Anda di halaman 1dari 33

PENGEMBANGAN DIAGNOSIS MOLEKULER

TOKSOPLASMOSIS BERDASARKAN SEKUEN


SPESIFIK Deoxyribonucleic Acid STADIUM
TAKIZOIT DAN BRADIZOIT

oleh

Ida Ayu Pasti Apsari


08/276691/SKH/62

PROGRAM STUDI SAIN VETERINER


FAKULTAS KEDOKTERAN HEWAN
UNIVERSITAS GADJAH MADA
YOGYAKARTA
2012

PENGEMBANGAN DIAGNOSIS MOLEKULER


TOKSOPLASMOSIS BERDASARKAN SEKUEN
SPESIFIK Deoxyribonucleic Acid STADIUM
TAKIZOIT DAN BRADIZOIT

Disertasi untuk memperoleh derajat


Doktor dalam Ilmu Kedokteran Hewan pada
Universitas Gadjah Mada

Dipertahankan terhadap sanggahan


Dewan Penguji Program Studi Sain Veteriner
Fakultas Kedokteran Hewan Universitas Gadjah Mada
Pada tanggal : 18 Juli 2012

oleh
Ida Ayu Pasti Apsari
08/276691/SKH/62

Lahir
di Denpasar Bali
ii

PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS


BERDASARKAN SEKUEN Deoxyribonucleic Acid SPESIFIK
STADIUM TAKIZOIT DAN BRADIZOIT
RINGKASAN

PENDAHULUAN
Latar Belakang
Toksoplasmosis merupakan penyakit zoonosis yang tersebar di seluruh dunia.
Kasus toksoplasmosis pada hewan dan manusia di Indonesia sangat tinggi. Prevalensi
toksoplasmosis pada manusia 4085%, sedangkan pada hewan berkisar antara 580%
(Subekti et al., 2005). Tingginya kasus toksoplasmosis dan dampak negatif yang
berakibat kerugian ekonomi maupun penurunan produksi, maka diagnosis menjadi hal
yang sangat penting. Diagnosis melalui gejala klinis, toksoplasmosis tidak menciri
(Bastien, 2002), melalui metode immunologis masih memerlukan uji tambahan
(Remington et al., 2004), sedangkan melalui level molekuler, walau memberi hasil yang
spesifik namun, biayanya mahal dan memerlukan peralatan khusus. Metode diagnosis
yang praktis dan akurat oleh karena itu perlu dilakukan pengembangan. Penelitian ini
berupaya mengembangkan diagnosis molekuler toksoplasmosis berdasarkan sekuen
DNA spesifik stadium takizoit dan bradizoit sebagai probe molekuler dengan metode
aplikasi hibridisasi dot blot.
Tujuan Penelitian
Tujuan umum untuk mendapat DNA probe berdasar fragmen DNA spesifik
stadium takizoit dan bradizoit yang dapat memenuhi syarat sebagai probe untuk
mendeteksi toksoplasmosis.
Tujuan khusus yaitu 1. mengamplifikasi dan sekuensing fragmen spesifik DNA
takizoit dengan primer gen sag-1 dan bag-1 T. gondii, 2. menganalisis sekuen spesifik
fragmen DNA stadium takizoit dan bradizoit yang dapat digunakan sebagai kandidat
probe, 3. membuat optimalisasi probe takizoit dan bradizoit dengan metode hibridisasi
84

dot blot untuk mendeteksi komplementernya, 4. menentukan spesifisitas dan sensitivitas


probe takizoit dan bradizoit dalam metode diagnosis aplikasi dot blot untuk mendeteksi
T. gondii.
Manfaat Penelitian
Probe takizoit dan bradizoit diharapkan dapat digunakan untuk mendeteksi
infeksi akut dan infeksi kronis, sehingga secara tidak langsung dapat membantu
meningkatkan keamanan pangan dari hewan ke manusia. Probe molekuler ini juga dapat
digunakan pada proses hibridisasi lain, seperti southern blot, northen blot atau in situ
hybridization, sehingga berguna bagi pengembangan ilmu pengetahuan baik dalam
bidang biologi maupun pada bidang parasitologi.
TINJAUAN PUSTAKA
Toksoplasmosis
Toksoplasmosis disebabkan oleh protozoa Toxoplasma gondii (Tenter et al.,
2000). Toxoplasma gondii adalah parasit intraseluler obligat yang termasuk phyllum
Apicomplexa, class Sporozoea, ordo Eucoccidiida, family Sarcocystidae dan genus
Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). Parasit ini dapat
menginfeksi semua vertebrata termasuk manusia dan berbagai hewan termasuk unggas
serta hewan berdarah panas lainnya (Tenter et al., 2000; Dubey and Jones, 2008).
Stadium infektif T. gondii yaitu, oosista yang hanya terdapat pada feses hospes definitif,
sedangkan stadium takizoit dan bradizoit terdapat dalam bentuk sista jaringan di hospes
perantara (Tenter et al., 2000; Dubey, 2007).
Rantai siklus hidup dari T. gondii, bisa terjadi penularan dari hospes definitif ke
hospes perantara, dari hospes perantara ke hospes definitif dan diantara hospes
perantara. Penularan terus berlanjut dalam waktu yang tidak terbatas, melalui sista
jaringan diantara hospes perantara (walaupun pada keadaan ketidak hadiran hospes
definitif) dan juga penularan dari oosista diantara hospes definitif (bahkan dalam ketidak
hadiran hospes perantara) (Tenter et al., 2000).
Adanya antibodi dalam serum untuk keperluan diagnosis toksoplasmosis,
merupakan manifestasi dari respon hospes terhadap keberadaan T. gondii di dalam
85

tubuhnya. Antibodi IgM terbentuk pada awal infeksi dan dapat dideteksi 5 hari setelah
infeksi. Antibodi ini meningkat cepat selama 2 minggu dan menghilang setelah 23
bulan. Antibodi IgG dibentuk kemudian yang bisa bertahan cukup lama sampai 1 tahun.
Adanya IgG merupakan tanda infeksi kronis (Cornain et al., 1990; Lubis et al., 1997).
Takizoit yang menginfeksi hospes cepat berreplikasi dan dengan cepat menyebar
ke seluruh tubuh hospes. T. gondii secara mudah melewati barier darah retina, otak dan
plasenta. Hospes yang mempunyai imunitas, menyebabkan takizoit berubah menjadi
bradizoit.

Bradizoit berada di dalam sel, membentuk sista jaringan yang resisten

(Filiceti and Candolfi, 2004).


Diagnosis Toksoplasmosis
Diagnosis penyebab toksoplasmosis dapat dilakukan dengan dua cara yaitu
secara klasik dan modern. Diagnosis secara klasik, berdasar gejala klinis, tidak berlaku
untuk toksoplasmosis, karena toksoplasmosis secara klinis tidak menunjukkan gejala
yang spesifik (Bastien, 2002), diagnosis dengan uji biologis, metode ini tidak praktis
karena memerlukan waktu lama, sedangkan diagnosis metode immunologis juga tidak
efektif karena masih memerlukan uji tambahan dan sering memberi hasil negatif palsu
(Remington et al., 2004). Diagnosis secara modern, pada level molekuler, berdasar
deoxyribonucleic acid (DNA) T. gondii, seperti metode Polymerase Chain Reaction
(PCR), (Susanto et al., 2002;

Priyowidodo,

2003) yang mengamplifikasi sekuen

spesifik Toxoplasma gondii memberi hasil yang sangat spesifik, namun metode ini
biayanya mahal dan memerlukan peralatan khusus. Diagnosis pada level molekuler yang
mempunyai kendala dalam hal interpretasi hasil, maka metode teknik hibridisasi dengan
DNA probe dapat dikembangkan (Samuelson et al., 1989; Garberi et al., 1994; Akin,
2001; Aidawati et al., 2007; Sarova and Saigoval, 2010).
Gena sag-1 dan bag-1 Toxoplasma gondii
Toxoplasma gondii mempunyai tiga stadium infektif yaitu takizoit, bradizoit dan
sporozoit. Secara struktur ketiganya mirip, tapi mereka beda dalam penotipe dalam
ekspresi protein spesifik. Protein 65 kDa sebagai MAG-1 dipakai sebagai penanda
ekspresi secara khusus selama bradizoit, karena protein ini berlokasi dalam sista jaringan
86

dan secara imunobloting akan terdeteksi oleh ekstrak sista (Holec et al., 2007).
Penelitian sebelumnya juga mendukung bahwa P30 dan P22 merupakan antigen spesifik
takizoit yang reaktif.
Toxoplasma gondii mempunyai gena sag-1 merupakan gena spesifik untuk
stadium takizoit, sedangkan bag-1 merupakan gena spesifik untuk stadium bradizoit
(Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004;
Kazemi et al., 2007a dan Kazemi et al., 2007b). Melalui metode Polymerase Chain
Reaction (PCR) gena spesifik stadium tertentu berhasil diisolasi menggunakan primer
dengan panjang 18-24 nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Landasan Teori
Sista T. gondii (terdapat di jaringan) terkandung di dalamnya sejumlah bradizoit,
dan takizoit terdapat bebas di cairan ekskresi dan sekresi (Tenter et al., 2000; Weiss and
Kim, 2000). Menurut Zhang et al.(1999), Weiss dan Kim (2000) dan Ajioka et al.
(2001) ada gena yang spesifik pada stadium takizoit dan gena spesifik pada stadium
bradizoit. Gena sag-1 merupakan gena spesifik untuk stadium takizoit, sedangkan bag-1
merupakan gena spesifik untuk stadium bradizoit (Weiss and Kim, 2000; Ajioka et al.,
2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi et al., 2007a; Kazemi et al.,
2007b). Sampai saat ini, eksplorasi kedua gena tersebut untuk tujuan diagnosis belum
banyak dilakukan. Menggunakan metode Polymerase Chain Reaction (PCR) gena
spesifik stadium tertentu berhasil diisolasi menggunakan primer dengan panjang 18-24
nukleotida (Susanto et al., 2002; Priyowidodo, 2003).
Deoxyribonucleic acid dapat digunakan sebagai probe molekuler untuk diagnosis
penyakit,

