Molecular characterization of yellow mosaic

virus resistance in cowpea (Vigna

unguiculata L.Walp.)

By

Tran Dinh Gioi

2004BS1D

Thesis submitted to the Chaudhary Charan Singh

Haryana Agricultural University in partial fulfilment
of the requirements for the degree of

DOCTOR OF PHILOSOPHY
IN
BIOTECHNOLOGY AND MOLECULAR BIOLOGY

DEPARTMENT OF BIOTECHNOLOGY & MOLECULAR BIOLOGY

COLLEGE OF BASIC SCIENCES AND HUMANITIES
CCS, HARYANA AGRICULTURAL UNIVERSITY
HISAR – 125004 (INDIA)
2008

2
 CERTIFICATE - I

This is to certify that this thesis entitled “ Molecular

Characterization of Cowpea Yellow Mosaic Virus in Cowpea

(Vigna unguiculata L.Walp.)”, submitted for the degree of Doctor

of Philosophy, in the subject of Biotechnology and Molecular

Biology to the Chaudhary Charan Singh Haryana Agricultural

University, is a bonafide research work carried out by Tran Dinh

Gioi under my supervision and that no part of this research project

has been submitted for any other degree.

The assistance and help received during the course of

investigation have been fully acknowledge

(Dr. Kamla Chaudhary)

Major Advisor (Professor)
Deptt. of Biotechnology & Molecular
Biology
CCS HAU, Hisar – 125 004 (India)

1
 CERTIFICATE - II

This is to certify that this thesis entitled, " Molecular

Characterization of Cowpea Yellow Mosaic Virus in Cowpea

(Vigna unguiculata L.Walp.)” submitted by Tran Dinh Gioi to the

Chaudhary Charan Singh Haryana Agricultural University , in partial

fulfilment of the requirements for the degree of Doctor of

Philosophy in the subject of Biotechnology and Molecular

Biology has been approved by the Student's Advisory Committee

after an oral examination on the same.

MAJOR ADVISOR

HEAD OF THE DEPARTMENT

DEAN, POST-GRADUATE STUDIES

2
 ACKNOWLEDGEMENT

In the last three and half years of accumulation in the study

and research, it is the immense pleasure reaching this stage of
releasing my thesis. From which I would like to express my profound
gratitude and sincere thanks to all people who have been contributed
to my success.
With the gratefulness and respectability, I express my deep
sense of regard and unforgettable indebtedness to my major advisor
Dr. (Ms) K. Chaudhary, Professor, Department of Biotechnology and
Molecular Biology for her invaluable guidance, constant
encouragement and suggestions during the course of investigation and
in preparation of thesis manuscript. Her constant encouragement and
sympathetic understanding at every step is much appreciated. I will
never forget the valuable suggestions given by her, which I never
expected from anyone other than my parents.
I take this opportunity to express my deepest sense of
gratitude towards my co-advisor, Dr. K. S. Boora, Professor,
Department of Biotechnology and Molecular Biology, for his keen
interest, learned counsel and sublime suggestions during the course
of investigation because without his untiring help this research would
not have been possible. His positive attitude and unstinted
advisement made my studies and research more interesting.
It is my privilege to express my profound sense of gratitude
and indebtedness to my advisory committee, Dr. A.S Yadav, Sr.
scientist, Genetics Department, Dr. (Mrs) Indra Hooda, Proffessor,
Pathology Department, Dr. R. S. Khatri, Ass. Professor, Forage
section, Plant Breeding Department, for their constructive help,
stimulating suggestions and encouragement.
I express my esteem and deep sense of gratitude to Prof. V.K.
Chowdhary, Dean and Head, Department of Biotechnology and
Molecular Biology for providing necessary facilities during the course
of investigation.
I would like to express sincerely and profoundly my
thankfulness to entire professors and scientists of the Biotechnology
and Molecular Biology Department for their teaching to impart the
scientific knowledge. I will never forget those who have given to me
the key to open the treasure of knowledge. I also record my cordial

3
thanks to entire officials and staffs of BMB Department for the help
and cooperation in the time of my study.
It gives me immense pleasure to record my gratitude to the
Vietnamese and Indian governments, especially ICCR, HAU and the
Cuu Long Delta Rice Research Institute for providing financial
support and encouragements in completion of my studies in Chaudhary
Charan Singh, Haryana Agriculrural University, Hisar, Haryana, India.
I do acknowledge my deeply sense of gratefulness to leaders
and scientists: Prof. Dr. Nguyen Van Luat, Prof. Dr. Bui Ba Bong, Prof.
Dr. Bui Chi Buu, Ass. Prof. Dr. Nguyen Thi Lang, Ass. Prof. Dr. Pham
Van Du, Dr. Nguyen Thi Loc, Dr. Bui Thi Thanh Tam, ect. of the Cuu
Long Delta Rice Research Institute, Ministry of Agriculture and Rural
Development, Vietnam.
Words in my vocabulary are too less and inappropriate to
express my innermost feeling and sincere appreciation to all of my
friends, especially Aditi Gualati, Harish Dhingra, Urvasi, Poonam
Sharma, Anshu Bajaj, Shardul Shanker, Zerihun Demrew, Rochika,
Poonam Yadav and all Vietnamese students/colleagues: Mr. N.C.
Thanh, Mr. D.V. Tam, Mrs, T.T.K. Trang, Mss. N.T.Q. Thuan, Mrs.
T.T.M. Hanh, Mss. N.T.N. Truc, Mrs V.T.T. Hang, Mr. N.V. Phong, Mr.
N.V. Khiem, Mr. V.T. Khang, Mr. D.H. Duc, Mr. N.L. Thang, Mr.
P.H.Lam, Mr. N.T. Hieu, Mr. D.H. Son, Mr. D.Q. Hung, Mr. N.X. Thang,
Mr. P.D. Tuan, Mr. B.V. Thu, Mr. Rajdeep Singh, and to all my
classmates for their help and cooperation.
Last but not the least, no words of mine can adequately express
my indebtedness to my respected parents my parents in-law, my
brothers and sisters, especially, my wife Nguyen Thi Pha and my son
Tran Minh Quang for their love, affection, inspiration, patience,
encouragement, well wishes and help throughout the course of study.
Sometimes silence is the only language in which I can express
my regards to those whose names I forget to mention in this
endeavour.
Finally, Iwould like to thank all whose direct and indirect
support helped me completing in my thesis in time.

Dated: May 2008 TRAN DINH GIOI

Place : Hisar

4
CHAPTER-I

INTRODUCTION

Cowpea, Vigna unguiculata (L.) Walp. is an important grain legume crop

in developing countries of the tropics and subtropics, especially in sub-
saharan Africa, Asia, Central and South America (Singh et al., 1997). Its
value lies in its high protein content (23-29%, with potential for perhaps
35%); and its ability to fix atmospheric nitrogen, which allows it to grow
on, and improve poor soils (Steele, 1972). Cowpea is cultivated for its
seed (shelled green or dried), pods and/or leaves, which are consumed in
fresh form as green vegetables, while snacks and main meal dishes are
prepared from the dried grain. All the plant parts used for food are
nutritious, making it extremely valuable where many people cannot afford
protein foods such as meat and fish. The rest of the cowpea plant, after
pods are harvested, is also used as a nutritious livestock fodder. Cowpea
seed is a nutritious component in the human diet and livestock feed. It is
a well-balanced vegetarian diet with low-fat, high-complex carbohydrate,
and moderate protein characteristics of the edible portion (Bubenheim et
al., 1990). The protein in cowpea seed is rich in the amino acids, lysine
and tryptophan, compared to cereal grains. Therefore, cowpea seed is
valued as a nutritional supplement to cereals and an extender of animal
proteins. Cowpea also has the ability to be intercropped with cereals such
as millet and sorghum.

Cowpea is considerable as one of the most widely adapted and versatile

crop which can tolerate to high temperatures and drought compared to
other crop species. Drought resistance is one reason that cowpea is such

5
an important crop in many underdeveloped parts of the world. One of the
more remarkable things about cowpea is that it thrives in dry
environments; it can produce the dry grain yield of up to 1000 kg/ha in a
Sahelian environment with only 181 mm of rainfall and high evaporative
demand (Hall and patel, 1985). It is estimated that cowpea is now
cultivated on at least 12.5 million hectares, with an annual production of
over 3 million tons worldwide (Singh et al. 1997). In India cowpea is
mainly cultivated for fodder, green manure and soil improving cover crop.
Green pods of cowpea are used as vegetable in Northern Indian States
whereas in West Bengal, Tamil Nadu, Andhra Pradesh, Kerala and
Maharashtra cowpea is cultivated as a pulse crop.

The crop productivity is greatly affected by a numbers of biotic factors

such as fungi, bacteria and viruses. Viral diseases are considered to be a
major limiting factor for the production of cowpea in the tropical and sub-
tropical countries (Mali and Thottappilly, 1986). More than 20 viruses are
reported from various cowpea-growing areas worldwide (Thottappilly and
Rossell, 1985). Among these viruses, cowpea yellow mosaic virus
(CYMV) is the most serious disease of cowpea. It may cause 80-100 %
yield reductions (Chant, 1960; Shoyinka, 1974; Gilmer et al., 1974; and
Williams, 1977). Cowpea yellow mosaic virus also affected seriously in
vegetative parts of the plant (Bashir et al., 2002). It may cause 14 to 54 %
decrease in plant height 30 to 95 % decrease in dry stem weight of
cowpea and mung bean (Ilyas, 1999).

Microsatellites or simple sequence repeats (SSR) are DNA sequences

with repeat lengths of a few base pairs. Variation in the number of repeats
can be detected with PCR by developing primers for the conserved DNA
sequence flanking the SSR. As molecular markers, SSR combine many
desirable marker properties including high levels of polymorphism and
information content, unambiguous designation of alleles, even dispersal,

6
selective neutrality, high reproducibility, co-dominance, and rapid and
simple genotyping assays. Microsatellites have become the molecular
markers of choice for a wide range of applications in genetic mapping
and genome analysis (Chen et al., 1997; Li et al., 2000), genotype
identification and variety protection (Senior et al., 1998), seed purity
evaluation and germplasm conservation (Brown et al., 1996), diversity
studies (Xiao et al., 1996), paternity determination and pedigree analysis
(Ayres et al., 1997; Bowers et al., 1999; van de Ven and McNicol, 1996),
gene and quantitative trait locus analysis (Blair and McCouch, 1997; Koh
et al., 1996), and marker-assisted breeding (Ayres et al., 1997; Weising
et al., 1998). For identification of molecular markers linked to
agronomically important genes, SSR was also the best choice in
compared to RAPD and AFLP in a more polymorphic information or more
cost effective manner, respectively (Lee 1995; Kelly and Miklas 1998;
Young 1999). The development and use of molecular marker
technologies has also facilitated the subsequent cloning and
characterization of disease, insect, and pest resistance genes from a
variety of plant species (Hammond-Kosack and Jones 1997; Ronald
1998; Meyers et al. 1999). Therefore, this study was done with the
following objectives:

1. To investigate the genetic basis of cowpea yellow mosaic virus

resistance in cowpea using microsatellites markers.

2. To tag microsatellite markers linked to cowpea yellow mosaic virus

resistance in cowpea.

3. To identify quantitative trait loci (QTLs) for resistance to cowpea

yellow mosaic virus in cowpea.

7
CHAPTER-II

REVIEW OF LITERATURE

Cowpea has a number of common names, including southern peas,

blackeye peas, and crowder pea. However, they are all the species Vigna
unguiculata (L.) Walp., which in older references may be identified as
Vigna sinensis (L.). It is classified in Vigna genus and unguiculata species
whose chromosome numbers were counted from root tips of 192 cultivars
and lines including wild forms, cultivated forms from 42 countries revealed
2n=22 (Faris, 1964). Mukherjee (1968) conducted a critical study of
panchytene chromosomes of V unguiculata and described each of 11
bivalents. He found that the complement consisted of a short (19µm), 7
medium (26-36 µm), and 3 long (41-45µm) chromosomes. The
chromosomes were not distributed uniformly along the chromosome
arms.

Cowpea diseases induced by species of pathogens belonging to various

pathogenic groups (fungi, bacteria, viruses, nematodes, and parasitic
flowering plants) constitute one of the most important constraints to
profitable cowpea production in all agro-ecological zones where the crop
is cultivated. Genes conferring resistance to these pathogens have been
isolated from a variety of plant species, including almost all of the
agronomically important grasses and legumes (Baker et al. 1997;
Gebhardt 1997; Hammond-Kosack and Jones 1997). The products of the
resistance (R) genes have been suggested to act as receptors that
specifically bind ligands encoded by the corresponding pathogen
avirulence factors in a gene-for-gene recognition process (Baker et al.
1997; Hammond-Kosack and Jones 1997). The R-gene product factor

8
complex is thought to initiate a series of signaling cascades within the cell
leading to disease resistance. Among the downstream cellular events that
characterize the resistant state are rapid oxidative bursts, cell wall
strengthening, the induction of defense gene expression, and rapid cell
death at the site of infection (Morel and Dangl 1997).

2.1 GENETICS OF PLANT VIRUS RESISTANCE

The study of plant resistance genes (R genes), plant genes in which

genetic variability occurs that alters the plant’s suitability as a host, also
raises many fundamental questions regarding the molecular, biochemical,
cellular, and physiological mechanisms involved in the plant-virus
interaction and the evolution of these interactions in natural and
agricultural ecosystems. Over the past decade, the cloning and analysis
of numerous plant R genes (Hanson et al., 2000 and Martin et al., 2003)
have stimulated attempts to develop unifying theories about mechanisms
of resistance and susceptibility, and co-evolution of plant pathogens and
their hosts. The focus has been mainly on monogenic dominant
resistance to fungal and bacterial pathogens (Hanson et al., 2000);
however, there is clear evidence that common mechanisms can be
involved in virus resistance.

2.1.1 Types of Resistance

Resistance to disease of plants has historically been divided into two
major categories (Fraser, 1990): non-host resistance and host resistance.
The former, which encompasses the case where all genotypes within a
plant species show resistance or fail to be infected by a particular virus,
specifically signifies the state where genetic polymorphism for
susceptibility to a particular virus has not been identified in a host taxon.
Clearly, most plant species are resistant to most plant viruses.
Susceptibility is the exception to the more general condition of resistance

9
or failure to infect. Although underlying mechanisms of non-host
resistance to viruses are largely unknown and are likely as diverse for
viruses as they are for other classes of plant pathogens (Mysore and Ryu,
2004), improved understanding of the ways in which infection fails in
these interactions may be particularly important for breakthroughs in the
development of plants with durable broad-spectrum disease resistance.

Host resistance to plant viruses has been more thoroughly investigated,

at least in part because, unlike non-host resistance, it is genetically
accessible. This general case, termed host resistance, specific
resistance, genotypic resistance, or cultivar resistance, occurs when
genetic polymorphism for susceptibility is observed in the plant taxon, i.e.,
some genotypes show heritable resistance to a particular virus whereas
other genotypes in the same gene pool are susceptible. In resistant
individuals, the virus may or may not multiply to some extent, but spread
of the pathogen through the plant is demonstrably restricted relative to
susceptible hosts, and disease symptoms generally are highly localized
or are not evident.

The distinction between resistance to the pathogen and resistance to the

disease is important to articulate. Resistance to the pathogen typically
leads to resistance to the disease; however, resistant responses involving
necrosis can sometimes be very dramatic, even lethal, e.g., the I gene in
Phaseolus vulgaris for resistance to Bean common mosaic virus (Collmer
et al., 2000). In the case of resistance to disease symptoms or tolerance
to the disease, the virus may move through the host in a manner that is
indistinguishable from that in susceptible hosts, but disease symptoms
are not observed. If the response is heritable, these plants are said to be
tolerant to the disease, although they may be fully susceptible to the
pathogen. This host response is very prevalent in nature, and has been
used to considerable benefit in some crops, e.g., the control of Cucumber

10
mosaic virus (CMV) in cucumber, even though the genetic control of this
response is typically difficult to study (Fraser, 1990 and Roger, 2002).
The genetics of tolerant responses are not considered further due to the
complexity of the biology and relative lack of information.

More recently, a third important category of host resistance has been

identified, systemic acquired resistance (SAR). This response can be
activated in many plant species by diverse pathogens that cause necrotic
cell death (Ross, 1961), resulting in diminished susceptibility to later
pathogen attack. Virus-induced gene silencing, another induced defense
mechanism to virus disease, has also been reviewed recently
(Baulcombe, 2004).

Transgenic approaches to plant virus resistance have been widely

explored since the earliest experiments where by transgenic tobacco
plants expressing Tomato Mosaic Virus (TMV) coat protein (CP) were
challenged with TMV and shown to be resistant (Goldbach et al., 2003;
Roger, 2002 and Rudolph et al, 2003). It is now possible to engineer
resistance and tolerance to plant viruses using transgenes derived from a
wide range of organisms including plant-derived natural R genes,
pathogen-derived transgenes, and even non-plant and non-pathogen-
derived transgenes. The issues related to the creation and deployment of
genetically engineered resistance in crop breeding has been recently
reviewed (Dunwell, 2000; Nap et al., 2003 and Tepfer, 2002).

2.1.2 Genetics of Virus Resistance in Nature

The first step in the study of genetics of viral resistance is to determine
whether the resistant response is inherited, if so, the number of genes
involved and their mode of inheritance. More than 80% of reported viral
resistance is mono-genically controlled; the remainder shows oligogenic
or polygenic control. Only slightly more than half of all reported

11
monogenic resistance traits show dominant inheritance. In most but not
all (Fraser, 1986) cases, dominance has been reported as complete. The
heterozygote may show a clearly different response from that of the
homozygote; however this is rarely checked carefully in inheritance
studies. Where incomplete dominance is observed, there are important
implications for mechanisms that may involve gene dosage effects. The
relatively high proportion of recessive viral R genes is in marked contrast
to fungal or bacterial resistance where most reported resistance is
dominant.

Dominant resistance is often, although not always, associated with the

hypersensitive response (HR) (Fraser, 1986), possibly due to the frequent
use of HR as a diagnostic indicator for field resistance by plant breeders.
HR, induced by specific recognition of the virus, localizes virus spread by
rapid programmed cell death surrounding the infection site, which results
in visible necrotic local lesions. HR-mediated resistance is a common
resistance mechanism for viruses and for other plant pathogens. Because
the extent of visible HR may be affected by gene dosage (Collmer et al.,
2000), genetic background, environmental conditions such as
temperature, and viral genotype, etc., schemes that classify or name virus
R genes based on presence or absence of HR may obscure genetic
relationships.

In contrast to dominant R genes, many recessive R genes appear to

function at the single cell level or affect cell-to-cell movement. More than
half of the recessive R genes identified to date confer resistance to
potyviruses, members of the largest and perhaps the most economically
destructive family of plant viruses (Shukla et al, 1994). In general,
considerably less is known regarding the mechanisms that account for
recessively inherited resistance mechanisms. Several recessive R genes

12
have recently been cloned and/or characterized (Gao et al., 2004; Kang
et al., 2005; Nicaise et al., 2003; Ruffel et al, 2002; Wicker et al, 2005).

2.1.3 Natural Resistance Mechanisms

To complete their life cycles, viruses undergo a multistep process that
includes entry into plant cells, uncoating of nucleic acid, translation of viral
proteins, replication of viral nucleic acid, assembly of progeny virions,
cell-to-cell movement, systemic movement, and plant-to-plant movement
(Carvalho and Lazarowitz, 2004). Plant viruses typically initiate infection
by penetrating through the plant cell wall into a living cell through wounds
caused by mechanical abrasion or by vectors such as insects and
nematodes. Unlike animal viruses, there are no known specific
mechanisms for entry of plant viruses into plant cells (ShawJ, 1999).
When virus particles enter a susceptible plant cell, the genome is
released from the capsid, typically in the plant cytoplasm. Although not
yet comprehensively analyzed, current work suggests this uncoating
process is not host-specific. e.g.. TMV and Tobacco yellow mottle virus
were uncoated in both host and non host plants (Kiho et al., 1972 and
Matthews and Witz, 1985). Once the genome becomes available, it can
be translated from mRNAs to give early viral products such as viral
replicase and other virus-specific proteins. Here after the virus faces
various constraints imposed by the host and also requires the
involvement of many host proteins, typically diverted for function in the
viral infection cycle.

Successful infection of a plant by a virus therefore requires a series of

compatible interactions between the host and a limited number of viral
gene products. Absence of a necessary host factor or mutation to
incompatibility has long been postulated to account for recessively
inherited disease resistance in plants, termed “passive resistance” by
Fraser (1986, 1990).

13
In contrast, dominant resistance has been shown in a number of plant
patho-systems to result from an active recognition event that occurs
between host and viral factors, resulting in the induction of host defense
responses (modeled in Figure IA) (Fraser, 1990). Genes that contribute to
this response are likely to be dominant or incompletely dominant, unless
the resistant response occurs as a result of derepression of a defense
pathway (Buschges et al., 1997). In theory, passive or active resistance
can function at any stage of the virus life cycle, although most known viral
resistance mechanisms appear to target virus replication or movement
(Figure IB). It is still technically difficult to quantify levels of viral
accumulation with precision in asynchronous infections of intact tissue (as
opposed to protoplasts). Even with the use of fluorescent reporter genes,
the extent to which viral accumulation reflects replication and translation
versus variations in virus movement cannot be easily discerned. Several
lines of evidence suggest that the level of viral accumulation may affect
the ability of virus to move systemically. Caution may therefore be needed
before concluding that the molecular defect resulting in resistance
specifically affects the viral infection cycle stage at which the defect, i.e.,
resistance, is observed.

14
Figure 1 (A) Possible virus resistance mechanisms showing dominant or
recessive inheritance contrasted with a susceptible interaction. (B) Stages
of a viral infection cycle with points of potential host interference identified
as resistance targets (Fraser, 1990).

2.1.3.1 Cellular Resistance to Plant Viruses

Resistance at the single cell level may be characterized as a state where
virus replication does not occur, or occurs at essentially undetectable
levels in inoculated cells. This type of resistance has been termed
“extreme resistance” (ER), “cellular resistance:’ or “immunity” (Fraser,
1986 and Fraser, 1990). A classical example of this type of resistance is
observed when Vigna tin guiculata is challenged with the Comovirus

15
Cowpea mosaic virus (CPMV) (Provvidenti, 1990). A protease inhibitor
that prevents CPMV polyprotein processing was proposed as a candidate
for the mechanism by which replication was prevented (Provvidenti,
1990).

The second type of mechanism that can result in resistance at the single-
cell level involves an active resistant response to virus infection that
occurs rapidly enough to limit virus replication before cell-to-cell
movement occurs. Plants with this response may show no symptoms or
extremely limited necrosis (pinpoint lesions). Well-known examples of this
response include resistance controlled by Tm-1 for TMV in tomato
(Motoyoshi and Oshima, 1975 and Watanabe et al., 1987), the R gene
against CPMV in cowpea (Provvidenti, 1990), Ry for Potato virus Y (PVY)
in potato (Solomon-Blackburn and Barker 2001), and Rsv1 in soybean
(Hajimorad and Hill, 2001). This response has been studied in some
detail using the Ry gene for ER in potato as a model. Plants carrying the
Ry gene do not show any visible symptoms when challenged with PVY.
Virus accumulation is not detected in the inoculated leaves by either RNA
hybridization or ELISA. Furthermore, protoplasts isolated from resistant
genotypes do not support viral replication. Because HR was not evident, it
was postulated that these genes might encode inhibitors of virus
accumulation (Fraser, 1990). However, there may be no mechanistic
distinction between reactions previously categorized as ER and HR.
When each of the PVY-encoded proteins was expressed in leaves of
PVY-resistant plants, the nuclear inclusion of a protease induced HR,
demonstrating that the HR mechanism may be a component of the ER
response.

2.1.3.2 Resistance to Virus Movement Within and Between Cells

Once viral multiplication has been established in the cytoplasm and/or
nucleus of a single plant cell from a susceptible host, plant viruses must

16
move from the initially infected cells to adjoining cells, eventually resulting
in systemic infection. An important class of host response to viral infection
is apparent when the virus appears to establish infection in one or a few
cells, but cannot move beyond the initial focus of infection. Resistance at
this level can result from either failure of interactions between plant and
viral factors necessary for cell-to-cell movement, or from active host
defense responses that rapidly limit virus spread.

Most plant virus genomes code for one or more movement proteins,
which are required for viral cell-to-cell movement. Based on their primary
structure, movement proteins can be divided into several superfamilies,
one of which is the "30K" superfamily, related to the Tobacco mosaic
virus movement protein (Melcher, 2000). Within this 30K superfamily, two
basic mechanisms for cell-to-cell movement have been proposed
(Lazarowitz and Beachy, 1999). Tobacco mosaic virus movement protein
typifies one mechanism whereby the movement protein modifies
plasmodesmata, allowing viral RNA-movement protein complexes to
move from cell to cell. The other type of movement, best known from
Cowpea mosaic virus movement protein, is the tubule-guided movement
of mature virus particles through drastically modified plasmodesmata.
Cell-to-cell movement of CPMV occurs through tubular structures, built-up
from the viral movement protein, that replace the desmotubule (ER
portion inside the plasmodesmata) and through which mature virions are
transported from one cell into the adjacent ones (Fig. 2; Wellink & van
Kammen, 1989 and van Lent et al., 1990).

17
Fig. 2 Model of the cell-to-cell movement mechanism of CPMV. In this
model a CPMV-infected cell is depicted, from which virus particles are
traveling to the neighbouring (uninfected) cell through a modified
plasmodesma.

As described above for viral replication and translation, intra-and

intercellular viral movement also requires both virus-encoded components
and specific host factors (Carrington et al., 1996 and Lazarowitz and
Beachy, 1999). With respect to intercellular movement, it is well
established that movement proteins (MP), identified for most families of
plant viruses (Deom et al., 1992; Gilbertson and Lucas, 1996; Mahajan et
al., 1998 and Santa Cruz, 1999), perform dedicated functions required for
cell-to-cell movement by modifying pre-existing pathways in the plant for
macro-molecular movement such that viral material can translocate
between plant cells (Carrington et al., 1996 and Lazarowitz, 2002). In the
case of potyviruses, which do not encode a dedicated MP, the movement
functions have been allocated to several proteins, including CP, HC-Pro,
the cylindrical inclusion (CI) protein, and the genome-linked protein (VPg)
(Revers et al., 1999). In mutant viruses defective in these proteins,
movement from the initially infected cell to adjacent non-infected cells did
not occur.

18
A number of mutations in host genes are known that prevent cell-to-cell
movement of plant viruses. The Arabidopsis cum1 and cum2 mutations
inhibit CMV movement (Yoshii et al., 1998a and Yoshii et al., 1998b). In
protoplasts prepared from plants homozygous for these alleles, CMV
RNA and CP accumulate to wild-type levels, but the accumulation of the
CMV 3a protein, necessary for cell-to-cell movement of the virus, is
strongly reduced.

The HR also serves to disrupt cell-to-cell movement of plant viruses.

Recognition of the viral elicitor results in the induction of a cascade of
host defense responses that include oxidative H2O2 bursts and up-
regulation of hydrolytic enzymes, PR proteins, and callose and lignin
biosynthesis. As a consequence, viral movement may be limited to a
small number of cells, illustrated by such classic examples as the tobacco
N gene (Otsuki et al., 1972) and the tomato Tm-2 and Tm-22 alleles
(Motoyoshi and Oshima, 1975). Protoplasts isolated from the plants
carrying these R genes allowed replication of TMV; no cell death was
observed. Despite the strong correlation of HR and disease resistance,
necrotic cell death is now thought to be an ancillary con-sequence of the
resistant response, not necessary for pathogen suppression.
Furthermore, when HRT was introgressed into Col-1, most of the HRT-
transformed plants developed HR upon TCV infection, yet the virus
spread systemically without systemic necrosis (Cooley et al., 2000).

