDNA struktur organisasinya 93% merupakan daerah ekson dan 7%
daerah intron. Dari 93% daerah ekson tersebut banyak terdapat gen, yaitu 37% gen
yang terdiri dari 13 polipeptida, 2 rRNA dan 22 tRNA. Daerah yang tidak menyandi
(noncoding region) pada mtDNA disebut daerah gelung-D (D-loop), yang merupakan
tempat awal terjadinya proses replikasi dan transkripsi (Wallace, 1992). Kecepatan
mutasi mtDNA pada D-loop adalah 1020 kali DNA inti (DNA), sehingga urutan DNA
pada daerah D-loop ini sangat variatif (Horai and Hayasaka, 1990; Wallace, 1992;
Brown and Wallace, 1993).
MtDNA mempunyai 2 untai yaitu untai Heavy (H) yang kaya dengan guanin
dan untai Light (L) yang kaya dengan sitosin. MtDNA merupakan DNA yang padat
gen dan hampir tidak mempunyai intron, berukuran sebesar 16569 pasang basa (pb)
yang membentuk 37 gen.
Untai H menyandi 13 polipeptida untuk protein kompleks rantai respirasi, 22
tRNA dan 2 rRNA (12S dan 16S) yang berfungsi dalam proses sintesis protein

mitokondria (Andersons et al., 1981). Ketiga belas polipeptida meliputi tujuh sub unit
(ND1, 2, 3, 4, 4L, 5 dan 6) dari kompleks I rantai respirasi, satu sub unit (apositokrom
b) dari kompleks III, tiga sub unit (CO I, II, III) dari kompleks IV dan dua sub unit
(ATP ase 6 dan ATP ase 8) dari kompleks V (Attardi et al., 1987).

Gambar 4. Genom mitokondria manusia.


Keterangan : MtDNA menyandi 13 rantai polipeptida sub unit kompleks enzim rantai
respirasi, 22 tRNA, 2 rRNA (12S dan 16 S).MtDNA mengandung titik asal
replikasi (origin of replication) untuk untai Heavy (H) yaitu OH dan untai Light
(L) yaitu OL serta mempunyai 2 promoter transkripsi untuk untai Heavy (H) dan
Light (L) (PH dan PL). Selain itu, terdapat daerah pengontrol yaitu D-loop yang
tidak menyandi gen (Anderson et al., 1981).

Terdapat suatu daerah pengontrol yang tidak menyandi (non coding region),
disebut sebagai displacement loop (D-loop). Daerah D-loop merupakan struktur
beruntai tiga (triple stranded), terdiri dari 1122 pb (16024-00575), mempunyai titik asal
replikasi rantai H (OH) dan 2 promoter utama untuk untai H dan L (PH dan PL).
Transkripsi MtDNA diinisiasi dari dua promoter yang ada di daerah Dloop yaitu PH
dan PL, transkripsi berjalan mengelilingi mtDNA sehingga membentuk RNA yang
polisistronik. D-loop merupakan daerah kontrol utama ekspresi mtDNA, dan berfungsi
sebagai promoter utama transkripsi (Clayton, 1991). Di daerah D-loop terdapat dua
daerah yang sangat bervariasi yaitu hypervariable region 1 (HVR1) dan hypervariable

region 2 (HVR2), kedua daerah ini tidak menyandi gen tertentu, namun telah diketahui
berperan penting pada studi populasi. Daerah D-loop diperkirakan bervariasi sekitar 13% (1-3 per 100 nukleotida) antara individu yang tidak memiliki hubungan keluarga
(Sudoyo, 2003).