disamping DNA mempunyai sifat yang komplementer dan adanya sifat

sekuen yang conserve (konstan) dan variabel. Sekuen yang baik untuk calon probe
adalah sekuen yang conserve (Keller and Manak, 1989; Weiss, 1995). Panjang pendek
sekuen dan jumlah copy gene sebagai calon probe juga mempengaruhi kualitas probe.
Sekuen dengan panjang 100 300 bp ideal sebagai probe (Leitch et al., 1994), dan
repetitif sekuen gen dengan jumlah 300 copy berhasil digunakan sebagai probe untuk
mendiagnosis toksoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).
Probe yang diperoleh dari gena yang mempunyai jumlah copy gene yang tinggi,
87

hibridisasi lebih cepat daripada yang lebih rendah. Isolasi dan analisis gena sag-1
(Ajioka et al., 2001) dan bag-1 (Bohne et al., 1995) mempunyai single copy, sebagai
calon probe molekuler diharapkan dapat mendeteksi T. gondii.
Hipotesis
1. Primer spesifik gena sag1 dan bag-1 dapat dipergunakan untuk mengamplifikasi
fragmen DNA takizoit T. gondii isolat lokal
2. Sekuen spesifik DNA stadium takizoit dan bradizoit dapat digunakan sebagai
probe molekuler toksoplasmosis
3. Probe takizoit dan bradizoit dapat dipergunakan mendeteksi toksoplasmosis
4. Probe takizoit dan bradizoit memiliki spesifisitas dan sensitivitas yang tinggi
sehingga dapat diaplikasikan untuk mendeteksi T. gondii
METODE PENELITIAN DAN CARA ANALISIS
Deoxyribonucleic Acid (DNA) takizoit diisolasi dari Takizoit Toxoplasma gondii
isolat lokal dengan metode alkali lysis. Sekuen spesifik fragmen gena sag-1 dan bag-1
Toxoplasma gondii, berhasil diamplifikasi dengan metode polymerase chain reaction
(PCR)

menggunakan

primer

sag-1

(forward:

5-CACCTGTAGGAAGCTG

TAGTCACTG 3 reverse: 5- TCACTGTGACCATACAACTCTGTG - 3) dan bag-1


(forward: 5-AGGAGAGAAGACCTCGAAAGAAG-3reverse: 5-TGAACGCTAGGT
TTCTGGATACG-3) dan PCR reaction mix (Invitrogen). Produk PCR disekuensing
dengan Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser di
Eijkman Institute, Jakarta. Spesifisitas sekuen stadium takizoit (sag-1) dan bradizoit
(bag-1) dianalisis menggunakan program BLAST, dengan: genom T. gondii yang ada
pada GenBank, genom hospes (sapi, kambing, domba, babi, unggas dan manusia),
parasit yang mempunyai hubungan kekerabatan dekat dengan T.gondii (Sarcocystis,
Hammondia hammondi, Neospora, Isospora, Eimeria). Analisis juga dilakukan diantara
kedua sekuen, untuk memastikan tidak terjadi reaksi silang. Kajian sekuen sebagai probe
molekuler untuk metode hibridisasi dengan aplikasi dot blot, terlebih dahulu dilakukan
pelabelan menggunakan Dig high prime DNA labeling and detection starter kit (Roche).

88

HASIL PENELITIAN
Sekuen sag-1 T. gondii isolat lokal hasil sekuensing 612 sekuen dan sekuen bag1 T. gondii isolat lokal hasil sekuensing 470 sekuen sangat conserve dengan beberapa
strain yang ada di GenBank. Analisis bagian sekuen yang conserve dari sekuen sag-1
dan bag-1 T. gondii isolat lokal diperoleh sekuen sebagai kandidat probe. Kandidat
probe yang dipilih memiliki spesifisitas terhadap T. gondii (tidak bereaksi silang dengan
hospes dan parasit lain, serta memiliki tingkat homologi yang tinggi dengan berbagai
strain T. gondii). Hasil analisis probe sag1 dan bag1 dengan program BLAST terhadap
hewan yang berperan sebagai hospes T. gondii tidak ada sekuen yang dikenal oleh
hospes, demikian pula pada parasit lain seperti Tyzzeria anseris, Histomonas
meleagridis, Trichomonas gallinae, Hexamita sp dan Sarcocystis yang kemungkinan
bisa menyerang ayam tidak ada index similarity yang signifikan. Probe terpilih lebih
difokuskan untuk diagnosis ayam.
Probe

sag1

panjang

136

nt

mengandung

52,2%

GC,

dengan

sekuen

CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGC
CCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCT
TGATTCCTGAAGCAGAAGATAGCTGGTGGAC dan probe bag-1 panjang 98 nt
mengandung 57,6% GC, dengan sekuen GCGCGCCGGTTCCAGCTCCCGAGTA
ATTACAAGCCCGACGGAATCAGTGCGGCAATGGACAACGGCGTTCTACGTG
TCACGATCAAGGTCGAGGA. Aplikasi probe untuk mendeteksi suatu agen patogen
dalam sampel klinis, probe harus memiliki kemiripan genetik tinggi dengan agen
patogen dan kemiripan genetik yang rendah dengan genom hospes (Rueue, 1998;
Brown, 2006). Panjang probe juga mempengaruhi spesifisitasnya (Pruitt et al., 2005).
Probe sag1 6,72 pg/l berhasil mendeteksi 0,45 ng/l DNA, sedangkan probe bag1
5,87 pg/l

berhasil mendeteksi 0,23 ng/l DNA ayam buras yang terinfeksi

toksoplasmosis.

89

SIMPULAN DAN SARAN


Simpulan
Deoxyribonucleic acid probe berdasar sekuen spesifik DNA stadium takizoit
(sag-1) dan bradizoit (bag-1) T. gondii

dapat digunakan untuk mendeteksi

toksoplasmosis pada ayam buras dengan hibridasi dot blot. .


Saran
Disarankan

menggunakan

probe

sag-1

dan

bag-1

untuk

diagnosis

toksoplasmosis pada ayam buras dengan metode hibridisasi dot blot. Penelitian
selanjutnya disarankan menggunakan probe sag-1 dan bag-1 untuk mendeteksi T. gondii
pada daging sebagai fungsi probe untuk keamanan pangan.

90

MOLECULAR DIAGNOSIS OF TOXOPLASMOSIS BASED ON


DEOXYRIBONUCLEIC ACID SPECIFIC SEQUENCE
OF TACHYZOITE AND BRADYZOITE STAGE
SUMMARY
INTRODUCTION
Background
Toxoplasmosis is a zoonotic disease that spread throughout the world. Cases of
toxoplasmosis in animals and humans in Indonesia is very high. The prevalence of
toxoplasmosis in humans 40-85%, whereas in the animals ranged from 50-80% (Subekti
et al, 2005). The high cases of toxoplasmosis and negative impacts that result in
economic losses and decline in production, then the diagnosis becomes very
important. Diagnosis by clinical symptoms, toxoplasmosis does not distinguish (Bastien,
2002), by immunologically the method still requires an additional test (Remington et
al., 2004), whereas the molecular level, although giving a specific result, however, be
expensive and require special equipment. Therefore required the development the
practical and accurate methods of diagnosis. This study make serious efforts to develop
molecular diagnosis of toxoplasmosis based on specific DNA sequences tachyzoite and
bradyzoite stage as molecular probes by hybridization method of dot blot application.
Objectives of the Research
The general obyective of the research is to get a DNA probe based on specific
DNA fragments tachyzoite and bradyzoite stage that can qualify as molecular probe to
detect toxoplasmosis.
The specific objectives are 1) to amplifaying and sequensing tachyzoite specific
DNA fragment using the primer sag1 and bag1 gene Toxoplasma gondii, 2) to analyze
the specific sequences of DNA fragments tachyzoite and bradyzoite stage that can be
used as candidate probes, 3)to make optimization tachyzoite and bradyzoite probe by
hybridization method using dot blot aplication for detection of its complementary, 4) to
91

determine the spesivisity and sensitivity of the tachyzoite and bradyzoite probe in the dot
blot method of diagnostic applications to detect Toxoplasma gondii.
Benefits of Research
Tachyzoite and bradyzoite probe expected to be used to detect acute and chronic
infections, so it may indirectly help to improve food safety from animals to
humans. Molecular probes can also be used in the hybridization process, such as
Southern blotting, Northern blotting or in situ hybridization, making it useful for the
development of field science in biology and parasitology
LITERATURE REVIEW
Toxoplasmosis
Toxoplasmosis is caused by the protozoan Toxoplasma gondii (Tenter et al.,
2000). Toxoplasma gondii is an obligate intracellular parasites belongs to phyllum
Apicomplexa, class Sporozoea, Eucoccidiida order, family Sarcocystidae and genus
Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). These parasites can
infect all vertebrates including humans and various animals including birds and other
warm-blooded animals (Tenter et al., 2000; Dubey and Jones, 2008). Infective stage of
T. gondii, oocyst present only in the definitive host feces, while the tachyzoite , and
bradyzoite stage contained in the cyst form of intermediate host tissues (Tenter et al.,
2000; Dubey, 2007).
Life cycle chain of T. gondii, transmission can occur from the intermediate host to
definitive host, the intermediate host to definitive host and among intermediate
host. Transmission continues in indefinitely, through the tissue cyst between
intermediate host (although in the absence of definitive host) and also the transmission
of oocyst between definitive hosts (even in the absence of intermediate host) (Tenter et
al., 2000).
Presence of antibodies in the serum for diagnosis of toxoplasmosis, is a
manifestation of host response to the presence of Toxoplasma in its body. IgM
92