2.1.3.3 Resistance to Long-Distance Movement

In susceptible hosts, plant viruses that do not show tissue restrictions
move from the mesophyll via bundle sheath cells, phloem parenchyma,
and companion cells into phloem sieve elements (SE) where they are
translocated, then unloaded at a remote site from which further infection
will occur (Carrington et al., 1996, Santa Cruz, 1999). This pathway is
typically part of an elaborate symplastic network in plants through which

19
viruses establish systemic infection (Lucas et al., 1995). Plasmodesmata,
elaborate and highly regulated structures with which viruses interact for
both cell-to-cell and long-distance movement, provide symplastic
connectivity between the epidermal/ mesophyll cells and cells within the
vasculature, including sieve elements (Carrington et al., 1996; Lucas and
Gilbertson, 1994 and Santa Cruz, 1999). Entry into the SE-companion
cell complex is currently thought to be the most significant barrier to long-
distance movement (Ding et al., 1998 and Wintermantel et al., 1997).
Once present in a companion cell, a virus potentially has direct access to
the sieve tube, the conducting element of the phloem that serves as the
pathway for both nutrient and virus transport throughout the plant
(Carvalho and Lazarowitz, 2004).

Virus particles loaded in the phloem apparently follow the same pathway
as photo-assimilates and other solutes, albeit not necessarily via strictly
passive processes (Murphy, 2002 and Santa Cruz, 1999). Most plant
viruses require CP for long-distance movement, independent of any
requirement for CP in cell-to-cell movement. Analysis of CP mutants for a
number of viruses including TMV suggests that CP is essential for entry
into and/or spread through sieve elements (Carvalho and Lazarowitz,
2004 and Lazarowitz and Beachy, 1999). Some DNA viruses also require
CP for long-distance movement (Boulton et al., 1989), although other
white fly transmitted geminiviruses do not require CP for systemic
infection (Gardiner et al., 1988). Phloem-limited viruses, e.g., Luteovirus,
are typically limited to phloem parenchyma, companion cells, and SE, and
apparently lack the ability to exit phloem tissue (Taliansky and Barker,
1999) or possibly to infect non-phloem tissue (Barker et al., 2001). A few
viruses, most notably members of the Sobemovirus genus, use xylem for
long-distance movement. The mechanisms of viral interaction with xylem
are largely unknown (Carvalho and Lazarowitz, 2004 and Moreno et al.,
2004).

20
Cowpea mosaic virus represents a large group of different plant viruses,
including comoviruses (van Lent et al., 1990, 1991), nepoviruses
(Wieczorek & Sanfaçon, 1993; Ritzenthaler et al., 1995), caulimoviruses
(Perbal et al., 1993) and tospoviruses (Storms et al., 1995), which employ
the tubule guided movement mechanism of virions. By means of a
surgical isolation procedure for leaf parts and pinpoint-inoculation of virus
it was demonstrated that CPMV can be loaded into the phloem of both
major veins and minor veins to establish systemic infection of the upper
leaves. Three possible routes for entry of virus into leaf veins have been
suggested (Ding et al., 1998; Nelson & Van Bel, 1998). Viruses could
enter the veins at the vein terminus, a gap at a vein branch or the side of
a vein. The successful systemic invasion of cowpea after pinpoint-
inoculation of isolated midveins suggests that CPMV is able to approach
and enter the phloem stream directly from the surrounding parenchyma
tissues.

2.2 GENETIC BASIS OF VIRAL DISEASE RESISTANCE IN COWPEA

As soon as Mendel’s work was rediscovered, Biffen (1905) illustrated that
disease resistance may be inherited in accordance with Mendelian laws,
and the genetic basic for breeding disease resistant varieties was
developed. From that many resistant genes were discovered in a wide
range of crops. Many genes resistance to virus diseases were identified
in cowpea, such as bean yellow mosaic virus resistance controlled by a
single recessive gene (Reeder et al., 1972), cowpea chlorotic mottle virus
resistance controlled by a single recessive gene (Rogers et al., 1973),
cowpea mottle virus controlled by single dominant gene (Bliss and
Robertson, 1971), cowpea severe mosaic virus controlled by a single
recessive gene (Mendoza et al, 1989), and cucumber mosaic virus
resistance controlled by a single dominant gene (Sinclair and walker,
1955).

21
Many other viruses virulence in cowpea were described in detail with their
distinct symptoms and genetic base resistance

2.2.1 Cowpea Aphid-Borne Mosaic Virus (CAbMV)

The cowpea plants infected with CAbMV show variable amounts of dark
green vein banding, leaf distortion, blistering and stunting (Bock and
Conti, 1974; Boswell and Gibbs, 1983). The first symptoms of the virus
when carried with seed appear on first trifoliate as a fine vein clearing and
irregular mosaic (Tsuchizaki et al., 1970; Ladipo, 1977; Ata et al., 1982).
About 15-87 per cent yield reduction was reported due to infection of
CAbMV (Kaiser and Mossahebi, 1975) and complete loss of an irrigated
crop in northern Nigeria was tentatively attributed to an aphid-borne virus
disease (Raheja and Leleji, 1974). The gene of CAbMV resistance was
reported controlled by a single dominant gene (Ramiah and
Narayanaswamy, 1983)

2.2.2 Blackeye Cowpea Mosaic Virus (BICMV)

Blackeye cowpea mosaic virus produces both local and systemic

symptoms on blackeye cowpea. Local symptoms include large reddish
lesions spreading along the veins. Systemic symptoms are severe
mottling, distortion, yellowing, mosaic and vein necrosis. Lima et al.
(1979) reported that BICMV causes mottling or mosaic symptoms in
different cultivars of cowpea. The other symptoms are systemic mosaic
(Boswell and Gibbs, 1983) and vein banding mosaic (Chang, 1983).
Murphy et al (1987) reported that BICMV had developed systemic mosaic
with distortion of leaflets and stunting of the plants. BICMV is a member
of potyvirus group. It was reported that BICMV resistance is controlled by
a single recessive gene (Taiwo et al, 1981; Walker and Chambliss, 1981;
and Melton et al, 1987)

22
2.2.3 Southern Bean Mosaic Virus-Cowpea Strain (SBMV-CS)

The cowpea strain of southern bean mosaic virus (SBMV-CS) produced

different types of symptoms in cowpea. They include mosaic, vein
clearing, leaf distortion, stunting, chlorosis, distinct chlorotic spots, early
senescence, generalized necrosis, necrotic local lesions and spindled
plants (O’Hair et aL, 1981). Kuhn et al. (1986) and Hobbs & Kuhn (1987)
reported symptoms of SBMV-CS in different cultivars of cowpea as leaf
chlorosis, leaf distortion, mosaic, mottling, stunting and systemic necrosis.
SBMV-CS is a member of sobemovirus group. Southern bean mosaic
virus resistance was reported with several hypotheses which controlled
by a single dominant gene (Brantley and Kuhn, 1970), a single recessive
gene (Hobbs et al, 1983), two recessive genes (Melton et al, 1987), and
three genes with incomplete dominance (Melton et al, 1987).

2.2.4 Legume Yellow Mosaic Virus (LYMV)

Yellow mosaic disease in India was first reported by Vasudeva (1942)

particularly from Punjab state and later from Maharashtra (Capoor et aL,
1947), Tamil Nadu, Gujrat, Uttar Pradesh, Punjab, Haryana and
Rajasthan (Nariani and Kandaswamy, 1961; Govindaswamy et al., 1970;
Khatri and Chenulu, 1970; Sharma and Varma, 1975).

LYMV causes typical mosaic symptoms in cowpea (Smith, 1924; Dale,

1949; Chant, 1959). Smith (1972) reported that LYMV caused chlorotic
lesions (2-4 nm dia.) on inoculated leaves of several cowpea cultivars. In
certain cases, these lesions may be in the form of alternating light and
dark green rings. When leaves are inoculated before attaining full size,
the local lesions tend to coalesce. The next leaf to unfold usually shows
pronounced vein clearing which changes, as the leaves expand to a fine
grained mosaic of numerous dark green islands on a pale green
background. The leaves developing subsequently show irregular

23
yellowish and dark green mottling accompanied by blistering of the
laminae. Lima and Nelson (1977) reported that LYMV causes mosaic and
leaf distortion on cowpea. The cowpea mosaic virus causes mottling,
mosaic, leaf distortion, systemic necrosis, chlorosis and plant death.
Shankar et al. (1973) observed that the cowpea mosaic disease produced
mosaic, mottling, banding and vein clearing symptoms on certain cultivars
of cowpea. Genetically isolated begomoviruses of YLMV was
investigated by Qazi et al. (2007)

The yield reduction due to LYMV varies from 60 to 100 per cent (Gilmer
et al., 1974). The virus belongs to the Geminiviridae group. Legume
yellow mosaic virus resistance was reported due to a single dominant
gene (Ouattara and Chambliss, 1991), and another un-allelic single
recessive gene reported by Raj and Patel (1979)

2.2.5 Cowpea Mottle Virus (CMeV)

Cowpea plants with conspicuous symptoms of bright mosaic, vein-
banding, distortion of leaves and often stunting of the whole plant were
widely found during the rainy season around Abidjan. The primary leaves
of cowpea developed diffuse chlorotic lesions 3-5 days after inoculation,
often followed by veinal necrosis and detachment of inoculated leaves.
Systemic symptoms which appeared 7-9 days after inoculation on young
leaves included chlorosis, veinal mottle, yellow mosaic, and sometimes
distortion. The entire plant was stunted. The virus is easily transmitted by
mechanical inoculation (Thouvenel, 1988), and two species of beetle
Monolepta tenuicornis Jacoby and Medythia quaterna Fairmaire
(Coleoptera; Chrysomelidae) were reported capable of transmitting the
virus to cowpea (Thouvenel, 1990). Cowpea mottle virus (CMeV) was first
described by Shoyinka et al. (1978) in Nigeria and, until now, only known
from that country, some 3000 km to the east of Ivory Coast. The resistant
gene was reported controlled by single dominant gene (Bliss and
Robertson, 1971)

24
.2.2.6 Cowpea Yellow Mosaic Virus (CYMV)

Chan (1959) first described the properties, symptom, and host range of
CYMV. Bliss and Robertson (1971) reported that CYMV caused varied
symptoms differ with cowpea variety. Systemic symptoms in susceptible
varieties range from an inconspicuous light green mottle to a distinct
yellow mosaic, leaf distortion with significantly reduced growth and pre-
mature death of plant. The first symptoms of yellow mosaic are
manifested by its damage to the host plant cells causing yellow specks
and spots on the leaves (Verma et al., 1991). The leaves emerging from
the apex show bright yellow patches interspersed by green areas. Later
on the specks coalesce and form bigger spots with yellow area. In severe
cases whole leaves become yellow and these symptoms later appear on
pods also leading to the formation of shriveled grains. The infected plants
also become stunted in growth. The size of the pods and seed reduced.

The gene for cowpea yellow mosaic virus resistance was reported
controlled by a single dominant gene (Bliss and Robertson, 1971; and
Kumar et al., 1994). ‘Dixielee’ variety is resistant to CYMV due to the
dominant gene Ymr. In addition, tolerance reaction to CYMV was also
reported due to the contribution of three additive loci and the tolerance
variety (Alabunch) was probably homozygous for the three genes (Bliss
and Robertson, 1971). The Ymr resistance gene segregates
independently of the three tolerance genes. The presence of the Ymr
dominant allele masked the effects of the three additive loci, with tolerant
and susceptible plants being seen only when the resistance gene was
homozygous recessive (ymr/ymr). The virus belongs to the comovirus
group. A weak serological relationship is reported between cowpea
mosaic virus and some other viruses of the genus Comovirus i.e. cowpea
severe mosaic virus (Swaans & Van Kammen, 1973); bean pod mottle

25
virus (Agrawal & Maat, 1964); red clover mottle virus (Agrawal, 1964);
broad bean true mosaic virus (Jones & Barker, 1976).

Cowpea yellow mosaic virus was reported to be transmitted by various

beetles with biting mouthparts. In Africa the chrysomelid beetle Ootheca
mutabilis is an efficient vector (Chant, 1959; Bock, 1971) but
Paraluperodes quaternus (Chrysomelidae) and Nematocerus acerbus
(Curculionidae) were also found to transmit the virus (Whitney & Gilmer,
1974). Jansen & Staples (1971) listed Cerotoma trifurcata, Diabrotica
balteata, D. undecimpunctata howardi, D. virgifera and Acalymma
vittatum (all chrysomelid beetles) as vectors. The transmission is
characterised by short acquisition and inoculation access periods and an
apparent lack of a latent period (Gergerich and Scott, 1996). Beetle
vectors may remain viruliferous for 1-2 to more than 8 days depending on
the species (Chant, 1959; Jansen & Staples, 1971). Transmission
efficiency and retention of infectivity are correlated with the amount of
vector feeding (Jansen & Staples, 1971). Whitney & Gilmer (1974)
reported also transmission by white fly Bemisia tabaci Genn. (Ahmad,
1978), and by two species of grasshoppers (Cantotops spissus spissus
and Zonocerus variegatus) as well as two species of thrips, foliage thrips
(Sericothrips occipilatis Hood) and flower bud thrips Megalurothrips
sjostedti Tryb (Whitney and Gilmer, 1974; Allen and Damme, 1981).

Major, monogenic resistance genes are attractive to the breeder because

they are easy to manipulate, and can be rapidly introgressed into
susceptible materials through simple backcrossing (Kelly and Miklas,
1999). Nonspecific, polygenic resistance would be more durable, but its
deployment creates a major challenge for the breeder since epistasis and
environmental variability often mask this type of resistance. The
disadvantage of major genes is that the resultant resistance can easily be
overcome by new, virulent insect biotypes (Yencho et al., 2000). These

26
race-specific genes are recognized as the least durable source of genetic
resistance to highly variable plant pathogens or insects. Although major
resistance genes have short lifetimes when used one at a time, the
opportunity to pyramid genes [using marker assisted selection (MAS)] will
make major gene resistance more useful than at present (Duvick, 1996).

Molecular genetic markers including RFLP, AFLP, RAPD, and various

other PCR-based markers can be used for indirect selection via
genotype, for locating R genes in plant genomes, and for gene isolation.
Relatively few quantitative trait loci (QTL) for plant viral resistance have
been tagged or genetically mapped (Ahmadi et al., Ghesquiere A. 2001;
Ben-Chaim et al., 2001; Caranta et al., 1997; Chague et al., 1997 and
Loannidou et al. 2003).

2.3 MOLECULAR MARKERS

Many marker based selection strategies are now available to improve
crop plants with speed and precision. The technique exploits the fact that
the marker locus identifies a chromosomal segment and enables that
segment to be monitored in subsequent generation of selfing or crossing.
In Phaseolus vulgaris, Temple and Morales (1986) reported the linkage of
purple mottled seed colour to a dominant allele controlling resistance to
bean common mosaic virus.

With the development of modern molecular techniques and PCR based

marker; tremendous progress has been made in mapping and tagging of
many agronomically important genes. The use of molecular techniques
for genome mapping and identification of markers for disease resistance
genes have opened up new vistas for rapid transfer of resistance and
pyramiding several resistance genes in a single population. The greater
utility of molecular markers arises from the five inherent properties that
distinguish them from morphological markers (Tanksley, 1983).

27
 The phenotype of most morphological markers can only be determined
at the whole plant level; whereas molecular loci can be assayed at
whole plant, tissue and cellular level.

 Allele frequency tends to be much higher at molecular loci compared

with morphologioal markers.

 Morphological markers tend to be associated with undesirable

phenotypic effect.

 Alleles at morphological loci interact in a dominant recessive manner

that limits the identification of heterozygous genotypes. Molecular loci
exhibit a codominant mode of inheritance that allows the genotypic
identification of individuals in segregating populations.

 Fewer epistatic or pleiotropic effects are observed with molecular

markers than with morphological markers.

With these advantages of molecular markers, a large number of

polymorphic markers can be generated and monitored in a single cross.
Therefore, a large progeny in a breeding programme can be screened
easily at an early generation by using molecular markers. Molecular
markers can be divided into two categories biochemical (storage proteins
and isozymes) and molecular (DNA) markers.

2.3.1 Protein Markers

Protein markers, including seed storage proteins, structural proteins, and

isozymes were among the first group of molecular markers exploited for
genetic diversity assessment and genetic linkage map development. They

28
also provide some of the most cost-effective tools for data point
generation; especially when iso-electric focusing equipment is used to
precisely distinguish between very similar versions of proteins.

The most widely used protein markers in plant breeding are isozymes.
Isozymes are differently charged protein molecules that can be separated
using electrophoretic procedure (usually starch gel) (Markert and Moller,
1959). An isozyme is one of the multiple forms of an enzyme having
similar identical catalytic activities. Isozyme analysis provides a powerful
means of assessing the levels of genetic variation in plant population
(Gottileb, 1981). This method has been especially useful in addressing
questions surrounding populations, genetic structure and genetic
conservation (Brown, 1978). The technique of isoelectric focusing (IEF) is
another protein electrophoretic technique with higher resolution (Radola,
1980). Since, enzymes catalyse specific biochemical reactions, it is
possible to visualize the location of a particular enzyme on a gel by
supplying the appropriate substrate and cofactors, and involving the
product of an enzymatic reaction in a colour producing reaction. The
coloured products become deposited on the gel forming a visible band,
where, a particular enzyme has been electrophoretically localized. Bands
visualized from the presence of specific enzymes have a genetic basis
and can provide information as codominant markers. The application of
isozymes in plant genetics has been reviewed by Tanksley and Orton
(1983). Isozyme have been extensively used in the germplasm
characterization and tagging disease resistance genes. Polymorphic
isozyme and storage protein systems have been investigated for use in
classification of a wide range of crops including wheat (Cooke, 1987)
maize (Cardy and Kannenberg, 1982), soyabean (Cardy and Beversdorf,
1984) and cowpea (Panella and Gepts, 1992; Pasquet, 1993, 1999;
Vaillancourt et al., 1993; and Fotso et al., 1994). Sonnante et al. (1996)
used isozymes variation to study the relationships between V.

29
unguiculata and other species of genus Vigna, finding that V. unguiculata
was relatively closer to V. vexillata (subgenus Plectotropis) than other
species belonging to genus Vigna Study the seed globulins of ten Vigna
species, Rao et al. (1992) performed SDS electrophoresis to separate
and observe their polymorphism. Both inter and intraspecific variation,
thus observed allowed the identification of the ten Vigna spp. analysed.
Isozymes have also been used to manipulate quantitatively determined
characters (Stuber et al., 1987). However, the paucity of isozyrne loci and
other limitations of protein markers often restrict their utility (Hash and
Bramel-Cox, 2000).

 A huge amount of the genome does not code for genes, which can be
used as protein markers.
 Different biochemical procedures are required to visualize allelic
differences for enzymes having different functions, and

 Many proteins are several post-transcriptional steps removed from

underlying DNA sequence polymorphism and thus can mask variation
present at that level.

2.3.2 DNA Markers

DNA molecular markers were defined as DNA sequences that are

characteristic of an individual, a group of individuals, of species, even of
systematic groups. They are extremely useful for individual and varietal
identification, the establishment of phylogenetic relationship, population
genetics and for marker assisted selection. Most points on molecular
marker based genetic linkage maps are anonymous DNA polymorphisms
and do not correspond to any gene of known function. However, some
molecular markers (including coding DNA and expressed sequence tag
markers, as well as isozyme markers) do pinpoint individual genes.
Anonymous DNA markers are generated by a wide variety of techniques,

30
differing in their reliability, difficulty, expense, and nature of polymorphism
that they detect. Because of these differences, they also vary greatly in
their stability for various uses. DNA markers may be hybridization based
(FLLP) or PCR based (RAPD, AFLP, SSRs etc.). DNA markers may
detect single locus, oligo-locus, or multiple locus differences and markers
detected may be inherited in a presence/absence, dominant, or co-
dominant.

2.3.2.1 Hybridization Based (probe) Marker:

The Restriction Fragment Length Polymorphism (RFLP) technique

consists of DNA isolation from a suitable set of plants, digestion of the
DNA with restriction enzyme, separation of the restricted fragments by
agarose gel electrophoresis, transfer of the separated restriction
fragments to a filter membrane by a method known as Southern Blotting
(Southern, 1975), detection of individual restriction fragment by nucleic
acid hybridization with labeled cloned probe, and scoring of RFLPs by
direct observation of auto radiogram.

2.3.2.2 PCR Based Markers:

Polymerase chain reaction (PCR) is a procedure for the in vitro enzymatic

amplification of a specific segment of DNA (Mullis and Faloona, 1987).
This technique has certain advantages over RFLP. PCR methods are
rapid, need very little quantities of target DNA, avoid the need for radio
labeling, blotting and hybridization steps and are more amenable to
automation.

The polymerase chain reaction has been used to develop several DNA
markers systems. Three strategies primarily have been employed in the
development of PCR based marker systems. These include:

31
 Markers are amplified using single primers in PCR where marker
system diversity results from variation in the length and/or sequence of
primers, and where anchor nucleotides are present at 5’ (or) 3’ termini
of primers e.g. RAPDs, DAFs, SSR anchored PCR.

 Markers that are selectively amplified with two primers in PCR such
that their selectivity comes from the presence of two to four random
basic at the 3’ ends of primers that anneal to the target DNA during the
PCR (AFLP)

 Markers amplified using two primers in PCR commonly require cloning

and/or sequencing for the construction of specific primers. In this case
variation in marker technology result from differences in the target
DNA sequence present between two primers e.g. STRs, AMP-FLP,
and SSRs,

Randomly Amplified Polymorphic DNA (RAPD)

RAPD markers are generated by PCR amplification of random genomic

DNA segments with single primers (usually 10 nucleotides long) of
arbitrary sequence (William et al., 1990). The primers are generated with
at least 60 per cent G + C content to ensure effective annealing and with
sequences that are not capable of internal pairing that can produce PCR
artifacts. This technique can be developed without knowledge of any
specific target DNA and can detect several loci simultaneously so it is
useful for polygenic studies. Amplification products can be separated by
electrophoresis on agarose or polyacrylamide gels and visualized by
staining with ethidium bromide or silver. RAPDs are usually dominant
markers with polymorphisms between individuals defined as the presence
or absence of a particular RAPD band. Therefore, RAPDs have
limitations in their use as markers for mapping, which can be overcome to
some extent by selecting those markers that are linked in coupling.

32
Powell (1992) gave the advantage of RAPDs over conventional RFLP
technology, which includes:
 Requirement for a small amount of genomic DNA (25-100 ng
per reaction) compared to 5-10 µg for RFLP analysis.
 An ethidium bromide based detection system.
 Many primers can be screened on a single PCR run (Gale and
Witcombe, 1992).
 RAPD may provide markers in regions of the genome
inaccessible to RFLP analysis due to presence of repetitive
DNA sequences (Williams et al., 1990).

Sequence Characterized Amplified Regions (SCARs)

Michelmore et al. (1991) and Paran and Michelmore (1993) introduced
SCARs for amplification of specific locus wherein the RAPD marker
termini are sequenced and longer primers (22-24 nucleotides bases long)
are designed. Hence, these PCR-based secondary markers are detected
with two primers homologous to sequenced ends of a RAPD marker.
They amplify a single band with high reproducibility. Many are
codominant and digesting the PCR product with restriction enzymes
having four-nucleotide binding sites can increase their polymorphism.
SCARs are advantageous over RAPD markers due to the following
reasons:

 They detect only single, genetically defined loci.

 Their amplification is less sensitive to reaction conditions.

 They can potentially be converted into co-dominant marker that will

increase the available information in a MAS program.

 They are not aware of the presence introns that could eliminate the
priming sites.

33
  Scoring results obtained by SCARs are more straightforward than
other PCR based markers.

Consequently, SCAR markers offer the most practical method for

screening numerous samples in a time and labour-saving manners, being
accurate, feasible to use and cost efficient (Kasai etal., 2000).

Adam-Blondon et al. (1994) constructed four pairs of near isogenic lines

(NILs) in which the Are gene (dominant gene conferring resistance to
anthracnose in common bean) was introgressed into different genetic
backgrounds. Five RAPDs and four RFLPs were found to discriminate
between the resistant and the susceptible members of NILs. The most
tightly linked RAPD marker RoH 20 (450 bp amplified fragment) was used
to generate a pair of SCAR primers SCH 20-1 and SCH 20-2, which
specifically amplified 450 bp band.

Ohmori et al. (1996) cloned and sequenced six RAPD fragments tightly
linked to Tm-1 gene, which confers tomato mosaic virus (TMV) resistance
in tomato. These co-dominant markers were useful for differentiating
heterozygotes from both types of homozygotes. Similar studies were
conducted in tomato by Chague et al. (1996). Bulked segregant analysis
was used to identify two RAPD markers linked to Sw- 5 gene for
resistance to tomato spotted wilt viruses (TSWV). One of these markers
was used to develop a SCAR marker and another was stabilized into a
pseudo SCAR marker for further marker-assisted plant breeding studies.

DNA Amplification Fingerprinting (DAF):

DAF is quite similar to RAPD but DNA amplification is achieved using one
or more arbitrary primers 5-6 nucleotides in length. DAF generates a
complex and more detailed pattern when separated on a polyacrylamide

34
gel which is visualised using the highly sensitive silver staining method
(Caetano-Anolles et al., 1991).

Microsatellites or Simple Sequence Repeats (SSRs):

Simple Sequence Repeats (SSRs) or Microsatellites are co-dominant
markers that are routinely used in many industrial and academic labs.
Microsatellites are the most widely used markers, occur at high frequency
and appear to be distributed throughout the genome of higher plants.
These are DNA sequences that consist of two to five nucleotide core units
such as (AT)n, (CTT)n and (ATGT)n, which are tandemly repeated. The
regions flanking the microsatellites are generally conserved among
genotypes of the same species, allowing the selection of PCR primers
that will amplify the intervening SSR in all genotypes. Variation in the
number of tandem repeats, n, results in different PCR product lengths.
These repeats are highly polymorphic even among closely related
cultivars, due to mutations causing variations in the number of repeating
units. They detect a large number of alleles; level of heterozygosity is
high and follows Mendelian inheritance (Wu and Tanksley, 1993). Unlike
the other PCR- based marker techniques, microsatellites markers are
rapidly becoming the predominant type of DNA markers used by human
geneticists for linkage map developed (Hudson et al; 1995) and for
identification of individuals (Hammond et al; 1994) while plant geneticists
still rely on restriction fragment length polymorphism (RFLP) and random
amplified polymorphic markers (RAPD). Investigators in many plant
species have begun to develop and use SSR markers in a wide range of
plant species. For assessment of genetic diversity among cultivars and
their wild relative a variety of molecular markers have been used in past
(Karp et al, 1998). However microsateIites have been considered to be
the markers of choice and their utility for this purpose has been
demonstrated in many crops including Soybean, maize, wheat, rice,
sorghum, barley, sunflower, potato etc. by different workers.

35
The use of SSR markers involves the isolation of SSR-containing DNA
clones from enriched genomic DNA libraries; synthesizing primer sets to
amplify the SSR contained region, and mapping SSR loci that are
polymorphic. Although many improved procedures are now available to
construct SSR-enriched libraries and to subsequently sequencing positive
clones, the isolation of SSRs is still a time consuming and expensive
process. The cost of developing a substantial number of robust SSR
makers for use in genotyping applications involving thousands of
individuals is often prohibitive. Moreover, even in the ‘dense maps’
containing many SSRs, there are many regions of the map that are
completely devoid of any SSR marker. Although they are abundant and
may occur with a frequency of one SSR for every 30-kb region of plant
genome, the realization of that density on a genetic map has not been
achieved yet in any crop species. Some SSRs can also be identified by
searching EST databases. As these SSRs are likely to be within or
adjacent to coding sequences, they may be less polymorphic than SSRs
derived from non-coding regions.

In most plant species the level of polymorphism with microsatellites is

considerable higher than found with RFLP markers. SSRs are reported to
exhibit high level of length polymorphism with as many as 37 alleles in
barley (Saghai-Maroof et a! 1994) and 26 alleles in soybean (Rongwen et
a! 1995). The high number of alleles per locus, precise allele identification
through the use of allelic ladders and the accurate comparison of data
make SSR markers one of the most informative techniques for genome
mapping, DNA fingerprinting and population studies (Taramino and
Tingey, 1996). Other microsatellites based markers e.g. STMS
(Sequence tagged microsatellite site), ISSR (inter- simple sequence
repeats) and RAMPs (Random amplified microsatellite polymorphism)

36
etc. have also been used for cultivar identification and for assessment of
genetic diversity in several plant system (Wolff et al, 1993).

