Anda di halaman 1dari 11

MERANCANG PROBE

MERANCANG PROBE
A. Tujuan
1.

Merancang dan menganalisis probe yang akan di gunakan dalam nothern


blot secara komputerisasi menggunakan biofarmatics database(NCBI).

2.

Mengetahui dan memahami cara mendeteksi terjadinya ekspresi gen dengan


tekhnik hibridisasi metode northern bolt.

B. Dasar Teori
Pemahaman kerja sel secara rinci dalam rangka molekuler saat ini
banyak mengalami perkembangan.Dahulu,cara untuk menyelidiki informasi
yang terkandung dalam DNA adalah melalui genetika,yang memungkinkan
deduksi fungsi-fungsi gen dari fenotip-fenotip organisme mutan serta
keturunannya.Sekarang,telah disempurnakan dengan seperangkat teknik
yang umum dikenal sebagai teknologi DNA rekombinan.
DNA merupakan polinukleotida yang terdapat dalam inti sel yang secara
kimiawi berupa asam nukleat yang tersusun secara double helix.Sedangkan
kromosom DNA adalah DNA yang tersusun secara kompak yang diikat oleh
protein-protein.bagian dari kromosom adalah gen.Gen adalah suatu unit DNA
yang diturunkan.Setiap GEN terdiri dari suatu rangkaian DNA yang membawa
informasi dari suatu protein.
Apabila larutan berair DNA dipanaskan sampai 1000 C atau berada
dalam kondisi dengan pH tinggi (pH >13),maka pasangan basa yang
komplemen berikatan membentuk double helix akan terdisosiasi menjadi dua
singgle strand.Proses ini disebut denaturasi DNA,dimana untuk beberapa
tahun yang lalu merupakan reaksi yang irreversible.
Reaksi hibridisasi adalah proses dimana singgle stand asam nukleat yang
komplementer dapat dengan mudah membentuk double stand kembali.Pada
reaksi hibridisasi rangkaian asam nukleat yang komplamenter dengan
konsentrasi rendah tetap dapat terdetekksi asalkan digunakan DNA probe
sebagai indikatornya.Teknik hibridisasi ini juga dapat di gunakan untuk
mencari gen yang tidak identik namun mempunyai suatu hubungan.Selain
itu,DNA probe dapat digunakan untuk menyelidiki ekspresi gen (dalam reaksi
hibridisasi dengan RNA).Hibridisasi DNA probe dengan RNA sel
memungkinkan aktif tidaknya suatu gen.Selain itu dapat menentukan

terjadinya perubahan akibat mekanisme kendali yang bekerja terhadap


transkripsi DNA,splising RNA atau translasi molekul-molekul mRNA-nya yang
sudah matang ke dalam protein jika ekspresi sebuah gen berubah.
DNA probabe sering di gunakan bersama dengan elektroforesis gel
untuk mendeteksi molekul-molekul asam nukleat dengan rangkaian-rangkaian
yang komplementer dengan semua atau sebagian dari rangkaian probe.
Untuk menganalisis RNA yang menyediakan suatu protein dengan
DNA probe terhadap RNA digunakan cara yang disebut northern
Blotting.Mula-mula molekul RNA yang masih utuh dari sel-sel suatu organ
dipisah(fraksionasi)menjadi sederet pita pada gel elektroforesis.Selanjutnya
agar molekul-molekul RNA itu dapat dimasuki oleh DNA probe perlu dibuat
replika gel dengan cara memindahkan(blotting)molekul-molekul RNA yang
telah difraksionasi pada sehelai kertas nitroselulosa atau kertas kertas
nilon.Molekul-molekul RNA yang telah membentuk hybrid dengan DNA probe
yang radioaktif(karena memiliki sebagian dari rangkaian gen yang normal)
kemudian ditentukan lokasinya dengan menginkubasi kertas tersebut dengan
larutan yang mengandung probe dan probe telah membentuk hybrida
dideteksi dengan otoradiografi.Karena molekul-molekul asam nukleat yang
kecil bergerak melintasi gel lebih cepat bila dibanding molekul-molekul yang
besar,ukuransetiap RNA yang mengikat probe dapat ditentukan dari laju
migrasi molekul-molekul RNA dengan ukuran yang diketahui(RNA standar).
C. Alat dan Bahan
Perangkat komputer

Jaringan Internet

D. Cara Kerja
Buka situs NCBI(PubMed)melalui www.google.com /MSN
Ketik E2F pada search nucleotide for dan klik go
Pilih salah satu gen (utamakan yang homosapiens/human),klik
Tentukan 3 macam probe di daerah CDS,dengan memilih sekuen
100-150 basa

