Clinical Ghemisr,y 42:!

9-13 (1996)

Strand displacement amplification (SDA) and

transient-state fluorescence polarization detection
of Mycobacterium tuberculosis DNA
G. TERRANCE WALKER,1’ JAMES G. NADEAU,’ C. PRESTON LINN,’ ROBERT F. DEVLIN,2 and
WALTER B. DANDLIKER3,*

Strand displacement amplification (SDA) is an isothermal, sequence during incubation at comistant temperature /5-8/. SDA
in vitro method of amplifying a DNA sequence for diagnos- is based on the ability of a restriction enzymne to nick a niotiified
tic purposes. We have combined SDA with fluorescence recognition site and the ability of a polymerase to initiate
polarization detection in a closed, homogeneous format. A synthesis at the nick anti displace a downstream DNA stramid
fluorescently labeled oligodeoxynucleotide detector probe durimig replication. SDA begins with a target-generation step
hybridizes to the amplification product that increases in (Fig. IA) that makes copies of the target sequence flamiked l)y
concentration during SDA. The single- to double-stranded miickable restriction sites. This is followeti by exponential am-
conversion of the probe is accompanied by an increase in plification of these motlifieti target sequences (Fig. I B) by
fluorescence polarization values, which can be measured in repeated nicking, stranti displacement, anti primer hybritiization
real-time without physical manipulation of the sample. The to displaced stramids. Despite the complicateti appearance of Fig.
probe was labeled with the near-infrared dye La Jolla Blue, I, SDA operates by a very simple protocol. Target l)NA is
and fluorescence polarization was measured on a transient- heat-denatured in the presence of all reagents except the restric-
state fluorometer. We have applied this homogeneous ti()n enzyme and polymerase. Amplification then proceeds at
SDA/detection system to a target DNA sequence specific 4() 0( after additit)n of the enzymes.
for Mycobacterium tuberculosis DNA. Previously, we detecteti amplified target sequences after Sl)A
by using 12P-probes /5/ or a sandwich hybridization assay with
INDEXINC 1’ERMS: DNA amplification . infection bacteria
#{149} chemilumninescent signal generation /7/. Both of these tietection
formiiats ret]uire separation of free and l)ound detector probe
Fluorescence polarization (FP) is a convenient methoti of irion- before signal readt)ut. however, the ability ofFP to) differentiate
itoring a single- to double-strand conversion of fluorescently free and bound probe without physical separation opens the
labeled DNA/I]. The ability to tiifferentiate single- anti double- possibility of combining Sl) anti detection in a closed system.
stranded conformations without physical separation of the two Ftmrthermore, SD anti FP tietection can he combined in a
forms renders FP an attractive option for momiitoring single step (i.e., real-time amplification anti detection), which is
hybridization in a diagnostic format. Despite the potential niade even more convenient by the isothermal nature o1 Sl). A
advantages of FP-baseti tietection, especially when comnbineti closet1, homogeneous assay tiecreases operating comnplexity amid
with nucleic acid amplification technologies, very few published helps comitrol the dispersal of SI)A products in the laboratory,
reports of its use exist /2, 3/. which accordingly reduces the potential for false positives from
We have comhineti FP detection with a nucleic acid amupli- accidental contamnination of samispies with target DNA. here
fication technique known as stranti tIisplacement amplification we report the use of SDA combineti with an Fl’ system that uses
(SDA), which provitles !08-fold amplification of a target DNA the near-imifrareti dye La Jolla Bltme anti a transient-state
fluorometer.

Bectiin I)ickinsiin Research Center. I’. 0. 11i,x 121)16, 21 l)avi, I)r., Research Mateiiats and Methods
‘I’riangle Park, NC 277119-2016. Fax 919/549-7572; e-mail walker@hdrc.lxl.com. The dye La Jolla Blue (Diatron Corp., Sami I)iego, CA) was
Viral Antigens, 5171 Wrlfong Rd Mcmphis, 1N 38134. symithesizeti anti comijugated to the 5 ‘-end of the detector oh-
1)iatron Corp., 4878 konson Ct. Suite I, San l)iegi, CA 92111. Fax
gotleoxynucleotide as previously descriheti /4/. Transient-state
619/268-5885.
Address c irrespondence or these authors. FP was performed omi ami instrumnent manufactureti ly Diatron as
Received August 2), 1995; accepted September 21), I 99). previously described /4/. Genomnic I)NA fromn i/1ycohacte,-ium