antibodies are formed early in infection and can be detected 5 days after infection. These
antibodies increase rapidly for 2 weeks and disappeared after 2-3 months. IgG antibodies
formed later that can survive long enough to 1 year. The presence of IgG is a sign of
chronic infection (Cornain et al., 1990; Lubis et al., 1997).
Tachyzoite infected host that fast replication and quickly spread throughout the
body. Toxoplasma easily pass through the blood retinal barrier, brain and placenta. Host
who have immunity, causing tachyzoite turned into bradyzoite form. Bradyzoite that is
in the intracellular, forming a resistant tissue cyst (Filiceti and Candolfi, 2004).
Diagnosis of Toxoplasmosis
The etiologic diagnosis of toxoplasmosis can be done by classical and modern
techniques. The classical techniques, based on clinical symptoms, do not apply to
toxoplasmosis, because toxoplasmosis is clinically not show specific symptoms
(Bastien, 2002), diagnosis with biological tests, this method is not practical because it
requires a long time, while the diagnosis of immunologically method is also not
effective because still require additional testing and often give false negative results
(Remington et al., 2004). The modern techniques, on a molecular level, based on
deoxyribonucleic acid (DNA) of T. gondii, such as the method of Polymerase Chain
Reaction (PCR), (Susanto et al. 2002; Priyowidodo, 2003) which amplifying a
Toxoplasma gondii specific sequences give very specific results, but the method is
expensive and requires special equipment. Diagnosis at the molecular level that have a
constraint in interpretation of the results, then the method of hybridization with DNA
probe techniques can be developed (Samuelson et al., 1989; Garberi et al., 1994; Akin,
2001; Aidawati et al., 2007; Sarova and Saigoval , 2010).
Sag-1 and Bag-1 Toxoplasma gondii genes
Toxoplasma gondii has a three infective stage namely, tachyzoite, bradyzoite and
sporozoites. In all of the structures are similar, but they vary in penotipe in the
expression of specific proteins. Protein 65 kDa as the MAG-1 is used as a marker
expression specifically during bradyzoite, because this protein is located in tissue cyst
93

and imunobloting cyst will be detected by a cyst extract (Holec et al., 2007). Previous
research also supports that the P30 and P22 is a specific tachyzoite reactive gene.
Toxoplasma gondii has specific gene. Sag-1 is specific gene for tachyzoite stage,
whereas Bag-1 is specific gene for bradyzoite stage (Weiss and Kim, 2000; Ajioka et
al., 2001; Hartati et al., 2003; Cristina et al. 2004; Kazemi et al., 2007a and Kazemi et
al., 2007b). Polymerase Chain Reaction (PCR) method successfully to be isolate specific
genes from certain stages using the primers specific (length of 18-24 nucleotides)
(Susanto et al., 2002; Widodo, 2003).
Basic Theory
Toxoplasma cyst (found in the tissues) contained a number of bradyzoite, and there
tachyzoite freely in excretion and secretion fluid (Tenter et al., 2000; Weiss and Kim,
2000). According to Zhang et al. (1999), Weiss and Kim (2000) and Ajioka et al. (2001)
there is a specific gene on tachyzoite stage and on bradyzoite stage. Sag-1 is specific
gene for tachyzoite stage, whereas bag-1 is specific gene for bradyzoite stage (Weiss
and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi
et al., 2007a and Kazemi et al., 2007b). To date, exploration of both gene for the
purpose of diagnosis has not been done. Through the method of Polymerase Chain
Reaction (PCR) specific gene certain stages was isolated using the specific primers
(length 18-24 nucleotides)(Susanto et al., 2002 and Widodo, 2003).
DNA molecules can be used as molecular probes for diagnosis, because of the nature
of the sequence of conserve (constant) and variable. A good sequence for candidate
probe is conserve sequences (Keller and Manak, 1989; Weiss, 1995). The length of
sequence and the copy number of gene as a potential probe, also affects the quality of
the probe. Sequences with a length of 100-300 bp ideal as probes (Leitch et al., 1994),
and repetitive sequences of genes with copy number 300 successfully used as a probe for
diagnosing toxoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).
Probe from gene that have a high copy number, hybridization is faster than the lower.
Isolation and analysis of genes sag-1 (Ajioka et al., 2001) and bag-1 (Bohne et al., 1995)

94

has a single copy gene, as prospective molecular probes are expected to detect
Toxoplasma gondii.
Hypothesis
1. Using gene specific primers can be amplified sag1 and bag1 gene fragments that are
specific stages of T. gondii in 400-700bp
2.There are specific DNA sequences tachyzoite and bradyzoite stage that meets the
requirements as molecular probes
3. Probes can detect tachyzoite and bradyzoite complementary DNA.
4. Probe tachyzoite and bradyzoite has high sensitivity and specificity that can be
applied to detect toxoplasmosis.
RESEARCH METHODS AND ANALYSIS
Deoxyribonucleic acid (DNA) tachyzoite Toxoplasma gondii was isolated from local
isolates with alkaline lysis method. Specific sequences of gene fragments of sag-1 and
bag-1 T. gondii, a method successfully amplified by Polymerase Chain Reaction (PCR)
using the primers sag-1 (Forward: 5'-CACCTGTAGGAAGCTG TAGTCACTG -3
'Reverse: 5'-TCACTGTGACCATACAACTCTGTG - 3') and bag-1 (Forward: 5'AGGAGAGAAGACCTCGAAAGAAG-3 'Reverse: 5'-TGAACGCTAGGTTTCTGG
ATACG-3') and the PCR reaction mix (Invitrogen). PCR products were sequenced with
Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser at the
Eijkman Institute, Jakarta. The specivicity tachyzoite stage sequence (sag-1) and
bradyzoite (bag-1) were analyzed using the BLAST program, for : T. gondii genome that
existed at GenBank, host genome (cow, goat, sheep, pigs, poultry and humans), a
parasite that has close kinship with T.gondii (Sarcocystis, Hammondia hammondi,
Neospora, Isospora, Eimeria). The analysis was also conducted between the two
sequences, to ensure no cross-reaction occurs. Study sequences as molecular probes for
hybridization method with dot blot applications, first performed using the Dig high
prime DNA labeling and detection starter kit (Roche).

95

RESEARCH RESULTS
Sag-1 sequence of T. gondii local isolates sequencing results of 612 sequences and
bag-1 sequence of T. gondii local isolates sequencing results were very conserve 470
sequences with several strains that exist in the GenBank. The conserve

sequence

analysis of sag-1 and bag-1 T. gondii local isolates sequences, obtained locally as a
candidate probe. The selected candidate probes having specificity against T. gondii (not
cross-react with other hosts and parasites, as well as having a high degree of homology
with various strains of T. gondii). The results of the analysis probe sag-1 and bag-1 by
BLAST program for animals that act as hosts of T. gondii no sequence is known by the
host, as well as in other parasites such as Tyzzeria anseris, Histomonas meleagridis,
Trichomonas gallinae, Hexamita sp and Sarcocystis who might attack the chicken does
not no significant similarity index. Sag-1 probe length 136 nucleotide contains 52.2%
GC, with sequences CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAA
CAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGT
AACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGAC and bag-1
probe

length

of

98

ntucleotide

containing

57.6%

GC,

with

sequences

GCGCGCCGGTTCCAGCTCCCGAGTAATTACAAGCCCGACGGAATCAGTGCG
CAATGGACAACGGCGTTCTACGTGTCACGATTCGAGGA. Application of probes
for detecting a pathogenic agent in clinical samples, the probe must have a high genetic
similarity with pathogenic agents and low genetic similarity with the host genome
(Rueue, 1998; Brown, 2006). The length of the probe also affect the specificity (Pruitt et
al., 2005). The sag1 and bag1 probe successfully detected 0.45 ng/l and 0.23 ng/l
DNA domestic poultry infected toxoplasmosis.
CONCLUSION AND SUGGESTIONS
Conclusion
Based on sequence specific DNA probes tachyzoite stage (sag-1) and bradyzoite
(bag-1) Toxoplasma gondii can be specific used to detect toxoplasmosis by dot blot
hybridization method
96

Suggestion
Suggested using a probe sag1 and bag1 for diagnosis of toxoplasmosis in free-range
chicken with dot blot hybridization applications.