Inter-Simple Sequence Repeats (ISSR):

ISSR involves amplification of DNA segments present at an amplifiable

distance in between two identical microsatellite repeat regions oriented in
opposite direction. The technique uses microsatellites as primers in a
single primer PCR reaction targeting multiple genomic loci to amplify
mainly inter simple sequence repeats of different sizes. The microsatellite
repeats used as primers for ISSRs can be di-nucleotide, tri-nucleotide,
tetranucleotide or penta-nucleotide. The primers used can be either
unanchored (Meyer et al., 1993; Gupta et al., 1994; Wu et al., 1994) or
more usually anchored at 3` or 5` end with 1 to 4 degenerate bases
extended into the flanking sequences (Zietkiewicz et al., 1994). ISSRs
use longer primers (15–30 mers) as compared to RAPD primers (10
mers), which permit the subsequent use of high annealing temperature
leading to higher stringency. The annealing temperature depends on the
GC content of the primer used and ranges from 45 to 65oC. The amplified
products are usually 200–2000 bp long and amenable to detection by
both agarose and polyacrylamide gel electrophoresis.

ISSRs exhibit the specificity of microsatellite markers, but need no

sequence information for primer synthesis enjoying the advantage of
random markers (Joshi et al., 2000). The technique is simple, quick, and
the use of radioactivity is not essential. ISSR markers usually show high
polymorphism (Kojima et al., 1998) although the level of polymorphism
has been shown to vary with the detection method used. Polyacrylamide
gel electrophoresis (PAGE) in combination with radioactivity was shown
to be most sensitive, followed by PAGE with AgNO 3 staining and then
agarose gel with EtBr system of detection. Like RAPDs, reproducibility,

37
dominant inheritance and homology of comigrating amplification products
are the main limitations of ISSRs. Fang and Roose (1997) reported a
reproducibility level of more than 99% after performing repeatability tests
for ISSR markers by using DNA samples of the same cultivar grown in
different locations, DNA extracted from different aged leaves of the same
individual, and by performing separate PCR runs. In other cases, the
reproducibility of ISSRs amplification products ranged from 86 to 94%,
with the maximum being when polyacrylamide gel electrophoresis and
AgNO3 staining were used and weak bands excluded from scoring
(Moreno et al., 1998). ISSRs segregate mostly as dominant markers
(Gupta et al., 1994; Tsumura et al., 1996; Ratnaparkhe et al., 1998; Wang
et al., 1998), although co-dominant segregation has been reported in
some cases (Wu et al., 1994; Akagi et al., 1996; Wang et al., 1998;
Sankar and Moore, 2001). There is also a possibility as in RAPD that
fragments with the same mobility originate from non-homologous regions
(Sanchez et al., 1996).

The utility of ISSR markers for tagging agronornically important genes

was first reported by Akagi et aL (1996) by identifying tight linkage with a
nuclear restorer gene in rice. Since then, ISSR markers were developed
for many eukaryotes including a number of crops like millets (Salimath et
al., 1995), rice (Blair et al., 1999; Joshi et al., 2000), wheat (Ammiraju et
al., 2001), citrus (Berto et al., 2001), cotton (Wu et al., 2001). Further this
marker system offers great potential for DNA fingerprinting, genome
mapping an to determine intra and inter- varietal or genomic variation
compared to other arbitrary primers as they reveal variation with in unique
regions of the genome at several loci simultaneously, yielding a
multilocus marker system.

Amplified Fragment Length Polymorphism (AFLP):

38
AFLP is a PCR-based technology for marker-assisted breeding and
genotyping. AFLP represents a significant breakthrough compared to the
currently available methods in terms of facility, precision, flexibility, speed
and cost. Essentially, AFLP enables the generation of thousands of DNA
markers from a genome of any complexity and without prior knowledge of
the genome’s structure or sequence.

AFLP involves the amplification of small restriction fragments, obtained by

cleaving genomic DNA with restriction enzymes, to produce high
resolution DNA "fingerprinting" patterns on denaturing polyacrylamide
gels (Vos et al., 1995). The rationale of the AFLP technique is based on
the use of specifically designed PCR primers which selectively amplify a
small subset of restriction fragments, or "markers", out of a complex
mixture comprising as many as several million different fragments. The
products of the reaction can be visualised by conventional DNA staining
or DNA labelling procedures using either radioactive or non-radioactive
methods.

AFLP is an extremely flexible technology which offers multiple

applications in the field of crop breeding and plant genome analysis,
especially in the fields of genotying, marker-assisted breeding and plant
genome analysis.

Single-Strand Conformation Polymorphism (SSCP)

Single-strand conformation polymorphism is technically simple and

sensitive. It can have mutation detection efficiency 100%. The technique
relies on the variation in electrophoretic mobility of secondary structures
formed by single stranded DNA. Fragments of different primary structures
i.e. DNA samples usually PCR products are denatured by heat and or
chemical denaturants and electrophoresed into a non-denaturing gel. As
the ssDNA moves from denaturing to non-denaturing conditions, intra-

39
strand base pairing causes folding of the fragments with stable
conformations, and mobility differences among them can be detected
under the appropriate electrophoretic conditions. DNA fragments 100-
400 bp in length are most appropriate as the efficiency of mutation
detection decreases outside this range. It is currently used in diagnostics
of inherited diseases in humans, but is not well developed for crop
applications.

Sequence-Tagged Site (STS):

STS was first developed by Olsen et al. (1989) as DNA landmarks in the
physical mapping of the human genome, and latter adopted in plants.
STS is a short, unique sequence whose exact sequence is found
nowhere else in the genome. Two or more clones containing the same
STS must overlap and the overlap must include STS. Any clone that can
be sequenced may be used as STS provided it contains a unique
sequence. In plants, STS is characterized by a pair of PCR primers that
are designed by sequencing either an RFLP probe representing a
mapped low copy number sequence (Blake et al., 1996) or AFLP
fragments. Although conversion of AFLP markers into STS markers is a
technical challenge and often frustrating in polyploids such as hexaploid
wheat (Shan et al., 1999; Prins et al., 2001), it has been successful in
several crops (Meksem et al., 1995, 2001; Qu et al., 1998; Shan et al.,
1999; Decousset et al., 2000; Parker and Langridge, 2000; Prins et al.,
2001; Guo et al., 2003). The primers designed on the basis of a RAPD
have also sometimes been referred to as STSs (Naik et al., 1998),
although they should be more appropriately called SCARs. STS markers
are co-dominant, highly reproducible, suitable for high throughput and
automation, and technically simple for use (Reamon-Buttner and Jung,
2000).

Expressed sequence tags (EST)

40
Messenger RNA (mRNA) was converted to complementary DNA (cDNA)
which represented only expressed DNA sequence or expressed gene. A
few hundred nucleotides from either the 5' or 3' end of these expressed
genes can be sequenced to create 5' expressed sequence tags (5' ESTs)
and 3' ESTs, respectively (Jongeneel, 2000). A 5' EST is obtained from
the portion of a transcript (exons) that usually codes for a protein. These
regions tend to be conserved across species and do not change much
within a gene family. The 3' ESTs are likely to fall within non-coding
(introns) or untranslated regions (UTRs), and therefore tend to exhibit
less cross-species conservation than do coding sequences. The
challenge associated with identifying genes from genomic sequences
varies among organisms and is dependent upon genome size as well as
the presence or absence of introns, which are the intervening DNA
sequences interrupting the protein coding sequence of a gene.

Single Nucleotide Polymorphisms (SNP)

Single nucleotide polymorpisms (SNPs) are DNA sequence variations

between individuals which are the most common form of DNA
polymorphisms in a genome. Since these are the most abundant
variations in a genome and thus have the potential of providing the
highest map resolution, a large amount of SNP data is available in
humans, but very limited data are available on SNPs in plants. Detection
of SNPs does not require DNA fragment length measurement, thus
allowing one to design high throughput, automatic assays, without
separating DNA by size. While SSRs can often represent many alleles,
SNPs are biallelic in nature. SNP discovery approaches such as re-
sequencing or data mining enable the identification of insertion deletion
(indel) polymorphisms. These indels can be treated as biallelic markers
and can be utilized for genetic mapping and diagnostics. The
mechanisms that generate indel polymorphisms are still largely
speculative. Insertion and deletion can occur by unequal crossing over or

41
replication slippage or slipped strand mis-pairing. The latter is believed to
be true for the DNA regions that contain short repeats like microsatellites.
This may be the first study that has characterized a large number of
indels in any crop species and demonstrated their utility as genetic
marker.

2.4 APPLICATION OF MOLECULAR MARKERS IN COWPEA

BREEDING
Recently development of molecular markers made it possible to be used
in a wide range of application including confirming the identity of hybrids
in breeding programmes, determining phylogenetic relationships in
related species, and facilitating introgression of desirable traits from wild
relatives to cultivated crop species. Molecular markers are also being
used to construct genetic maps. A genetic map is a collection of genetic
markers that have been grouped according to their linkage. Breeders can
use DNA maps to carry out marker-assisted selection. This technique
enables plants carrying desirable traits such as pest and disease
resistance to be selected while still in the seedling stage. Ultimately, this
enables the cloning of the genes to be used for crop improvement. The
polymerase chain reaction (PCR) has become a popular technique for
molecular genome mapping and the diagnosis of plant pathogens. The
technique ensures amplification of specific DNA sequences by the use of
primers and the enzyme Taq DNA polymerase. Restriction Fragment
Length Polymorphisms (RFLPs), Random Amplified Polymorphic DNAs
(RAPDs), microsatellites and Amplified Fragment Length Polymorphism
(AFLP) are some of the most useful molecular markers for DNA
fingerprinting.

2.4.1 Genetic Diversity and Phylogenetic Relationship

Population genetic diversity and phylogenetic relationships may not only
illustrate the evolutionary process and biological conservation but also

42
provide information for selection of parents in conventional breeding. The
genetic diversity in cultivated cowpea has been assessed on the basis of
morphological and physiological traits (Ehlers and Hall, 1996; Fery, 1985),
allozymes (Panella and Gepts, 1992; Pasquet, 1993, 1999; Vaillancourt et
al., 1993), seed storage proteins (Fotso et al., 1994), chloroplast DNA
polymorphism (Vaillancourt and Weeden, 1992), restriction fragment
length polymorphisms (RFLP) (Fatokun et al., 1993), amplified fragment
length polymorphisms (AFLP) (Fatokun et al., 1997), simple sequence
repeat (SSR) (Li et al., 2001), and random amplified polymorphic DNA
(RAPD) (Mignouna et al., 1998).

Pasquet (1996) evaluated cowpea gene pool organization on the basis of

morphological and isoenzymatic data. Morphologically analysis, cultivated
cowpea can be split up into two groups, well characterized by their ovule
numbers and their photosensitivity, with fairly primitive and fairly evolved
forms in each group. These two morphophysiological groups are,
however, difficult to distinguish isoenzymatically; all of the cultivar groups
have the same most common alleles for each isozyme.

Determining genetic similarities and relationships among cowpea

breeding lines and cultivars by microsatellite markers, Li et al (2001)
observed 90 cowpea lines grams shared an average of 44% similarity. A
large group of 47 cowpea lines shared over 45% similarity on the
dendrogram. The microsatellite markers were also highly polymorphic in
cowpea. They could be used in germplasm conservation and analysis,
not only for breeding lines and cultivars but also for the wild cowpea
species and other Vigna species.
Degenerate oligonucleotides designed to recognize conserved coding
regions within the nucleotide binding site (NBS) and hydrophobic region
of known resistance (R) genes from various plant species were used to
target PCR to amplify resistance gene analogs (RGAs) from a cowpea

43
(Vigna unguiculata L.Walp.) cultivar resistant to Striga gesnerioides
(Gowda et al, 2002). The nucleotide sequence of fifty different cloned
fragments was determined and their predicted amino acid sequences
compared to each other and to the amino acid sequence encoded by
known resistance genes, and RGAs from other plant species. Cluster
analysis identified five different classes of RGAs in cowpea. Gel blot
analysis revealed that each class recognized a different subset of loci in
the cowpea genome. Several of the RGAs were associated with
restriction fragment length polymorphisms, which allowed them to be
placed on the cowpea genomic map.

The efficiency of RAPD, AFLP, and SAMPL marker systems was

investigated to detect genetic polymorphism in cowpea landraces (Vigna
unguiculata subsp. unguiculata L. Walp.) (Tosti and Negri, 2002). Each
marker system was able to discriminate among the materials analysed,
but a clear distinction between all the local varieties was only obtained
with AFLP and SAMPL markers. The average diversity index was quite
similar for each marker system, but owing to the differences in the
effective multiplex ratio values the marker index was higher for the AFLP
and SAMPL systems than for the RAPD system. The AFLP and SAMPL
techniques appear to be more useful than the RAPD technique in the
analysis of limited genetic diversity among the cowpea landraces tested.
The significant correlations of SAMPL similarity and cophenetic matrices
with those of the other markers, and the lower number of primer
combinations required, indicate that this technique is the most valuable.
The low genetic similarity detected among landraces suggests that all the
cowpea landraces should be maintained on the respective farms from
which they came.

Fall et al. (2003) studied the genetic diversity of cultivated Senegalese

varieties using physiology trait based on nitrogen fixation and genotypic

44
analysis utilized by RAPD observed the polymorphisms of RAPD can be
used to reorganize the cowpea germplasm in order to eliminate the
putative duplicates, and to identify elite varieties. The polymorphic data
showed that some DNA fragments could be specific to the higher or lower
nitrogen fixing varieties suggesting that some genes could govern the
higher nitrogen fixation character in cowpea. These findings also provide
an alternative avenue for understanding the biological nitrogen fixation
process and the genetic identification of parent plants in a breeding
program.

Genetic diversity of cultivated cowpeas and their wild types was reported
that wild accessions were more diverse than domesticated cowpeas, wild
cowpeas were more diverse in eastern than in western Africa, and a
unique domestication event in cowpea in the northern Africa was
suggested by Coulibaly et al. (2002) and Fana et al. (2004). The AFLP
technique was reported superiority over isozymes resided in its ability to
uncover variation both within domesticated and wild cowpea, and should
be a powerful tool once additional wild material becomes available
(Coulibaly et al., 2002). As isozymes and AFLP markers, although with a
larger number of markers, RAPD data confirmed the single domestication
hypothesis, the gap between wild and domesticated cowpea, and the
widespread introgression phenomena between wild and domesticated
cowpea (Fana et al., 2004).

Pandey and Dhanasekar (2004) studied morphological features and

inheritance of foliaceous stipules of primary leaves in Cowpea (Vigna
unguiculata). The stipules have been recognized as an important
morphological character for identification of species or varieties.

In 1992, Vaillancourt and Weeden discovered a very important mutation

for studying cowpea evolution and domestication. A loss of a BamHI

45
restriction site in chloroplast DNA characterized all domesticated
accessions and a few wild (Vigna unguiculata ssp. unguiculata var.
spontanea) accessions. In order to screen a larger number of accessions,
Feleke et al. (2006) screened 54 domesticated cowpea accessions and
130 accessions from the wild progenitor using PCR RFLP or direct PCR
methods. The use of s13.3/BamHI haplotype specific primers developed
for chloroplast DNA was a key element to further evaluate the various
domestication hypotheses. The absence of haplotype 0 was confirmed
within domesticated accessions, including primitive landraces from
cultivar-groups Biflora and Textilis, suggesting that this mutation occurred
prior to domestication. However, 40 var. spontanea accessions
distributed from Senegal to Tanzania and South Africa showed haplotype
1. Whereas this marker could not be used to identify a precise center of
origin, it did highlight the widely distributed cowpea crop-weed complex.
Its very high frequency in West Africa could be interpreted as a result of
either genetic swamping of the wild/weedy gene pool by the domesticated
cowpea gene pool or as the result of domestication by ethnic groups
focusing primarily on cowpea as fodder.

2.4.2 Markers Linked to Disease Resistance Gene in Cowpea

The local reactions of primary leaves were used as morphological trait to

recognize resistant gene in cowpea (Robertson, 1965). Varieties that
gave no reaction or developed necrotic lesion when inoculated with
CYMV were immune from infection and were therefore resistant; those
that developed chlorotic lesions became systemically infected and
therefore susceptible to infection.

Since the number of morphological traits are limited and affected by

environment condition, molecular markers are recently best of choice
complementation with conventional segregation analysis to identify
disease resistance loci in the plant genome.

46
Fatokun et al. (1993) used RFLP analysis of nuclear Sequences to study
the genetic relationships in 18 species belonging to four subgenera of
genus Vigna and higher amount of variation was found in species from
Africa as compared to those from Asia.

A highly sensitive reverse transcription-polymerase chain reaction (RT-

PCR) was used to detect the presence of cowpea mottle carmovirus
(CPMeV) in germ plasm of Vigna spp (Gillaspie et al., 1999), and the
presence of cowpea aphid-borne mosaic virus (CABMV) in peanut
(Gillaspie et al. 2001) instead of ELISA techniques. The RT-PCR method
was up to 105 times more sensitive than direct antigen coating enzyme-
linked immunoadsorbent assay (DAC-ELISA) in detecting CPMoV, and
was ten times more sensitive than enzyme-linked immunoadsorbent
assay (ELISA) in detecting CABMV.

Based on bulked segregant analysis described by Michelmore et al.

(1991), identification of AFLP markers linked to resistance of cowpea to
parasitic weed disease (Striga gesnerioides) was carried out by
Ouedraogo et al. (2001). Three AFLP markers were identified that are
tightly linked to resistance reaction to S. gesneroides race 1 (a single
dominant gene, designated Rsg2–1) with the distance of 2.6 cM, 0.9 cM,
and 0.9 cM, respectively; and six AFLP markers linked to resistance
reaction to S. gesneroides race 3 (a single dominant gene, designated
Rsg4–3) with the distance of 10.1 cM, 4.1 cM, 2.7 cM, 3.6 cM, 3.6 cM,
and 5.1 cM.

Marker-assisted selection (MAS) was applied in breeding cowpea for

resistance to the parasitic weed Striga gesnerioldes (WilId.) using AFLP
and ALFP-derived SCAR markers (Boukar et al., 2004). An F2 population
developed from the cross between a resistance breeding line (1T93K-

47
693-2) and the susceptible cultivar 1AR1696 was characterized for
resistance against race 3 of S. gesnerioldes for genetic analysis and
molecular mapping. 1T93K-693-2 was found to have a single dominant
gene for resistance. Four AFLP markers, designated E-ACTIM-CTC115,
E-ACTIM-CAC115, E-ACAIM-CAG108 and E-AAGJE-CTA1, were
identified and mapped 3.2, 4.8, 13.5 and 23.0 cM, respectively, from Rsgl,
a gene in 1T93K-693-2 that gives resistance to race 3 (or Nigerian strain)
of S. gesnerioldes. The first two markers were validated in a second F2
population developed from crossing the same resistant parent with
‘Kamboinse local’, a different susceptible cultivar. The AFLP fragment
from marker combination E-ACTIM-CAC, which is linked in coupling with
Rsgl was cloned, sequenced, and converted into a sequence
characterized amplified region (SCAR) marker named
SEACTMCACX3/85, which is codominant and useful in breeding
programs.

A new marker system, targeted region amplified polymorphism (TRAP),

has been utilized for mapping and tagging disease resistance traits in
common bean (Phaseolus vulgaris L.) (Miklas et al., 2006). Most widely
used marker types, random amplified polymorphic DNA (RAPD) and
amplified fragment length polymorphisms (AFLP), for linkage mapping in
bean are located randomly throughout the genome and associate with
particular traits by chance. The new marker system, TRAP, uses
expressed sequence information and a bioinformatics approach to
generate polymorphic markers around targeted candidate gene
sequences. TRAP markers were amplified by fixed primers designed
against sequenced expressed sequence tag (EST) associated with
disease resistance in the Compositae Genomics database or against
sequenced resistance gene analog (RGA) from common bean.
Seventeen of 85 TRAP markers located in the BAT 93/Jalo EEP558 core
mapping population mapped in the vicinity of R genes. Six of 21 TRAP

48
markers generated in the Dorado/XAN 176 mapping population were
linked with newly identified QTL, two conditioning resistance to ashy stem
blight (14% and 16% of the phenotypic variation explained, R 2), and one
each conferring resistance to Bean golden yellow mosaic virus (BGYMV)
(15%) and common bacterial blight (30%). The TRAP marker system has
potential for mapping regions of the common bean genome linked with
disease resistance.

A single incompletely dominant gene was suggested controlled clover

yellow vein virus (ClYVV) elicits lethal tip necrosis in pea after observing
ratios of necrosis, mosaic with slight stem necrosis, and mosaic fit the
expected 1:2:1 ratio from F2 population of a cross between PI 118501 and
PI 226564 (Ravelo et al., 2007). This locus in pea, conferring necrosis
induction to ClYVV infection, was designated Cyn1 (Clover yellow vein
virus-induced necrosis). A linkage analysis using 100 recombinant inbred
lines derived from a cross of PI 118501 and PI 226564 demonstrated that
Cyn1 was located 7.5 cM from the SSR marker AD174 on linkage group
III.

2.4.3 Genetic Mapping in Cowpea

Genetic maps of cowpea have been established by Fatokun et al. (1992,
1993), Menancio-Hautea et al. (1993), Menendez et al. (1997), Ubi et al.
(2000) and Ouedraogo et al. (2002). Of these, the latter, building on the
earlier version developed by Menendez et al.(1997), is the most current
and complete map. This map was established in the recombinant inbred
population IT84S-2049 x 524B (n=94) developed by the Bean/Cowpea
Collaborative Research Support Program (CRSP) project at the
University of California, Riverside. IT84S-2049 is an advanced breeding
line developed at IITA in Nigeria for multiple disease and pest resistance
and has resistance to several races of blackeye cowpea mosaic virus
(B1CMV) and to virulent root-knot nematodes in California (Menendez et

49
al., 1997). Line 524B is a black-eyed cowpea that shows resistance to
Fusarium wilt and was developed at the University of California,
Riverside, from a cross between cultivars CB5 and CB3, which
encompasses the genetic variability that was available in cowpea
cultivars in California.

As many studies suggested domesticated cowpea consists of a single

gene pool (Coulibaly et al., 2002; Fana et al. 2004). The genetic diversity
in this gene pool for RFLPs was limited and alternative markers have
been pursued, including RAPDs (Menendez et al., 1997) and AFLPs
(Ouedraogo et al., 2002), which detect a larger number of polymorphic
loci. The current map of cowpea consists of 11 Linkage groups (LGs)
spanning a total of 2670 cM, with an average distance of approximately 6
cM between markers. It includes 242 AFLP, 18 disease or pest
resistance-related markers (Ouedraogo et al., 2002) and 133 RAPD, 39
RFLP, and 25 AFLP markers from the original map of Menendez et al.
(1997) for a total of 441 markers, of which 432 were assigned to a LG.
Among these markers loci, genes for a number of biochemical and
phenotypic traits have been located on this map. These include C, a
general color factor, and P, for purple pod color, on LG4, a 35 kDa
dehydrin protein, implicated in chilling tolerance during emergence (LG2;
Ismail et al., 1999), and markers for resistance to Striga gesnerioides
races 1 and 3 (LG1 and LG6), cowpea mosaic virus (CPMV) and cowpea
severe mosaic virus (CPSMV) (two distinct loci on LG2), B1CMV (LG8),
southern bean mosaic virus (SBMV) (LG6), Fusarium wilt (LG6, distinct
from the previous locus), and root-knot nematodes (Rk on LG1)
(Ouedraogo et al., 2002). Resistance gene candidates (RGCs) were also
placed by RFLP analysis in various locations on the integrated cowpea
map, including LG3, LG5, and LG9. Nevertheless, none of the GC loci co-
segregated with disease resistance phenotypes, suggesting that

50
additional mapping for both RGCs and phenotypic disease resistance
traits should be pursued in cowpea.

2.4.4 QTL Mapping in Cowpea

An effective approach for studying complex and polygenic forms of
disease resistance is known as “Quantitative Trait Locus” (QTL) mapping,
which is based on the use of DNA markers (Tanksley, 1993). The theory
of QTL mapping was first described in 1923 by Sax (1923), where he
noted that seed size in bean (a complex trait) was associated with seed
coat color (a simple, monogenic trait). This concept was further
elaborated by Thoday (1961), who suggested that if the segregation of
simply inherited monogenes could be used to detect linked QTLs, then it
should eventually be possible to map and characterize all the QTLs
involved in complex traits. Modern QTL mapping is essentially the
fulfillment of this idea, with the key innovation being that defined
sequences of DNA act as the linked monogenic markers. With the
development of comprehensive DNA marker maps (Phillips and Vasil,
1994), it is now possible to search for QTLs throughout the genomes of
most crop species. This has had the profound effect of moving the focus
in studies of polygenic traits to questions about the chromosomal
locations, gene actions, and biological roles of specific loci involved in
complex phenotypes.

The QTL localization is carried out by the interval mapping method, with
LOD ≥ 2. This is justified considering the number of individuals in the
mapping population. Higher LOD values undoubtedly increase the
reliability of QTL mapping (Paretson 1995; Shibaike 1998) but on the
other hand it decreases the statistic chance to detect minor genes (with a
low VE value), especially in the experiments where the number of
individuals in the tested population is low (Tanksley 1993). Other authors
working with populations of a similar size established the same threshold

51
value of LOD. Timmerman- Vaughan et al. (1996) used LOD ≥ 2 in QTL
mapping studies with a population of 102 pea F2 plants and 51 RILs.
Maughan et al. (1996), working with an F2 population of 150 plants, used
the same LOD value in comparative QTL mapping among three legume
species. Higher LOD values were applied (LOD ≥ 2.5) for QTL mapping
studies when population size reached 200-250 F2 plants (Schafer-Pregl
et al. 1999; Lan, Paterson 2000; Lippman, Tanksley 2001).

A well saturated genomic map is a necessity for a breeding program

based on marker assisted selection. Fatokun et al. (1992) developed
genomic maps for cowpea (Vigna unguiculata) and mung bean (Vigna
radiata) based on restriction fragment length polymorphism (RFLP)
markers. Location of major quantitative trait loci (QTLs) for seed weight in
both species was constructed. Two unlinked genomic regions in cowpea
contained QTLs accounting for 52 .7% of the variation for seed weight. In
mung bean there were four unlinked genomic regions accounting for
49.7% of the variation for seed weight. In both cowpea and mung bean
the genomic region with the greatest effect on seed weight spanned the
same RFLP markers in the same linkage order. This suggests that the
QTLs in this genomic region have remained conserved through evolution.
This inference is supported by the observation that a significant
interaction (i.e., epistasis) was detected between the QTL(s) in the
conserved region and an unlinked RFLP marker locus in both species.

Bean/Cowpea Collaborative Research Support Program (B/C CRSP)

scientists have successfully developed integrated consensus maps of the
11 linkage groups (LGs) in both bean (Phaseolus vulgaris L.) and cowpea
(Vigna unguiculata L. Walp) (Kelly et al., 2003). The bean map is
approximately 1200 cM with some 500 markers and an additional 500
markers shared with other bean maps. The cowpea map spans 2670 cM
with over 400 markers. In addition to molecular markers, both maps

52
include map locations of defense genes and phenotypic traits for disease
and insect resistance, seed size, color and storage proteins, pod color
and those traits associated with the domestication syndrome in bean.
Since the bean and cowpea maps were developed independently, LGs
with the same number probably refer to non-syntenic groups. Map
locations of major resistance genes in bean are revealing gene clusters
on LGs B1, B4, B7, and B11 for resistance to bean rust, anthracnose,
common bacterial blight and white mold. Gene tagging and marker-
assisted selection for disease resistance has progressed to a point where
the indirect selection for resistance to a number of major diseases is now
routine in bean breeding programs both in the US and overseas.