9
 Walker et al.: Strand displacement amplification of DNA

tuberculosis was isolated from culture as previously described fIQ/

A
j,denature
I

tar3et &
_________ and kindly supplied by Daryl Shank (Becton Dickinson Diag-
nostic Instrument Systems, Sparks, MD).
bin primers
SDA reactions were performed on samples containing M.
tuberculosis target DNA generally as previously described [5, 7/.
____ I primer extension t I
and displacement + Each 120-jtL saniple contained 50 nnmoh/L K,HPO4 (pH 7.6);
“q51 S1-ext 7 miimol/L MgCI,; 0.5 mmiioi/L dUTP; 0.2 mmol/L each of
B1 dGTP, dCTP, and dATPxS; 160 mL/L glycerol; 0.1 g/L
S2 hovimie serumn albumin; 0.0! mL/L Tween-20; 100 ng of human
52 and B2 bind I S2 binds
‘Irto S1-ext l,displaced strand placental DNA; 100 nmol/L prinier m (5’-dTTGiiT-
.S S1-ext AGTCGGTTACYTG7TGAcG(;CGTACTCGACC, with
S2 the HincIl recognition sequence in bold italics); 300 nmoh/L
IS2 is extended
I extension and pri trierS, (5 ‘-dGCATTATAGTACCTGTCTGTTG4cACT-
I forming an
1dispIaisplacement I intermediate in
GAGATCCCCT); 25 nmol/L each of primers Bm (5’dTG
‘I’the SDA cycle
GACCCGCCAAC) anti B, (5’-dCGCTGAACCGGAT); 300
B2
units of HinchI (New England Biolabs); 0.25 of exo
IS1
S2
binds to
B Kienow (United States Biochemical, Cleveland,
units
OH); 50 or 500
-.._.

2ext __ pmoh/L 5’-La Jolla Blue-labeled detector probe (5’-dTGAAA-

,i,S1 is
52
Eten.9 T2 #{149}‘
GACGTTATCCACCATACGGATAG);
amrmounts of itf. tuberculosis DNA. The detector
and
probe
the indicated
is homolo-

ended gous to nucleotide positions 985-1012 of the 1S6110 element of M.

S2 tuberculosis [9/, which is contained within the target sequence being
____nick 1 5’S ‘ exten.
nicking T1 - amnphifled (1S6! 10 nucleotide positions 972-1023) /5]. For each
saniphe, all reagents except Hincli and exo - Klenow were assem-

________
I extenston
S2
I displacement
and strand
4’displac
bled
boiling
water
in a mnicrocentrifuge

bath.
water
Whemi
bath for
SDA
2 mm
tube,

was performed
and
and
then
the samnphe
equilibrated
in the Diatron
was heated
at 41 #{176}C
instrument
ina
in a

from the ... nick new SDA primersstrandsbind

to displaced
(tiiscussed later with Fig. 3), the samples were transferred to glass
Fig. 1. Schematic
SDA is performed
representation
with an excess of four primers
of SDA.
(B1, B2, S1. and S2). S1 and S2
cylindrical
40 #{176}C
in the
cuvettes
Diatron
(4 mm mm
instrumnent,
i.d., 23
anti then
height,
mixed
equilibrated
with Hind and
at