97

DAFTAR PUSTAKA
Anonimus. 2007. Protocols and applications. Http://www.promega.com/paguide/chap9
html 3-12-2007.
Anonimus. 2008. 260/280 and 260/230 Ratios. T042-Technical Bulletin. Nanodrop
Spectrofotometer. www.nanodrop.com.
Anonimus. 2009. Glen Reseach Product for RNA and DNA.
www.glenresearch.com/reference/...html.
Ahn, H.J.; Kim, S.; Kim, H.E. and Lappin, M.R. 2006a. Molecular cloning of rhoptry
protein (ROP6) secreted from Toxoplasma gondii. Korean J.Parasitol. 44(3):
251-254.
______. 2006b. Interactions between secreted GRA protein and host cell proteins across
the parasitophorous vacuolar membrane in the parasitism of Toxoplasma gondii.
Korean J.Parasitol. 44(4): 303-312.
Aidawati, N; Hidayat, S.H.; Hidayat, P.; Suseno, R.; Sujiprihati, S. 2007. Response of
Various Tomato Genotypes to Begomovirus Infection and Its Improved
Diagnostic. Hayati J.Bioscience. 14(3): 93-97.
Ajioka J.W.; Fitzpatrick, J.M. and Reitter, C.P. 2001. Toxoplasma gondii genomic :
shedding ligth on Pathogenesis and Chemotheraphy. Expert Review. In Mol.
Med. http://www.ermm.cbcu.cam.ac.uk. Departement of Pthology. University of
Cambridge. Cambridge: 2 19
Akin, H.M. 2001. Penggunaan Pelacak Nonradioaktif (Digoxigenin-DNA Probe) untuk
Mendeteksi Peanut Stripe Virus. J.Hama dan Penyakit Tumbuhan Tropika.
1(2): 75-79.
Ali, N.Z.; Valian, H.K.; Rezaian, M.; Khorramizadeh, M.R.; Kazemi, B.; A.Fazaeli, A.
and Darde, M. 2005. Moleculer Characterization of Toxoplasma gondii from
Bird Host. Iranian J.Publ Health. 34(3): 27-30.
Alcamo, E. 2001. DNA Analysis and Diagnosis. In DNA Technology. The A we some
skill. Second edition. Academic Press, Printed USA. 155-158.
Alfonso, Y.; Fraga, J.; Jimenez, N.; Fonseca, C.; Dorta-Contreras, A.J.; Cox, R.; Cao,
V.; Bandera, F.; Fomer, O.and Ginorio, D. 2009. Detection of Toxoplasma
gondii in cerebrospinal fluid from AIDS pasient by nested PCR and rapid
identification of type I alele at Bi gene by RLFP. Exp.Parasitol. 122(3): 203207.
98

Amirudin; Hastuti, S. dan Artama, W.T. 1999. Deteksi Antigen Toxoplasma gondii
Isolat Lokal dengan cara ELISA Sandwich menggunakan Anti bodi monoklonal.
Agrosain 12(3): 187-197.
Angel, S.O; Blanco, J.C.;Maero, E.;Pzsenny, V. and Garberi, J.C. 1991. Repetitive DNA
Sequences of Toxoplasma gondii for Development of Diagnostic Probes. Mem
Inst Oswldo Cruz, Rio de Janeiro. 86(4): 483-484.
Angel, S.O.; Maero, E.; Blanco, J.C.; Pzsenny, V.; Zala, C.; Gonzalez, R.; Perelmulter,
H. and Garberi, J.C. 1992. Early Diagnosis of Toxoplasmic Encephalitis in AIDS
Patient by Dot Blot Hyridization Analysis. J.Clinical Microbiol. 30(12): 32863287
Araujo, F.G. 1994. Immunization against Toxoplasma gondii. Parasitol.Todays 10(9):
358-360.
Artama, W.T. 2007. Animal Toxoplasmosis in Indonesia : Serologic and Biomolecular
Diagnostic. Prosiding Simposium Nasional Parasitologi dan Penyakit Tropis.
25-26 Agustus 2007. Bali: 1-11
Artama, W.T.; Utami, W.S. and Sarjono. 2009. Recombinant Granule Protein-1 for
biomolecular diagnosis of Toxoplasmosis in Indonesia. Proceeding of
Internationl Conference on Animal Health and Human Safety. 6-8 Des.2009.
Kualalumpur Malaysia: 298-306.
Artama, W.T. 2009. Biologi Molekuler Toxoplasma dan Aplikasinya pada
Penanggulangan Toxoplasmosis. Pidato Pengukuhan Jabatan Guru Besar
dalam bidang Biokimia pada FKH-UGM: 1-25.
Bastien, P. 2002. Diagnosis. Molecular diagnosis of toxoplasmosis. Transactions of The
Royal Society of Trop.Med.and Hyg. 96(1): 205-215.
Behnke, M.S.; Radke, J.B.; Smith, A.T.; Sullivan, W.J. and White, M.W. 2008. The
transcription of bradyzoite genes in Toxoplasma gondii is controlled by
autonomous promotor elements. Molecular Biology 68(6): 1502-1518.
Bonhomme, A; Maine, G.T.; Beorchia, A.; Burlet, H.; Aubert, D.; Villena, I.; Hunt, J.;
Chovan, L.; Howard, L.; Brojanac, S.; Sheu, M.; Tyner, J.; Pluot, M. and Pinon,
J.M. 1998. Quantitative immunolocalization of a P29 Protein (GRA7) a new
antigen of Toxoplasma gondii. J.Histochem.and Cytochem. 46: 1411-1422.
Brown, T. 2000. Hybridization Analysis of DNA Blots. Current Protocol in Molecular
Biology.2.10.1-2.10.16. By John Willey & Sons Inc.

99

Brown, T.A. 2006. The Basic Principles of Gene Cloning and DNA Analysis. In Gene
Cloning and DNA Analysis. An Introduction. Fifth Ed. Blackwell Publishing:
1 84
Budijanto, S.K. 1995. Antibodi IgA anti P30 sebagai petanda pada toksoplasmosis
kongenital dan akut. Majalah Kedokteran Indonesia, 45(1): 61-65.
Burg, J.L.; Grover, C.M.; Poeletty, P. & Boothroyd, J.C. 1989. Direct and Sensitive
Detection of a pathogenic protozoa Toxoplasma gondii by Polymerase chain
Reaction. J.Clin.Microbiol. 27: 1787 1792
Burgess, G. W. dan Malcolm, K. M. 1995. ELISA untuk mendeteksi antigen. Dalam
Teknologi ELISA Dalam Diagnosis dan Penelitian. Terjemahan oleh
W.T.Artama. Gadjah Mada University Press. Cetakan Pertama : 252 257.
Carruthers, V.B.; Sherman, G.D. and Sibley, L.D. 2000. The Toxoplasma adhesive
protein MIC2 is proteolytically processed at multiple sites by two parasite
derived proteases. J.Biol.Chem. 275: 14346-14353.
Cesbron-Delauw, M.F.; Tomavo, S. and Beauchamp, P. 1994. Similarities between the
primary structure of two distinct major surface protein of Toxoplasma gondii.
J.Biol.Chem. 269(62): 17-22.
Chandra, G. 2001. Toxoplasma gondii : Aspek Biologi, Epidemiologi, Diagnosis dan
Penatalaksanaannya. Medika XXVII (5): 297-304.
Chatterton, J.M.W. 1992. Pregnancy In: Ho-Yen DO, Joss AWL, Editor: Human
Toxoplasmosis. Oxford: Oxford University Press: 144-184.
Chen, X.G.; Gong, Y.; Li, H.; Lun, Z.R.; Fung, M.C. 2001. High-level expression and
Purification of Immunogenic recombinant SAG1 (P30) of Toxoplasma gondii in
Escherichia coli. Protein Expression and Purification 23: 33-37.
Cheng, S; Fockler, C; Barnes, WM; Higuchi, R. 1994. Effective amplification of long
target from cloned insert and human genomic DNA. Proceeding of the National
Academy of Sciences. 91 (12): 5695-5699.
Chevalier, J.; Yi, J.; Michel, O. and Tang, X.M. 1997. Biotin and Digoxigenin as Labels
for Ligth and Electron microscopy in situ hybridization probe : Where Do We
Stand ?. J.Histochem.and Cytochem. 45: 481-492.
Chiabchalard, R.; Wiengcharoen, J.T. and Sukthana, Y. 2005. Sensitivity and Specificity
of Polymerase Chain Reaction for Detection of Toxoplasma gondii DNA added
to laboratory samples. Southest Asian J.Trop.Med.Public Health. 36(2): 408411
100

Cornain, S.; Suryana, E.J.; Sugiharto; Jacoeb, T.Z.; Rahman, I.A.; Lubis, N.S. dan
Gusmiarti, N. 1991. Aspek immunolog dan pendekatan immunoterapi pada
infeksi Toxoplasma. Majalah Kedokteran Indonesia. 41(7): 395-401.
Conraths, F.J. and Schares, G. 2006. Validation of Molecular diagnostic techniques in
parasitological laboratory. Vet.Parasitol. 136: 91-98.
Clark, W.and Christopher, K. 2001. An Introduction to DNA: Spectrophotometry,
Degradation and Frankengel experiment. University of Alberto.
Cristina, M.D.; Porto, P.D.; Buffolano, W.; Beghetto, E.; Spadoni, A.; Gaglietta, S.;
Piccolella, E.; Felici, F. and Gargano, N. 2000. The Toxoplasma gondi
bradyzoite antigen BAG1 and MAG1 induce early humoral and cell-mediated
immune responses upon human infection. Microbes and Infections. 6: 164-171.
Curry, E.; Pratt, S.L.; Kelley, D.E.; Lapin, D.R. and Gibbons, J.R. 2008. Use of a
combined Duplex PCR/Dot blot assay sor more sensitive genetic
characterization. Biochemistry Insights: 35-39.
Damriyasa,I.M.; Bauer, C.; Edelhofer, R; Failling, K; Lind, P; Peterson, E.; Schares, G.;
Tenter, A.M.; Volmer, R. and Zahner, H. 2004. Cross Sectional study in pig
breeding farm In Hesse, germany: Prevalence of antibodies to Toxoplasma
gondii , Sarcocystis spp.,Neospora caninum in sows and analysis of risk factor.
Vet.Parasitol. 126: 271-286.
Darcy, F and Santoro, P. 1994. Toxoplasmosis. Dalam Kierszen-baum, F (Ed). Parasitic
Infection and the immune system. Academic Press, London: 163-201.
Darde, M.L. 2004. Genetic analysis of diversity in Toxoplasma gondii. Ann.Ist.Super
Sanita. 40 (1): 57-63.
Daryani, A; Hosseini, A.Z.; Sharif, M.; Dalimi, A.; Dehghan, M.H. and Ziaei, H. 2006.
Protective role of antigens from pritoneal exudates of infected mice against
toxoplasmosis. Iran J.Immunol. 3(2): 78-85.
Darwich, L.; Cabezon, O.; Echeverria, I.; Pabon, M.; Marco, I.; Lopez, R.M.; AlarciaAlejos, O.; Gatius, F.L.; Lavin, S. and Almeria, S. 2011. Presence of Toxoplasma
gondii and Neospora caninum DNA in the brain of wild bird. Vet.Parasitol. 23:
21831525.
Desmonts, G. and Remington, J.S. 1980. Direct Agglutination test for Diagnosis of
Toxoplasma Infection : Method for Increasing sensitivity and Specificity. J.
Clinical Microbiol. 11: 562-568.