Masukkan probe dalam analisis BLASTn,dikotak QUERY,klik


BLAST
Klik format
Setelah didapat hasilnya,ditentukan komplemen dan
komplementitornya

Bandingkan hasil antara 3 probe,tentukan yang terbaik

E.
F.Pembahasan
Praktikum ini kita akan merancang probe.Probe adalah indikator untuk mendeteksi
ekspresi dari suatu gen pada reseptor yang dilakukan secara komputerisasi.sangat
bermanafaat untuk mengetahui disain probe sebelum mensintesisnya. Penyelidikan disain
probe yang ideal di antaranya dapat membedakan dengan baik antara target yang diinginkan
dan non target,kita juga dapat mendeteksi perbedaan konsentrasi gen di bawah kondisi
hibridisasi.Aspek seleksi pada DNA probe itu sendiri meliputi;panjang probe(semakin
panjang semakin spesifik,namun jikalau DNA probe terlalu panjang ,probe tersebut susah
untuk disintesis dan juga probe bisa mengikat dirinya sendiri,sehingga mengurangi afinitas
dengan DNA target). Hibridization Affinity /Suhu leleh optimal (untuk hibridisasi semakin
tinggi suhu semakin bagus).Selektif (Hindari Cross-hibridisasi) .Folding (menghindari
pemeriksaan diri anil) .Low-kompleksitas(menghindari urutan disain yang selalu AAA atau
yang berulang,karena dapat mengurangi selektivitas). Penerapan DNA Probe itu
sendirimeliputi pemilihan rekombinan cDNA tentang kloning.Dan Microarray DNA, dapat
digunakan untuk mendeteksi perbedaan dalam ekspresi gen tingkatan dalam populasi yang
berbeda dari sel-sel pada tingkat genome.

Pada praktikum kali ini kita menggunakan metode Northern blotting.Pada dasarnya
metode yang dapat digunakan ada 3, yaitu northern blot (untuk RNA), southern blot (untuk
DNA), dan western blot (untuk Protein).Northern blotting adalah teknik yang

digunakan dalam penelitianbiologi molekuler untuk mempelajari ekspresi gen


dengan mendeteksi RNA(mRNA atau terisolasi) dalam sampel (Alberts, B.2008).
Dengan Northern blotting kita dapat mengamati kontrol selular dalamstruktur dan
fungsinya, dengan menentukan tingkat ekspresi gen tertentuselama differentiation,
morphogenesis, serta kondisi tidak normal atau sakit.(Schlamp,
K.2008).Northern blotting melibatkan
penggunaan elektroforesissampel RNA terpisah berdasarkan ukuran dan
deteksi dengan hibridisasi probe melengkapi sebagian atau seluruh urutan target. Istilah
Northernblotting sebenarnya mengacu pada transfer kapiler RNA dari elektroforesisgel ke
membran blotting. Teknik Northern blotting dikembangkan pada tahun 1977
oleh James Alwine, David Kemp, dan George Stark di Stanford University.
Pada praktikum ini kita merancang,menganalisis probe secara komputerisasi
menggunakan biofarmasetics database (NCBI),serta mendeteksi terjadinya ekspresi gen
dengan tekhnik hibridisasi metode northern blot.Oleh karena,cara yang pertama yaitu
membuka situs NCBI(pubmed),lalu memilih nucleotide,selanjutnya menulis gen target yang
diinginkan.Saya memilih INS,dan klik go.Setelah itu muncul:

Reseptor yang saya pilih dalam desain probe adalah insulin (INS), dengan sel target
synaptotagmin VIII (SYT8)pada manusia. Insulin adalah hormon yang dihasilkan oleh
sel
Langerhans yang berperan dalam menurunkan konsentrasi glukosa darah dan
meningkatkan proses glikolisis, glukogenosis, dan lipogenesis.
Selanjutnya saya memilih salah satu gen terutama Homo sapiens(manusia) untuk
melihat ekspresi dari mRNA manusia.

Kemudian saya mengklik CDS pada hasil ekspresi gen yang telah di pilih dan akan
muncul semua rantai mRNA yang digunakan dalam analisis BLAST.

Lalu mengeblok 100 sampai 150 rantai mRNA ,jumlah tersebut bertujuan agar lebih
baik hasil yang didapatkan.Mengkopinya di Word untuk di hapus nomer dan
spasinya.Mengklik run BLAST,setelah itu mengkopi rantai mRNA tadi ke dalam kolom
analisis BLAST. Selanjutnya menulis nama Probe,dan mengklik format ,lalu akan didapatkan
hasilnya.Selanjutnya kita dapat menentukan komplemen dan kompetitornya.