contain target binding regions at their 3-ends and a recognition site l5’GTrGAC( for
the restriction enzyme Hincll located immediately 5’ to the target binding regions exo Kienow. FP values (mP) were recorded as SDA proceeded at
(Hincll recognition sites are designated by the raised boxes). S1 and S2 bind to 40 xc: fri the instrument. For the experiment where SDA was
opposite strands of the target sequence, flanking the region to be amplified. B1 and
conipleted before FP measurements (see Fig. 4), SDA was per-
B2 are simply target-binding sequences (containing no Hincll recognition sites) and
bind at positions 5’ to S1 and S2. (A) Starting at the top, the target DNA is formed in microcentrifuge tubes incubated in a water bath at 41 #{176}C.
heat-denatured. S1 and B1 then hytridize to one strand of the target as the
After heat denaturation of target DNA and equilibration of the
temperature is lowered to 41 #{176}C. (Only one of the two target strands is shown; a
corresponding series of reactions originates off the other strand.) Hincll and exo sample at 41 #{176}C,
HincII and exo Klenow were added to the
Klenow (an exonucleasexieficient form of DNA polymerase I from Escherichia colt) samples. SDA proceeded 3 h at 41 O( and was terminated by
are then added to the sample. At this point the remaining steps proceed as a single
cascade: Exo Klenow, which is present in large molar excess over the number of addition of EDTA (8 mniol/L final concentration). Samples were
target strands, simultaneously extends S1 and B1 by using dGTP, dCTP, dUTP, and transferred to the glass cuvettes, and FP values were measured with
dATPaS. As S1 is extended, the extension product (S1-est) is displaced through
extension of B1. S1.ext serves as target for binding of S2 and B2. Simultaneous
the samples at roomn temperature.
extension of S2 and B2 results in displacement of an S2 extension product (S2-est).
An S primer binds to S2-ext and is extended, forming a double.stranded structure
with a hemiphosphorothioate Hincll site at each end. Hincll nicks the unmodified
Resulls
strand of the hemiphosphorothioate site on S1. leaving intact the modified comple- We have designed an SDA system in which a fluorescent!y
mentary strand of the Hincll site. [Hind) nicking can also occur at the hemiphospho-
labeled simigle-stranded ohigodeoxynucleotide is converted to a
rothioate site on the opposite end of the fragment (not shown)1. Exo Klenow then
extends the 3-end at the nick and displaces the downstream strand. An S2 primer double-stranded formn in a target-dependent manner during
binds to the displaced strand and is extended, forming an intermediate in the SDA amplification (Fig. 2). The fluorescent probe (D) hybridizes to
cycle shown in Fig. lB (dashed arrow). (B) The SDA cycle is where the majority of
amplification occurs. During each round of the cycle, the 3-end of S binds to the
one of the displaced target strands generated during SDA (Fig.
3-end of the displaced target strand 12, forming a duplex with 5-overhangs. 1), at a location immediately downstream from one of the SDA
Ukewise. S2 binds toT1, the complement of T2. Exo Klenow extends the recessed
3-ends of the duplexes, producing hemiphosphorothioate recognition sites that are
primers (S1) (structure I, Fig. 2). Primer 5m and D in structure I
nicked by Hincll. These nicking and extension/displacement steps cycle continu- are then extended by polymerase, resulting in displacement of
ously (short upturned arrows) because extension at a nick regenerates a nickable
the probe extension product (structure II) in a manner analo-
Hincll recognition site. The strand displaced from the S1T2 duplex is identical to T1.
Likewise, the displaced strand from the 5211 duplex is identical to T2. Conse- gous to the stranti displacement reaction intrinsic to SDA (Fig.
quently, target amplification is exponential because each displaced T2 binds a new 1). The displaced, single-stranded probe extension product

_.
S1 primer, while each displaced T1 binds a new S2 (long upturned arrows). Sense
and antisense strands are differentiated by thin and thick lines, respectively. Intact (structure III) hinds the other SDA primer (S,), forming a
and nicked HincII recognition sequences are depicted by and _ U.-. The complex (structure IV) that becomiies fully double-stranded
partial HinclI recognition sequence 5’GAC and its complement 5’GTC are prosent at
the 5’- and 3’ends of displaced strands as represented by U. and U. Additional
through polymerase extension (structure V). This double-
details are reported elsewhere [5, 6]. stranded complex provides a temnplate for linear SDA in which
 Clinical Ghernisriy 42, No. 1, 1996 11

Fluorescence duceti by using the fluorescent probe at low concentrations

Polarization (50-500 pmol/L).
(mP)

100
___ D
Structure
We
conversion
have chosen
of the probe
to mnomtor
through
the
FP.
single-
The
to
increase
double-stranded
in exclusion
T2 ‘
volume that accompanies the change in probe conformation

100
5’_ ____________
______________ II
results in slower tunibling of the fhmorescent label and an
observable increase in correlation time by fluorescence polar-
‘I, izatiomi. The fluorescent dye La Jolla Blue J4J absorbs and eniits
60 III light in the near-infrared spectrumn (intensity mnaxima at 685 and
705 nni, respectively). Changes in FP values were monitored on
a prototype instrument that is currently not comnmnercially
60 . IV
‘I’ available. The fluoronieter was designed especially for La Jolla
Blue anti operates in a transient-state mode, using laser diode
.5.
excitation.
FP-haseti tietection requires conversion of a significant per-
100 = V centage of the single-strantied probe concentration because
reacted anti unreacted probe are not separateti before measure-
100 . VI ment and the associated FP change is muodest. Therefore, low