101

Drennan, J.L.; Westra, A.A.G.; Slack, S.A.; Delserone, I.M. and Collmer, A. 1993.
Comparison of a DNA Hybridization Probe and ELISA for the Detection of
Clavibacter michiganensis subsp. sepedonicus in Fild-Grown Potatoes. Plant
Dis. 77(12): 1243-1247.
Dubey, J.P.; Desmont, G.; McDonald, C.; and Walls, K.W. 1985.Serologic evaluation of
Cattle inoculated with Toxoplasma gondii comparison of sabin-Fieldman dye test
and other aglutination test. Am.J.Vet.Res. 46: 1085-1088
Dubey, J.P. 1986. : Riview of Toxoplasmosis in Pig. Vet.Parasitol: 19: 181-223.
_________ 1988. Long term persistence of Toxoplasma gondii in tissue of pigs
inoculated with T.gondii ocyst and effect of freezing on viability of tissue cyst
pork. Am.J.Vet.Res. 49(6): 910-913.
Dubey, J.P. and Beattle C.P. 1988. Toxoplasmosis of animal and man. Boca Raton,
FL. CRC. Press: 69-80
Dubey, J.P. 1994. Toxoplasmosis. J.Am.Vet.Med.Assoc. 205: 1593-1598.
Dubey, J.P.; Thuliez, P.; Wegel, R.M.; Andrew,C.D.; Lind, P. and Powel, E.C. 1995.
Sencitivity and Specificity of various serologic test for detection of Toxoplasma
gondii infection in naturally infected sows. Am.J.Vet.Res. 56: 1033-1036.
Dubey, J.P. 1996. Pathogenicity and Infectivity of Toxoplasma gondii oocyst for Rats.
J.Parasitol. 83(6): 95-956.
_________ 1997. Distribution of tissue cyst in organ of rats fed Toxoplasma gondii
oocysts. J.Parasitol. 83(4): 755-757.
_________ 1998. Refinement of Pepsin digestion method for isolation of Toxoplasma
gondii from infected tissue. Vet.Parasitol. 74: 75-77.
Dubey, J.P.; Linsay, D.S. and Speer, A. 1998. Structure of Toxoplasma gondii
tachyzoites, bradizoites and spoozoites and biology and development of tissue
cysts. Clin.Microbiol.Rev. 11(2): 267-299.
Dubey, J.P.; Graham, D.H.; Dahl, E.; Hilali, M.; El-Ghaysh, A.; Sreekumar, C.;
Kwok,O.C.H. Shen, S.K. and Lehman, T. 2003a. Isolation and Moleculer
Characterization of Toxoplasma gondii from Chickens and Ducks from Egypt.
Vet.Parasitol. 114: 89-95
Dubey, J.P. ; Navaro, I.T.; Graham, D.H.; Dahl, E.; Hilali, M.; Freire, L.B.; Prudencio,
L.B.; Sreekumar, C.; Viana, M.C.B. and Lehman, T. 2003b.
Characterization
of Toxoplasma gondii isolate from free range chickens from Parana, Brazil. Vet.
Parasitol. 117: 229-234.
102

Dubey, J.P.; Venturini, M.C.; Venturini, L.; Piscopo, M.; Graham, D.H.; Dahl, E.;
Sreekumar, C.; Viana, M.C. and Lehmann, T. 2003c. Isolation and Genotyping
ofToxoplasma gondii from Free Ranging Chickens from Argentina. J.Parasitol.
89(5): 1063-1064.
Dubey, J.P.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Lehmann, T.; Davis, M.F. and
Morishita, T.Y. 2003d. Toxoplasma gondii Isolates from Free Ranging Chickens
from the United States. J.Parasitol. 89(5): 1060-1062.
Dubey, J.P.; Morales, E.S. and Lehman, T. 2004. Isolation and Genotyping of
Toxoplasma gondii from Free-Ranging Chickens from Mexico. J.Parasitol.
90(2): 411-412
Dubey, J.P.; Paula, L. and Lehmann, T. 2005. Characterization of Toxoplasma gondii
Isolates in free-ranging chickens from argentina. J.Parasitol. 91(6): 1335-1339.
Dubey, J.P.; Su, C.; Oliviera, J.; Morales, J.A.; Bolanos, R.V.; Sundar, N.; Kwok,
O.C.H. and Shen, S.K. 2006. Biologic and Characterization of Toxoplasma
gondii isolates in free-ranging chickens from Costa Rica, Central America. Vet.
Parasitol. 139: 29-36
Dubey, J.P. 2007. The history and life cycle of Toxoplasma gondii. In : Toxoplasma
gondii the model apicomplexa. Perspectives and methods. Weiss, L.M. and Kim,
K (eds). Elsevier Ltd, Amsterdam.
Dubey, J.P. and Jones, J.L. 2008. Toxoplasma gondii Infection in Human and Animals
in United State. Int.J.Parasitol. 38: 1257-1278
El-Massry, A.; Mahdy, O.A.; El-Ghaysh, A. and Dubey, J.P. 2003. Prevalence of
Toxoplasma gondii Antibodies in Sera of Turkey, Chicken and Duck from Egypt.
J.Parasitol. 86(3): 627-628.
Evans, R. 1992. Life Cycle an animal infection. In Ho-Yen, DO and Joss, AWL (eds).
Human Toxoplasmosis. Oxford Univ.Press, Oxford, GB.: 26-55.
Faria, E.B.; Gennari, M.S.; Pena, H.F.J.; Athayde, R.A.C.; Silva, M.L.C.R. and
Azevado, S.S. 2007. Prevalence of anti-Toxoplasma gondii and anti Neospora
caninum antibodies in Goats Slaughtered in The Public Slaughterhouse of Patos
city, Paraiba State, Northeast region of Brazil. Vet.Parasitol. 149: 126-129
Feyer, R; Gamble, HR; Lichtenfels, JR and Bier, JW (1992). Food borne and water
bone Parasites. In Compendium of Methods for microbiological examination of
food (ed Speck, ML). Washington DC. USA Am.Pub.Health Ass.: 789-809
Frenkel, J.K. 1990. Transmision of Toxoplasmosis and The Role of Immunity in
Limiting Transmission and Illness. J.Am.Vet.Med.Assoc. 196: 233-240.
103

Filliseti, D. and Candolfi, E. 2004. Immune response to Toxoplasma gondii. Ann.Ist.


Super Sania. 40(1): 71-80.
Fusco, G.; Rinaldi, L; Guarino, A; Proroga, Y.T.R.; Pesce, A; Giuseppina, D.M. and
Cringoli, G. 2007. Toxoplasma gondii in sheep from the Champania region
(Italy). Vet.Parasitol. 149: 271-274
Furuya, H; Yamada, T; Ikezoe, K; Ohyagi, Y; Fukumaki, Y; Fujii, N. 2006. An
improved method for Southern DNA and Northern RNA blotting using a Mupid2 Mini-Gel electrophoresis unit. J.Biochem.Biophys.Methods. 68(2): 139-143
Garberi, J.C.; Angel, S.O.; Paulin, P.; Pszenny, V. And Romano, L. 1994. Use of a
monoclonal antibody and a DNA probe for diagnosing acute toxoplasmosis in
ambiguous cases. J.Clin.Pathol. 47: 853-854
Ge, N.L.; Kocan, M.; Murphy, G.L. and Blouin, E.F. 1995. Detection of Anaplasma
marginale DNA in Bovine erythrocyte by slot-blot and In Situ hybridization with
a PCR-mediated digoxigenin-labeled DNA Probe. J.Vet.Diagn.Invest. 7: 465472.
Goel, R.; Kumar, P.; Sinha, R.and Ambwani, S. 2004. Dot blot assay using reverseprobe genomic hybridization of repetitive DNA for environmental monitering of
flourescent Pseudomonads. Indian J.Biotech. 3: 82-85.
Goodwin, MA; Dubey, JP and Hatkin, J. 1994. Toxoplasma gondi peripheral neuritis in
chickens. J.Vet.Diagn.Invest. 6: 682-385.
Hanafiah, M.; Nurcahyo, W.; Kamarudin, M. dan Karmil, F. 2009. Produksi dan Isolasi
Protein Membran Stadium Bradizoit Toxoplasma gondii : Suatu usaha untuk
mendapatkan material diagnostik dalam mendiagnosa toksoplasmosis. Jur.Vet.
10(3): 156-164.
Hartati, S; Widada, S.J.; Sumartono dan Kusumawati, A. 2003. Cloning of gene
encoding SAG1 of lokal isolate Toxoplasma gondii in Escherichia coli DH5. J.
Sain Vet. XX(2): 51-56.
Hartati, S.; Kusumawati, A.; Wuryastuti, H.and Widada, J.S. 2006. Primary structure of
mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with
other strains. J.Vet.Sci. 7(3): 263-270.
Hartono, T. (1990). Identifikasi kista Toxoplasma gondii pada kambing/domba di RPH
Surabaya dan Malang. Cermin Dunia Kedokteran 61: 31-33.