Quantitative trait loci (QTLs) mapping for resistance to thrips (Thrips

palmi Karny) in common bean (Phaseolus vulgaris L.), using F5:7
recombinant inbred lines (RILs) of the cross of two Mesoamerican bean
lines, BAT 881 and G 21212, as a mapping population was found to show
transgressive segregation for thrips resistance in the field (Frei et al.,
2005). Correlations between damage and reproductive adaptation (RA)
scores were significant within and between seasons. The QTLs for both
traits were located based on single interval mapping (IM) and joint interval
mapping (JIM) analysis using a genetic map constructed with
microsatellite and random amplified polymorphic DNA (RAPD) markers.
Eight of eleven resulting linkage groups (LGs) were shown to be
homologous to chromosomes of the integrated linkage map of common
bean. A major QTL for thrips resistance located on LG b06 explained up
to 26.8% of variance for resistance in a single season and was named
Tpr6.1. The JIM across several seasons revealed various QTLs on LGs
b02, b03, b06, and b08, some of which were located at regions of genes
encoding for disease resistance. The identification and mapping of thrips-
resistance genes is expected to facilitate the development of resistant
bean cultivars by using molecular marker-assisted selection.

53
Cowpea [Vigna unguiculata (L.) Walp.] and mungbean [Vigna radiata (L.)
Wilczek]. QTL analysis for seed weight was carried out in the Vigna
domesticates cowpea and mungbean since this is an important trait
related to yield (Fatokun et al., 1992). Using populations derived from
crosses between cowpea and wild cowpea and mungbean and wild
mungbean, two and four QTLs for seed weight, respectively, were
reported (Fatokun et al., 1992). Recently QTLs for seed size have also
been mapped in azuki bean (Vigna angularis) (Isemura et al., 2007). The
synteny of seed weight QTLs between azuki bean and related legumes
were comparative in figure 3. Linkage groups ii and vi in the cowpea map
correspond to linkage groups 1 and 4, respectively, in the azuki bean
map. Linkage groups i, ii, iii and vi in the mungbean map correspond to
linkage groups 9, 1, 8 and 10, respectively, in the azuki bean map (Fig.
3). In this study, a QTL for seed weight was detected on linkage group 1
at a location corresponding to that of a QTL for this trait on linkage group
ii in cowpea and mungbean. This seed weight QTL appears to be
conserved among these three species. QTLs for seed weight were also
detected at similar locations on azuki bean linkage group 9 and
mungbean linkage group i. Although the QTL with largest effect for seed
weight was detected on the linkage group 2 in azuki bean, no QTL was
detected on the linkage groups corresponding to this linkage group in
cowpea and mungbean. QTLs on linkage group vi of cowpea, iii and vi of
mungbean and 8 of azuki bean appear to be specific to these crops.
These results suggest that the main genome regions related to increased
seed weight under domestication do not correspond among these related
species despite high homology between the linkage groups. In azuki
bean, seed weight in cultivated taxa is about eight times that of the wild
parent. In contrast, seed weight in cultivated and wild parents of crosses
analysed for both cowpea and mungbean only exhibited a 5-fold
difference (Fatokun et al., 1992). Azuki bean has among the largest seed

54
for the cultivated Asian Vigna (Tomooka et al., 2000). It seems that
increase in seed size in azuki bean compared with cowpea and
mungbean involves some different loci.

Fig. 3. Comparative QTL maps for seed weight in three cultivated Vigna
species, V. angularis (azuki bean), V. radiata (mungbean) and V.

55
unguiculata (cowpea). Linkage groups of mungbean are after the maps of
Fatokun et al. (1992) (Roman numerals) and Menancio-Hautea et al.
(1993) (Arabic numerals). Linkage groups of cowpea are after the maps
of Fatokun et al. (1992). The QTL regions for seed weight in mungbean
and cowpea are after Fatokun et al. (1992).
2.5 GENOME DATABASES AND SEQUENCES HOMOLOGY SEARCH
2.5.1 Plant Genome Databases
One of the key sources of information and links to studies being carried
out in a specific crop species, or for a specific trait in more than one
species, is the plant genome databases that are available for use on the
internet (Hash and Bramel-Cox, 2000). Access to the information retained
in these databases as well as the contribution of experimental results to
the various databases will result in
• A broader application of marker analysis from specific studies,
• An efficient method to identify possible markers for new users, and
• A link to understanding the exact nature of the trait, marker, QTL,
evolutionary relationship, or other biological issues of interest.
These databases are available for users on the internet through
www.nal.usda.gov and at individual sites for each crop or data collection.

2.5.2 Cowpea Genome Databases

Cowpea Genespace/Genomics Knowledge Base (CGKB) is an
annotation knowledge base developed under the Cowpea Genomics
Initiative (CGI). The database is based on information derived from
298,848 cowpea genespace sequences (GSS) isolated by methylation
filtering of genomic DNA. The CGKB consists of three knowledge bases:
GSS annotation and comparative genomics knowledge base, GSS
enzyme and metabolic pathway knowledge base, and GSS simple
sequence repeats (SSRs) knowledge base for molecular marker
discovery. A homology-based approach was applied for annotations of
the GSS, mainly using BLASTX against four public FASTA formatted
protein databases (NCBI GenBank Proteins, UniProtKB-Swiss-Prot,

56
UniprotKB-PIR (Protein Information Resource), and UniProtKB-TrEMBL).
Comparative genome analysis was done by BLASTX searches of the
cowpea GSS against four plant proteomes from Arabidopsis thaliana,
Oryza sativa, Medicago truncatula, and Populus trichocarpa. The possible
exons and introns on each cowpea GSS were predicted using the HMM-
based Genscan gene predication program and the potential domains on
annotated GSS were analyzed using the HMMER package against the
Pfam database. The annotated GSS were also assigned with Gene
Ontology annotation terms and integrated with 228 curated plant
metabolic pathways from the Arabidopsis Information Resource (TAIR)
knowledge base. The UniProtKB-Swiss-Prot ENZYME database was
used to assign putative enzymatic function to each GSS. Each GSS was
also analyzed with the Tandem Repeat Finder (TRF) program in order to
identify potential SSRs for molecular marker discovery. The raw
sequence data, processed annotation, and SSR results were stored in
relational tables designed in key-value pair fashion using a PostgreSQL
relational database management system. The biological knowledge
derived from the sequence data and processed results are represented
as views or materialized views in the relational database management
system. All materialized views are indexed for quick data access and
retrieval. Data processing and analysis pipelines were implemented using
the Perl programming language. The web interface was implemented in
JavaScript and Perl CGI running on an Apache web server. The CPU
intensive data processing and analysis pipelines were run on a computer
cluster of more than 30 dual-processor Apple XServes. A job
management system called Vela was created as a robust way to submit
large numbers of jobs to the Portable Batch System (PBS). The cowpea
GSS, chloroplast sequences, mitochondrial sequences, retro-elements,
and SSR sequences are available as FASTA formatted files and
downloadable at CGKB. This database and web interface are publicly
accessible at http://cowpeagenomics.med.virginia.edu/CGKB/ webcite.

57
2.5.3 Sequence Homology Searches Using BLAST
Different search algorithms are BLAST, FASTA and non-traditional
search methods.

BLAST (Basic Local Alignment Search Tool) is a popular program frer

searching biosequences against databases. BLAST was developed and
is maintained by a group at the National Center for Biotechnology
information (NCBI).

 BLAST tries to find patches of regional similarity, rather than trying

to find the best alignment between entire query and an entire
database sequence.
 Alignments generated with BLAST do not contain gaps. BLAST’s
speed and statistical model depend on this, but in theory it reduces
sensitivity. However, BLAST will report multiple local alignments
between query and a database sequence.
 BLAST is based on an explicit statistical theory. The original theory
was later extended to cover multiple weak matches between query
and database entry.
 BLAST is extremely fast. One can either run the program locally or
send queries to an E-mail server maintained by NCBI
blast@ncbi.nlm.nih.gov
 Both phases of the alignment process (scanning & extension) use a
substitution matrix to score matches.
 BLAST comes in 4 flavors:
 BLASTP: search a Protein Sequence against a Protein
Database.
 BLASTN: search a Nucleotide Sequence against a Nucleotide
Database.

58
 TBLASTN: search a Protein Sequence against a Nucleotide
Database, by translating each database Nucleotide sequence in
all 6 reading frames.
 BLASTX: search a Nucleotide Sequence against a Protein
Database, by first translating the query Nucleotide sequence in
all 6 reading frames.

59
CHAPTER III

MATERIALS AND METHODS

3.1 MATERIALS
3.1.1 Plant materials
One hundred ninety cowpea lines were used to screen cowpea yellow
mosaic virus resistance under the field condition of Forage section, Plant
breeding Department in July 2005. Resistant lines and susceptible lines
were classified based on the grade of disease symptom as following

Disease
Description
incidence score

0 (resistance) No systemic symptom

2 (moderately Distinct leaf mottling but no detectable reduction in

susceptible) plant size or seed yield

4 (susceptible) Distinct mottling and leaf distortion with significantly

reduced growth and seed yield
6 (highly
susceptible) Distinct mottling and severely distorted leaf with plant
growth greatly reduced and few seed produced

From 190 genotypes screening, 20 resistant lines and 20 susceptible

lines were selected for further analysis using SSR markers (Table 1).

60
 Table 1. List of resistant and susceptible cowpea lines used in the
study.

Susceptible Resistant
Ordinal Code Code
genotypes genotypes
Standard Chirodi CS GC-3 CR
1 HC97-39 S1 HC98-30 R1
2 HC98-O8 S2 HC98-33 R2
3 HC9B-28 S3 CS88 R3
4 HC2-59 S4 HC98-45 R4
5 HC2-61 S5 HC 98-46 R5
6 HC2-62 S6 HC98-48 R6
7 HC2-69 S7 HC98-50 R7
8 HC2-72 S8 HC98-51 R8
9 HC2-85 S9 HC98-58 R9
10 FC-68 S10 HC98-63 R10
11 HC2-87 S11 HC98-64 R11
12 HC3-2 S12 HC1-3 R12
13 HC3-21 S13 HC2-9 R13
14 HC3-22 S14 HC2-11 R14
15 HC3-25 S15 CPD26-0 R15
16 HC3-29 S16 HC1-10 R16
17 HC3-30 S17 HC1-11 R17
18 HC3-31 S18 HC1-14 R18
19 HC3-39 S19 HC1-15 R19
20 HC3-40 S20 HC1-19 R20

3.1.2 Molecular markers

Sixty SSR primers were used to study identify major QTL(s) for disease
resistance against cowpea yellow mosaic virus in cowpea. The SSR
primers specific for cowpea (Vigna unguiculata; table 2) and moth bean
(Vigna aconitifolia; table 3) were obtained from Life Technologies Pvt. Ltd.
The table 2 and 3 give brief information of these markers.

61
Table 2. Summary of cowpea SSR primer pairs used in the study.
Predicted
Primer 5’-3’ Secquence SSR sequence
size (bp)*
F CACCCGTGATTGCTTGTTG
VM1 (TC)20 135
R GTCCCCTCCCTCCCACTG
F GTAAGGTTTGGAAGAGCAAAGAG
VM2 (AG)32 162
R GGCTATATCCATCCCTCACT
F GAGCCGGGTTCAATAGGTA
VM3 (AG)27 171
R GAGCCAGGGCAGAGGTAGT
F AGTAAATCACCCGCACGATCG
VM4 (CT)20 248
R AGGGGAAATGGAGAGGAT
F AGCGACGGCAACAACGAT
VM5 (AG)32 188
R TTCCCTGCAACAAAAATACA
F GAGGAGCCATATGAAGTGAAAAT
VM6 (AG)26 248
R TCGGCCAGCAACAGATGC
F CGCTGGGGGTGGCTTAT
VM7 (AG)13 158
R AATTCGACTTTCTGTTTACTTG
F TGGGATGCTGCAAAGACAC
VM8 (AG)16 295
R GAAAACCGATGCCAAATAG
F ACCGCACCCGATTTATTTCAT
VM9 (CT)21 271
R ATCAGCAGACAGGCAAGACCA
F TCCCACTCACTAAAATAACCAACC
VM10 (AC)3(CT)10(AC)3 278
R GGATGCTGGCGGCGGAAGG
F CGGGAATTAACGGAGTCACC
VM11 (AT)4..(AC)12 195
R CCCAGAGGCCGCTATTACAC
F TTGTCAGCGAAATAAGCAGAG
VM12 (AG)27 157
R CAACAGCAGACGCCCAACT
F CACCCGTGATTGCTTGTTG
VM13 (CT)21 135
R GTCCCCTCCCTCCCACTG
F AATTCGTGGCATAGTCACAAGAGA
VM14 (AG)24 144
R ATAAAGGAGGGCATAGGGAGGTAT
F CGGCTGCAGCAAACAAGAG
VM15 (AG)4..(GT)10 162
R AAACCCGTGCAAGAAACCAA

62
 F TCCTCGTCCATCTTCACCTCA
VM16 (CT)7…(CT)7 203
R CAAGCACCGCATTAAAGTCAAG
F GGCCTATAAATTAACCCAGTCT
VM17 (CT)12 152
R TGTGTCTTTGAGTTTTTGTTCTAC
F AGCCGTGCACGAATGAT
VM18 (GA)13 257
R TGGCCTCTACAACAACACTCT
F TATTCATGCGTGACACTA
VM19 (AC)7…(AC)5 241
R TCGTGGCACCCCCTATC
F GGGGACCAATCGTTTCGTTC
VM20 (GT)17 246
R ATCCAAGATTCGGACACTATTCAA
F TAGCAACTGTCTAAGCCTCA
VM21 (AT)17 179
R CCAACTTAACCATCACTCAC
F GCGGGTAGTGTATACAATTTG
VM22 (AG)12 217
R GTACTGTTCCATGGAAGATCT
F AGACATGTGGGCGCATCTG
VM23 (CT)16 174
R AGACGCGTGGTACCCATGTT
F TCAACAACACCTAGGAGCCAA
VM24 (AG)15 144
R ATCGTGACCTAGTGCCCACC
F CCACAATCACCGATGTCCAA
VM25 (TC)18 240
R CAATTCCACTGCGGGACATAA
F GGCATCAGACACATATCACTG
VM26 (TC)14 294
R TGTGGCATTGAGGGTAGC
F GTCCAAAGCAAATGAGTCAA
VM27 (AAT)5..(TC)14(AC)3 207
R TGAATGACAATGAGGGTGC
F GAATGAGAGAAGTTACGGTG
VM28 (TC)20 250
R GAGCACGATAATATTTGGAG
F CGTGACACTAATAGTAGTCC
VM29 (TC)11 295
R CGAGTCTCGGACTCGCTT
F CTCTTTCGCGTTCCACACTT
VM30 (TC)10 140
R GCAATGGGTTGTGGTCTGTG
F CGCTCTTCGTTGATGGTTATG
VM31 (CT)16 200
R GAAAAAGGGAGGAACAAGCACAAC
VM32 F GCACGAGATCTGGTGCTCCTT (AG)10 177

63
 R AGCGAAAACACGGAACTGAAATC
F GCACGAGATCTGGTGCTCCTT
VM33 (AG)18(AC)8 270
R CAGCGAGCGCGAACC
F AGCTCCCCTAACCTGAAT
VM34 (CT)14 216
R TAACCCAATAATAAGACACAT
F GGTCAATAGAATGGAAAGTGT
VM35 (AG)11(T)9 127
R ATGGCTGAAATAGGTGTCTGA
F ACTTTCTGTTTTACTCGACAACTC
VM36 (CT)13 160
R GTCGCTGGGGGTGGCTTATT
F TGTCCGCGTTCTATAAATCAGC
VM37 (AG)5(CCT)3 (CT)13 289
R CGAGGATGAAGTAACAGATGATC
F AATGGGAAAAGAAAGGGAAGC
VM38 (AG)10(AC)5 135
R TCGTGGCATGCAGTGTCAG
F GATGGTTGTAATGGGAGAGTC
VM39 (AC)13(AT)5(TACA)4 212
R AAAAGGATGAAATTAGGAGAGCA
F TATTACGAGAGGCTATTTATTGCA
VM40 (AC)18 200
R CTCTAACACCTCAAGTTAGTGATC
*
The predicted size was determined from the sequencing results for the
isolated clones.

Table 3. Summary of moth bean SSR primer pairs used in the study.

Predicted
Primer Accession Primer sequence (5’-3’) SSR sequence
size (bp)*
AG1 CATGCAGAGGAAGCAGAGTG (GA)8GGTA(GA)5
AGB1 132
AF48383 GAGCGTCGTCGTTTCGAT GGGGACG(AG)4
GATS11 CACATTGGTGCTAGTGTCGG (CT)8CA(CT)2GT
AGB2 306
AF48384 GAACCTGCAAAGCAAAGAGC TT (CT)4
GATS11B CCCACACATTGGTGCTAGTG
AGB3 (CT)8 160
AF48384 AGCGCAATGCTACTCGAAAT
GATS54 GAACCTGCAAAGCAAAGAGC (GA)5AACAGAG
AGB4 114
AF48384 TCACTCTCCAACCAGATCGAA T (GA)8

64
 GATS91 GAGTGCGGAAGCGAGTAGAG
AGB5 (GA)17 229
AF48384 TCCGTGTTCCTCTGTCTGTG
BM3 CAGAAGTGCTTATCCCCGAG (GAA)3GATGAA
AGB6 193
AF48384 TGAAATCTTCCCCTCCTTCA (GCA)2(GAA)4
BM6 AGGGTTTACACACGACAGGC
AGB7 (GAAAA)3 153
AF483844 GGTTGATATGCCCTCATGGT
BM16 CACCGGGAGTGGCTGACA
AGB8 (CA)21TA(CA)5 149
AF483845 GTTTGGGGCGGAGTTCGA
BM20 ATCCGTAGAGAGGTGAACGG (CAGA)3GACA
AGB9 146
AF483846 ATGAGTGCAGTTTGGTGCAG (CAGA)12
AGB10 BM25 CGCCTCCAACGGTCTTCT
(CA)17CG(CA)2 227
AF483847 CAAGCAGGTGCGAATCCA
BM48 GCCGTTGAGCTGGAGAGCA
AGB11 (GA)5 232
AF483848 CCTTCTTCTTGAGCCCGCTG
BM53 AACTAACCTCATACGACATGAAA
AGB12 287
AF483849 AATGCTTGCACTAGGGAGTT (CT)21(CA)19(TA)9
BM67 CCAATGCTGCCACACAGATA (CA)31(CG)5
AGB13 289
AF483850 CGCCCTTATGATCCAGTCCT (CA)10
BM68 TTCGTTCACAACCTCTTGCATT (CA)6TA(CA)4
AGB14 170
AF483851 TGCTTGTTATCTTGCCCAGTG (TA)4 (CA)5
CATGGAGGTAGAGGATAATAAG
BM79B
AGB15 GAG (GA)28 125
AF483852 CATTAGAGCCGCCACTTG

65
 BM98 GCATCACAAAGGACTGAGAGC
AGB16 (CA)8(CT)3 247
AF483853 CCCAAGCAAAGAGTCGATTT
BM114 AGCCTGGTGAAATGCTCATAG
AGB17 (TA)8(GT)10 234
AF483854 CATGCTTGTTGCCTAACTCTCT
BM137 CGCTTACTCACTGTACGCACG
AGB18 (CT)33 155
AF483855 CCGTATCCGAGCACCGTAAC
TGTCCCTAAGAACGAATATGGA
BM138
ATC (GT)13
AGB19 203
GAATCAAGCAACCTTGGATCAT
AF483856
AAC
BM139 TTAGCAATACCGCCATGAGAG
AGB20 (CT)25 115
AF483857 ACTGTAGCTCAAACAGGGCAC
*
The predicted size was determined from the sequencing results for the
isolated clones.

3.1.3 Chemicals
Chemicals used for DNA extraction were obtained from Sigma Chemicals
Co. USA and Promega Inc. USA. Taq DNA polymease and dNTPs used
for polymerase reaction were purchased from Biogene, USA, Genetix,
India, Bangalore GENEI, Promega and Life Technologies Pvt. Ltd. Silver
staining kit used in SSRs analysis was obtained from Sigma Chemicals
Co. USA. All other chemicals used in the study were of analytical grade
and purchased from E.Merck, Sisco Research Laboratories, Sigma
Chemicals CO., USA, BDH Chemicals, Hi-media, Life Technologies Pvt.
Ltd. and Bangalore GENEI.

3.2 METHODS
3.2.1 DNA Isolation and Purification
Reagents:
CTAB extraction buffer

66
 Tris (pH 8.0) 0.2M
EDTA (disodium, pH 8.0)* 0.02M
Sodium chloride 1.4M
CTAB** 1.5%
β-Mercaptoethanol 2.0%
(Added prior to use)

TE buffer
Tris (pH 8.0) 10mM
EDTA (pH 8.0) 1mM

Genomic DNA was isolated from the young leaves of 3 to 4 week old
seedlings of cowpea lines (Fig. 4) using CTAB extraction method of
Murray and Thompson (1980) modified by Sanghai-Maroof et al. (1984)
and Xu et al. (1994).

• Leaf samples were taken from the net house and mid-rib was
removed. The leaves were ground into fine powder in liquid
nitrogen using sterilized pestle and mortar.
• 5 grams of ground leaf tissue was mixed with 10ml of CTAB
extraction buffer pre-warmed at 65°C in sterilized 50 ml centrifuge
tubes. The samples were thoroughly mixed by inverting the tubes
several times and were incubated in water bath at 65°C for 1 hour
30 minutes. Contents of the tubes were mixed gently at an interval
of 15 minutes, by inverting the tubes several times.
• After incubation, the samples were cooled to room temperature and
added 10 ml of chloroform: isoamyl alcohol (24: 1) solution. The
samples were mixed by gently inverting the tubes several times,
and centrifuged at 8000 rpm for 10 minutes at room temperature.

67
• The upper aqueous phase was transferred in a clean sterilized
centrifuge tube and again extracted with 6 ml of chloroform:
isoamyl alcohol (24: 1) solution.
• The extracted DNA was precipitated by adding one-tenth volume of
3M sodium acetate (pH 5.2) and equal volume of ice-cold
isopropanol, chill it overnight in refrigerator for complete
precipitation of DNA.
• Centrifuge at 8000 rpm in 10 minutes to pellet down DNA samples.
• Discard supernatant and pellet was washed two times with 70%
alcohol and dried at room temperature by inverted the tubes on
tissue paper subsequently dissolved in appropriate volume of TE
buffer.
*Ethylene diamine tetra acetic acid
**Cetyl trimethyl ammonium bromide

Fig. 4. Young leaves of cowpea suitable stage for DNA isolation

68
Rnase treatment
DNA samples were treated with Rnase A (50µg/ml), if required and
incubated at 37°C for 2-4 hours to remove the RNA contamination from
DNA samples.

Purification of DNA
DNA samples which do not form a clear solution and showed turbidity
were purified by phenolization. The samples were mixed with equal
volume of phenol: chloroform: isoamyl alcohol (25: 24: 1). Contents were
mixed thoroughly until an emulsion was formed. Samples were
centrifuged at 8000 rpm for 10 minutes at room temperature (25°C).
Aqueous phase was transferred to fresh sterilized eppendorf tube and
was extracted with chloroform: isoamyl alcohol (24: 1 v/v). DNA from
aqueous phase was precipitated by adding one-tenth volume of 3M
sodium acetate (pH 5.2) and two volumes of ice-cold ethanol and
incubated at -70°C for 1 hour. DNA was pelleted down by centrifugation
at 8000 rpm for 10 minutes at 4°C. Supernatant was carefully removed
and pellet was washed with 70 per cent ethanol. Sample tubes were kept
open at 37°C until last trace of ethanol had evaporated. The DNA pellet
was dissolved in appropriate volume of TE buffer and stored at -20°C
until further use.

Quantitative of DNA
DNA estimation was done by using an UV-absorbance
spectrophotometer. DNA concentration was estimated by measuring
absorbance (A) at 260 nm. Using the relationship of 1.0 A at 260 nm
equivalent to 50µg DNA per ml, the concentration of DNA was estimated
from the following formula:

Concentration of DNA (µg/ml) = A260 x 50 x dilution factor.

69
Quality of DNA
Quality of DNA sample was checked both by UV-spectrophotometer and
on 0.8 per cent (w/v) agarose gel electrophoresis. Using spectrometer,
the ratio of the absorbance at 260 nm and 280 nm was noted.
A260/A280 = 1.8±0.1 (pure DNA)
For agarose gel electrophoresis, the DNA band should be clear with high
molecular weight and without smearing.

3.2.2 Microsatellite marker analysis

Sixty SSR primer pairs (Table 2, 3) were used to detect polymorphism
between standard resistant (GC-3) and susceptible (Chirodi) cowpea
varieties. The polymorphic markers were then used to carry out PCR for
all individuals of 40 cowpea lines to detect the resistant genes. PCR for
the amplification of template DNA was performed in PTC 100TM thermo-
cycler (MJ Research Inc., Watertown, MA, USA). Total volume of PCR
reactions mixture was kept 20 µl containing 1x PCR buffer, 200 µM
dNTPs, 0.5 µM of primer (both), 2 mM MgCl2, 1.5 unit of Taq polymerase
and 50 ng of template DNA.

PCR conditions for the microsatellite analysis included an initial pre-

denaturation step of three minutes at 94°C and following 30 cycles of
amplification as:
Step Temperature Time

Denaturation 92°C 2 min

Annealing 55°C 1.5 min

Extension 72°C 1.5 min
Final extension was carried out at 72°C for 10 minutes.

70
The amplified fragments were stored at -20°C till further use. PCR
products were then checked on 3% agarose gel or 6% polyacrylamide gel
electrophoresis
3.2.3 Agarose gel electrophoresis
Stock solutions
10X TBE Buffer

Tris 108g
Boric acid 55g
0.5M EDTA 40ml
Final volume 1000ml

6X loading dye
Sucrose 4g
Bromophenol blue 0.025g
Xylene cyanol 0.025g
Volume 10ml
(Loading dye solution was stored at 4°C)
• PCR amplified DNA fragments were resolved in horizontal gel
electrophoresis with 3.0 per cent (w/v) agarose gel and visualized
by ethidium bromide staining.
• Gel casting plate was washed with distilled water and dried. Plate
was wiped with ethanol, air-dried and assembled with rubber ends.
• Prepared agarose solution (3.0 per cent) in 1X TBE buffer and
boiled it in microwave oven. The solution was cooled to about 50-
55°C then added ethidium bromide into the gel at a concentration
of 0.2µg/ml.
• Agarose gel was then poured into the gel casting plate in which
comb of appropriate size had been placed to get the required
number of wells with a gel thickness of 0.5 cm. Gel was allowed to

71
 solidify for 30 minutes. After setting of gel, rubber ends were
removed from the plate.
• Placed the gel in electrophoresis chamber and submerged with 1X
TBE buffer. The comb was removed gently.
• DNA samples were mixed with loading dye solution (1µl/ml), and
loaded in wells using a micropipette.
• Covered the electrophoretic unit and made connection with power
supply.
• Electrophoresis was carried out at constant voltage (3V/cm) of gel
until dye had moved to three-fourth length in the gel.
• PCR amplified products were viewed by fluorescence under UV
light (high UV length 350 nm) using gel documentation system
(Pharmacia Biotech) and saved in computer.

3.2.4 Polyacrylamide gel for electrophoresis

3.2.4.1 Prepare the plates

The glass plates must be meticulously clean. Rinse washed plates
thoroughly in de-ionized water to remove residue and perform a final
ethanol wash of plates.

Short glass plate:

• Prepare fresh binding solution by adding 3 µl of bind silane to 1 ml of
95% ethanol and 3 µl of glacial acetic acid.
• Wipe scrupulously cleaned plate using tissue paper moistened with 1
ml of freshly prepared binding solution. Make sure the plate is
completely covered.
• After 4–5 min, apply approximately 2 ml of 95% ethanol to the tissue
paper, wiping first in one direction and then perpendicular to the first
direction, using gentle pressure. Repeat this wash three times, using

72
 fresh paper towel each time to remove excess binding solution (this
step is essential to prevent contamination from the binding solution,
which could tear the gel).

Long glass plate:

• Change gloves before preparing the long glass plate to prevent cross-
contamination with the binding solution.
• Apply 0.3 ml of SigmaCote on the 15 x 15 cm plate using a
micropipette. Spread the SigmaCote over the plate by circular motion
using tissue paper making sure the entire surface was covered.
• After 5–10 min, remove the excess repellant solution by wiping the
plate with tissue.