2.4 Peran Genetik mtDNA Pada Motilitas Spermatozoa


Motilitas sperma adalah pergerakan sperma. Sperma bergerak (motil), dengan
maksud agar sampai di alat reproduksi wanita untuk pembuahan. Energi untuk
motilitas bersumber pada bagian tengah spermatozoa. Di bagian itu terdapat
mitokhondria, yang memecah bahan-bahan tertentu untuk mengeluarkan energi.
Bagian tengah spermatozoa dapat diibaratkan generator spermatozoa. Energi dari
bagian tengah disalurkan ke distal, yaitu ke ekor. Ekor kemudian bergerak. Jadi ekor
dapat diibaratkan sebagai kemudi juga sebagai pendorong spermatozoa (Tjipto, 2008).
Mitokondria spermatozoa memegang peranan penting terhadap fungsi sperma,
perubahan genetik pada DNA mitokondria (karena mutasi atau varian haplogroup)
membawa konsekuensi tersendiri pada fertilisasi secara normal terutama kesuburan
pria (Sanchez et al., 2003). Hal ini dapat dipahami karena selain genom inti, mtDNA
ikut bertanggung jawab menyandi kompleks enzim respirasi dalam menghasilkan ATP
yang digunakan untuk motilitas spermatozoa (Moore dan Reijo-Pera, 2000). ATP
digunakan untuk menggerakkan protein dinein penyusun axonema flagela. Telah
dilaporkan bahwa gangguan pada motor dinein atau komponen lain yang mengatur
aktivitas motor dapat menyebabkan infertilitas dan respirasi (Supp et al., 2000).
ATP yang dihasilkan oleh mitokondria sebagian besar berasal dari rantai
transfer elektron pada waktu fosforilasi oksidatif, dimana segala protein yang terlibat
pada proses rantai respirasi ini disandi oleh genom inti dan genom mitokondria.
Hambatan fosforilasi oksidatif diyakini juga terkait dengan genom mitokondria karena
secara genetik mtDNA ikut berperan dalam menyandi kompleks enzim respirasi.
Genom mitokondria hanya memiliki ekson, tidak mengandung intron dan
histon. Protein histon dianggap sebagai dasar dari mekanisme pemulihan terhadap
kerusakan gen, dengan demikian genom mtDNA kurang terlindungi. Mutasi yang
terjadi pada mtDNA 10 100 kali lebih tinggi daripada nDNA.
Mutasi titik atau delesi skala besar diyakini dapat menyebabkan disfungsi
motilitas spermatozoa (St. John et al., 2005). Mutasi pada mtDNA dapat mengganggu
ekspresi satu atau lebih protein enzimatik (Schon et al., 1997). Mutasi mtDNA dapat
menurunkan motilitas spermatozoa dengan cara menurunkan produksi ATP.

Beberapa mutasi yang terjadi pada mtDNA yang terkait dengan motilitas
spermatozoa banyak diteliti. Folgero et al. (1993) menemukan mutasi mtDNA A3243G
menurunkan motilitas sperma. Pada level yang sangat rendah mutasi A3243G sudah
mampu menyebabkan gangguan metabolisma energi (Chinnery et al., 2000).
Spiropoulos et al. (2002) menemukan mutasi mtDNA A3243G yang terjadi pada
mitokondria dengan level yang tinggi secara kuat berhubungan dengan penurunan
motilitas spermatozoa.
Selain mutasi A3243G, delesi 4977 pb mtDNA juga ditemukan pada
spermatozoa dari pria infertil atau subfertil. Mutasi ini dapat ditemukan juga pada pria
normal, namun jika frekuensinya tinggi dapat menurunkan motilitas spermatozoa. Dari
penelitian lain menemukan bahwa mutasi delesi 4977 pb yang hadir sendirian pada
spermatozoa (tanpa disertai mutasi lain) jika levelnya sedikit tidak mempengaruhi
kualitas semen (Cummins et al., 1998) atau parameter spermatozoa (St. John et al.,
1997).
Kao et al. (1998) lebih menegaskan lagi bahwa multi delesi mtDNA (delesi
4977 pb; delesi 7345 pb atau delesi 7599 pb) berperan penting pada kondisi
patofisiologi spermatozoa manusia, karena dapat menyebabkan defisiensi multi rantai
pernafasan. Delesi 4977 menyebabkan hilang atau terpotongnya banyak gen struktur
(ATPase 6/8, COIII, ND3, ND4L dan ND4) dan 5 gen tRNA. Delesi 7345 pb dan 7599
pb menyebabkan hilang atau terpotongnya gen struktur ATPase 6/8, COIII, ND3,
ND4L, ND4 dan 8 gen tRNA (Lee dan Wei, 1997).
Gangguan terbentuknya enzim respirasi karena multi delesi (gen struktur dan
tRNA) ternyata dapat menimbulkan kerusakan oksidatif yang disebabkan munculnya
radikal bebas. Kerusakan oksidatif ini dapat merusak struktur membran plasma
spermatozoa karena membran plasma kaya akan asam lemak poly unsaturated (Rao
dan Martin, 1989; Yakes dan van Houten, 1997).
Di dalam jaringan tubuh, mitokondria bersifat heteroplasma, yang berarti di
dalam jaringan yang sama bisa terdapat mutan mtDNA dan wild type mtDNA. 1,16
Pasien dengan akumulasi mutasi delesi mtDNA pada 4977 bp yang telah disebutkan di