104

Hayde, M. and Polack, A. 2000. A Clinical picture neonatal sign and symptoms. In:
Ambroise Thomas P; Peterson E editor. Congenital Toxoplasmosis: scientific
background, Clinical Management and Control. Paris. Springer verlag. France:
153-164.
Held, P. 2001. The Importance of the 240 nm Absorbance Measurement. Biotek
Instruments, Inc. Winooski, VT, USA. www.Biotek.com.: 1-3
Hendrix, C.M. 1998. Diagnostic Veterinary Parasitology. 2ndEd. Masby: 7-8.
Hermawan, P. 1988. Survey Serologis terhadap Toksoplamosis pada Ayam Buras di
Kabupaten Lamongan dengan Uji Haemaglutinasi tak Langsung. Skripsi. FKHUNAIR. Surabaya: 1-53.
Herzer, S and Englert, D.F. 2001. Nucleic Acid Hybridization. Molecular Biology
Problem Solver: A Laboratory Guide. Willey-Liss, Inc.
Hitt, J.A. and Filice, G.A. 1992. Detection of Toxoplasma gondii parasitemia by gene
amplification, cell culture and mouse inoculation. J.Clin.Microbiol. 30(12):
3181-3184.
Hohlfield, P.; Daffos, F.; Costa, J.M.; Thulliez, P.; Forestier, F. and Vidaud, M. 1994.
Prenatal diagnosis of congenital Toxoplasmosis with Polymerase Chain Reaction
test on amniotic fluid. The New England J.Med. 331 (11): 695-699.
Holec, L.; Hiszczynska-Sawicka, E.; Gasior, A.; Brillowski-Dabrowski, A. and Kur, J.
2007. Clinical and Vaccine. Immunol.14(3): 220-225.
Holliman, R.E. 2003. Toxoplasmosis. In: A manson,s tropical diseases. 21th ed. Cook,
G.C. and Zumia(eds). Saunders Elsevier Science, London: 211-240
Ho-Yen, D.O.; Joss, A.W.; Balfour, A.H.; Smyth, E.T.; Baird, D. and Chatterton, J.M.
1992. Use of the polymerase chain reaction to detect Toxoplasma gondii in
human blood samples. J.Clin.Path. 45: 910-913.
Howe, D..K and Sibley, L.D. 1995. Toxoplasma gondii comprises three clonal lineages
corelation of parasites genotype with human diseases. J.Infect.Dis.172: 15611566.
Howe, D.K.; Mercier, C.; Messina, M. and Sibley, L.D. 1997. Expression of
Toxoplasma gondii in the closely related apicomplexan parasites Neospora
caninum. Moleculer and Biochem.Parasitol. 86: 29-36.
Ibrahim, A.K.; Abeer, A.; Abdelall and Amin, A.S. 2012. Long-Term Diagnostic
Studies for Detection of Brucella spp. in Milk Samples. Global Veterinaria.
8(1): 54-61
105

Indra, C. 2003. Epidemiologi Toxoplasma gondii. USU Digital Library: 1-13


Indri, S. 1999. Hibridisasi Asam Nukleat. Dalam Biologi Molekuler Kedokteran. Ed
Suhartono Taat Putra. Airlangga University Press.: 168-172.
Iskandar, T. 1998. Pengisolasian Toxoplasma gondii dari Otot Diafragma Seekor Domba
yang Mengandung Titer Antibodi Tinggi dan Tanah Tinja dari Seekor Kucing.
Jurnal Ilmu Ternak dan Veteriner. 3(2): 111-116.
Jackson, M.H and Hutchinson, W.M. 1989. The prevalence and source of Toxoplasma
infection in the environtment. Adv.Parasitol. 28: 55-104.
Jacobs, I; Remington, JS. And Milton, MI. 1960. A Survey of meat samples from swine,
cattle and sheep for the presence of encysted Toxoplasma. J.Parasitol. 46: 23-26
Jensen, L.; Heegaard, P.M.H. and Lind, P. 1998. A study of virulence parameters for
Toxoplasma gondii infections in mice. Parasitol.Res.84: 382-387.
Jin, Si ; Chang, Z.Y.; Ming, Xu; Min, C.L.; Wei, He; Sheng, L.Y. and Hong, G.X. 2005.
Fast Dipstick Dye Immunoassay for Detection of Immunoglobulin G (IgG) and
IgM Antibodies of Human Toxoplasmosis. Clin.Diagn.Lab.Immunol. 12(1) :
198-201.
Jittapalapong, S.; Nimsupan, B.; Pinyopanuwat, N.; Chimnoi, W.; Kabeya, H. and
Maruyama, S. 2006. Seroprevalence of Toxoplasma gondii antibodies in stray
cats and dogs in the Bankok metropolitan area. Thailand Vet.Parasitol. 10:
3833-3837.
Johnson, A.M.; Robert, H. and Tenter, A.M. 1992. Evaluation of recombinant antigen
ELISA for the diagnosis of acute toxoplasmosis and comparison with
traditional Antigen ELISAs. J.Med.Microbiol. 37: 404-409.
Joiner, I.A. and Roos, D.S. 2002. Secretory traffic in the Eukaryotic parasite
Toxoplasma gondii : Less is more. J.Cell Biol. 157(4): 557-563
Jones, D.D.; Okbravi, N.; Adamson, P; Tasker, S and Ligbtman, S. 2000. Comparison of
PCR detection methods for B1, P30 and 18S rDNA genes of Toxoplasma gondii
in equeous humor. Int.Opthamol.Vis.Sci. 41(3): 634-644
Jungersen, G.; Bille-Hansen, V.; Jensen, L. and Lind, P. 2001. Tranplacental
transmission of Toxoplasma gondii in minipig infected with strain of different
virulence. J.Parasitol. 87(1): 108-113.
Kazemi, B.; Bandepour, M.; Maghen, L. and Solgi, G.H. 2007a. Gene Cloning of 30
kDa Toxoplasma gondii tachyzoite surface antigen (SAG1). Iranian J.Parasitol.
2(2): 1-8.
106

Kazemi, B.; Maghen, L.; Bandehpour, M.; Shahabi, S. and Haghighi, A. 2007b. Gene
Cloning of 43 kDa surface protein of Toxoplasma gondii tachyzoite and
bradyzoite (SAG3). Gene Ther.Mol.Biol. 11: 113-116.
Karkata, K. dan Suwardewa, T.G.A.. 2006. Infeksi TORCH pada ibu hamil di RSUP
Sanglah Denpasar. Cermin Dunia Kedokteran. 151: 5-7.
Kasper,L.H. and Boothroyd, J.C. 1993. Toxoplasma gondii and Toxoplasmosis. In
Immunology and Moleculr Biology of Parasitic Infections. Ed by Kenneth S
Warren. Blackwell Scientific Publications. Oxford. London Edinburgh,
Melbourne Paris Berlin Vienna: 269-301
Keller, G.H. and Manak, M.M. 1989. DNA Probe. Macmillan Publisher ltd.: 1-16.
Khan, A.; Taylor, S.; Su, C.; Mackey, A.J.; Boyle, J.; Cole, R.; Glover, D.; Tang, K.;
Paulsen, I.T.; Berriman, M.; Boothroyd, J.C.; Pfefferkorn, E.R. Dubey, J.P.;
Ajioka, J.W.; Roos, D.S.; Wootton, J.C. and Sibley, L.D. 2005. Composite
genome map and recombination parameters derived from three archetypal
lineages of Toxoplasma gondii. Nucleic Acid Res. 33(9): 2980-2992.
Koskiniemi, M.; Lappaiainen, M.; Hedman, K. 1989. Toxoplasmosis needs evaluation
on : Overview and proposals. Am.J.Dis.Chid. 143: 724-728.
Kresno, S.B. 1996. Imunologi. Diagnosis dan Prosedur Laboratorium. Ed ketiga.
Penerbit Fakultas Kedokteran UI-Jakarta: 1-336.
Kruchen, B. and Rueger, B. 2003. The Dig System Nonradioactive and Highly
Sensitive Detection of Nucleic Acids. Biochemica. 3: 13-15.
Kusumawati, A.; Nafratilova, S. and Hartati, S. 2011. Digoxigenin(DIG) Labeled Probe
Candidate of Surface antigen1 (SAG1) for Toxoplasma gondii Detection. Ind.J.
Biotech. 16(1): 17-23.
Lehman, T.; Blacksten, C.R.; Parmiey, S.F.; Remington, J.S. and Dubey, J.P. 2000.
Strain typing of Toxoplasma gondii: Comparison of antigen-coding and
housekeeping genes. J.Parasitol. 8(5): 960-971.
Lehman, T.; Graham, D.H; Dahl, E.; Sreekumar, C.; Launer, F.; Corn, J.L.; Gamble,
H.R and Dubey, J.P. 2003. Transmission dynamics of Toxolasma gondii on a
pig farm. Infect.Genet.Evol. 3: 135-141.
Leitch, A.R.; Schwarzacher, T.; Jackson, D and Leitch, I.J. 1994. 1sted. In situ
hybridization. A practical guide, BOS Sciencetific Publisher Limited: 4-5: 33-39
Levine, N.D. 1994. Buku Pelajaran Parasitologi Veteriner. Edisi Indonesia. Gadjah
Mada University Press.: 1-531
107