‘I! probe
low
concemitrations
concentrations of SDA
facilitate high
protiucts)
sensitivity
because
(i.e.,
they
detection
result in a
of

100 _________ VII

higher percentage of converted probe for a given aniount of
Fig. 2. Single- to double-stranded conversion of the fluorescently amplified target. Unfortunately, however, low probe concentra-
labeled detector probe during SDA.
tions (50-500 pmol/L) present a kinetic challenge for SDA. The
This series of hybridization, extension, and displacement steps occurs concur-
rently with the SDA cycle (Fig. 18). At top (structure I), the detector probe (D(
probe must hind the displaced strand before the upstreamn
binds a displaced strand in the SDA cycle at a location downstream from the SDA primer (S,) is extentied by polymerase (Fig. 2). The kinetics of
primer S1. This complex is identical to the complex shown at the top left side of
the SDA cycle (Fig. 1B(, where it is depicted without the detector probe. Exo
S extension are controlled by S1 and polymnerase hintiing. We
Klenow simultaneously extends D and S1 along the displaced strand (structure have modified our typical SDA conditions /5, 6/ to decrease the
II). Extension of S1 displaces the extension product of D (structure III), which then
rate of S extension and thereby promote probe hint!ing. This
binds the other SDA primer )2). forming structure IV. This complex is then
extended by exo Klenow, forming a complex (structure V( that undergoes linear was achieved by lowering the concentrations of S1 and poly-
SDA upon nicking of the primer sequence on S2 and strand displacement by exo merase to 100 nmol/L anti 2100 units/L, respectively. Lower S1
Klenow. The strands displaced during this linear SDA bind additional detector
probes (Structure VI), which are extended by exo Klenow to form the terminal
anti polymerase concentrations result in slower SDA rates, so it
structure VII. Structures I, II, V. VI. and VII all account for double-stranded forms was necessary to extend the typical SDA reaction time from 2 to
of the detector probe, which are observable through an increase in FP values.
3 h. Fortunately, however, these modifications have not sub-
Sense and antisense strands are differentiated by thin and thick lines, respec-
tively. Intact and nicked Hincll recognition sequences are depicted by ._.._ stantially affected the amplification efficiency of the systemn.
and _ U.. The partial Hincll recognition sequence 5’GAC and its complement We applied FP detection to an SDA system previously
5’GTC are present at the 5’- and 3-ends of displaced strands as represented by
U_ and __U. Approximate FP values are indicated for the various forms of the developed for M. tuberculosis DNA (5, 7). Samples containing
detector probe when measured at room temperature )see Fig. 4). For the tiifferemit amnounts of M. tuberculosis DNA were amplifleti and
experiment in Fig. 3, where polarization was recorded at the SDA operating
temperature of 40 1C, the corresponding single- and double-stranded values
simtmltaneouslv detected in the transient-state fluoromneter (Fig.
decrease to -40 and 60 mP, respectively, because of the decrease in viscosity 3). The two samnples containing target M. tuberculosis DNA
at higher temperatures.
exhibit an increase in FP values over time, but the zero M.
tuberculosis sample does not tiisplay a significant change in FP
the HincII site on 5, is nicketi and polynierase extensiomi! values. Ftirthermore, the samples containing M. tuberculosis
displacement at the nick produces single-stranded strands to DNA exhibit increasing FP values in a tinie-dependent fashion
which additional fluorescent probes bind (structure VT) and that reflects the initial M. tuberculosis amounts present (i.e.,
extend upon (structure VII). Structures I, II, V, VI, and VII (Fig. tiuantitative detection).
2) all account for double-stranded forms of the fluorescent The experiment described in Fig. 3 illustrates the utility of
probe, which are detectable through an increase in FP values. the systemn for real-time detection of SDA. Ilowever, the current
The entire process described in Fig. 2 occurs simultaneously design of the Diatron instrument remiders careful execution of
with SDA (Fig. 1). The fluorescent probe does not interfere with SDA reactions logistically difficult. Specifically, sample temper-
target amplification by increasing SDA background reactions attire control on the current prototype instrument is inadequate
because any undesired mispriming between the probe and an for SDA, and disposable, sealable cuvettes are not yet available
SDA primer does not generate a product that can be exponen- for l00-p.L sample volumes. Consequently, SDA was performed
tially amplified (the fluorescent probe does not contain a Hind! in mnicrocentrifuge tubes with a temperature-controlled water
site). In contrast to the polymerase chain reaction, in which any bath, after which the FP values were measured. Samples con-
oligonucleotide can serve as an amnplification primer, SDA taining M. tuberculosis DNA, even a single genomne, exhibit
requires two HincII site-containing primers to participate in higher FP values than the samples lacking M. tuberculosis DNA
exponential amplification [8/. Background SDA is further (Fig. 4). Unlike the quantitative results ohtained with real-time
 Walker et al.: Strand displacement amplification of DNA