atas, disamping menderita mitochondrial myopathy juga mengalami penurunan


fertilitas dan motilitas.
2.5 Hubungan Mutasi mtDNA dengan Infertilitas Pria
Salah satu penentu fertilitas pria adalah motilitas sperma. Sperma memerlukan
energi yang besar sehingga dapat berfungsi secara layak untuk keberhasilan fertilisasi.
Lokasi mitokondria dalam sperma yang unik yaitu terletak pada bagian basal dari
flagela (mid piece), berperan penting dalam ketersediaan energi secara efektif dan
cepat. Tetapi, motilitas sperma yang sangat bergantung pada fungsi respirasi
mitokondria, dapat diprediksi bahwa akumulasi mutasi yang bersifat patogenik dari
mtDNA dan kelainan respirasi menyebabkan disfungsi sperma dan infertilitas.
Mengingat bahwa kelainan respirasi bisa terjadi akibat mutasi nDNA maupun
mtDNA, maka untuk meyakinkan bahwa energi yang digunakan untuk motilitas
sperma, lebih banyak berasal dari respirasi sistem respirasi oksidatif mitokondria
(OXPHOS) bila dibandingkan dengan glikolisis, dilakukan dua macam percobaan.
Percobaan pertama menggunakan mencit yang mengalami kelainan ekspresi enzim
gliseraldehid-3-fosfat dehidrogenase dan percobaan kedua menggunakan mencit
transmitokondria (mito-mice) yang membawa mtDNA patogen (mtDNA). Mito-mice
ini merupakan mencit yang mengalami delesi 4696 bp dari posisi nukleotida 7759 bp
pada gen tRNALys yang berpindah (translokasi) ke posisi 12454 pada gen ND5 (mutan
mtDNA ini sama seperti pada manusia dengan penyakit yang umum terjadi akibat
delesi pada mtDNA). Penelitian membuktikan bahwa akumulasi mutasi pada mtDNA
menginduksi oligozoospermia dan asthenozoospermia. Sebagian besar mito-mice
adalah infertil dan pengamatan pada testis menunjukkan berhentinya proses meiosis
pada tahap zigoten, juga terjadi peningkatan apoptosis.
Sekitar 1112% dari kasus infertilitas, mtDNA mengalami mutasi titik (point
mutation) yang spesifik pada daerah kompleks I (ND5) yaitu pada urutan nukleotida
11719 dan kompleks IV (COI) pada nukleotida 9055.1.3 Beberapa laporan lainnya
menyatakan bahwa asthenozoospermia dan oligozoospermia berkaitan dengan mutasi
titik, delesi berulang, substitusi, polimorfisme nukleotida tunggal (haplogroup), delesi