__________ 1995. Protozoologi Veteriner. Edisi Indonesia. Gadjah Mada University


Press.: 1-585
Liesenfeld, O.; Montoya, J.G.; Tathinemi, N.J.; Davis, M.; Brown, Jr. B.W.; Cobb, K.L.;
Parssonet, J. and Remington, J.S. 2001. Confirmatory serologic testing for acute
toxoplasmosis and rate of induced abortions among women reported to have
positive Toxoplasma immunoglobulin M antibody titer. Am.J.Obstet.Gynecol.
184: 140-145.
Lodish, H.; Berk, A.; Matsudaira, P.; Kaiser, C.A.; Krieger, M.; Scott, P.M.; Zipursky,
L. and Darnell, J. 2006. Moleculer Cell Biology. 5th Ed. Media conected.: 40408.
Lubis, N.K.; Gandahusada, S. dan Surjana, E.J. 1997. Peran antibodi IgA dan IgE pada
diagnosis toksoplasmosis. Majalah Kedokteran Indonesia, 4(11): 563-567.
Luft, B.J.; Haffler, M.D. and Korzun, A.H. 1993. Toxoplasmic encephalitis in patients
with the aquaired immunodeficiency syndrome. New England J.Med. 329: 9951000.
Luft, BJ. and Remington, JS. 1988. AIDS commentary. Toxoplasmosis encephalitis.
J.Infect.Dis. 157(1): 1-6
Lyons, R.E.; McLeod, R. and Robert, C.W. 2002. Toxoplasma gondii Tachyzitebradyzoite interconversion. Trends in Parasitol. 18(5): 198-201.
Maganathan, P; Singh, S; Ling, LY; Singh, J; Subrayan, V and Nisapatorn, V. 2010.
Detection of Toxoplasma gondii DNA by PCR following microwave treatment
of serum and whole blood. Southeast Asian J.Trop.Med.Public Health. 41(2):
265-273.
Maroef, S. 1990. Toxoplasmosis di Indonesia. Cermin Dunia Kedokteran, 61: 34- 39.
Martin, J.; Kwok, O.C.H. and Dubey, J.P. 2011. Seroprevalence of Neospora caninum in
free-range chickens (Gallus domesticus) from Americas. Vet.Parasitol. 27:
21676546.
McLeod, R.; Mack, D. and Brown, C. 1991. Toxoplasma gondii-New advance in
Cellular and Moleculer Biology. Exp.Parasitol. 72: 109-121.
McPherson, M.J.; Quirke, P.; Taylor, G.R.1992. PCR. A practical Approach. IRL Press
Milton, M.; McAllister, Stephen, F.; Parmiey; Weiss, L.M.; Weich, V.J. and McGuire,
A.M. 1996. An Immunohistochemical Method for detecting Bradyzoite antigen
(BAG5) in Toxoplasma gondii-Infected tissue cross-reacts with a Neospora
caninum bradyzoite antigen. J.Parasitol. 82(2): 354-355.
108

Montoya, J.G. and Liesenfeld, O. 2004. Toxoplasmosis. The Lancet. 363: 1965-1967.
Mori, J.; Field, A.M.; Clewley, J.P. and Cohen, B.J. 1989. Dot Blot Hybridization Assay
of B19 Virus DNA i Clinical Specimens. J.Clin.Microbiol. 27(3): 459-464.
Mudenda, H.B.; Willliam, U.; James, M.C.L.; Charles, M.; Nayuta, I.; Evans, M.;
Ladslav, M.; Hiroshi, I. And Emiko, I. 2011. Feasibility of using dot blot
hybridization to detect Salmonella InvA, SpiC and SipC directly from clinical
specimens. African J.Microbiol.Res. 5(6): 582-585.
Mufasirin 1999. Kloning dan Ekpresi cDNA yang menyandi Protein Membran Takizoit
Toxoplasma gondii Isolat Bogor. Tesis. Universitas Gadjah Mada, Yogyakara: 169
Mufasirin; Suprihati, E. dan Suwanti, L.T. 2003. Studi Toksoplasmosis pada Telur
Ayam yang dijual sebagai campuran jamu di kota Surabaya dan Kabupaten
Sidoarjo menggunakan uji Dot Blot. J.Penelitian Medika Eksakta. 4(2): 113119.
Muller, N.; Zimmerman, V.; Hetrich, B. and Gottstein, B. (1996).Diagnosis of Neospora
caninum and Toxoplasma gondii infection by PCR and DNA hybridization
immunoassy. J.Clin.Microbiol. 34: 2850-2652.
Nardone, R.M. 1999. Overview of In Situ Hybridization. In Imunocytochemical
Methods and Protocols. Second eds. Edited by Lorette C Javois. Humana Press.
Totowa, New Jersey: 357-363.
Owen, M.R.; Clarkson, M.J. and Trees, A.J. 1998a. Diagnosis of Toxoplasma abortion
in ewes by polymerase chain reaction. Vet.Record. 142: 445-448.
__________ 1998b. Acute phase Toxoplasma abortion in sheep. Vet.Record. 142: 480482.
Palmer, H.M.; Atkinson, H.J. and Perry, R.N. 1991. The Use of DNA probe to identify
Ditylenchus dipsaci. Revue Nematol. 14(4): 625-628.
Patricia, M.; Craver, J. and Knoll, L.J. 2007. Increased efficiency of homologous
recombination in Toxoplasma gondii dense granule protein 3 demontrates that
GRA3 is not necessary in cell culture does contribute to virulence. Mol.and
Biochem.Parasitol. 153: 149-157.
Pesic, Z. and Hiruki, C. 1988. Comparison of ELISA and dot-hybridization for of Alfalfa
mosaic virus in alfalfa pollen. Can.J.Plant Pathol. 10: 116-122.
Polak, M.W.P.; Wojciech, R. and Zmudzinski, J.F. 2005. Implementation of Dot Blot in
Rapid Diagnosis of BSE. Bull.Vet.Inst.Pulawy. 49: 263-266.
109

Powell, L.C.; Brewer, M. and Lappin, M.R. 2001. Detection of Toxoplasma gondii in
the milk of experientally infected lactating cats. Vet.Parasitol. 102: 29-33.
Pratama, D.A.O.A. 2009. Analisis Toxoplasma gondii repeat region 529 bp (NCBI Acc
No AF146527) sebagai kandidat probe untuk diagnosis molekuler
toksoplasmosis. Tesis Program Studi Bioteknologi. Pascasarjana UGM.
Yogyakarta.
Priadi, A. 2003. Prinsip Dasar Enzyme Linked Immunosorbant Assay (ELISA).
Dalam Whorkshop Pengembangan Diagnostik Fasciolosis dengan ELISA
untuk Mendeteksi Cathepsin L(CatL). BPV. Bogor. 17-19 Februari 2003.
Primrose, S.B. 1995. Principles of genome analysis. A guide to mapping and
sequencing DNA from different organism. Blackwell Science. Oxford.
Priyana, A. 2000. Antibodi Anti Toxoplasma pada Ayam Kampung (Gallus domestius)
di Jakarta. Majalah Kedokteran Indonesia. 50(11): 504-507.
Priyowidodo. 2003. Kajian Metoda Diagnosis Toksoplasmosis secara Polymerase Chain
Reaction (PCR) dan Pemeriksaan Histologis. Tesis. Universitas Gadjah Mada,
Yogyakarta.: 1-51
Pruitt, K.D., Tatusova, T., Maglott, D.R. 2005. NCBI Reference Sequence. (RefSeq): a
curated non-redundant sequence database of genomes, transcripts and proteins.
Nucleic Acids Res. 33, D501-D504

Purwanto, M.; Lusida, M.I. dan Handayani, R. 1997. Polymerase chain reaction. Dalam
Biologi Molekuler Kedokteran. Editor Suhartono Taat Putra. Edisi pertama.
Erlangga Universiy Press.: 150-167
Raizman, R.E. and Neva, F.A. 1975. Detection of circulating antigen in acute
experimental Infection with Toxoplasma gondii. J.Infect.Dis. 122, 44-48.
Reischl, U., S. Bretagne, D. Kruger, P. Ernault, J.M. Costa. 2003. Comparison of Two DNA
Targets for the Diagnosis of Toxoplasmosis by Real-time PCR using Fluorescence
Resonance Energy Transfer Hybridization Probes. BMC. Infect.Dis. 3(1): 1-9.

Remington, J.S. and Destmon, G. 1990. In Remington, JS; Kleid GO (eds). Infection
Diseases of the fetus and Newborn infant 4th.ed.Philadelphia WB. Saunders
Comp.: 89-195.
Remington, J.S.; McLeod, R.; Destmont, G. 1995. In: Remington JS : Kleid JO
(eds)Infection Diseases of the fetus and Newborn infant. 2 ed . Philadelphia
WB Saunder Comp.: 140-257.