3.2.4.2 Prepare the polyacrylamide gel and run electrophoresis:

• Assemble the glass plates ("sandwich-style") just before pouring the
gel. Special care should be taken to prevent leakage and to ensure
uniform pressure of the clamps and adequate combs. Prepare the
"pre-mix" solution using 6% polyacrylamide (19:1) acrylamide:bis-
acrylamide:

Stock Final 1L
Urea 7M 420 g
Acrylamide-Bisacrylamide 6% 57 g – 3 g
10x TBE 1x 50 ml
Milli-Q H2O Up to 1000 ml

• Filter the solution and store it at 4°C in a bottle wrapped in aluminum.

• Prepare the gel with 1 mm spacers as follows:
Polyacrylamide pre-mix solution 20 ml
TEMED 11 µl
10% Ammonium persulfate 110 µl

73
• Pour the gel solution: Make sure there are no bubbles (left a little
polyacrylamide mixture in a tightly eppendorf tube for polymerized
check). If there are any bubbles, position the glass plate sandwich
vertically, and tap the plates gently. Place the combs between the
plates carefully. Let them polymerize horizontally for at least 2 h.

• Pre-run the gel at 500 V for about 1–1.5 hours to equilibrate until the
gel temperature reaches 52°C. Never allow the gel temperature to
exceed 60°C.

• Prepare sequencing loading Dye as following:

Reagents Stock To make 10 ml
Formamide 9.4 ml
0.2 M EDTA 500 ml
Dye 100 ml

Note: Dye = 50 mg xylene cyanol + 50 mg bromophenol dissolved in 1 ml

of distilled H20

• Load the samples: Add sequencing loading dye to each sample.

Denature the DNA by heating at 94°C for 5 min, and chill immediately
on ice. Perform electrophoresis at 400 V for 3–4 h). After
electrophoresis, gels should be dried.

• Carefully separate the glass plates, and the gel attached to the short
glass plate is now ready for silver staining.

3.2.4.3 Silver-Staining the Gel

Prepare the solutions:
• Fixing/stop solution (10% glacial acetic acid): Add 100 ml of glacial
acetic acid to 900 ml of ultra-pure (Milli-Q) or double-distilled water.

74
 • Staining solution: Combine 1 g of silver nitrate (Ag NO3) and 1.5 ml
of 37% formaldehyde in 1 L of ultra-pure water.
• Developing solution: Dissolve 30 g of sodium carbonate (Na2CO3)
in 1 L of ultra-pure water. Chill to 10°C in an ice bath. Immediately
before use add 1.5 ml of 37% formaldehyde and 200 µl of sodium
thiosulfate (10 mg/ml).
Staining
• Fix the gel. Place the plate in a tray with the gel facing upward,
cover with fix/stop solution and agitate well for 20 minutes or until
the tracking dyes are no longer visible. After fixing, save the fix/stop
solution to terminate the developing reaction in the last step.
• Wash the gel twice with ultra-pure water. Wash the gel for 5
minutes with 1 L ultra-pure water and agitation. Lift the plate out of
the water and allow it to drain. Discard the used water and place
the plate back on the tray. Wash again with 1 L ultra-pure water for
5 minutes and shaking.
• Stain the gel. Transfer the plate to the staining solution and agitate
well for 30 minutes.
• Complete the preparation of developing solution by adding the
formaldehyde and sodium thiosulfate to the pre-chilled sodium
carbonate solution, and pour it into a separate tray.
• Remove the gel from the staining solution and set it aside. Transfer
the staining solution into a container for proper disposal. Rinse the
tray and fill it with 1 L ultra-pure water.
NOTE: The timing of the next step is very important. Total time from
when the gel is placed in ultra-pure water to the time it is placed in
developing solution should be no longer than 5-10 seconds. Longer rinse
may result in weak or no signal.

75
 • Rinse the gel. Dip the gel briefly into the tray containing ultra-pure
water, drain, and place the gel immediately into the tray of
developing solution.
• Develop the gel. Agitate the gel by shaking until the bands
become visible. Prolonged development time will result in a high
background.
• Stop the development. Terminate the developing reaction by
adding the fix/stop solution onto the developing solution. Shake
until the bubbles subside. Avoid long incubation as this will fade the
stain.
• Rinse the gel. Wash the gel for 5 minutes in 1 L ultra-pure water.
• Dry the gel. Allow the gel to dry at room temperature on a paper
towel.

3.2.5 Data analysis:

3.2.5.1 Genetic diversity: The polymorphisms were scored as 1 for

visible band and 0 for absence and fed to NTSYSpc (version 2.0) as the
method of Rholf (1998). Genetic diversity of 40 cowpea lines was
analyzed on the basis of the genetic similarity (Jaccard’s coefficient)
using qualitative data function following by clustering/SAHN function for
cluster analyses (Unweighted Paired Group Method Using Arithmetic
Averages) to construct a dendrogram of genetic diversity.

The polymorphism information content (PIC) of each microsatellite was

calculated based on allele pattern of all the genotypes as described by
Weir (1996). PIC = 1-∑Pi2, where Pi is the frequency of the i th allele in the
examine test lines.

76
3.2.5.2 Mapmaker and QTL analysis: To detect linkage group and map
distances between markers loci and markers QTLs association for the
trait of yellow mosaic virus resistance, the map manager QTXb20 version
0.30 was employed.

The search & find linkage function made the linkage markers in the order
loci and calculated the map distances.

Simple linear regression and interval QTL mapping was analyzed using
polymorphic scores coupling with the trait scores of resistance,
susceptible reaction.

Single marker analysis was done based on the simple linear regression
model (Haley & Knott 1992). This single marker analysis served as the
primary method of detecting association between markers and the trait.
Groups of two or more closely linked markers that showed significant
association were assumed to identify the same QTL

To determine the precise location of the putative QTLs, interval mapping

of map manager QTXb20 program was done using Kosambi map function
based on the method of Darvasi and Soller (1997). A LOD score of 2.0
was used as the threshold for detecting QTLs location. Interval analysis
was also used to confirm the results of the single marker analysis.

3.2.6 Cloning of the linked marker

 Cloning of marker closely linked to cowpea yellow mosaic virus

resistance gene was done with QIAGEN cloning kit.
 The amplified product was ligated into a pDrive vector (Figure 4).
 Ligation mixture was prepared as the following scheme:

77
 Component Volume
pDrive vector (50 ng/μl) 0.5μl
PCR product (50 ng/μl) 2.0μl
Ligaton master mix (2X) 0.5μl
Total volume 5.0μl

The mixture was kept at 16oC overnight for ligation. The ligation was
checked on agarose gel

Figure 4: pDrive cloning vector

3.2.7 Transformation of E.coli with recombinant plasmid

3.2.7.1 Preparation of competent cells of E. coli

Reagents:
LB (Luria Bertani) medium
Tryptone 10.0 g
Yeast extract 5.0 g
Sodium acetate 5.0g
Sterilized distilled water up to 1000 ml

78
 PH 7.0

Amount of 30 ml LB broth was distributed into 100ml flask and sterilized

in autoclave for 15 minutes. For solidified medium, 2% of agar was
added.

Competent cells of E. coli were prepared according to the protocol given

by Sambrook et al. (1989) with slight modification.

• Single colony of Escherichia coli strain EZ was inoculated in 2-3 ml LB

broth and incubated overnight on orbital shaker at 37°C. This batch of
cell suspension was then inoculated onto 100 ml flask containing 30
ml fresh LB and again grown for 2-3 hours.
• The culture broth was transferred to sterile centrifuge tube aseptically,
and the cells were pelleted at 8000 rpm in 10 minutes at 4 oC. The
broth was removed and the cells were re-suspended with 5-7 ml of
cold 100 mM calcium chloride (CaCl2) solution.
• Calcium chloride was then removed by 8000 rpm centrifugation for 10
minutes and 5 ml of it was again added to the cell pellet. This was then
mixed and kept on ice for 30 minutes.
• Centrifuge the tube at 3000 rpm for 15 minutes at 4 oC to pellet down
the cells and gently suspended them on 0.2 ml of ice-cold glycerol
(20%) in 100 mM CaCl2. The competent cells can be stored at – 80 °C
for further use.

3.2.7.2 Transformation of E. coli

A slightly modified procedure of Sambrook et al. (1989) was used for
transformation of E.coli competent cells.

79
• For the transformation of the bacterial cells, 1μl ligation mixtures were
added to 50μl of freshly prepared competent cells and kept on ice for
30 minutes.
• Heat shock treatment was given to the cells at 42°C for 2 minutes and
transferred to water bath at room temperature for 5 minutes.
• The cells were then transferred to sterile culture tubes containing
900μl LB medium and incubated at 37°C for 2-3 hours in orbital
shaking.
• Transferred the cell suspension to sterile eppendorf tubes and
centrifuge at 8000 rpm for 10 minutes. Discard supernatant and re-
suspended the cells in remain LB broth.
• Plate 15 µl of transformed cells on solid LB medium supplemented
with 100 µg/ml ampicillin in the order as following: take 10 µl X-gal (40
mg/ml) and spread over the plate, then 2.5 µl IPTG (100 mM) and
spread over the plate, and 15 µl of transformed cells then spread over
the plate.
• The plates were kept at room temperature until the transformation
mixture had absorbed into the agar, then incubated at 37°C overnight.
The second incubation was done at 4°C to facilitate blue/white
screening.

3.2.7.3 Plasmid DNA isolation

Plasmid DNA was isolated using alkaline lysis method. This protocol is
the modification of the method given by Brinboim and Dolly, 1979.

Reagents used:
Solution I
50 mM Glucose
25 mM Tris HCl (pH 8.0)
10 mM EDTA (pH 8.0)

80
 Solution II
0.2 N NaOH (freshly diluted from a 10 N solution)
1% Sodium dodecyl sulphate (SDS)

Solution III
3M Sodium acetate (pH 4.8)

• Single white colony was incubated into 2 ml of LB broth containing

ampicillin (100 µg / ml) in a culture tube and incubated overnight at
37°C with vigorous shaking.
• In the next day, 1.5 ml of the culture was taken in an eppendorf
tube and centrifuged at 5000 rpm for 10 minutes.
• The supernatant was removed and bacterial cell pellet was
resuspended in 100 µl of solution I containing 1 µl/ml of lysozyme
(taken from the 40 mg/ml stock). Then incubated the cell
suspension at 37°C for 10 minutes to digest the cell membrane
releasing cell component including chromosome DNA and plasmid.
• Subsequently, 200 µl of freshly prepared solution II was added,
mixed thoroughly by inverting several times and kept on ice for 10
minutes. This step made denatured all chromosomal DNA and
plasmid DNA in the basic condition of the solution II.
• In the next step, 150 µl of Solution III was added, and mixed
vigorously and then incubated on ice for 30 minutes. With the weak
acid condition of sodium acetate neutralized the base of solution II
and made plasmid DNA re-naturation and remained in solution
while the chromosomal DNA was still denatured (because of high
molecular weight) and pellet down along with the cell debris.
• The content in the tube was centrifuged at 10,000 rpm for 15
minutes, and the supernatant carrying plasmid DNA was
transferred into a new eppendorf tube.

81
 • To precipitate DNA plasmid, the twice volume of ice-cold ethanol or
equal volume of isopropanol and 1/10 volume of Na-acetate was
added and incubated at -20 °C for an hour.
• Centrifuged the tubes at 10,000 rpm for 15 minutes at 4oC and
removed supernatant. The pellet was washed with 70 per cent
ethanol.
• The plasmid DNA pellet was dried and dissolved in TE buffer. The
plasmid was stored at 4°C and checked on 1.2 per cent agarose
gel by electrophoresis.

3.2.8 Re-amplification of fragments closely linked to yellow mosaic

virus disease resistance

 Isolated DNA plasmid samples were used as templates to amplify in

PCR reaction with their original genomic DNA using the same SSR
marker.
 The presence of the insertion bands was checked on 3% agarose gel
with both positive and negative control of resistance and susceptible
PCR products.
.
3.2.9 Sequencing fragments closely linked to yellow mosaic virus
resistance gene
The closely linked markers i.e.,VM31 SSR marker, was commercially got
sequenced from………………..Sequence analysis was done using an
automated DNA Sequencer, which used fluorescent label dye terminators
or fluorescent label primers. ABI’s Ampli Taq FS dye terminator cycle
sequencing chemistry based on dideoxy chain termination method was
used.

3.2.10 Sequence homology analysis

82
 Sequence homology searchers were performed using BLAST
algorithm at http://www.ncbi.nlm.nih.gov of the National Center for
Biotechnology Information (NCBI), with the program BLASTN. Sequence
identity was compared with respect to the number of accessions to which
the clone had most similarity, the putative function of the accession and
the probability value for likelihood that the similarity of association was by
random chance.

83
CHAPTER IV

EXPERIMENT RESULTS

Screening 190 cowpea genotypes in the field condition of Forage

section, Plant Breeding Department in July 2005, observed 100
resistant lines without any disease symptom, 29 moderate
susceptible line with distinct leaf mottling but no detectable reduction
in plant size or seed yield, 22 susceptible line which produced
distinct mottling and leaf distortion with significantly reduced growth
and seed yield, and 39 highly susceptible lines which gave distinct
mottling and severely distorted leaf with plant growth greatly
reduced and few seed produced. From these, 20 resistant lines and
20 susceptible line were used in molecular marker analysis with their
disease incidence were given in the table 4

Symptom of cowpea yellow mosaic virus observed in the field

condition was distinct yellow mosaic, leaf distortion with significantly
reduced growth and pre-mature death of plant. The leaves were
beginning with bright yellow patches interspersed by green areas.
Later on the specks coalesce and form bigger spots with yellow
area and the whole leaves become yellow at the late stage (Fig. 5)

84
 Table 4. The incidence score of 40 selected cowpea genotypes.
Disease Disease
Susceptible Resistant
Ordinal Code incidence Code incidence
genotypes genotypes
score score
Standard Chirodi CS 6 GC-3 CR 0
1 HC97-39 1S 6 HC98-30 1R 0
2 HC98-O8 2S 6 HC98-33 2R 0
3 HC9B-28 3S 6 CS88 3R 0
4 HC2-59 4S 6 HC98-45 4R 0
5 HC2-61 5S 6 HC 98-46 5R 0
6 HC2-62 6S 6 HC98-48 6R 0
7 HC2-69 7S 6 HC98-50 7R 0
8 HC2-72 8S 6 HC98-51 8R 0
9 HC2-85 9S 6 HC98-58 9R 0
10 FC-68 10s 6 HC98-63 10R 0
11 HC2-87 11S 6 HC98-64 11R 0
12 HC3-2 12S 6 HC1-3 12R 0
13 HC3-21 13S 6 HC2-9 13R 0
14 HC3-22 14S 6 HC2-11 14R 0
15 HC3-25 15S 6 CPD26-0 15R 0
16 HC3-29 16S 6 HC1-10 16R 0
17 HC3-30 17S 6 HC1-11 17R 0
18 HC3-31 18S 6 HC1-14 18R 0
19 HC3-39 19S 6 HC1-15 19R 0
20 HC3-40 20S 6 HC1-19 20R 0

85
Fig. 5 symptom of the CYMV disease in cowpea at the late stage

4.1 Genomic DNA isolation and quantification

Forty cowpea lines were grown in the net house of Biotechnology
and Molecular Biology Department. Genomic DNA was isolated
from the young leaves of 3-4 week old seedlings using modified
CTAB extraction method. The quantity and quality of extracted
genomic DNA was checked both by 0.8 percent agarose gel
electrophoresis and spectrophotometer.

The agarose gel electrophoresis gave a discrete single band of high

molecular weight DNA without smearing. This showed that the
genomic DNA of all the genotypes was intact and good quality (Fig.
6&7).

86
Spectrophotometric determination was done at the UV absorbance
of 260 and 280 nm. The ratio of absorbance at 260 and 280 nm was
used to determine the quality of DNA extraction. This ratio is equal
to 1.8 ± 1 for the pure DNA without contaminants like RNA,
polyphenols, polysaccharides, proteins etc. For this, almost DNA
samples were good quality except some of them contaminated with
RNA (HC97-39, HC2-72, HC98-51, HC1-19 and HC1-14) or proteins
(HC2-59, HC 98-46, HC98-58, HC98-63, HC2-9, HC1-10 and HC1-
15) (table 5&6). They were then purified with RNase treatment or
phenolization.

The reading absorbance at 260 nm was used to calculate the

quantity of DNA. It was found that CTAB extraction protocol yielded
good quantity of DNA, which ranged between 1414 to 9908 ng/µl for
20 susceptible cowpea lines (table 5) and from 1505 to 5500 ng/µl
for 20 resistant cowpea lines (table 6). They were then diluted to
equal concentration before further analysis using SSR markers.

87
 Table 5. Quantification of DNA from 20 susceptible genotypes
Quality of DNA DNA Conc.
Ordinal Genotypes Code
(A260/A280) (ng/µl)
1 HC97-39 S1 1.951 7,664.5
2 HC98-08 S2 1.848 3,464.8
3 HC9B-28 S3 1.832 3,761.2
4 HC2-59 S4 1.650 1,414.7
5 HC2-61 S5 1.709 3,024.6
6 HC2-62 S6 1.822 1,542.5
7 HC2-69 S7 1.819 9,276.2
8 HC2-72 S8 1.934 5,889.5
9 HC2-85 S9 1.885 7,582.8
10 FC-68 S10 1.769 2,041.3
11 HC2-87 S11 1.806 9,908.1
12 HC3-2 S12 1.884 4,776.5
13 HC3-21 S13 1.877 6,129.1
14 HC3-22 S14 1.876 7,991.1
15 HC3-25 S15 1.876 5,087.2
16 HC3-29 S16 1.818 8,780.9
17 HC3-30 S17 1.841 8,828.9
18 HC3-31 S18 1.812 8,924.7
19 HC3-39 S19 1.846 8,566.2
20 HC3-40 S20 1.853 5,349.9

88
 Table 6. Quantification of DNA from 20 resistance genotypes

Quality of DNA DNA Conc.

Ordinal Genotypes Code
(A260/A280) (ng/µl)
1 HC98-30 R1 1.685 3,665.0
2 HC98-33 R2 1.851 3,100.0
3 CS88 R3 1.788 3,115.0
4 HC98-45 R4 1.783 4,935.0
5 HC 98-46 R5 1.650 4,430.0
6 HC98-48 R6 1.727 4,995.0
7 HC98-50 R7 1.812 3,660.0
8 HC98-51 R8 1.959 2,645.0
9 HC98-58 R9 1.508 1,810.0
10 HC98-63 R10 1.573 3,600.0
11 HC98-64 R11 1.745 5,355.0
12 HC1-3 R12 1.762 2,850.0
13 HC2-9 R13 1.617 2,870.0
14 HC2-11 R14 1.791 1,505.0
15 CPD26-0 R15 1.851 2,470.0
16 HC1-10 R16 1.559 3,250.0
17 HC1-11 R17 1.876 3,715.0
18 HC1-14 R18 1.906 3,795.0
19 HC1-15 R19 1.607 4,935.0
20 HC1-19 R20 1.936 5,500.0

89
 CS S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 M

S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 M

Figure 6. Electrophoretic pattern of purified genomic DNA of 20

susceptible cowpea genotypes:
Lane M: 1kb DNA ladder;
CS: check (standard) sus. variety,
S1-S20 are 20 susceptible genotypes

90
 CR R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 M

R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 M

Figure 7. Electrophoretic pattern of purified genomic DNA of 20 resistant

cowpea genotypes:
Lane M: 1kb DNA ladder;
CS: check (standard) resistant variety,
S1-S20 are 20 resistant genotypes

91
4.2 Polymorphic detection using SSR markers
To detect polymorphism between resistant and susceptible cowpea
genotypes, genomic DNA of standard resistant variety (GC-3) and
susceptible variety (Chirodi) were used as template for SSR
analysis. Among 60 SSR markers used, 40 cowpea specific SSR
primer pairs produced amplification, 20 moth bean SSR primer pairs
were fail to give amplification except two primer pairs (AGB1 and
AGB16). These 42 SSR primer pairs produced 110 amplified
fragments, in which only 9 polymorphic bands were obtained (table
7). The number of alleles ranged from one (monomorphic primer
pair) to seven (VM33) with their polymorphic alleles, monomorphic
alleles and polymorphism information content (PIC) were listed in the
table 8.

Out of 42 amplified SSR primer pairs, four SSR markers gave clearly
polymorphic bands on the gel were used to analyze 40 cowpea
genotypes (Fig. 8). Among these, VM31 and VM3 primer pairs
produced polymorphism in bands size. For VM31 primer pairs, 200
bp band was detected in resistant genotype and 180 bp band
observed in susceptible genotype. The same as VM3 primer pairs,
180bp and 160bp were observed in resistant and susceptible
genotypes, respectively. In case of VM1 and ABG1 primer pairs,
they gave differences in the presence or absence of extra DNA
bands (an extra band obtained for susceptible genotype in compared
to resistant genotype).

The representative photographs of electrophoretic gels showing DNA

banding patterns after amplification are shown in Figures 9-12 in
which some clearer banding patterns were resolved in
polyacrylamide gel (Fig 9b, Fig. 10b).

92
Polymorphisms detected by VM31 were observed with 16 resistant
bands (200 bp) out of 20 resistant genotypes checked (fig. 9). Three
resistant genotypes HC98-48, HC98-63 and HC1-15 (R6, R10 and
R19, respectively) gave heterozygous bands (one band was
missing). This showed the pattern of dominant effect of a resistant
gene. Among 20 susceptible genotypes, 18 susceptible bands (180
bp) were obtained; one heterozygous band HC2-87 (S11) was
observed (one missing band).

In case of moth bean designed SSR marker, AGB1 (AG1/AF48383),

17 susceptible bands (100 bp band presence) out of 20 susceptible
genotypes analysis were observed; Three resistant bands HC98-O8,
HC2-62 & FC-68 (100 bp band absence) were produced (fig. 10) In
the other group of 20 resistant genotypes, 15 resistant bands were
obtained; Three susceptible bands HC98-50, HC98-63 and HC1-10
(R7, R10 & R16, respectively) were observed (2 bands missing).

At VM1 SSR locus, 18 susceptible bands (250 bp band presence)

obtained from 20 susceptible genotypes; two resistant bands HC2-61
and HC2-69 (without 250 bp band) were observed (fig 11).
Seventeen resistant bands produced in 20 resistant genotypes
investigated; three susceptible bands, HC98-48, HC98-51 and HC1-
11 (R6, R8 & R17, respectively), were obtained.

Using VM3 primer pairs, two susceptible bands (160 bp), HC98-48
and HC98-51 (R6, R8), out of 20 resistant genotypes were amplified;
two genotypes (HC 98-46, HC98-63) produced heterozygous bands,
and 13 resistant bands were obtained (three missing bands). Three
susceptible bands (FC-68, HC3-29 and HC3-31), four heterozygous
bands (HC97-39 HC3-21, HC3-22 & HC3-25) and 13 resistant bands
were amplified from 20 susceptible genotypes (fig 12)

93
Table 7. SSR primers used for screening CYMV polymorphism among 40
cowpea lines
Primers Number
Total primers used 60
Primers which showed amplification 42
Primers which produced polymorphism 4
Primers which produced monomorphism 38
Total fragments amplified 110
Total number of monomorphic bands 101
Total number of polymorphic bands 9

Table 8. Polymorphic studies revealed by SSR primer pairs

Total Percent
SSR Polymorphi Monomorphic PIC
No. of polymorphis
primers c alleles alleles value
alleles m
VM1 3 2 1 66.7 0.72
VM2 3 0 3 0.0 0.00
VM3 2 2 0 100.0 0.30
VM4 4 0 4 0.0 0.00
VM5 3 0 3 0.0 0.00
VM6 3 0 3 0.0 0.00
VM7 2 0 2 0.0 0.00
VM8 3 0 3 0.0 0.00
VM9 2 0 2 0.0 0.00
VM10 3 0 3 0.0 0.00
VM11 5 0 5 0.0 0.00
VM12 5 0 5 0.0 0.00
VM13 3 0 3 0.0 0.00
VM14 6 0 6 0.0 0.00
VM15 6 0 6 0.0 0.00
VM16 3 0 3 0.0 0.00
VM17 1 0 1 0.0 0.00
VM18 3 0 3 0.0 0.00
VM19 1 0 1 0.0 0.00
VM20 2 0 2 0.0 0.00
VM21 1 0 1 0.0 0.00
VM22 1 0 1 0.0 0.00
VM23 1 0 1 0.0 0.00
VM24 2 0 2 0.0 0.00
VM25 1 0 1 0.0 0.00

94
VM26 3 0 3 0.0 0.00
VM27 2 0 2 0.0 0.00
VM28 2 0 2 0.0 0.00
VM29 2 0 2 0.0 0.00
VM30 5 0 5 0.0 0.00
VM31 2 2 0 100.0 0.45
VM32 2 0 2 0.0 0.00
VM33 7 0 7 0.0 0.00
VM34 1 0 1 0.0 0.00
VM35 1 0 1 0.0 0.00
VM36 2 0 2 0.0 0.00
VM37 2 0 2 0.0 0.00
VM38 2 0 2 0.0 0.00
VM38 1 0 1 0.0 0.00
VM40 2 0 2 0.0 0.00
AGB1 4 3 1 75.0 0.67
AGB16 1 0 1 0.0 0.00

95
 M CR CS CR CS CR CS CR CS

VM31 VM1 AGB1 VM3

Figure 8. Polymorphic pattern of VM31, VM1, AGB1 & VM3 PCR

products between 2 standard resistant and susceptible varieties.
Lane M: 100bp ladder;
CR: check (standard) resistant variety (GC-3)
CS: check (standard) susceptible variety (Chirodi)

96
 M R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 S1 S2 S3 S4 S5 S6 S7 S8 S9 M

M R11 R12 R13 R14 R15 R16 R17 R18 R19 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20 M

Figure 9a. Electrophoresis pattern of PCR amplified fragments of 20

susceptible & 20 resistant genotypes with SSR marker VM31
Lane M: 100bp DNA ladder;
Upper lanes R1-10: resistant genotypes, S1-9: susceptible genotypes
Lower lanes R11-19: resistant genotypes; S11-20: susceptible
genotypes (some data was missing)

97
 M R11 R12 R13 R14 R15 S11 S12 S13 S14 S15 S16 S17 S18

200 bp
180 bp

Figure 9b. Electrophoresis pattern of PCR amplified fragments of 5

resistant & 8 susceptible genotypes with SSR marker VM31
Lane M: 100bp DNA ladder;
Lanes R11-15: resistant genotypes,
S11-18: susceptible genotypes

98
 M R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10

100 bp

M R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20

100 bp

Figure 10a. Electrophoresis pattern of PCR amplified fragments of 20

susceptible & 20 resistant genotypes with SSR marker AGB1
Lane M: 100bp DNA ladder;
Upper lanes R1-10: resistant genotypes, S1-10: susceptible genotypes
Lower lanes R11-20: resistant genotypes; S10-20: susceptible genotypes.

99
M R11 R12 R13 R14 R15 R16 R17 S11 S12 S13 S14 S15 S16

Figure 10b. Electrophoresis pattern of PCR amplified fragments of 7

resistant & 6 susceptible genotypes with SSR marker AGB1

Lane M: 100bp DNA ladder;

lanes R11-17: resistant genotypes,
S11-16: susceptible genotypes

100
 M R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10

250 bp

M R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20

250 bp

Figure 11. Electrophoresis pattern of PCR amplified fragments of 20

resistant & 20 susceptible genotypes with SSR marker VM1
Lane M: 100bp DNA ladder;
Upper lanes R1-10: resistant genotypes, S1-10: susceptible genotypes
Lower lanes R11-20: resistant genotypes; S10-20: susceptible genotypes.

101
R1 R2 R3 R4 R5 R6 R7 R8 R9 R10 S1 S2 S3 S4 S5 S6 S7 S8 S9 S10

R11 R12 R13 R14 R15 R16 R17 R18 R19 R20 S11 S12 S13 S14 S15 S16 S17 S18 S19 S20

Figure 12. Electrophoresis pattern of PCR amplified fragments of 20

resistant & 20 susceptible genotypes with SSR marker VM3
Lane M: 100bp DNA ladder;
Upper lanes R1-10: resistant genotypes, S1-10: susceptible genotypes
Lower lanes R11-20: resistant genotypes; S10-20: susceptible genotypes.