pada alel DNA polimerase mitokondria, dan mutasi pada glutathion S-transferase
M1. 5
Mutasi yang terjadi pada nDNA, bisa menyebabkan mitokondria cacat, karena
sel cenderung mengalami delesi berulang pada mtDNA. Mutasi ini berakibat pada
kelainan fungsi respirasi sebagai akibat koordinasi ekspresi gen dari genom nukleus
dan mitokondria. Koordinasi antara genom nukleus dan mitokondria juga dinyatakan
oleh Panloup dkk (2003), bahwa penurunan jumlah copy mtDNA pada sampel sperma
dari pasien infertil merupakan akibat dari penurunan faktor transkripsi A (tfam) dari
nDNA yang mengkode banyaknya copy mtDNA.
Delesi dari protein kapsul mitokondria yang disebut mitochondrial capsule
selenoprotein (Mscp) dan sperm mitochondria-associated cysteine-rich protein
(Smcp), dapat mempengaruhi motilitas sperma meskipun sperma tampak normal secara
morfologis. Sedangkan mutasi gen nDNA yang mengkode mitochondrial voltagedependent anion channel 3 (Vdac3) pada membran luar mitokondria, menyebabkan
flagela abnormal yang mengganggu motilitas sperma selama transit ke epididimis.
Akumulasi mutasi polimorfisme pada mtDNA terjadi sekitar 10 17 kali lebih
cepat daripada nDNA.1 Polimorfisme gen polimerase (POLG) sangat berhubungan
dengan oligo atau asthenozoospermia. Polimorfisme ini mengandung pengulangan
nukleotida CAG (umumnya 10 kodon), dikode oleh gen PLOG, pada kromosom
15q25.17,18
Polimorfisme nukleotida tunggal (SNP) mitokondria T4216C merupakan hasil
perubahan satu asam amino histidin yang disubstitusikan ke tirosin pada subunit ND1
dari Kompleks I (NADH ubiquinone oxidoreductase). Alel dari T4216C ini
diasosiasikan dengan infertilitas pria akibat asthenozoospermia, diabetes insipidus,
diabetes melitus, atrophy optik, tuli, dan Lebers hereditary optic neuropathy.
Polimorfisme mitokondria A10398G mengubah threonin menjadi alanin subunit ND3
dari NADH dehidrogenase, yang diasosiasikan dengan neurodegeneratif dan penyakitpenyakit akibat berkurangnya produksi energi atau meningkatnya produk radikal
bebas. Polimorfisme A4917G menyebabkan perubahan urutan asam amino asparagin

ke asam aspartat pada subunit ND2 kompleks I yang menyebabkan peningkatan ROS
dan merusak mtDNA dan nDNA.

III
METODE PENELITIAN

Untuk melihat peranan genetik DNA mitokondria pada infertilitas pria berupa gangguan
motilitas spermatozoa, dilakukan dua pendekatan :
1. Analisa kadar hidrogen peroksida pada semen dengan varian T16189 C
menggunakan metoda kemilumisensi.
Dipilih Semen dengan varian T16189C mtDNA. Karena varian ini merupakan
bagian