110

Remington, J.S.; Tulliez, P. and Montoya, J.G. 2004. Recent development for diagnosis
of toxoplasmosis. J.Microbiol. 42(3): 941-945.
Roche, P.J. 2006. Preparationof Template DNA and Labeling Techniques. From
Methods in Molecular Biology, vol 326 : In Situ Hybridization Protocols : Third
Edition. Edited by : I.A.Darby and T.D.Hewitson. Humana Press Inc, Totowa,
NJ.: 9 16
Roche, 2009. DIG High Prime DNA Labeling and Detection Starter Kit I. WWW.rocheapplied-science.com.
Rueue, K., 1998. mRNA Quantitation Techniques: Considerations for Experimental
Design and Application. J.Nutrition. 128(11): 2038-2044.
Salehzada, T. and Taha, M.N. 1992. Licence de Biochemie. Travaux Practique de
Biochemie. Biochemie des Proteine. Biochemie Moleculaire. Universitie
Montpellier II. U.F.R-S. F.A.: 10-22.
Salis, AD. 2009. Application in Clinical Microbiology. Real time PCR: Current
Technology and Application. Caister Academic Press. ISSN 978-1-90445539-4
Sambrook, J. and Russell, D.W. 2001. The Basic Polymerase Chain Reaction. In
Molecular cloning. A Laboratory manual. Third Ed. Cold Spring Harbor
Laboratory Press, NewYork. Vol 2: 8.18 8.24
Samuelson, J.; Soto, R.A.; Reed, S.; Biage, F. and Wirth, D. 1989. DNA Hybridization
Probe for Clinical Diagnosis of Entamoeba histolitica. J.Clin.Microbiol. 27(4):
671-676.
Sandi, E.A. and Brenes, O.V. 2005. Serological Prevalence of Toxoplasma gondii in
Free-range Chickens from Costa Rica. Trop.Ann.Health Prod. 37: 369-372.
Sarjono; Nurcahyo, W dan Hanafiah, M. (2004). Studi Produksi takizoit Toxoplasma
gondii dari pembiakan in vivo pada mencit (Mus musculus).Media Kedokteran
Hewan. 20(2): 53-56
Sarovar, B. and Saigopal, D.V.R. 2010. Development of Probe-base blotting technique
for the detection of Tobacco streak virus. Acta Virologica. 54: 221-234.
Sarva, U. and Holliman R.E. 1989. Diagnosis of Ovine Toxoplasmosis: an alternative to
Serology. Vet.Record. 125: 212.
Sibley, D.; Howe, K.; Wan, K.L.; Khan, S.; Aslett, M.A.; Ajioka, J.W. 1996.
Toxoplasma as a model genetic system. In Molecular Biology of Parasitic
Protozoa. Edited by Deborah F. Smith and Marilyn Parson. IRL Press.: 55 74.
111

Son, E.S. and Nam, H.W. 2001. Detection and Characterization of Excretory/Secretory
Protein from Toxoplasma gondii by Monoklonal Antibodies. Korean J.
Parasitol. 39(1): 49-56.
Soulsby, E.J.L. 1982. Protozoa. In Helminth, Arthropods and Protozoa of domesticated
animals. 7th Ed. Bailliere Tindall London: 507-759
Sreekumar, C.; Grahan, D.H.; Dahl, E.; Hilali, M.; Freire, L.B., Prudencio, L.B.; Viana,
M.C.B. and Lehman, T.; Dubey, J.P. 2003. Genotyping of Toxoplasma gondii
isolates from Chickens from India. Vet.Parasitol.118: 186-194.
Steuber, V.S.; Niu, A.; Reetz, J.; Roth, A. and Janitschke, K. 1995. Der Nachweis von
Toxoplasma gondii in abortgeweben vom schaf mittels der polymeraseketterreaktion. Dsch.Tierarztl.wschr. 102: 91-93.
Subekti, D.T.; Artama, W.T. dan Iskandar, T. 2005. Perkembangan kasus dan Teknologi
diagnosis Toksoplasmosis. Lokakarya Nasional Penyakit Zoonosis. Bogor
Sudjadi. 2008. Bioteknologi Kesehatan. Cetakan pertama. Penerbit Kanisius: 21-279
Sumartono; Nurcahyo, W. dan PriyoWidodo, D. 2005. Pengembangan Probe Molekuler
untuk Optimalisasi diagnosis Koksidiosis. J.Sain Vet. 23(2): 60-66.
Sumartono; Artama, W.T., Asmara, W. dan Tabbu, C.R. 2007. Analisis kandidat probe
molekuler untuk diagnosis toksoplasmosis berdasarkan fragmen sekuen repetitif
genom takizoit. Media Kedokteran Hewan 23(1): 7-12.
Suratma, A. 2008. Sensitifitas dan Spesifisitas uji ELISA menggunakan antigen Protein
30 kDa untuk mendeteksi kista Toxoplasma gondii dalam jaringan Babi.
Disertasi-Program Pascasarjana-UNUD.
Suryadi (2006). Bahan Genetik. Dalam Genetika Kedokteran. Fakultas Kedokteran.
UGM: 7-20.
Susanto, L.; Supali, T. dan Gandahusada, S. 2002. Penentuan konsentrasi minimal Gen
B1 dan Gen P30 Toxoplasma gondii yang masih terdeteksi dengan reaksi Rantai
Polimerase. Makara Kesehatan 6(2): 64-70.
Susanto, L.; Gandahusada, S. dan Muljono, R. 1999. Invasi Toxolasma gondii ke dalam
sel hospes serta deferensiasinya dari takizoit ke bradizoit. Majalah Kedokteran
Indonesia. 49 (6): 208-211.
Suwanti, LT.; Suprihati, E.; Mufasirin. (2006). Prevalensi Toxoplasmosis pada Ayam di
beberapa Pasar di kota Surabaya. Media Kedokteran Hewan. 22(1): 32-35.

112

Taylor, G.R. 1991. Polymerase Chain Reaction. Basic principles and automation. In
PCR a practical approach. Ed by M.J.Mepherson, P.Quirhe and GR.Taylor.
Oxford University Press.: 1-13
Tenter, A.M.; Vietmeyer, C. and Johnson, A.M. 1992. Development of ELISAs based
on Recombinant antigen for the detection of Toxoplasma gondii-spesific in sheep
and Cats . Vet.Parasitol. 43: 187-194
Tenter, A.M.; Seineke, P.; Simon, K. ; Heckerozh, A.R.; Damriyasa, I.M.; Bauer, C. and
Zahner, H. 1999. Aktuelle Studien zur Epidemiologie von Toxoplasma
infectionen. Proc.German Vet.Med.Soc.1999: 247-264.
Tenter, A.M.; Heckeroth, A.R.; Weiss, L.M. 2000. Toxoplasma gondii : From Animals
to humans. Int.J.Parasitol. 30: 1217-1258.
Tomavo, S.; Fortier, B; Soete, M.; Ansel, C.; Camus, D. and Dubremetz, J.F. 1991.
Characterization of bradyzoite-specific antigens of Toxoplasma gondii. Infect.
and Immunity. 59(10): 3750-3753.
Tomavo. 1996. The Major Surface Protein of Toxoplasma gondii : Structures and
Functions. Toxoplasma gondii Gross, U (eds). Springer-Verlag. Berlin.
Waree, P.; Ferguson, D.J.P.; Pongponratn, E.; Chaisri, U. and Sukthana, Y. 2007.
Immunohistochemical study of acute and chronic Toxoplasmosis in
experimentally infected mice. Shouthest Asian J.Trop.Med.Helth. 38(2): 223231.
Weiss, L.M; Ma, Y.F; Takvorian, P.M; Tanowitz, H.B and Wittner, M. 1998. Bradyzoite
Development in Toxoplasma gondii and the hsp 70 Stress Response. Infect.
Imun. 66(2): 3295-3302.
Weiss, L.M. and Kim, K. 2000. The development and Biology of Bradizoite of
Toxoplasma gondii. Frontiers in Bioscience 6: 391-405.
Weiss, J. 1995. DNA Probe and PCR for Diagnosis of Parasitic Infectious. Clin.
Microbiol. 8(1): 113-130
Winarto. 2008. Peran Protein Rekombinan ROPTRI dalam Pengembangan Diagnostik
secara Molekuler pada Infeksi Aktif Toxoplasma gondii. Disertasi. Universitas
Diponogoro, Semarang: 1-227
Wu, K; Chen, X.G; Li, H.; Yan, H.; Yang, P.L.; Lun, Z.R; Zhu, X.Q. 2009. Diagnosis of
Human toxoplasmosis by using the recombinant truncated surface antigen 1 of
Toxoplasma gondii. Diag. Microbiol.and Infect.Dis. 64(3): 261-266

113

Yang, H.; Wanner, I.B.; Roper, S.D. and Chaudhari, N. 1999. An Optimized Method
for In Situ Hybridization with signal amplification hat allows the detection of
Rare mRNAs. J.Histochem.and Cytochem. 47: 431-446.
Yasodara, P.; Ramalakshmi, B.A.; Sarma, M.K.J. 2001. A New Approach to
Defferentiate Recent VS Chronic Toxoplasma Infection : Avidity ELISA in
Toxoplasma serology. Indian J.Med.Microbiol. 19(3): 145-148
Yuwono, T. 2006. Teori dan Aplikasi Polymerase Chain Reaction. Edisi pertama.
Penerbit Andi Yogyakarta: 1-237
Yuwono, T. 2008. Biologi Molekuler. Edisi pertama. Penerbit Erlangga: 1-258
Zhang, Y.W.; Kim, K.; Ma, Y.F.; Wittner, M; Tanowitz, H.B. and Weiss, L.M. 1999.
Disruption of Toxoplasma gondii bradyzoite-specific gene bag-1 decreases in
vivo cyst formation. Mol.Microbiol. 31(2): 691-701.

114