102
4.3 Allele scoring and cluster analysis
The amplified fragments were sized by comparing with lambda
DNA Hind III digest marker. The size of PCR-amplified fragments
ranged from 30 bp to 700 bp. These alleles were binary coded as 1
or 0 for the presence or absence. All the data analyses were
performed using the software package NTSYSpc (Rhoif, 1998).
Pairwise similarity indices among all the pairs of genotypes for
SSRs were calculated by using ‘Simqual’ sub-program of software
NTSYS-pc. The similarity indices for 40 cowpea genotypes
extracted in two groups of 20 susceptible and 20 resistant
genotypes (Table 9 & 10).

The similarity indices for 20 susceptible genotypes ranged from

0.33 to 1.00 but concentrated around 0.75 to 1.00 (Table 9)
indicating high genetic similarity among the susceptible genotypes.
The maximum distance pair observed between FC-68 & HC3-40
(10S & 20S) with similarity index only 0.333. Two genotypes had
lowest similarity indices with all other genotypes were FC-68 and
HC3-29, which ranged from 0.333 to 0.750 for FC-68 and 0.375 to
0.875 for HC3-29 genotypes.

Almost the similarity indices for 20 resistant genotypes ranged

from 0.625 to 1.000 (Table 10) indicating genetic similarity among
the resistant genotypes also very high except some pairwises had
similarity indices from 0.250 to 0.375 [HC98-51 & HC98-63 (8R &
10R), HC98-51 & HC98-50 (8R & 7R) and HC98-50 & HC98-48
(7R & 6R)]. Many genotypes pairs had similarity indices 1.0 or
100% similarity which were more clearly observed in dendrogram
of clustering analysis.

103
The cluster analysis was based on similarity matrices obtained
with the Unweighted Pair Group Method Using Arithmetic Averages
(UPGMA) clustering algorithm. The UPGMA cluster tree identified
two major clusters (Fig. 13). The resemblance efficient between
the genotypes is the value at which their branches join.

Among 20 resistant cowpea lines, 18 lines shared 77% to 100%

similarity, in which 10 cowpea lines are 100% similarity. These 10
genotypes were HC98-30, CS88, HC98-45, HC98-58, HC98-64,
HC1-3, HC2-9, HC2-11, CPD26-0 and HC1-14 (R1, R3, R4, R9,
R11, R12, R13, R14, R15 and R18, respectively).

From 20 susceptible cowpea lines, 2 small groups are separated

with 75% similarity among 12 cowpea lines (HC97-39, HC9B-28,
HC2-59, HC2-72, HC2-85, HC98-08, HC2-62, HC2-61, HC2-69,
HC3-40, HC2-87, HC3-21) and 71% similarity for 7 cowpea lines
(HC3-25, HC3-39, HC3-22, HC3-30, HC3-2, HC3-31, HC3-29).
These 2 groups shared 65% similarity with each others.

The third separated group was 2 resistant lines (HC98-48 and

HC98-51) and 1 susceptible lines (FC-68) shared 45% similarity
with the resistant group.

The same pattern of similarity between resistant and susceptible

group were observed in two-dimensional (Fig. 14) and three-
dimensional (Fig. 15) views of dendrogram. There were also two
separated groups of resistant and susceptible genotypes on the
dendrogram with resistant genotypes HC1-19
HC98-33, HC1-10, HC1-11, HC1-14 and HC1-15 (R20, R2, R16,
R17, R18 and R19, respectively) lying nearer to each other in one
group, and the susceptible genotype HC2-62, HC2-72, HC2-85,

104
HC2-87, HC3-22, HC3-25, HC3-30, HC3-31, HC3-39 and HC3-40
(S6, S8, S9, S11, S14, S15, S17, S18, S19 and S20, respectively).
HC98-48, HC98-51, HC98-63, FC-68 and HC3-29 (R6, R8, R10,
S10 and S16) were separated with these two groups.

105
Table 9: Similarity matrIx data (NTSYS-PC) of 40 cowpea genotypes obtained using the allelic diversity
data of 4 SSR loci (a part of 20 susceptible genotypes pairwise)
1S 2S 3S 4S 5S 6S 7S 8S 9S 10S 11S 12S 13S 14S 15S 16S 17S 18S 19S 20S
1S 1.000
2S 0.875 1.000
3S 1.000 0.875 1.000
4S 1.000 0.875 1.000 1.000
5S 0.875 0.750 0.875 0.875 1.000
6S 0.875 1.000 0.875 0.875 0.750 1.000
7S 0.875 0.750 0.875 0.875 1.000 0.750 1.000
8S 1.000 0.875 1.000 1.000 0.875 0.875 0.875 1.000
9S 1.000 0.875 1.000 1.000 0.875 0.875 0.875 1.000 1.000
10s 0.625 0.750 0.625 0.625 0.500 0.750 0.500 0.625 0.625 1.000
11S 0.750 0.625 0.750 0.750 0.625 0.625 0.625 0.750 0.750 0.375 1.000
12S 0.750 0.625 0.750 0.750 0.625 0.625 0.625 0.750 0.750 0.375 0.750 1.000
13S 0.875 0.750 0.875 0.875 0.750 0.750 0.750 0.875 0.875 0.500 0.875 0.875 1.000
14S 0.750 0.625 0.750 0.750 0.625 0.625 0.625 0.750 0.750 0.625 0.750 0.750 0.875 1.000
15S 0.750 0.625 0.750 0.750 0.625 0.625 0.625 0.750 0.750 0.625 0.500 0.750 0.625 0.750 1.000
16S 0.500 0.375 0.500 0.500 0.375 0.375 0.375 0.500 0.500 0.625 0.500 0.750 0.625 0.750 0.750 1.000
17S 0.875 0.750 0.875 0.875 0.750 0.750 0.750 0.875 0.875 0.750 0.625 0.625 0.750 0.875 0.875 0.625 1.000
18S 0.625 0.500 0.625 0.625 0.500 0.500 0.500 0.625 0.625 0.500 0.625 0.875 0.750 0.625 0.625 0.875 0.500 1.000
19S 0.625 0.500 0.625 0.625 0.500 0.500 0.500 0.625 0.625 0.500 0.625 0.875 0.750 0.875 0.875 0.875 0.750 0.750 1.000
20S 0.833 0.666 0.833 0.833 0.666 0.666 0.666 0.833 0.833 0.333 1.000 0.833 1.000 0.833 0.500 0.500 0.666 0.666 0.666 1.000

106
Table 10: Similarity matrIx data (NTSYS-PC) of 40 cowpea genotypes obtained using the allelic diversity
data of 4 SSR loci (a part of 20 resistant genotypes pairwise)
1R 2R 3R 4R 5R 6R 7R 8R 9R 10R 11R 12R 13R 14R 15R 16R 17R 18R 19R 20R
1.00
1R 0
0.87 1.00
2R 5 0
1.00 0.87 1.00
3R 0 5 0
1.00 0.87 1.00 1.00
4R 0 5 0 0
0.87 0.75 0.87 0.87 1.00
5R 5 0 5 5 0
0.50 0.37 0.50 0.50 0.62 1.00
6R 0 5 0 0 5 0
0.87 0.75 0.87 0.87 0.75 0.37 1.00
7R 5 0 5 5 0 5 0
0.50 0.62 0.50 0.50 0.62 0.75 0.37 1.00
8R 0 5 0 0 5 0 5 0
1.00 0.83 1.00 1.00 1.00 0.66 0.83 0.66 1.00
9R 0 3 0 0 0 6 3 6 0
0.75 0.62 0.75 0.75 0.62 0.50 0.87 0.25 0.66 1.00
10R 0 5 0 0 5 0 0 0 6 0
1.00 0.87 1.00 1.00 0.87 0.50 0.87 0.50 1.00 0.75 1.00
11R 0 5 0 0 5 0 5 0 0 0 0
1.00 0.87 1.00 1.00 0.87 0.50 0.87 0.50 1.00 0.75 1.00
1.000
12R 0 5 0 0 5 0 5 0 0 0 0
1.00 0.83 1.00 1.00 1.00 0.66 0.83 0.66 1.00 0.66 1.00 1.000 1.00
13R 0 3 0 0 0 6 3 6 0 6 0 0 0
14R 1.00 0.87 1.00 1.00 0.87 0.50 0.87 0.50 1.00 0.75 1.00 1.000 1.00 1.00

107
 0 5 0 0 5 0 5 0 0 0 0 0 0
1.00 0.87 1.00 1.00 0.87 0.50 0.87 0.50 1.00 0.75 1.00 1.00 1.00 1.00
15R 1.000
0 5 0 0 5 0 5 0 0 0 0 0 0 0
0.87 0.75 0.87 0.87 0.75 0.37 1.00 0.37 0.83 0.87 0.87 0.83 0.87 0.87 1.00
16R 0.870
5 0 5 5 0 5 0 5 3 5 5 3 5 5 0
0.87 0.75 0.87 0.87 0.75 0.62 0.75 0.62 0.83 0.62 0.87 0.83 0.87 0.87 0.75 1.00
17R 0.875
5 0 5 5 0 5 0 5 3 5 5 3 5 5 0 0
1.00 0.87 1.00 1.00 0.87 0.50 0.87 0.50 1.00 0.75 1.00 1.00 1.00 1.00 0.87 0.87 1.00
18R 1.000
0 5 0 0 5 0 5 0 0 0 0 0 0 0 5 5 0
0.83 0.66 0.83 0.83 0.83 0.83 0.66 0.50 0.83 0.83 0.83 0.83 0.83 0.83 0.66 0.66 0.83 1.00
19R 0.833
3 6 3 3 3 3 6 0 3 3 3 3 3 3 6 6 3 0
0.83 0.66 0.83 0.83 1.00 0.66 0.66 0.50 1.00 0.66 0.83 1.00 0.83 0.83 0.66 0.66 0.83 1.00 1.00
20R 0.833
3 6 3 3 0 6 6 0 0 6 3 0 3 3 6 6 3 0 0

108
Fig. 13. Phylogenetic relationship of the 40 cowpea lines constructed
using four microsatellite polymorphisms.

109
Fig. 14. Two-dimension principle coordinate analysis of the 40 cowpea
lines

110
Fig. 15. Genetic similarity among 40 cowpea genotypes revealed by
three-dimensional view of dendrogram.

111
4.4 Map maker and QTL mapping
4.4.1 Map maker analysis

Similarity analysis confirmed the uniform of the resistant and

susceptible populations and showed enough confidence for further
map maker and QTL analysis.

The polymorphic scores of SSR makers were fed to the map

manager QTXb20 to analyze linkage group and map distances. The
search & find linkage function made the linkage markers in the
order loci and calculated the map distances (figure 16) with the
detail information loaded in the stat window.

The statistics displayed in the window are the following:

• Res: The number of progeny with the resistant genotype at this locus.
• Het: The number of progeny with the heterozygote genotype at this locus.
• Sus: The number of progenies with the susceptible genotype at
this locus

• X: The number of crossovers for this interval (does not include

crossovers whose position is ambiguous because of missing da -
ta).
• N: The number of informative loci for this interval.
• Map: The map distance for this interval calculated using the
mapping function.

112
• SE: The standard error of the map distance for this interval.
• Low: The lower limit of the 95% confidence interval for the map
distance.
• High: The upper limit of the 95% confidence interval for the map
distance.
• LOD: The LOD linkage of the markers flanking this interval.

The number of progenies in both resistant and susceptible

population was so much variation between four SSR loci. The
resistant progenies were maximal observed at VM3 locus (26) and
minimal at VM31 locus (16). Some heterozygote progenies were
also observed at VM31 and VM3 loci (4 and 6, respectively). The
number of susceptible genotypes was variation from 5 to 21
progenies with the maximum observed at VM1 locus (21), and
minimum was at VM3 locus (5). The map distances were
constructed at p=0.05 with 4 loci covered 88.6cM calculated from 40
progenies with 53 crossover (Fig. 14). The LOD scores for two
intervals detected closely linkage with CYMV resistant trait were 8.3
between AGB1 & VM31 and 8.5 between VM31 & VM1.

113
Figure 16. Distances of 4 SSR markers in total length of 88.6 cM map
calculated over 40 progenies.

4.4.2 QTL mapping analysis

These polymorphic markers scores were also used to analyze
simple linear regression, and interval QTL mapping along with the
trait scores of resistant and susceptible reaction. The linear
regression function calculated the likelihood ratio statistic (LRS) for
the association of the trait with the loci, the probability of an
association and estimate of the 95% confidence interval size for a
QTL (CI). The detail information was summarized in Marker
Regression report. The interval QTL mapping function estimated
probability of the resistance trait with the interval loci distances of
SSR markers (fig. 17)

114
 Stat: The likelihood ratio statistic (LRS) for the association of the
trait with this locus.
 %: The difference between the total trait variance and the
residual variance, expressed as a percent of the total variance.
 P: The probability of an association this strong happening by
chance.
 CI: An estimate of the size of a 95% confidence interval for a
QTL of this strength, using the estimate of Darvasi and Soller
(1997).
 Dom: The dominance regression coefficient for the association.

The marker regression function calculated the highest likelihood

ratio statistic (46.9) and smallest CI (19 cM) at VM31 locus that
means 95% confidence interval for the QTL of CYMV resistant trait
was mapped within 19 cM around VM31 locus with 46.9 likelihood
ratio statistic. The interval QTL mapping estimated 98.4% of the
resistant trait was mapped within the interval of three loci AGB1,
VM31 & VM1 covered 32.1 cM (Fig. 17).

115
Figure 17. Interval QTL map of 4 SSR markers in the chromosome

4.5 Cloning of the linked marker

For all of the above advantages, VM31 locus was selected to clone
into Escherichia coli using QIGEN cloning kit. The transformed
E.coli cells were screening in blue and white method. The non
recombinant cells gave the blue colony while the white colonies
were given by the recombinant cell with the DNA insertion (figure
18)

116
 White colony

Blue colony

Figure 18. Transformed E.coli cells with recombinant plasmid

having SSR primer VM31 amplified product

4.6 Plasmid isolation and re-amplification of recombinant plasmid

The white colonies were selected and cultured overnight at 37 o C in
LB broth supplementation with Ampicillin (100μg/l) for alkaline lysis
method in the next day. Plasmid isolation was done and checked on
1.2% gel electrophiresis (Fig. 19). The plasmid DNA of the two
clones presented different banding size but both of them were good
quality for further analysis to confirm the presence of the insert in
recombinant plasmid.

To confirm the presence of DNA insertion in the plasmid, 2µl of

each plasmid clones were used as templates for PCR reaction
along with their origin genomic DNA from resistant and susceptible
genotype using the same SSR marker (VM31). The presence of

117
PCR products of plasmid in both 2 clones were checked on 3%
agarose gel with both positive control from the resistant and
negative control from susceptible genotype (figure 20). The PCR
products of both plasmid clones showed the same band with their
control of genomic DNA amplification products.

M 1 2 3 4 5 6 7 8

Figure 19. Electrophoretic pattern of DNA plasmids isolated from

resistant and susceptible clones
• Lane M: 100bp DNA ladder,
• Lane1-5: DNA plasmids isolated from resistant clones,
• lane 6-8: DNA plasmids isolated from susceptible clones.

118
Figure 20. Electrophoretic pattern of PCR products from recombinant
plasmids and their relative genomic DNA;
• Lane M: 100bp DNA ladder,
• Lane1: PCR product of genomic susceptible genotype,
• lane 2: PCR product of plasmid DNA with the insertion of susceptible
genotype,
• Lane 3: PCR product of genomic resistant genotype,
• lane 4: PCR product of plasmid DNA with the insertion of resistant
genotypes

119
CHAPTER V

DISCUSSIONS

Recently uses of DNA-based genetic markers have been extensively

utilized as genetic markers for assessment of genetic diversity,
cultivar identification and gene tagging. Introducing novel genes for
agronomic traits such as yield, quality traits, disease resistance and
abiotic stress tolerance facilitates the improvement of any crop
species. These new genes are most successfully gleaned from the
primary gene pool of the crop of interest. Many plant breeders are
concerned that genetic diversity within such primary gene pools has
been decreasing at an alarming rate as a consequence of modern
agricultural practices (Lee, 1995).

Biotechnological approaches are of immense importance for

improving breeding programmes in crop plants. With the aid of
molecular techniques, it is possible to transfer desirable genes and
to introduce novel genes from related wild species (Mohan et al,
1997). In the recent years, progress has been made in mapping and
tagging of genes for agronomically important traits that form the
foundation of marker-assisted selection (MAS). RAPD coupled with
bulked segregant analysis has been successfully used to map and
tag genes for disease resistance in many crop species like wheat (Qi
et al., 1996), barley (Horvath et al., 1995), sorghum (Gowda et al.,
1995; Boora et al., 1998) and cowpea (Ouedraogo et al. 2002). In
order to increase the reliability and specificity of RAPD markers,
they have been converted into sequence characterized amplified
regions (SCARs) (Martin et al., 1991, Boora et al., 1999).

120
Microsatellites being abundant and occurring frequently in all
eukaryotic nuclear DNA have also been used to construct genetic
maps in humans (Weissenbach et al., 1992) and plants (Morgante et
al., 1994). Their high information content make them an ideal marker
and now simple sequence repeat polymorphism (SSRP) is gaining
popularity in plant genetic diagnostics and gene pyramiding of
desirable traits.

In view of these, present investigation was carried out for

assessment of the genetic basis of cowpea yellow mosaic virus
resistance in cowpea using microsatellites markers, mapping of
cowpea yellow mosaic virus resistant genes in cowpea, identifying
quantitative trait loci (QTLs) for resistance to cowpea yellow mosaic
virus and cloning microsatellite markers linked to cowpea yellow
mosaic virus resistance in cowpea.

5.1 Genotype analysis of cowpea using SSR markers

Microsatellite markers have shown high levels of polymorphism in

many important crops including rice (Oryza sativa L., Chen et al.,
1997), wheat (Triticum aestivum L., Devos et al., 1995; Roder et al.,
1995), barley (Hordeum vulgare L., Liu et al., 1996), oat (Avena
sativa L., Li et al., 2000), maize (Zea mays L., Senior et al., 1998),
sorghum [Sorghum bicolor (L.) Moench, Brown et al., 1996], soybean
[Glycine max (L.) Merr., Akkaya et al., 1992], beans (Phaseolus and
Vigna, Yu et al., 1999), Brassica species (Szewc-McFadden et al.,
1996), alfalfa (Medicago spp., Diwan et al., 1997), sun-flower
(Helianthus annuus L., Brunel, 1994), tomato (Lycopersicon
esculentum Mill., Smulders et al., 1997), and cowpea (Vigna
unguiculata L. Walp, Li et al., 2001).

The present study showed that microsatellite markers could also be

used to distinguish CYMV resistant lines in cowpea. In fact, four

121
polymorphic microsatellites were able to distinguish 13 to 17
resistant lines out of the 20 resistant genotypes. All the microsatellite
primer pairs of cowpea could successfully amplify DNA from 40
cowpea lines in the present study. Furthermore, two microsatellite
primer sets designed from the sequences of moth bean
(AG1/AF48383 and BM98/AF483853; AGB1 and AGB16) were able
to amplify DNA of cowpea in which AG1/AF48383 (AGB1) could
distinguish 15 resistant lines in 20 resistant genotypes investigated.
Therefore, microsatellite markers of cowpea could be used to detect
CYMV resistant genes and map these genes to cowpea linkage map.
In addition, these microsatellite primers could be used for
comparative genome analysis between the different Vigna species.

Cowpea is predominantly self-fertilize crop and most variants

appeared to be homozygous. However, heterozygous individuals
may occur due to out crossing or residual heterozygosity. Plaschke
et al. (1995) detected heterozygosity in wheat (a self-fertilize crop)
and explained that detected heterozygous genotypes were probably
due to heterogeneity rather than the genetic heterozygosity. Roder et
al. (1998) reviewed that multiple alleles in wheat are homoeologous
or non-homoeologus amplified products. The present study also
detected 4 and 6 heterozygosity at VM31 and VM3 loci, respectively.

Microsatellite markers have been used to investigate genetic

diversity of a large number of cultivars in rice (Yang et al., 1994),
soybean (Rongwen et al., 1995), wheat (Plaschke et al., 1995),
maize (Senior et al., 1998), and cowpea (Li et al., 2001). The number
of alleles amplified per primer pair was from 3 to 25 for rice, 11 to 26
for soybean, 3 to 16 for wheat, 2 to 23 for maize and 2 to 7 for
cowpea. In the present study, the same results as Li et al., (2001)
done, only one to seven alleles per primer pair were amplified from

122
the 40 cowpea lines, but in present study, microsatellites bands were
detected on 3% agarose gel electrophoresis. This showed that the
level of microsatellite polymorphism in cowpea is much lower than
other crops. The same reason as Li et al. (2001) did, the materials
used in the present study were all from the GP breeding program in
HAU and thus had a relatively narrow genetic base. In a study of
genetic diversity in soybean, 11 to 26 alleles per microsatellite
primer pair were amplified from 96 soybean genotypes while this
number was reduced to five to 10 alleles per primer pair in 26
cultivars from North American breeding programs (Rongwen et al.,
1995).

As discussion by Li et al. (2001), the other possible reason for the

low level of microsatellite polymorphism is that the cultivated cowpea
is relatively low in genetic diversity compared with other crops. It has
been suggested that cowpea was only domesticated once (Pasquet.
1999), unlike P. vulgaris (Singh et al.. 1991) or rice (Second. 1985).
The low genetic diversity in cultivated cowpea may be a result of this
narrow genetic base.

The low level of genetic diversity at the DNA level among cowpea
breeding lines and cultivars could be increased by using its wild
relatives to broaden the genetic base. Li et al. (2001) demonstrated
that microsatellite markers were conserved among Vigna species.
Hence microsatellite markers could provide a simple approach to
assaying the introduction of such genetic material.

Polymorphic information content (PlC) provides an estimate of the

discriminatory power of a locus by taking into account, not only the
number of alleles that are expressed, but also the relative
frequencies of those alleles (Smith et al., 1997). PlC values range
from 0 (monomorphic) and 1 (very high discriminative, with many

123
alleles in equal frequencies). Senior et al. (1998) reported that PlC is
synonymous with the term “gene diversity” as described by Weir
(1996). The PlC value of SSR markers in the present study was not
very high and ranged from 0.00 to 0.72 but only four out of 42 SSR
primer pairs gave polymorphism. The PlC values of SSR markers
can be compared to results reported by Li et al. (2001) with PIC
ranged from 0.02 to 0.73. Presently, event poly-acrylamide gels were
used to detect the DNA alleles, the polymorphic information still
could not compare with other crop species.

The information on microsatellite markers collected in the present

study was further used to analyse genetic diversity among 40
cowpea genotypes through cluster analysis. UPGMA tree was
prepared using NTSYS-PC sub-programme “Simqual” which used
“SM’ coefficient to establish genetic relationships at molecular level.
The estimates of genetic similarity coefficients in dendrogram ranged
from 0.45 to 1.00 and variation between two groups of cowpea lines
with CYMV disease reaction.

Groupings of the 40 cowpea lines based on microsatellite

polymorphisms generally agreed with the CYMV resistant phenotype
of these lines. Two major groups separated at 45% similarity (fig.
13). The resistant group including 18 resistant lines with 77% to
100% similarity. The other two resistant lines were classified in a
separated group with one susceptible line and joined with resistant
group at 47% similarity. The susceptible group consisted of two
subgroups with 71% and 77% similarity within each subgroup. This
genetic diversity in resistant and susceptible population was enough
uniform and confident for tagging to CYMV resistant genes and
mapping them to cowpea linkage map.

124
5.2 Mapping of CYMV resistance genes in cowpea
The current genetic linkage map of cowpea made by Ouedraogo et
al. (2002) included 441 markers (267 AFLP, 133 RAPD and 39
RFLP) on 11 LGs spanning a total of 2670 cM, rendering it the most
extensive map for cowpea available to date. The average distance
between markers is 6 cM. Because the physical size of the cowpea
genome is estimated to be 613 × 106 bp, 1 cM would relate to 229 kb
on average. This is less than the 360 kb for chickpea (Winter et al.
2000) or the 750 kb/cM for the high-density map of tomato (Tanksley
et al. 1992). In view of plans to proceed with the map-based cloning
of certain loci of interest, this information will undoubtedly prove
useful in judging the degree of marker density needed to ensure the
timely completion of such an undertaking.

A direct application of genetic linkage maps has been in tagging

genes of economic importance with molecular markers (Kumar
1999). Besides the genes controlling chilling tolerance and seed
weight mapped (Menéndez et al. 1997) and the mapping of AFLP
markers linked to Striga gesnerioides resistance genes (Ouedraogo
et al., 2002), the present study was applied cowpea genetic linkage
map to tag microsatellite markers with CYMV resistant genes. Four
microsatellite markers, AG1/AF48383 (AGB1), VM31, VM1 and VM3,
were mapped in the same chromosome covered 88.6 cM. Because
no any microsatellite marker was present in the current cowpea
genetic linkage map, this segment of chromosome can not be
assigned to any linkage group of cowpea map directly. But in other
relative revelation that the resistance to cowpea mosaic virus have
been mapped in the linkage groups 2 in current map using AFLP,
RFLP and RAPD (Ouedraogo et al., 2002), this segment of
chromosome can be located in a part of linkage group 2 of cowpea
genetic map.

125
5.3 QTL analysis and interval mapping

Some forms of plant disease resistance are genetically simple and

have been analyzed extensively by traditional methods of plant
pathology, breeding, and genetics (Flor, 1955; Hulbert and
Michelmore, 1985; Jorgensen and Moseman, 1972; Nelson and
Ullstrup, 1964; Randle et al., 1984). Genetically complex forms of
disease resistance, by contrast, are more poorly understood (Geiger
and Heun, 1989). The classical quantitative genetics provided the
tools for studying complex disease resistance (Falconer, 1989).
However, quantitative genetics is unsuited for dissecting polygenic
resistance characters into discrete genetic loci or defining the roles
of individual genes in disease resistance. An effective approach for
studying complex and polygenic forms of disease resistance is
known as “Quantitative Trait Locus” (QTL) mapping, which is based
on the use of DNA markers (Tanksley, 1993).

QTL analysis is predicated on looking for associations between the

quantitative trait and the marker alleles segregating in the
population. It has two essential stages; the mapping of the markers
and the association of the trait with the markers. Both of these
stages require accurate data plus statistical software. The basic
theory underlying marker mapping has been available since the
1920s (Mather, 1938), but had to be extended to handle hundreds of
markers simultaneously. Although slightly different algorithms are
used in the final stages to smooth the results to fit the multiple
marker information, the maps produced are very similar (Lander et
al, 1987; Stam, 1993).

Most QTL analyses in plants involved populations derived from pure

lines and several approaches have been developed to associate QTL
with molecular markers in such populations (Kearsey & Pooni, 1996).

126
The present study also used 40 cowpea pure lines to detect cowpea
yellow mosaic virus QTL associated with SSR markers. The basic
problem was that the trait score of a particular genotype was a single
value resulting from the combined allelic effects of many genes and
the environment. Two individuals could have the same genotype but
a different phenotype or vice versa. This was observed at VM31
locus with the same banding pattern of 4 heterozygous genotypes,
one of them had susceptible reaction with CYMV disease (HC2-87)
while 3 others (HC98-48, HC98-63 and HC1-15) gave resistant
phenotypes. The earliest approach to this problem was to look at all
individual associations between marker and phenotype. There were
three problems with this approach. First, false positives will occur if
the significance level is set too low. Second, because all genes on a
chromosome will show some linkage among themselves, any one
QTL will be associated with several markers. Third, because the QTL
will not necessarily be allelic with any given marker, its exact position
and its effect can not be known, although the strongest association
will be with the closest marker.

Interval mapping as introduced to overcome many of these problems.