DNA mitokondria

yang

sangat

variable

pada

semen,

mengandung

homopolimerik sitosin antara nt 1618416193 (Bendall and Sykes, 1995). Varian ini
berhubungan dengan kelainan energy mitokondria melalui suatu proses respirasi
fosforilasasi oksidatif. Penurunan fungsi OXPHOS berhubungan dengan gangguan
replikasi, yang menyebabkan jumlah ATP menurun (Brown dan Wallace, 1993) yang
akan berdampak pada penurunan motilitas. Disamping itu, Hidrogen peroksida yang
merupak ROS (Reactive Oxygen Spesies) terbentuk akibat adanya penurunan ATP yang
dihasilkan pada kasus mutasi mtDNA (Scriver et al, 1995; Sohal and Brunk, 1992;
Cahill et al., 1997; Richter, 1992 ). Sehingga dengan dua pendekatan ini,dengan
menggunakan ujibeda makna t-test antara kadar hidrogen peroksida pada varian T16189
C dan non varian T16189, akan diteliti gambaran pengaruh hidrogen peroksida pada
motilitas spermatozoa.
50 sampel semen yang diambil secara acak dari pasien yang datang rutin di poli
Infertilitas Rumah sakit Budi Mulia, Surabaya untuk kontrol kualitas semen ditentukan
konsentrasi dan motilitas spermatozoanya menurut petunjuk laboratorium WHO (1992).
Semen dari

sampel yang ada tergolong

normozoospermia (sperma normal) dan

astenozoospermia (motilitas sperma rendah). Kemudian masing-masing sampel di


tentukan jenis variannya,lalu masing-masing diuji kadar hidrogen peroksidanya. Dari
data kadar hidrogen peroksida varian 16189C dan data kadar hidrogen peroksida
negatif varian tersebut pada golongan normozoopernia dibandingkan dengan uji t,
begitu pula pada golongan asthenospermia. Dari hasil analisa akan dilihat pengaruh

hidrogen peroksida pada motilitas spermatozoa. Adapun kerangka operasional seperti


dibawah ini:

3U15PE
( (
j+640e
l ine
) )
ek V V
n at a
t rr
r
uo a
i
a a nf
non T
Tr 1
e1 6
s6 1
1 8 i
s8 9
9C

Untuk dapat dilakukan analisa RFLP (restriction fragment length polymorphism),


diperlukan sampel berupa DNA, sehingga semen harus dipreparasi untuk mengisolasi
DNA, dengan cara dibawah ini.

Isolasi DNA
Prinsip isolasi mtDNA:
mtDNA yang terdapat dalam mitokondria, di dalam sel pada sampel semen
diisolasi dengan cara osmotic shok untuk melisis membrane sel, kemudian melisis
protein semen menggunakan enzim proteinnase K, DTT, dan SDS. Setelah protein dan
membrane sel lisis, mtDNA akan keluar dari sel dan berada di larutan. Untuk
memisahkan protein, lemak, dan mtDNA dilakukan ekstraksi menggunakan fenolchloroform dalam buffer tris HCl. Sehingga lemak dan protein yang telah lisis akan
cenderung berada di fasa organik dan mtDNA yang bersifat lebih polar akan berada di
fasa air. Dengan bantuan sentrifugasi kedua fasa Ini dipisahkan, dan untuk
menghilangkan pengotor yang terlarut difasa air dan memekatkan mtDNA dilakukan
pengendapan DNA menggunakan etanol pada suhu rendah. Dan untuk menghilangkan
sisa pelarut, pengeringan pelarut dilakukan dengan menggunakan vacuum speedvac,
hal ini dilakukan untuk menghindari degradasi mtDNA. Adapun diagram alir isolasi
mtDNA adalah seperti dibawah ini :

%
J(b
c
7
3
O
X
5
+
4
F
,1
0
-2
M
C
V
G
B
N
K
U
L
D
A
T
IP
S
E
R
)
9
k
H

Amplifikasi DNA
Untuk dapat dilanjutkan ke proses penentuan varian T16189C, diperlukan
mtDNA dalam konsentrasi yang tinggi, maka dilakukan PCR dari hasil isolasi mtDNA
sperma.