Didapatkan hasil 3 Probe,di antaranya:


1. Probe 129-240

atgctccacctgcatggctggcaaaccatgcagggtagaaagatggggcacccaccagtctctcccagtgccccggccccagctgg
caccacagctatacctgggcttattc
Desain probe pertama diperoleh hasil gen target berada pada posisi pertama
dengan 6 kompetitor, dan komplemen yang di peroleh max score: 207, total score: 207, query
cover: 100%, E value: 1e- 50, dan max ident 100%.Max / Total Nilai memiliki arti jumlah
kesamaan basa probe yang di disain,semakin tinggi Max score semakin baik.
Nilai E memiliki arti jumlah entri yang diperlukan dalam database untuk
pertandingan terjadisecara kebetulan acak. Misalnya E = e-6 berarti bahwa satu
pertandinganyang akan diharapkan untuk setiap 1.000.000 entri dalam database.Semakin
kecil E value semakin baik.Max Ident berarti bahwa suatu gen dapat berhibridisasi dengan
gen lain sebesar x.Query cover menunjukkan berapa persen ikatan.

2.

Probe 241-350
cagaccttgtcgccgggaccccctggccccgctgggctctcattgccggcgcccttgccgcgggcgtcctcctcgtctc
ctgcctcctctgtgctgcctgctgctgctgccgccgccaca
Hasil untuk desain probe ke-dua ini,gen target memiliki lebih dari 10 kompetitor(12
kompetitor) dan gen target yang diinginkan berada pada posisi kelima, sedangkan pada posisi
pertama adalah gen target yang tidak diinginkan. Jadi, hasil yang didapatkan tidak jauh lebih
baik daripada desain yang pertama karena mempunyai jumlah kompetitor yang lebih banyak
dan posisi gen target yang diiginkan tidak pada posisi pertama.

3.

Probe 361- 480


ggaagaagcccagggacaaggagtccgtgggtctgggcag tgcccgcggcaccaccaccacccacctggt
gcaacctgatgtggatggcctggagtccagcccgggggatgctcagcaat
Desain ketiga di peroleh hasil dimana gen target memiliki lebih dari 10 kompetitor
dan gen target yang diinginkan berada pada posisi kelima, sedangkan pada posisi pertama
adalah gen target lain yang tidak diingankan. Jadi, hasil yang didapatkan tidak jauh lebih baik
daripada desain yang pertama dan kedua.

Dari ketiga probe di atas, dapat disimpulkan bahwa desain probe yang pertama lebih baik dari
pada hasil probe yang kedua dan ketiga. karena desain yang pertama memiliki enam
kompetitor dan gen target berada pada posisi pertama. Sedangkan desain yang kedua dan
ketiga memiliki lebih dari 10 kompetitor dan posisi gen target yang diinginkan tidak pada
posisi pertama melainkan pada posisi kelima.

KESIMPULAN
1. Probe adalah indikator untuk mendeteksi eksprei gen secara komputasi dengan beberapa
metode, seperti northern blot (untuk RNA), southern blot (untuk DNA), dan western blot
(untuk protein).
2.

Praktikum ini mendeteksi ekspresi gen dengan metode northern blotting. northern blot
yaitu suatu metode untuk mengetahui ekspresi RNA, tepatnya adalah mRNA pada
manusia (Homo sapiens).

3. Kriteria desain probe yang baik adalah yang dapat membedakan sel target dan non target,
serta dapat membedakan konsentrasi yang berbeda.
4. Pada desain probe ini reseptor yang digunakan adalah reseptor insulin dengan sel target
synaptotagmin VIII (SYP8).
5. Dari 3 desain probe yang dilakukan di dapat hasil yaitu, probe pertama yang memiliki 6
target lain sebagai kompetitor yang memiliki nilai komplemen yang sama tetapi sel target
yang diinginkan berada pada posisi pertama.
6. Desain probe yang kedua dan ketiga, sel target yang diinginkan berada pada posisi kelima
dan memiliki lebih dari 10 sel target lain sebagai kompetitor.Selain itu memiliki nilai
komplemen yang sama.
7. Probe yang memiliki aksi yang paling spesifik ialah desain probe pertama.

DAFTAR PUSTAKA
Alberts, B., Johnson, A., Lewis, J. Raff, M., Roberts, K., Walter, P. 2008. Molecular Biology
of the Cell, 5th ed. Garland Science, Taylor & Francis Group, NY, pp 538-539.
Schlamp, K.; Weinmann, A.; Krupp, M.; Maass, T.; Galle, P. R.; Teufel, A. (2008). "BlotBase:
A northern blot database". Gene 427 (12): 4750.