FP values with regard to initial M. tuberculosis concentrations

than do the 50 pmol/L probes because of higher fluorescence
signal-to-noise ratios at the higher probe concentration.
Samples lacking M. tuberculosis DNA should exhibit FP
values identical to unhybridized detector probe (-60 mP) (Fig.
4). The higher FP value that was observed for the zero M.
tuberculosis sample containing 500 pmol/L probe could have
arisen from two sources. First, this sample may have been
accidentally contaminated with a few copies of the 1S61 10 target
sequence [9], which is present in -10 copies per M. tuberculosis
genome. Low-level contamination of negative samples is a
critical concern with amplification techniques like SDA that can
detect even a few target molecules. Alternatively, the detector
probe in this zero M. tuberculosis sample could have been
converted to a double-stranded form either directly through
background hybridization, perhaps to the 100 ng of human
150 DNA that was present in all the samples, or through some
time (minutes) polymnerase activity such as extension of a transiently formed
hairpin conformation by the detector probe.
Fig. 3. Simultaneous SDA and FR detection.
To account for such possibilities, we included two types of
SDA was performed inside the Diatron fluorometer, and FR values were recorded
as a function of time for three samples containing the indicated amount of target control samples in this experiment to elucidate possible sources
DNA from M. tuberculosis. FR values are expressed as FR (mP) = l000lS(par)
of background signal that arise independently of target amplifi-
- S(perp)l/lS(par) +
S(perp)J, where S)par) and S(perp) represent the total
number of counts over a portion of the fluorescence decay curve with the cation. One control sample contained dATP instead of
emission polarizer in the parallel and perpendicular positions, respectively [4]. dATPtS; this still enables any nonspecific extension of the
detector probe by exo Kienow, but it disables the SDA
detection (Fig. 3), however, FP values for the endpoint assay mechanism by allowing double-stranded cleavage of Hincli
(Fig. 4) tend to reach a maximum value over a range of initial M. sites. In the second control sample we omitted exo Klenow,
tuberculosis concentrations because of the complete conversion of which disables both SDA and any nonspecific detector probe
the low probe concentration (50 or 500 pmiioVL). Samples extension. Therefore, the mmnus-polyrnerase control reflects any
containing 500 pmol/L detector probe exhibit more consistent nonspecific hybridization of the detector probe, e.g., with
human DNA. Inspection of the control samples indicates that
nonspecific hybridization of the detector probe is extremely low
110 and is not mediated by exo Klenow. The slightly higher FP
E 500 pM detector
50 pM detec
value recorded for the zero M. tuberculosis sample containing 500
pmol/L probe probably reflects minute contamination of this
100 -

0
sample with a few molecules of target DNA.
E
C
0 90 - Discussion
N
We have combined the power and simple workflow of SDA with
CS the simplicity of FP to create a truly homogeneous assay for
0 80 -
0. nucleic acid detection. This format allows detection of as few as
a)
C.) 1 genome of M. tuberculosis in 3 h with single-temperature
C
a) incubation.
U)
a)
70 -

0 The La Jolla Blue dye we used absorbs and emits light in the
near-infrared spectrum, a region of relatively low background
60 -
fluorescence for clinical specimens. Background fluorescence
was further minimized through transient-state fluorescence
50 spectroscopy, which reduces the contribution from light scat-
io4 102 10 1 0 A B tering. (The signal-to-noise ratio for fluorescence intensity was
M tuberculosis genomes 30:1 for SDA samples containing 50 pmoVL La Jolla Blue
Fig. 4. P05tSDA detection with fluorescence polarization. detector probe.) Lower background fluorescence allows the use
SDA was performed in the presence of the La Jolla Blue-labeled detector probe of lower concentrations of probe, which improves detection
at the indicated concentrations on samples containing the indicated amounts of sensitivity by ensuring that a greater percentage of the single-
target DNA from M. tuberculosis. Fluorescence polarization values were subse-
quently recorded. Two negative control samples were included. Control A stranded probe concentration is converted to a double-stranded
contained dATP instead of dATPaS, which disables SDA but still allows any form for a given amount of amplified product. Unfortunately,
background hybridization or extension of the detector probe by exo Klenow.
Control B lacked exo Klenow and tests for any background hybridization of the
however, low probe concentrations result in probe saturation
detector probe. (100% single- to double-stranded conversion) over a broad
 clinical Chemistiy 42, No. 1, 1996 13