Prinsip PCR untuk mengamplifikasi varian T16189C:

mtDNA sebagai template DNA diperbanyak secara invitro sebanyak 35 kali

siklus, dengan temperature denaturasi DNA untai ganda pada 95 C selama 10 menit,

tahap penempelan primer spesifik untuk varian ini menggunakan pasangan primer
L15904

(5CTAATACACCAGTCTTGTAAACCGGAG3)

dan

H16540

(5TGGGCTATTTAGGCTTTATGACCCTG3) pada temperatur 62 C selama 20


detik, dan perpanjangan DNA/polimerisasi menggunakan enzim tag polymerase, dan
dNTP pada temperatur 72 C selama 60 detik. Adapun alur kerja dari amplifikasi mt
DNA varian T16189 C ini adalah sebagai berikut :

35
siklus

Visualisasi hasil PCR

Setelah diamplifikasi, DNA dideteksi secera elektroforesis pada 1,5% gel


agarosa dengan voltase 100V selama 30 menit dan diwarnai dengan etidium bromide
dan diamati dibawah sinar uv. Visualisasi mobilitas DNA hasil amplifikasi dilakukan
dengan membandingkan terhadap DNA standar yang dibuat dari DNA lamda phage
yang dipotong dengan HaeIII sehingga menghasilkan beberapa potongan DNA dengan
ukuran tertentu yang diketahui. Adapun skema visualisasi hasil PCR adalah sebagai
berikut:

Amati pita

DNA dibawah

Penentuan varian T16189C


mtDNA
sinar
UV
1 lg fragmen DNA yang telah diamplifikasi didigesi menggunakan enzim
restriksi MnL1 pada temperature 37C semalam (14-18 jam). Hasil digesti dipisahkan
dengan cara elektroforesis agarosa dan divisualisai dengan cara mengamati fragmen
hasil elktroforesis yang telah dibawarnai dengan etidium bromide di bawah sinar UV.

Penentuan konsentrasi hidrogen peroksida


Prinsip penentuan konsentrasi hidrogen peroksida:
Luminol adalah 5-amino-2,3-dihidro-1,4-phthalazinedione. Ketika digunakan bersama
hidrogen peroksida, salah satu cincin pada molekul luminol akan terbuka, melepaskan gas
nitrogen dan menghasilkan senyawa yang dikenal sebagai 3-aminophthlate dalam keadaan

2
,
0
a
i
D
8
+
4
l
t
m
tereksitasi. Sejenak kemudian, 3-APA* melepaskan photon dan menghasilkan cahaya violet
kebiruan (berpendar). Tes dilakukan pada ruangan gelap agar cahaya yang dihasilkan dapat
dilihat dengan jelas. Adapun diagram kerja sebagai berikut :

2. Analisa kadar 8-hidroksi-deoksiguanosin menggunakan metoda HPLC.

Sebelum dilakukan analisa 8-hidroksi-deoksiguanosin, sampel diambil secara acak dari donor

sprma pada poli infertilitas rumah sakit Budi Mulia, Surabaya, ditentukan konsentrasi dan
motilitasnya menurut petunjuk WHO, dan dilakukan isolasi DNA dengan cara yang sama
seperti metode sebelumnya.

Penentuan 8-hidroksi-deoksiguanosin
Prinsip:
mtDNA yang telah diisolasi difragmentasi dengan natrium asetat dan didigesti dengan
nuclease-P1, hasil fragmentasi dianalisa dengan menggunakan HPLC. Korelasi antara 8-

hidroksi-deoksiguanosin dengan motilitas spermatozoa menggunakan uji korelasi dan uji

beda makna menggunakan t-test dan nilai batas denan ROC curve. Adapun alur kerja
sebagai berikut:

g
d
A
N
u
k
D
0
2
+
e
j
n
i
b
a
s

IV
HASIL DAN PEMBAHASAN
1. Analisa kadar hidrogen peroksida pada semen dengan varian T16189 C
menggunakan metoda kemilumisensi.
Penentuan varian T16189C mtDNA
Analisa varian digunakan dengan metode PCR-RFLP dengan menggunakan
enzim restriksi MnLI pada fragmen mtDNA sepanjang 636 pb denganpasang primer
L15904-H16540. Ada tidaknya situs restriksi ditentukan oleh ukuran fragmen DNA.
Hasil dinyatakan dengan tanda positif dan negative, dibawah ini pada jalur 1 dan 3
menunjukkan mtDNA dengan varian sepanjang 118 dan 321 pb. Sedangkan tanda
negative menunjukkan mtDNA bukan varianT16189C sepanjang 286 dan 118 pb
pada jalur 1 dan 2. Heteroplasmi diperoleh apabila ada ketiga fragmen 118,286, dan
321 pb pada lajur 4 seperti yang terlihat pada gambar dibawah.