Intervals between adjacent pairs of markers along a chromosome are
scanned and the likelihood profile of a QTL being at any particular
point in each interval is determined; or to be more precise, the log of
the ratio of the likelihoods (LOD) of there being one against no QTL
at a particular point (Lander & Botstein, 1989). Those maxima in the
profile which exceed a specified significance level indicate the likely
sites of QTL. Significance levels have to be adjusted to avoid false
positives resulting from multiple tests, while confidence intervals are
set as the map interval corresponding to a 1 LOD decline either side
of the peak. This has been the most widely used approach,
particularly for those working with populations derived from inbred

127
parents. Using multiple regression approach, Haley & Knott (1992)
gave very similar results to LOD mapping both in terms of accuracy
and precision, but has the advantages of speed and simplicity of
programming. It has been adapted to handle complex pedigrees and
to include a wide range of fixed effects in the model such as sex
differences and environments. Tests of significance and confidence
intervals can be obtained by bootstrapping approaches (Visscher et
al., 1996; Lebreton & Visscher, 1998).

The current study performed single marker analysis based on the

simple linear regression model (Haley & Knott, 1992). QTL detected
closely linked with three SSR loci, AG1/AF48383 (AGB1), VM31 &
VM1 with absolutely probability of the association (0.00). Using
multiple regression approach developed by Haley & Knott (1992)
with significances and confidence intervals performed by bootstrap
test, the present interval mapping estimated 98.4% of the resistant
trait was associated within the interval of three loci AGB1, VM31 &
VM1 covered 32.1 cM (Fig. 17), in which 95% confidence interval for
the QTL was associated with VM31 locus in only 19 cM.

It has long been clear that the confidence intervals (CI) associated
with QTL locations in segregating populations are large (van Ooijen,
1992; Darvasi etal., 1993; Hyne etal, 1995). The reliability depends
on the heritability of the individual QTL. Given a typical trait with an
overall broad heritability of 50 per cent or less, the individual QTL
will have heritability of this 50 per cent. Thus with 5 equally sized
QTL, each can only have a heritability of 10 per cent. Simulations
have shown that the 95 per cent CI of such a QTL in an F 2 population
of 300 individuals is more than 30 cM while it is very difficult to
reduce the CI to much less than 10 cM even for a very highly
heritable QTL; more markers beyond a density of one every 15 cM

128
do not help much. These distances should be viewed in the context
that, on average, a chromosome is about 100 cM long.

In the present study, confidence interval associated with QTL

location at VM31 locus was 19 cM. It showed that QTL for CYMV
resistant trait was very highly heritable. With the haft of overall broad
heritability calculated 49.2 per cent, the QTL was highly associated
with three SSR markers (AGB1, VM31 & VM1) and most closely
linkage with VM31. With all of these advantages, VM31 PCR product
was used to clone into Escherichia coli

5.4 Cloning of the linked marker

The PCR products of VM31 were cloned into pDrive Cloning Vector
(Fig. 4) using QIAGEN PCR Cloning kit ligation protocol and
transformed into fresh competent cells of E.coli EZ strain. pDrive
Cloning Vector had an advantage as it contained T7 and SP 6
promoters which facilitated the sequencing of desired inserts by
primer walking. Thus, cloning of the linked marker VM31 was useful
for further analysis after sequencing. The sequence of DNA fragment
insertion can be used to search for the open reading frame or the
gene that adjacency to the former on the cowpea database using
BLAST program.

The information provided by the identified markers would be very

useful in breeding programs to select cowpea lines resistance to
CYMV disease. These markers may prove useful in marker-assisted
selection, plant genetic diagnostics and gene pyramiding of desirable
traits.

129
CHAPTER VI

SUMMARIZE AND CONCLUSIONS

The present investigation was carried out to identify SSR markers closely
linked to cowpea yellow mosaic virus resistance genes and map the
closely linked markers on the cowpea genetic likage map. Fourty cowpea
lines selected from screening experiment in the field condition, in which
20 resistant genotypes and 20 susceptible genotypes were used for
molecular marker analysis. The results obtained and conclusions from
this study are given below:

1. Among 60 SSR markers used to detect CYMV resistant gene, 40

cowpea specific SSR primer pairs produced amplification in 40
cowpea genotypes, 20 moth bean designed SSR primer pairs were
fail to give amplification except two primer pairs (AGB1 and
AGB16). These 42 SSR primer pairs produced 110 amplified
fragments, in which only 9 polymorphic bands were obtained.
Numbers of alleles ranged from one (VM 17, VM 19, VM 21, VM
22, VM 25, VM 34, VM 35, VM 38, AGB16) to seven (VM33) with
the PIC value ranged from 0.0 to 0.72.

2. Out of 42 amplified SSR primer pairs, four SSR markers gave

clearly polymorphic bands on the gel, in which VM31 and VM3
primer pairs produced polymorphism in bands size, VM1 and ABG1
(AG1/AF48383) primer pairs gave differences in the presence or
absence of extra DNA bands. For VM31 primer pairs, 200 bp band
was detected in resistant genotype and 180 bp band observed in
susceptible genotype. The same as VM3 primer pairs, 180bp and

130
 160bp were observed in resistant and susceptible genotypes,
respectively. In case of VM1 and AG1/AF48383 primer pairs, an
extra band (250 bp and 100 bp, respectively) obtained for
susceptible genotype in compared to resistant genotype.

3. The alleles were sized by comparing their relative migration with

standard size digested lambda DNA marker and then binary coded
as 1 or 0 for their presence or absence. The allelic sizes ranged
from 30 bp to 700 bp. All the data analyses were performed using
software package NTSYS-pc. Similarity indices for pair wise
combinations among all the genotypes ranged from 0.33 to 1.00
but concentrated around 0.75 to 1.00 for 20 susceptible genotypes
indicating high genetic similarity among the susceptible genotypes.
The genetic similarity among the resistant genotypes was also very
high with the similarity indices for 20 resistant genotypes ranged
from 0.625 to 1.000.

4. Dendrogram was constructed using Unweighted Pair Group

Method Using Arithmetic Averages (UPGMA) algorithm. Based on
the tree cluster analysis, all the 40 genotypes were grouped into
two major clusters. First cluster comprised 18 resistant lines with
77% to 100% similarity. The other subgroup joined with this group
at 47% similarity including two resistant lines and one susceptible
line. The second cluster including 19 susceptible genotypes and
separated into two subgroups with 71% and 77% similarity within
each subgroup. This genetic diversity in resistant and susceptible
population was enough uniform and confident for tagging to CYMV
resistant genes and mapping them to cowpea linkage map.

5. Four microsatellite markers, AG1/AF48383 (AGB1), VM31, VM1

and VM3, were mapped in the same chromosome covered 88.6cM
calculated from 40 progenies with 53 crossover using map

131
 manager QTXb20 in linkage map analysis. This segment of
chromosome was located in a part of linkage group 2 of cowpea
genetic map.

6. The interval QTL mapping showed 98.4 per cent of the resistance
trait mapped in the region of three loci AGB1, VM31 & VM1
covered 32.1 cM, in which 95% confidence interval for the CYMV
resistance QTL associated with VM31 locus was mapped within
only 19 cM. It showed that QTL for CYMV resistant trait was very
highly heritable

7. Cloning with DNA fragment from VM31 product collected the

recombinant plasmid which gave the same PCR product as the
genomic DNA did in both resistant genotypes and susceptible
genotypes. The VM31 linked marker clones can be used for
sequencing and further analysis. The sequences of resistance
clone were useful for searching the open reading frame or the gene
that adjacency to the marker on the cowpea database using BLAST
program.

These identified markers could be utilized in the resistance breeding

program of cowpea by marker-assisted selection, and provide prior
materials for isolation of CYMV reststance genes in transgenic plant
programe to improve cowpea disease resistace.

132
BIBLIOGRAPHY

Agrawal, H.O. 1964. Identification of cowpea mosaic virus isolates.

Meded. Landb Hogesch. Wagenigen 64: 1-53.

Agrawal, H.O. and Maat, D.Z. 1964. Serological relationships among

polyhedrol plant viruses and production of high-titred antisera. Nature
202: 674-675.

Ahmad, M., 1978. Whitefly (Bemisia tabaci) transmission of a yellow

mosaic disease of cowpea (Vigna unguiculata). Pl. Dis. Rep. 62: 224-
226.

Ahmadi N, Albar L, Pressoir G, Pinel A, Fargette D, Ghesquiere A. 2001.

Genetic basis and mapping of the resistance to Rice yellow mottle
virus. III. Analysis of QTL efficiency in introgressed progenies
confirmed the hypothesis of complementary epistasis between two
resistance QTLs. Theor. Appl. Genet. 103:1084–92

Akkaya, M.S., A.A. Bhagwat, and P.B. Cregan. 1992. Length

polymorphisms of simple sequence repeat DNA in soybean. Genetic.
132: 1131-1139.

Allen D.J. and P.V. Damme. 1981. On thrips transmission of cowpea

yellow mosaic virus. Trop. Agric. 58 (2): 181-184

Ata, A.E.A., Allen, D.J.,Thottappilly, G. and Rossel, H.W. 1982. Variation

in the rate of seed transmission of cowpea aphid borne mosaic virus in
cowpea. Trop. Grain Leg. Bull. 25:27

Ayres, N.M., A.M. McClung, P.D. Larkin, H.F.J. Bligh, C.A. Jones, and
W.D. Park. 1997. Microsatellite and a single nucleotide polymorphism
differentiate apparent amylose classes in an extended pedigree of US
rice germplasm. Theor. Appl. Genet. 94:773–781.

Baker, B., P. Zambriski, B. Staskawicz & S.P. Dinesh-Kumar, 1997.

Signaling in plant-microbe interactions. Science 276: 726–733.

133
Barker H, McGeachy KD, Ryabov EV, Commandeur U, Mayo MA,
Taliansky M. 2001. Evidence for RNA-mediated defence effects on the
accumulation of Potato leaf-roll virus. J. Gen. Virol. 82: 3099–106

Bashir, M. and R.O. Hampton, 1993. Natural occurrence of five seed-

borne cowpea viruses in Pakistan. Pl. Dis. 77 (9): 948-951.

Bashir, M., M.S. Iqbal, A. Ghafoor, Z. Ahmed and A.S. Qureshi. 2002.
Variability in cowpea germplasm for reaction to virus infection under
field conditions. Pak. J. Bot. 34: 47-48.

Bashir, M., Z. Ahmad and N. Murata, 2000. Seed-borne viruses in

cowpea germplasm. pp: 71. In: Seed-borne Viruses: Detection,
Identification and Control. Pakistan Agricultural Research Council,
National Agricultural Research Centre, Islamabad, Pakistan, pp: 156.

Baulcombe D. 2004. RNA silencing in plants. Nature 431:356–63

Ben-Chaim A, Grube RC, Lapidot M, Jahn MM, Paran I. 2001.

Identification of quantitative trait loci associated with tolerance to
Cucumber mosaic virus in Capsicum annuum. Theor. Appl. Genet.
102:1213–20

Biffen, R.H. 1905. Mendel’s laws of inheritance and wheat breeding. J.

Agric. Sci. 1:4-48

Blair, M., and S.R. McCouch. 1997. Microsatellite and sequence tagged
site markers diagnostic for the bacterial blight resistance gene, xa-5.
Theor. Appl. Genet. 95:174–184.

Bliss, F.A. and D.G. Robertson. 1971. Genetic of host reaction in

cowpeas to cowpea mosaic virus and cowpea mottle virus. Crop Sci.
11: 258-262

Bock, K.R. 1971. Notes on East African plant virus diseases. I. Cowpea
mosaic virus. E. Afr. Agric. For. J. 37: 60-62.

134
Bock, K.R. and Conti, M. 1974. Cowpea aphid-borne mosaic virus. Kew,
UK, CMI (Commonwealth Mycological Institute), CMI/AAB
Descriptions of Plant Viruses, 134.

Boswell, K.F. and Gibbs, A.J. 1983. Viruses of legumes: descriptions and
keys from virus identification and data exchange. Canberra, Australian
National University.

Boukar O., L. Kong, B. B. Singh, L. Murdock, and H. W. Ohm. 2004.

AFLP and AFLP-Derived SCAR Markers Associated with Striga
gesnerioides Resistance in Cowpea. Crop Sci. 44:1259–1264

Boulton MI, Steinkellner H, Donson J, Markham PG, King DI, Davies JW.
1989. Mutational analysis of the virion-sense genes of maize streak
virus. J. Gen. Virol. 70:2309–23

Bowers, J., J. Boursiquot, P. This, K. Chu, H. Johansson, and C.

Meredith. 1999. Historical genetics: The parentage of Chardonnay,
Gamay, and other wine grapes of northeastern France. Science
285:1562–1565.

Brantley, B.B. and C.W. Kuhn. 1970. Inheritance of resistance to southern

bean mosaic virus in southern pea (Vigna sinesis). Proc. Am. Soc.
Hortic. Sci. 95: 155-158

Brown, S.M., M.S. Hopkins, S.E. Mitchell, M.L. Senior, T.Y. Wang,
Powell, R.R. Duncan, F. Gonzalez-Candelas, and S. Kresovich. 1996.
Multiple methods for the identification of polymorphic simple sequence
repeats (SSRs) in sorghum [Sorghum bicolor (L.) Moench]. Theor.
Appl. Genet. 93:190–198.

Bubenheim, D.L., C.A. Mitchell, and S.S. Nielsen. 1990. Utility of cowpea
foliage in a crop production system for space. p. 535-538. In: J. Janick
and J.E. Simon (eds.), Advances in new crops. Timber Press, Portland

135
Buschges R, Hollricher K, Panstruga R, Simons G,Wolter M, et al. 1997.
The barley Mlo gene: a novel control element of plant pathogen
resistance. Cell 88:695–705

Caetano-Anolles, G.; Bssam, B.J. and Cresshoff, P.M. 1991. High

resolution DNA amplification, fingerprinting using very short arbitrary
oligonucleotide primers. Bio/ Technology. 9: 553-557.

Capoor, S.P., Varma, P.M. and Uppal, B.NT. 1947. A mosaic disease of
Vigna catjang Walp. Current Sci. 16: 151.

Caranta C, Palloix A, Lefebvre V, Daubeze AM. 1997. QTLs for a

component of partial resistance to cucumber mosaic virus in pepper:
restriction of virus installation in host-cells. Theor. Appl. Genet.
94:431–38

Carrington JC, Kasschau KD, Mahajan SK, Schaad MC. 1996. Cell-to-cell
and long-distance transport of viruses in plants. Plant Cell 8:1669–81

Carvalho MF, Lazarowitz SG. 2004. Interaction of the movement protein

NSP and the Arabidopsis acetyltransferase AtNSI is necessary for
Cabbage leaf curl geminivirus infection and pathogenicity. J. Virol.
78:11161–71

Chague V, Mercier JC, Guenard AD, de Courcel A, Vedel F. 1997.

Identification of RAPD markers linked to a locus involved in
quantitative resistance to TYLCV in tomato by bulked segregant
analysis. Theor. Appl. Genet. 95:671–77

Chague, Y.; Mercier, J.C.; Guenard, M.; de Courcel, A. and Vedel, F.

1996. Identification and mapping on chromosome 9 of RAPD markers
linked to Sw-5 gene in tomato by bulked segregant analysis. Theor.
Appi. Genet. 92: 1045-1051.

Chant, S.R. 1959.Viruses of cowpea, Vigna unguiculata (L.) Walp. in

Nigeria. Am. Appl. Biol. 47: 565-572

136
Chant, S.R. 1960. The effect of infection with tobacco mosaic and
cowpea yellow mosaic viruses on the growth rate and yield of cowpea
in Nigeria. Emp. J. Exp. Agric. 28: 114-120

Chen, X., S. Temnykh, Y. Xu, Y.G. Cho, and S.R. McCouch. 1997.
Development of a microsatellite framework map providing genome-
wide coverage in rice (Oryza sativa L.). Theor. Appl. Genet. 95:553–
567.

Clark, M.F. and A.N. Adamas, 1977. Characteristic of the microplate of

enzyme-linked immunosorbent assay for the detection of plant viruses.
J. Gen. Virol., 34: 475-483.

Collmer CW, Marston MF, Taylor JC, Jahn MM. 2000. The I gene of
bean: a dosage-dependent allele conferring extreme resistance,
hypersensitive resistance, or spreading vascular necrosis in response
to the potyvirus Bean common mosaic virus. Mol. Plant Microbe
Interact.13:1266–70

Cooley MB, Pathirana S,Wu HJ, Kachroo P, Klessig DF. 2000. Members
of the Arabidopsis HRT/RPP8 family of resistance genes confer
resistance to both viral and oomycete pathogens. Plant Cell 12:663–
76

Dale, W.T. 1949. Observations on a virus disease of cowpea in Trinidad.

Ann. Appl. Biol. 36: 327-333.

Darvasi, A. and M. Soller. 1997. A simple method to calculate resolving

power and confidence interval of QTL map location. Behavior Genetics
27(2): 125-132

Deom CM, Lapidot M, Beachy RN. 1992. Plant virus movement proteins.
Cell 69:221–24

Deom CM, Murphy JF, Paguio OR. 1997. Resistance to Tobacco etch
virus in Capsicum annuum: inhibition of virus RNA accumulation. Mol.
Plant Microbe Interact. 10:917–21

137
Ding XS, Carter SA, Deom CM, Nelson RS. 1998. Tobamovirus and
potyvirus accumulation in minor veins of inoculated leaves from
representatives of the Solanaceae and Fabaceae. Plant
Physiol.116:125–36

Don, R.H., P.T. Cox, B.J. Wainwright, K. Baker, and J.S. Mattick. 1991.
Touchdown PCR to circumvent spurious priming during gene
amplification. Nucleic Acids Res. 19: 4008.

Doyle, J.J. and J.L. Doyle. 1987. A rapid DNA isolation procedure for
small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11-15.

Dunwell JM. 2000. Transgenic approaches to crop improvement. J. Exp.

Bot. 51:487–96

Duvick, D.N. 1996. Plant breeding, an evolutionary concept. Crop Sci.

36:539–548.

Ehlers, J.D., and A.E. Hall. 1996. Genotypic classification of cowpea

based on responses to heat and photoperiod. Crop Sci. 36: 673–679

Ehlers, J.D., and A.E. Hall. 1997. Cowpea (Vigna unguiculata L. Walp).
Field Crops Res. 53: 187–204.

Fall, L., D. Diouf, M.A. Fall-Ndiaye, F.A. Badiane and M. Gueye. 2003.
Genetic diversity in cowpea [Vigna unguiculata (L.) Walp.] varieties
determined by ARA and RAPD techniques. African Journal of
Biotechnology Vol. 2 (2), pp. 48–50

Fang DQ and Roose ML. 1997. Identification of closely related citrus

cultivars with inter-simple sequence repeat markers. Theor. Appl.
Genet. 95: 408–417.

Faris, D.G. 1964. The chromosome of Vigna sinensis (L.). Savi. Canad. J.
Genet.Cytol. 6: 255-258

Fatokun C. A., I. Desiree, M. Hautea, D. Danesh and N. D. Young. 1992.

Evidence for Orthologous Seed Weight Genes in Cowpea and Mung
Bean Based on RFLP Mapping. Genetics 132: 841-846

138
Fatokun, C.A., D. Danesh, N.D. Young, and E.L. Stewart. 1993.
Molecular taxonomy relationships in the genus Vigna based on RFLP
analysis. Theor. Appl. Genet. 86: 97-104

Fatokun, C.A., H.D. Mignouna, M.R. Knox, and T.H.N. Ellis. 1997. AFLP
variation among cowpea varieties. p. 156. In Agronomy Abstracts.
ASA, Madison, WI.

Feleke Y., R. S. Pasquet, and P. Gepts. 2006. Development of PCR-

based chloroplast DNA markers that characterize domesticated
cowpea (Vigna unguiculata ssp. unguiculata var. unguiculata) and
highlight its crop-weed complex. Pl. Syst. Evol. 262: 75–87.

Fery RL. 1980. Genetics of Vigna. Hort Rev 2: 311Ð394

Fery RL. 1985. The genetics of cowpeas: a review of the world literature.
In: Singh SR, Rachie KO (eds) Cowpea research, production and
utilization. John Wiley and Sons, New York, pp 25-62

Fotso, M., J.L. Azanza, R. Pasquet, and J. Raymond. 1994. Molecular

heterogeneity of cowpea (Vigna unguiculata, Fabaceae) seed storage
proteins. Plant Syst. Evol. 191: 39–56.

Fraser RSS. 1986. Genes for resistance to plant viruses. CRC Crit. Rev.
Plant Sci. 3:257–94

Fraser RSS. 1990. The genetics of resistance to plant viruses. Annu.

Rev. Phytopathol.28:179–200

Gao Z, Johansen E, Eyers S, Thomas CL, Noel Ellis TH, Maule AJ. 2004.
The potyvirus recessive resistance gene, sbm1, identifies a novel role
for translation initiation factor eIF4E in cell-to-cell trafficking. Plant J.
40:376–85

Gardiner WE, Sunter G, Brend L, Elmu JS, Rogers SG, Bisaro DM. 1988.
Genetic analysis of tomato golden mosaic virus: The coat protein is
not required for systemic spread or symptom development. EMBO J.
7:899–904

139
Gebhardt, C., 1997. Plant genes for pathogen resistance-variation on a
theme. Trends Plant Sci 2: 243–244.

Gergerich, R.C.; Scott, H.A. 1996. Comoviruses: transmission,

epidemiology and control. In: Harrison, B.D.; Muranti, A.F. (Ed.) The
plant viruses: polyhedral virions and bipartite genomes. New York:
Plenum Press, 1996. cap.4, p.77-98.

Gilardi P, Garcia-Luque I, Serra MT. 1998. Pepper mild mottle virus coat
protein alone can elicit the Capsicum spp. L gene-mediated
resistance. Mol. Plant Microbe Interact. 11:1253–57

Gilbertson RL, Lucas WJ. 1996. How do viruses traffic on the ‘vascular
highway?’ Trends Plant Sci. 1:260–68

Gillaspie, A.G. Jr., G. Pio-Ribeiro, G.P. Andrade, and H.R. Pappu. 2001.
RT-PCR detection of seed-borne Cowpea aphid-borne mosaic virus in
peanut. Plant Dis. 85: 1181-1182.

Gillaspie, A.G. Jr., S.E. Mitchell, G.W. Stuart, and R.F. Bozarth. 1999.
RT-PCR method for detecting cowpea mottle carmovirus in Vigna
germplasm. Plant Dis. 83: 639-643.

Gilmer R.M., W.K. Whitney, R.J. Williams. 1974. Epidemiology and

control of cowpea mosaic in Western Nigeria. In pro. 1 st IITA Grain
legume improvement workshop. International Institute of Tropical
Agriculture, Ibadan, Nigeria. Pp: 325.

Goldbach R, Bucher E, Prins M. 2003. Resistance mechanisms to plant

viruses: an overview. Virus Res. 92:207–12

Govindaswamy, C. V., Mariappan, V., Muragesan, S.S., Padmanathan,

C., Thangamani, G. and Janaki, I.P. 1970. Studies on a cowpea
mosaic virus disease. Madras agric. J. 57: 405-414

Gowda B.S., Jennifer L. Miller1, Sarah S. Rubin, Dilram R. Sharma2 &

Michael P. Timko. 2002. Isolation, sequence analysis, and linkage

140
 mapping of resistance-gene analogs in cowpea (Vigna unguiculata L.
Walp.) Euphytica 126: 365–377

Gupta M, Chyi YS, Romero-Severson J, Owen JL. 1994. Amplification of

DNA markers from evolutionarily diverse genomes using single
primers of simple-sequence repeats. Theor. Appl. Genet. 89:998-
1006.

Hajimorad MR, Hill JH. 2001. Rsv1-mediated resistance against soybean

mosaic virus-N is hypersensitive response independent at inoculation
site, but has the potential to initiate a hypersensitive response-like
mechanism. Mol. Plant Microbe Interact. 14:587–98

Haley, C. S. and S. A. Knott. 1992. A simple regression method for

mapping quantitative trait loci in line crosses using flanking markers.
Heredity 69: 315-324

Hall, A.E. and P.N. Patel. 1985. Breeding for resistance to drought and
heat. In: eds. S.R. Singh and K.O. Rachie. Cowpea research,
production and utilization. Wiley, New York. pp: 137-151

Hammond H. A., Jin L., Zhong Y., Caskey C. T. and Chakraborty R. 1994
Evaluation of 13 short tandem repeat loci for use in personal
identification applications. Am. J. Hum. Genet. 55: 175–89.

Hammond-Kosack K.E., J.D.G. Jones. 1997. Plant disease resistance

genes. Annu. Rev. Plant Physiol Plant Mol Biol. 48: 575–607

Hampton, R.O. 1983. Seed-borne viruses in cop germplasm resources:

disease dissemination risks and germplasm reclamation technology.
Seed Sci. Technol., 11: 536-546.

Hanson PM, Bernacchi D, Green S, Tanksley SD, Muniyappa V, et al.

2000. Mapping a wild tomato introgression associated with Tomato
yellow leaf curl virus resistance in a cultivated tomato line. J. Am. Soc.
Hortic. Sci. 125:15–20

141
Harland S.C. 1919. Inheritance of certain characters in the cowpea
(Vigna sinensis). J. Genet 8: 101-132

Hobbs H.A., Kuhn, C.W. and Brantley, B.B. 1983. Resistance to southern
bean mosaic virus in cowpea plant introduction 186465 (Abstract).
Phytopathology 73(5): 790.

Hobbs, H.A. and Kuhn, C.W. 1987. Differential field infection of cowpea
genotypes by southern bean mosaic virus. Phytopathology 77: 136-
139.

Hudson, T.J., L.D. Stein, S.S. Gerety, J. Ma, A.B. Castle, J. Silva, D.K.
Slonim, R. Baptista, L. Kruglyak, S.-H. Xu 1995. An STS-based map of
the human genome. Science 270: 1945-1954

Ilyas, M.B. 1999. Production constraints of pulses in Pakistan. In: Proc. of

2nd National Conference of Pl. Pathol., Sep. 27-29, Univ. Agric.
Faisalabad, Pakistan, pp: 36-40

Isemura T., A. Kaga, Saeko Konishi, Tsuyu Ando, Norihiko Tomooka ,

Ouk Kyu Han And Duncan A. Vaughan. 2007. Genome Dissection of
Traits Related to Domestication in Azuki Bean (Vigna angularis) and
Comparison with other Warm-season Legumes. Annals of Botany 100:
1053–1071.

Jansen, W.P. and Staples. R. 1971. Specificity of transmission of cowpea

mosaic virus by species within the sub-family Galerucinae, family
chrysomelidae. J. econ. Ent. 64:365-67.

Jones, A.T. and Barker,. H. 1976. Properties and relationships of broad

bean stain virus and Echtes Ackerbohnenmosaik virus. Ann. app!.
Biol. 83: 231-238.

Joshi SP, Gupta VS, Aggarwal RK, Ranjekar PK, Brar DS. 2000. Genetic
diversity and phylogenetic relationship as revealed by intersimple
sequence repeat (ISSR) polymorphism in the genus Oryza. Theor.
Appl. Genet. 100: 1311-1320.

142
Kaiser, W.J. and Mossahebi, H. 1975. Studies with cowpea aphid-borne
mosaic virus and its effect on cowpca in Iran. FAO Plant Protection
Bulletin 27: 27-30.

Kang B-C, Yeam I, Frantz JD, Murphy JF, Jahn MM. 2005. The pvr1
locus in pepper encodes a translation initiation factor eIF4E that
interacts with Tobacco etch virus VPg. Plant J. 42:392–405

Karp, A., Isaac, P.G. & Ingram, D.S. 1998. Molecular tools for screening
biodiversity. Plants and animals. Chapman & Hall, London. Plant
Growth Regulation. 26:139-140

Kelly J.D., P. Gepts, P.N. Miklas, D.P. Coyne. 2003. Tagging and
mapping of genes and QTL and molecular marker-assisted selection
for traits of economic importance in bean and cowpea. Field Crops
Research 82: 135–154

Kelly JD, P.N. Miklas. 1998. The role of RAPD markers in breeding for
disease resistance in common bean. Molecular breeding: new
strategies in plant improvement 4: 1–11

Kelly, J.D., and P.N. Miklas. 1999. Marker-assisted selection. p. 93–123.

In S.P. Singh (ed.) Common bean improvement in the twenty-first
century. Kluwer Academic Publ., Dordrecht, the Netherlands.

Khatri HL. and Chenulu, V.V. (1970). Effect of cowpea mosaic virus
infection on dry weight, moisture and mineral content of leaves of
resistant and susceptible cowpea varieties. Indian J. Sci. Indust.
4:153-158.