range of amplified product concentrations, which means that FP in the lal)oratory and obviate the associated problem of false-
endpoint measurements alone after SDA are not quantitative positive clinical results due to accidental contamination of
with regard to initial target concentrations. However, mnonitor- clinical specimens with amplicons.
ing FP during SDA circumvents the problem because samples
containing higher amounts of target exhibit increases in FP References
values sooner than those containing less target. Of course, this 1. Murakami A, Nakaura M, Nakatsuji 5, Tran-Cong Q, Makino K.
correlation between the time of FP changes and initial target Fluorescent-labeled oligonucleotide probes: detection of hybrid
formation in solution by fluorescence polarization spectroscopy.
concentrations will hold only for a series of samples that
Nucleic Acids Res 1991;19:4097-102.
experience identical SDA rates. In the real world of clinical
2. Garman AJ. Moore RS. Detection of nucleic acid sequences using
specimens, each may contain various amounts of SDA inhibitors
fluorescence polarisation. Eur Patent Application; Pubi. No. 0 382
so that FP changes during real-time mnonitoring may not reflect 433 A2, Application No. 90301135 1, 1990.
initial target amounts. For example, it may be difficult to 3. Wang Ci, Ammons HC. Jolley ME. Detection of DNA/RNA by
differentiate a high target sample that undergoes imiefficient fluorescence polarization. Patent Cooperation Treaty (PCI) Pubi.
SDA from a low target sample with high SDA rates. In theory, No. WO 92/18650, 1992.
4. Devlin R, Studholme RM, Dandliker WB, Fahy E, Blumeyer K,
the time-course curves in Fig. 3 contain the necessary data to
Ghosh SS. Homogeneous detection of nucleic acids by transient
estimate the SDA rate and initial target concentration. How-
state polarized fluorescence. Clin Chem 1993;39:1939-43.
ever, the current fluorescence detection sensitivity does not
5. Walker GT, Fraiser MS, Schram JL, Little MC, Nadeau JG, Mali-
allow us to monitor the exponential phase of SDA. Substantial nowski DR. Strand displacement amplification-an isothermal, in
changes in FP do not occur until SDA enters the plateau phase, vitro DNA amplification technique. Nucleic Acids Res 1992;20:
which makes it extremely difficult to extrapolate back to the 1691-6.
exponential rate and initial target amount. 6. Walker GT. Empirical aspects of strand displacement amplifica-

Nevertheless, real-time momiitoring of FP values during SDA tion. PCR Methods AppI 1993;3:1-6.
provides a semiquantitative estimate of initial target concentra- 7. Spargo CA, Haaland PD, Jurgensen SR. Shank DD, Walker GT.
Chemiluminescent detection of strand displacement amplified
tions. Quantitation could be improved by including a positive
DNA from species comprising the Mycobacterium tuberculosis
control target at a known initial concentration /8/. This positive complex. Mol Cell Probes 1993;7:395-404.
control target would not only provide an indication of general 8. Walker GT, Nadeau PA, Schram JL, Nycz CM, Shank
JG, Spears
SDA performance for a given sample (i.e., a control for false DD. Multiplex strand displacement amplification (SDA) and detec-
negatives) but also provide a calibrator for quantifying the tion of DNA sequences from Mycobacterium tuberculosis and
amount of initial target. other mycobacteria. Nucleic Acids Research 1994:22:2670-7.
9. Thierry D, Cave MD, Eisenach KD, Crawford iT, Bates JH, Gicquel
Another advantage to real-time detection of SDA is that the
B, Guesdon JL. lS6110, an IS-like element of Mycobacterium
entire operation could he performed in a closed-tube forniat.
tuberculosis complex [Letter]. Nucleic Acids Res 1990;18:188.
This means there would be no reason to open or otherwise 10. Walker GT, Little MC, Nadeau JG, Shank DD. Isothermal in vitro
manipulate samples after amplification, which would eliminate amplification of DNA by a restriction enzyme/DNA polymerase
the possibility of dispersal of amplification products (amplicons) system. Proc Nat) Acad Sd U S A 1992:89:392-6.