Hasil analisis varian menunjukkan dari 14 semen asthenozoospemia yang


mengalami variasi 16189C sebanyak 7 sampel dan yang tidak 7 sampel. Sedangkan

untuk semen normozoospermia yang mengalami variasi T16189C sebanyak 19


sampel dan yang lain tidak.
Pada analisis variasi T16189C mtDNa, sampel semen normospermia
diperoleh hasil positive hal ini karena sampel semen normospermia dan
astenozoospermia terdiri dari campuran motilitas spermatozoa tanpa dipisahkan
dahulu.
Penentuan kadar Hidrogen Peroksida
Untuk persen motilitas spermatozoa motil terlihat seperti tabel dibawah ini:

Pada normospermia dan astenozoospermia terjadi perbedaan yang bermakna, dapat


dijelaskan bahwa adanya varian T16189C mtDNA mempunyai hubungan dengan
meningkatnya total hidrogen peroksida. Sifat ROS dari hidrogen peroksida adalah
oksidator yang dapat mengoksidasi DNA, dan berpengaruh pada motilitas
spermatozoa yang merupakan salah satu penyebab fertilitas.

2. Analisa kadar 8-hidroksi-deokisguanosin menggunakan metoda HPLC.


Analisa konsentrasi dan motilitas sperma
Dari 53 sampel yang diambil secara acak, 14 tergolong asthenospermia (motilitas rendah), 4
oligospermia (jumlah sperma kurang), dan 35 normozoospermia, dengan kossentrasi dan
motilitas seperti berikut.

Tabel diatas menunjukkan motilitas dan kualitas sperma yang rendah pada
asthenospermia dan oligospermia bila dibandingkan dengan normozoospermia.
Selanjutnya dilakukan penentuan konsentrasi 8-hidroksi-deokisguanosin menggunakan

metoda HPLC, dengan data seperti tabel dibawah ini:

Tabel diatas menunjukkan bahwa konsentrasi 8-hidroksi-deokisguanosin paling tinggi


pada oligospermia, diikuti dengan asthenospermia dan normozoospermia. Hal ini
dijelaskan bahwa kelainan sperma dapat dilihat dari konsentrasi 8-hidroksideokisguanosin dan menunjukkan bahwa kerusakan DNA dalam hal ini guanine
menghasilkan 8-hidroksi-deokisguanosin akibat oksidasi ROS lebih tinggi di
oligospermia dan asthenospermia daripada normozoozpermia.

Dari gambar 1 diatas, terlihat hubungan antara konsentrasi 8-hidroksi-deokisguanosin


dengan % motilitas sperma yang berbanding terbalik.
Adapun nilai batasnya, bahwa sperma dengan kadar 8-hidroksi-deokisguanosin di
atas nilai ambang (36,6769 fmol/ng DNA) termasuk sperma yang tidak normal. Hal
ini disebabkan kadar 8-hidroksi-deokisguanosin berbanding terbalik dengan motilitas
sperma, dan tingginya 8-hidroksi-deokisguanosin merupakan salah satu indicator
kerusakan DNA. Adapan kurva nilai batas terlihat pada gambar dibawah ini.