Kiho Y, Machida H, Oshima N. 1972. Mechanism determining the host

specificity of tobacco mosaic virus. I. Formation of polysomes
containing infecting viral genome in various plants. Jpn. J. Microbiol.
16:451–59

143
Koh, H.J., M.H. Heu, and S.R. McCouch. 1996. Molecular mapping of the
ge gene controlling the super giant embryo character in rice (Oryza
sativa L.). Theor. Appl. Genet. 93:257–261.

KojimaT, Nagaoka T, Noda N, Ogihara Y. 1998. Genetic linkage map of

ISSR and RAPD markers in Einkorn wheat in relation to that of RFLP
markers. Theor. Appl. Genet. 96: 37–45.

Kuhn, C.W., Benner, C.P. and l-Iobbs, I-l.A. 1986. Resistance responses
in cowpea to southern bean mosaic virus based on virus accumulation
and symptomatology. Phytopathology 76: 795-799.

Kumar, K., B.S. Dahlya, and N. Rishi. 1994. Inheritance of resistance to

cowpea yellow mosaic virus in cowpea (Vigna unguiculata (L.) Walp.).
Virology in the tropics. 653-658

Ladipo, J.L. 1977. Seed transmission of cowpea aphid-borne mosaic

virus in some cowpea cultivars. Nigerian Journal of Plant Protection 3:
3-10.

Lazarowitz SG, Beachy RN. 1999. Viral movement proteins as probes for
intracellular and intercellular trafficking in plants. Plant Cell 11:535–48

Lazarowitz SG. 2002. Plant Viruses. In Fundamental Virology, ed. DM

Knipe, PM Howley, pp. 1–107. Philadelphia: Lippincott Williams &
Wilkins. 4th ed.

Lee, M. 1995. DNA markers and plant breeding programs. Adv. Agron.
55:265–344

Li C.D, C. A. Fatokun, U. Benjamin, B. B. Singh, and G.J. Scoles . 2001.

Determining Genetic Similarities and Relationships among Cowpea
Breeding Lines and Cultivars by Microsatellite Markers. Crop Sci.
41:189–197

Li, C.D., B.G. Rossnagel, and G.J. Scoles. 2000. The development of oat
microsatellite markers and their use in identifying Avena species and
oat cultivars. Theor. Appl. Genet. 101:1259-1268.

144
Lima, J.A.A. and Nelson, M.R. 1977. Etiology and epidemiology of mosaic
of cowpea in Ceara Brazil. PLDis. Reptr. 61:864-867

Lima, J.A.A., Purcifull, D.E. and Fliebert, E. 1979. Purification, partial

characterization and serology of blackeye cowpea mosaic virus.
Phytopathology 69: 1252-1258.

Loannidou D, Pinel A, Brucidou C, Albar L, Ahmadi N, et al. 2003.

Characterisation of the effects of a major QTL of the partial resistance
to Rice yellow mottle virus using a near-isogenic-line approach.
Physiol. Mol. Plant Pathol. 63:213–21

Lucas WJ, Bouche-Pillon S, Jackson DP, Nguyen L, Baker L,. 1995.

Selective trafficking of KNOTTED1 homeodomain protein and its
mRNA through plasmodesmata. Science 270:1980–83

Lucas WJ, Gilbertson RL. 1994. Plasmodesmata in relation to viral

movement within leaf tissues. Annu. Rev. Phytopathol. 32:387–411

Mahajan SK, Chisholm ST, Whitham SA, Carrington JC. 1998.

Identification and characterization of a locus (RTM1) that restricts
long-distancemovement of tobacco etch virus in Arabidopsis thaliana.
Plant J. 14:177–86

Mali, V.R. and G. Thottappilly. 1986. Virus disease of cowpeas in the

tropics. pp. 361-403. In: Review of Tropical Plant Diseases.
Raychandhuri, S.P and Varman, J.P. (Eds). Volume. 3.

Martin GB, Bogdanove AJ, Sessa G. 2003. Understanding the functions

of plant disease resistance proteins. Annu. Rev. Plant Biol. 54:23–61

Matthews REF, Witz J. 1985. Uncoating of turnip yellow mosaic virus in

vivo. Virology 144:318–27

Melcher, U. 2000. The '30K' superfamily of viral movement proteins. J.

Gen. Virol. 81:257-266

145
Melton, A., Ogle, W.L., I3arnett, O.W. and Ca!dwell, J.D. 1987.
Inheritance of resistance to viruses in cowpeas. Phytopathology 77(4):
642.

Menacio-Hautea D, Fatokun CA, Kumar L, Danesh D, Young ND. 1993.

Comparative genome analysis of mungbean (Vigna radiate (L.)
Wilczek) and cowpea (V. unguiculata (L.) Walpers) using RFLP
mapping data. Theoretical and Applied Genetics 86: 797–810.

Mendoza de Jimenez C.C, F.O.L. Borges and C.E.A. Debrot. 1989.

Inheritance of resistance in cowpea servere mosaic virus in cowpea
[Vigna unguiculata (L.) Walp]. Fitopatologia Venezolana. 2(1):5-9

Menendez, C.M., A.E. Hall, P. Gepts. 1997. A genetic linkage map of

cowpea (Vigna unguiculata) developed from a cross between two
inbred, domesticated lines Theor Appl Genet 95 : 1210-1217

Meyer W, Mitchell TG, Freedman EZ, Vilgalys R. 1993. Hybridization

probes for conventional DNA fingerprinting used as single primers in
the polymerase chain reaction to distinguish strains of Cryptococcus
neoformans. J. Clin. Microbiol. 31:2274-2280.

Meyers, B.C., A.W. Dickerman, R.W. Michelmore, S. Sivaramakrishnam,

B.W. Sobral, N.D. Young. 1999. Plant disease resistance genes
encode members of an ancient and diverse protein family within the
nucleotide-binding super-family. Plant J 20:317–332

Michelmore R.W, I. Paran, R.V. Kesseli. 1991. Identification of markers

linked to disease-resistance genes by bulked segregant analysis: a
rapid method to detect markers in specific genomic regions by using
segregating populations. Proc Natl Acad Sci USA 88: 9828–9832

Mignouna, H.D., N.Q. Ng, J. Ikca, and G. Thottapilly. 1998. Genetic

diversity in cowpea as revealed by random amplified polymorphic
DNA. J. Genet. Breed. 52:151–159.

146
Morel, J. and J.L. Dangl. 1997. The hypersensitive response and the
induction of cell death in plants. Cell Death and Differentiation 4: 671–
683.

Moreno IM, Thompson JR, Garcia- Arenal F. 2004. Analysis of the

systemic colonization of cucumber plants by Cucumber green mottle
mosaic virus. J. Gen. Virol. 85:749–59

Moreno S, Martin JP, Ortiz JM. 1998. Inter simple sequence repeats PCR
for characterization of closely related grapevine germplasm. Euphytica
101:117–125.

Motoyoshi F, Oshima N. 1975. Infection of leaf mesophyll protoplasts

from susceptible and resistance lines of tomato. J. Gen. Virol. 29:81–
91

Mukherjee, p. 1968. Pachytene analysis in Vigna. Chromosome

morphology in Vigna sinensis (cultivated). Sci. Cult. 34:252-253

Murphy JF. 2002. The relationship between pepper mottle virus source
leaf and spread of infection through the stem of Capsicum sp. Arch.
Virol. 147:1789–97

Murphy, J.F., Barnett, O.W. and Witcher, W. 1987. Characterization of

blackeve cowpea mosaic virus strain from South Carrollina. Plant Dis.
71: 243-248

Murray, H.G., and Thompson, W.F. 1980. Rapid isolation of higher weight
DNA. Nucleic Acids Res. 8: 4321–4325.

Myers, G.O., C.A. Fatokun, N.D. Young. 1996. RFLP mapping of an

aphid resistance gene in cowpea (Vigna unguiculata L. Walp.).
Euphytica 91:181–187

Mysore KS, Ryu CM. 2004. Nonhost resistance: How much do we know?
Trends Plant Sci. 9:97–104

147
Nap JP, Metz PL, Escaler M, Conner AJ. 2003. The release of genetically
modified crops into the environment. Part I. Overview of current status
and regulations. Plant J. 33:1–18

Nariani, T.K. and Kandaswamy, T.K. 1961. Studies on a mosaic disease

of cowpea (Vigna sinensis Savi). indian Phytopathol. 14: 77-82.

Nelson, R. S. & van Bel, A. J. E. 1998. The mystery of virus trafficking

into, through and out of vascular tissue. Progess in Botany 59, 476-
533.

Nicaise V, German-Retana S, Sanjuan R, Dubrana MP, Mazier M, et al.

2003. The eukaryotic translation initiation factor 4E controls lettuce
susceptibility to the potyvirus Lettuce mosaic virus. Plant Physiol.
132:1272–82

O’Hair, S.K., Miller, J.C., Jr. and Toler, R.W. 1981. Reaction of cowpea
introductions to infection with the cowpea strain of southern bean
mosaic virus. Plant Dis. 65: 251-252.

Olson, M., L. Hool, C. Cantor, and D. Botstem. 1989. A common

language for physical mapping of the human genome. Science 245:
1434 – 1435.

Otsuki Y, Takebe I, Honda Y, Matsui C. 1972. Ultrastructure of infection

of tobacco mesophyll protoplasts by tobacco mosaic virus. Virology
49:188–94

Ouattara, S. and Chambliss, O.L. 1991. Inheritance of. resistance to

blackeye cowpea mosaic virus in ‘White Acre - BVR’ cowpea. Hort.
Sci. 26(2):194-1 96.

Ouedraogo, J.T., V. Maheshwari, D.K. Berner, C.-A. St-Pierre, F. Belzile,

and M.P. Timko. 2001. Identification of AFLP markers linked to
resistance of cowpea (Vigna unguiculata L.) to parasitism by Striga
gesnerioides. Theor. Appl. Genet 102: 1029–1036

148
Pandey R. N, and P. Dhanasekar 2004. Morphological Features and
Inheritance of Foliaceous Stipules of Primary Leaves in Cowpea
(Vigna unguiculata). Annals of Botany 94: 469–471

Paran I., and R.W. Michelmore. 1993. Development of reliable PCR-

based markers linked to downy mildrew resistant genes in lettuce.
Theor. Appl. Genet. 85:985-993

Pasquet, R.S. 1993. Variation at isozyme loci in wild Vigna unguiculata

(L.) Walp. (Fabaceae, Phaseoleae). Plant Syst. Evol. 186:157–173.

Pasquet, R.S. 1996. Cultivated cowpea (Vigna unguiculata): genetic

organization and domestication. In: B. Pickersgill and J.M. Lock
(editors). Advances in Legume Systematics 8: Legumes of Economic
Importance, pp. 101-108.

Pasquet, R.S. 1999. Genetic relationships among subspecies of Vigna

unguiculata (L.) Walp. Based on allozyme variation. Theor. Appl.
Genet. 98:1104–1119.

Perbal, M. C., Thomas, C. L. & Maule, A. J. 1993. Cauliflower mosaic

virus gene I product (P1) forms tubular structures which extend from
the surface of infected protoplasts. Virology 195, 281-285.

Phillips RL, Vasil IK, eds. 1994. DNA Based Markers in Plants. Dordrecht,
The Netherlands: Kluwer

Ponz F, Russel ML, Rowhani A, Bruening G. 1988. A cowpea line has

distinct genes for resistance to tobacco ring-spot virus and cowpea
mosaic virus. Phytopathology 78:1124–28

Provvidenti R. 1990. Inheritance of resistance to pea mosaic virus in

Pisum sativum. J. Hered. 81:143–45

Qazi J., M. Ilyas, S. Mansoor and R. W. Briddon.2007. Yellow legume

mosaic virus: Genetically isolated begomoviruses. Molecular Plant
Pathology 8(4): 343–348

149
Rachie, K.O. 1985. Introduction of cowpea. In: Cowpea Research,
Production and Utilization. Singh, S.R. and Rachie, K.O. (Eds.).
Chichester, John Wiley and Sons, England.

Rachie, K.O. and L.M. Roberts. 1974. Grain legumes of the low land
Tropics. Advan. Agron. 26: 1-32.

Raheja, A.K. and Leleji, 0.1. 1974. An aphid-borne virus disease of

irrigated cowpea in northern Nigeria. Plant Dis. Rep. 58: 1080-1084.

Raj, S. and P.N. Patel. 1979. Studies on resistance to crops to bacterial

diseases in India. Inheritance of multiple disease resistance in
cowpea. Indian Phytopath. 31(3): 294-299.

Ramiah, M. and Narayanaswamy, p. 1983. Inheritance of resIstance to

cowpea aphid-borne mosaic virus disease of cowpea. (Abstract). In:
National Seminar on breeding crop plants for resistance to pests and
diseases, May 25-27, 1983, Coimbatore, Tarnil Nadu, India.

Rao, R., M. Del Vaglio, D. Paino, M. Urzo, and L. Monti. 1992.

identification of Vigna spp. through specific seed storage polypeptides.
Euphytica. 62: 39-43

Ravelo G., U. Kagaya. T. Inukai, M. Sato, I. Uyeda. 2007. Genetic

analysis of lethal tip necrosis induced by Clover yellow vein virus
infection in pea. J Gen Plant Pathol 73:59–65

Reeder, B.D., .D. Norton and O.L. Chambliss. 1972. Inheritance of bean
yellow mosaic resistance in southern pea, Vigna sinensis (Torner). J.
Amer. Soc. Hortic. Sci. 97: 235-237

Revers F, Le Gall O, Candresse T, Maule AJ. 1999. New advances in

understanding the molecular biology of plant/Potyvirus interactions.
Mol. Plant Microbe Interact. 12:367–76

Ritzenthaler, C., Schmit, A. C., Michler, P., Stussi-Garaud, C. & Pinck, L.

1995. Grapevine fanleaf nepovirus P38 putative movement protein is

150
 located on tubules in vivo. Molecular Plant- Microbe Interactions
8:379-387.

Robertson, D.G. 1963. Further studies on the host range of cowpea

yellow mosaic virus. Trop. Agr. (Trinidad). 40: 319-324

Robertsons, D.G. 1965. The local lesion reaction for recognizing cowpea
varieties immune from and resistant to cowpea yellow mosaic virus.
Phytopathology. 55: 923-925.

Roger H. 2002. Matthews’ Plant Virology. New York: Academic. 4th ed.

Rogers, K.M., J.D. Norton and O.L. Chambliss. 1973. Inheritance of

resistance to cowpea chlorotic mottle virus in southern pea, (Ahmad,
1978;Vigna sinensis. J. Am. Soc. Hortic. Sci. 98: 62-63

Ronald, P.C. 1998. Resistance gene evolution. Curr. Opin. Biol. 1: 294–
298

Rongwen, J., M.S. Akkaya, A.A. Bhagwat, U. Lavi, and P.B. Cregan.
1995. The use of microsatellite DNAmarkers for soybean genotype
identification. Theor Appl. Genet. 90:43–48.

Ross AF. 1961. Systemic acquired resistance induced by localized virus

infections in plants. Virology 14:340–58

Rudolph C, Schreier PH, Uhrig JF. 2003. Peptide-mediated broad-

spectrum plant resistance to tospoviruses. Proc. Natl. Acad. Sci. USA
100:4429–34

Ruffel S, Dussault MH, Palloix A, Moury B, Bendahmane A, et al. 2002. A

natural recessive resistance gene against potato virus Y in pepper
corresponds to the eukaryotic initiation factor 4E (eIF4E). Plant J.
32:1067–75

Saghai, M.MA., K.M. Soliman, R.A. Jorgensen and L.W. Allard. 1984.
Ribosomal DNA spacer-length polymorphisms in Barley: Mendelian
inheritance, chromosomal location and population dynamics. Proc.
Natl. Acad. Sci. 91: 5466-5470

151
Saghai-Maroof, M.A.; Soliman, K.M.; Jorgensen, R.A.; Allerd, R.W. 1984.
Ribósomal spacer length polymorphism in barley Mendelian
inheritance, chromosomal location and population dynamics. Proc.
Natl. Acad. Sci. USA. 81: 8014-8019.

Santa Cruz S. 1999. Perspective: phloem transport of viruses and

macromolecules-What goes in must come out. Trends Microbiol.
7:237–41

Sax K. 1923. The association of size differences with seed-coat pattern

and pigmentation in Phaseolus vulgaris. Genetics 8:552–60

Senior, M.L., J.P. Murphy, M.M. Goodman, and C.W. Stuber. 1998. Utility
of SSRs for determining genetic similarities and relationships in maize
using an agarose gel system. Crop Sci. 38:1088–1098.

Shankar, G., Nene, Y.L. and Srivastava, S.K. 1973. A mosaic disease of
cowpea (Vigna sinensis Savi.). Indian J. Microbial. 13: 209-211.

Sharma S.R. and Varma, A. 1975. Three sap transmissible viruses from
cowpea in India. Indian Phytopathol. 28(2):192-198.

ShawJG. 1999. Tobacco mosaic virus and the study of early events in
virus infections. Philos. Trans. R. Soc. London Ser. B 354:603–11

Shepherd, R.J. 1963. Serological relationship between bean pod mottle

virus and cowpea mosaic viruses from Arkansas and Trinidad.
Phytopathology. 53: 865-866

Shoyinka, S.A. 1974. Status of virus diseases of cowpea in Nigeria. In

pro. 1st IITA Grain legume improvement workshop. International
Institute of Tropical Agriculture, Ibadan, Nigeria. 325 pp.

Shoyinka, S.A., Bozarth, R.F., Reese,J. and Rossel, HW. 1978. Cowpea
mottle virus: with distinctive properties infecting cowpeas in Nigeria.
Phytopathology 68: 693-699.

Shukla DD, Ward CW, Brunt AA. 1994. The Potyviridae. Wallingford, UK:
CAB Int.

152
Sinclair, J.B. and J.C. Walker. 1955. Inheritance of resistance to
cucumber mosaic virus in cowpea. Phytopathology. 45: 563-564

Singh BB., O.L. Chambliss, and B. Shamar. 1997. Recent advances in

cowpea breeding. In Singh BB, Mohan Raj DR, Dashiell KE, Jackai
Len (ed.). Advances in cowpea research. IITA-JIRCAS, Ibadan,
Nigeria.

Singh, S.R. and Rachie, K.O. (Eds) 1985. ‘Cowpea Research, Production
and Utilization’. John Wiley and Sons, Chichester, U.K. p: 340-342

Smith, C.E. 1924. Transmission of cowpea mosaic by bean leaf beetle.

Science 60:268.

Smith, K.M. 1972. A Text Book of Plant Virus Diseases. 3rd edition.
Academic Press, New York, pp 667.

Solomon-Blackburn RM, Barker H. 2001. A review of host major-gene

resistance to potato viruses X, Y, A and V in potato: genes, genetics
and mapped locations. Heredity 86:8–16

Sonnante, G., A.R. Piergiovanni, N.Q. Ng, and P. Perinno. 1996.

Relationship of Vigna unguiculata (L.) Walp., V. vexillata (L.) A. Rich.
And species of section Vigna based on isozyme variation. Genetic
Resources and Crop evolution. 43: 157-165.

Steele, W.M. 1972. Cowpea in Africa. Doctoral thesis. University of

Reading, United Kingdom.

Storms, M. M. H., Kormelink, R., Peters, D., van Lent, J. W. M. &

Goldbach, R. W. 1995. The non-structural NSm protein of Tomato
spotted wilt virus induces tubular structures in plant and insect cells.
Virology 214: 485-493.

Swaans, H.and van Kammen (1973). Reconsideration of the distinction

between the severe and yellow strains of cowpea mosaic virus Neth J.
Pl. Path. 79: 257-265.

153
Taiwo, M.A., Provvidenti, R. and Gonsalves, D. 1981. Inheritance of
resistance to blaekeye cowpea mosaic virus in Vigna unguiculata. J.
Hered. 72(6):433—434.

Taliansky ME, Barker H. 1999. Movement of luteoviruses in infected

plants. In The Luteoviridae, ed. HG Barker, pp. 69–81. Wallingford,
UK: CAB Int.

Tanksley SD. 1993. Mapping polygenes. Annu. Rev. Genet. 27:205–33

Taramino, G. and Tingey, S. 1996. Simple sequence repeats for

germplasm analysis and mapping in maize. Genome. 39: 277-287.

Tepfer M. 2002. Risk assessment of virusresistant transgenic plants.

Annu. Rev. Phytopathol. 40:467–91

Thoday JM. 1961. Location of polygenes. Nature 191:368–70

Thottappilly, G. and H.W. Rossel, 1985. Worldwide occurrence and

distribution of virus Dis., pp: 155-171. In: Cowpea Research,
Production and Utilization. Singh, S.R. and Rachie, K.O (Eds.).
Chichester: John Wiley and Sons, England.

Thottappilly, G. and H.W. Rossel. 1980. ELISA technique for detection of

viruses of economically important food crops in the humid tropics of
West Africa. IITA Research briefs. 1:1-2.

Thouvenel J.C, E. Tia and L.D.C. Fishpool. 1990. Characterization of

cowpea mottle virus on cowpea (Vigna unguiculata) in the Ivory Coast
and the identification of a new vector. Trop. Agric. (Trinidad) Vol.
67(3):280-282

Thouvenel, J.C. 1988. A serious disease caused by Cowpea mottle virus

in the Ivory Coast, Plant Dis. 72: 363

Tomooka N, Kashiwaba K, Vaughan DA, Ishimoto M, Egawa Y. 2000.

The effectiveness of evaluating wild species: searching for sources of
resistance to bruchid beetle in the genus Vigna subgenus
Ceratotropis. Euphytica 115: 27–41.

154
Tsuchizaki, T., ora, K. and Asuyama, H. 1970. The viruses causing
mosaic of eowpeas and adzuki beans, and their transmissibility
through seeds. Ann. Phytopath. Soc. (Japan) 36: 112-120.

Vaillancourt, R.E., and N.F. Weeden. 1992. Chloroplast DNA

polymorphism suggests a Nigerian centre of domestication for the
cowpea Vigna unguiculata (Leguminosae). Am. J. Bot. 79:1194–1199.

Vaillancourt, R.E., N.F. Weeden, and J. Barnard. 1993. Isozyme diversity

in the cowpea species complex. Crop Sci. 33: 606–613.

Van de Ven, W.T.G., and R.J. McNicol. 1996. Microsatellites as DNA

markers in Sikta spruce. Theor. Appl. Genet. 93:613–617.

Van Lent, J., Storms, M. & Goldbach, R. 1990. Evidence for the
involvement of 58K and 48K proteins in the intercellular movement of
Cowpea mosaic virus. Journal of General Virology 71:219-223.

Van Lent, J., Storms, M., van Der Meer, F., Wellink, J. & Goldbach, R.
1991. Tubular structures involved in movement of Cowpea mosaic
virus are also formed in infected protoplasts. Journal of General
Virology 72: 2615-262

Vasudeva, R.S. 1942. A mosaic disease of cowpea. Indian J. agric. Sci.

12:281-283.

Verma, M.M., S.S. Sandhu, J.B. Brar and G. Singh. 1991. Mungbean
breeding for tolerance to biotic stress. In: Golden jubilee celebrations:
Symposium on grain legumes (Shamar, B. ed.). I.A.R.I., New Delhi,
India, pp: 127-147

Vos P, R. Hogers, M. Bleeker, M. Reijans, T. van de Lee, M. Hornes, A.

Frijters, J. Pot, J. Peleman, M. Kuiper, M. Zabeau. 1995. AFLP: a new
technique for DNA finger-printing. Nucl. Acids Res 23: 4407–4414.

Watanabe Y, Kishibayashi N, Motoyoshi F, Okada Y. 1987.

Characterization of Tm-1 gene action on replication of common

155
 isolates and a resistance-breaking isolate of TMV. Virology 161:527-
32

Weising, K., P. Winter, B. Huttel, and G. Kahl. 1998. Microsatellite

markers for molecular breeding. J. Crop Prod. 1:113–143.

Wellink, J. & van Kammen, A. 1989. Cell-to-cell transport of Cowpea

mosaic virus requires both the 58K/48K proteins and the capsid
proteins. Journal of General Virology 70, 2279-2286.

Whitney, W.K. and R.M. Gilmer. 1974. Insect vector of cowpea mosaic
virus in Nigeria. Ann. Appl. Biol. 77: 17-21

Whyte, R.O., G. Nilsson-Lessner, H.C. Trumble. 1953. Cowpea (Vigna).

In: Legume in agriculture. Rome, FAO. p. 342-344. (FAO Agricultural
Studies No. 21)

Wicker T, Zimmermann W, Perovic D, Paterson AH, Ganal M, et al. 2005.

A detailed look at 7 million years of genome evolution in a 439 kb
contiguous sequence at the barley Hv-eIF4E locus: recombination,
rearrangements, and repeats. Plant J. 41:184–94

Wieczorek, A. & Sanfaçon, H. 1993. Characterization and subcellular

localization of Tomato ringspot nepovirus putative movement protein.
Virology 194, 734-742.

Williams, R.J. 1977. Identification of multiple disease resistance in

cowpea. Trop. Agric. 54 (1): 53-59

Williams. J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalkski. 1990. DNA
polymorphisms amplified by arbitrary primers are useful as genetic
markers. Nucleic. Acid Res. 18: 6531-6535.

Wintermantel WM, Banerjee N, Oliver JC, Paolillo DJ, Zaitlin M. 1997.

cucumber mosaic virus is restricted from entering minor veins in
transgenic tobacco exhibiting replicase-mediated resistance. Virology
231:248–57

156
Wolff K, Schoen ED, Peters-Van Rijn J. 1993. Optimizing the generation
of random amplified polymorphic DNA in chrysanthemum. Theor. Appl.
Genet. 86:1033-1037.

Wu K, Jones R, Dannaeberger L, Scolnik PA. 1994. Detection of

microsatellite polymorphisms without cloning. Nucleic Acids Res.
22:3257-3258.

Wu, K.S. and Tanksley, S.D. 1993. Abundance, polymorphism and

genetic mapping of microsatellites in rice. Mol. Gene. Genet. 241: 225-
235.

Xiao, J., J. Li, L. Yuan, S.R. McCouch, and S.D. Tanksley. 1996. Genetic
diversity and its relationship to hybrid performance and heterosis in
rice as revealed by PCR-based markers. Theor. Appl. Genet. 92:637–
643.

Xu, G.W., C.W. Magill, K.F. Schertz, G.E. Hart. 1994. A RFLP linkage
map of Sorghum bicolor (L.) Moench. Theoretical and Applied
Genetics. 89 (2-3): 139 – 145

Yencho, G.C., M.B. Cohen, and P.F. Byrne. 2000. Applications of tagging
and mapping insect resistance loci in plants. Annu. Rev. Entomol.
45:393–422

Yoshii M, Yoshioka N, Ishikawa M, Naito S. 1998a. Isolation of an

Arabidopsis thaliana mutant in which accumulation of cucumber
mosaic virus coat protein is delayed. Plant J. 13:211–19

Yoshii M, Yoshioka N, Ishikawa M, Naito S. 1998b. Isolation of an

Arabidopsis thaliana mutant in which the multiplication of both
cucumber mosaic virus and turnip crinkle virus is affected. J. Virol.
72:8731–37

Young, N.D. 1999. A cautiously optimistic vision for marker-assisted

breeding. Mol. Breed. 5: 505–510

157
Young, N.D., C.A. Fatokun, D. Menancio-Hautea, D. Danesh. 1992.
RFLP mapping in cowpea. In: Thottappilly G, Monti GL, Mohan Raj
DR, Moore AW (eds) Biotechnology, enhancing research on tropical
crops in Africa. CTA/IITA, Ibadan, Nigeria, pp 237–246

Zietkiewicz E, Rafalski A, Labuda D. 1994. Genome fingerprinting by

simple sequence repeats (SSR)-anchored PCR amplification.
Genomics 20:176-183.

158
Dr. Kamla Chaudhary
Major advisor and chairman

1. Dr. K.S. Boora

2. Dr. A.S. Yadav

3. Dr. Indra Hooda

4. Dr. Jaivir Singh

(Members of the advisory

committee)

Head of Department

159
Approved

Dean, post-Graduate Studies

160