V
PENUTUP
5.1 Kesimpulan
a. Mutasi mtDNA merupakan salah satu faktor penyebab infertilitas pada pria, yang
dapat menyebabkan asthenozoospermia, oligozoospermia, dan teratozoospermia.
Mutasi ini antara lain menyebabkan berkurangnya energi dari proses fosforilasi
oksidatif (OXPHOS) yang sangat diperlukan dalam proses spermatogenesis dan
motilitas sperma.
b. Adanya mutasi mtDNA di samping mengakibatkan menurunnya ATP, akan
diperoleh Reactive Oxygen Species(ROS) antara lain hidrogen peroksida yang
tinggi. Tingginya konsentrasi hidrogen peroksida pada semen dengan varian
T16189C mempunyai hubungan dengan menurunnya motilitas spermatozoa.
c. Hasil akhir dari oksidasi DNA adalah senyawa 8-OH-dG. Tingginya senyawa 8-OHdG di dalam sperma mempunyai korelasi terbalik dengan spermatozoa motile
Sehingga tingginya senyawa 8-OH-dG di dalam sperma manusia dapat sebagai
salah satu indikator infertilitas pria.

DAFTAR PUSTAKA
Artika, IM. 2003. Struktur, fungsi dan biogenesis mitokondria. Eijkman Lecture Series I:
Mitochondrial medicine. Lembaga Biologi Molekul Eijkman Jakarta:17-42.
Brown MD dan Wallace DC, 1993. Genetic approaches to mitochondria DNA disease of
oxidative phosphorylation.
Holstein AF, Schulze W, Davidoff M. 2003. Understanding spermatogenesis is a
prerequisite for treatment. Reprod Biol Endocrinol 1:107.
Horai S dan Hayasaka K, 1990, Intraspecific nucleotide sequence difference in the major
noncoding region of human mitochondria DNA, American Journal of Human Genetic,
46, 828842.
Kao SH, Chao HT, Wei YH, 1995. Mitochondrial deoxyribonucleic acid 4977-bp deletion
is associated with diminished fertility and motility of human sperm, Biology of
Reproduction, 52: 7129736.
Lodish H, Berk AS, Zipursky L, Matsudaira P, Baltimore D, Darnell J. 2000. Molecular
Cell Biology. W. H. Freeman and Company.
St. John JC, Jokhi RP, Barratt CLR. 2005. The impact of mitochondrial genetics on male
infertility. Int. J. Androl 28:65-73.
Sies dan Menck, 1992. Singlet oxygen induced DNA damage,Mutation Research, 275: 367
375.
Sohal RS dan Brunk UT, 1992. Mitochondrial production of prooxidants and cellular
senescence, Mutation Research, 275: 295304.
Sudoyo, H. 2003. Polimorfisme DNA mitokondria dan kedokteran forensik. Eijkman
Lecture Series I: Mitochondrial medicine. Lembaga Biologi Molekul Eijkman
Jakarta:43-56.

Sudjarwo,2004. 8-hidroksi-deoksiguanosin Sebagai Salah Satu Indikator Infertilitas Pria.


Fakultas Farmasi Universitas Airlangga, Surabaya.
Sudjarwo,2006. Meningkatnya Hidrogen Peroksida Pada Varian T16189C mtDNA Semen
Manusia. Fakultas Farmasi Universitas Airlangga, Surabaya.

Sumiarsih, T. 2010. Peran Genetik DNA Mitokondria (mtDNA) Pada Motilitas


Spermatozoa, Majalah Kesehatan PharmaMedika, Jakarta.
Tjipto, 2008. Kajian Infertil Pria di Laboratorium Infertil Andrologi Puslitbang Sistem dan
Kebijakan

KesehatanSurabaya,

Pengembangan

Sistem

dan

Tahun

Kebijakan

20052008.

Pusat

Penelitian

dan

Kesehatan,

Badan

Penelitian

dan

Pengembangan Kesehatan, Kementerian Kesehatan RI.


Utami, S. 2009. Etiologi Infertilitas pada Pria Akibat dari Mutasi DNA Mitokondria
(mtDNA), Fakultas Kedokteran Universitas Kristen Maranatha, Bandung.