Anda di halaman 1dari 15

BAB 1.

PENDAHULUAN
1.1 Latar Belakang
Bioinformatik merupakan suatu studi interdisiplin yang mempelajari
analisis kuantitatif dari informasi yang berkaitan dengan makromolekul biologi,
ditunjang oleh perangkat komputer. Komputer berperan untuk menyimpan,
mendapatkan kembali, memanipulasi,dan mendistribusikan informasi yang
berkaitan dengan makromolekul biologi, seperti DNA, RNA dan protein. Peranan
komputer sangat diperlukan karena kebanyakan analisis data genomik
memerlukan pengulangan tinggi ataupun fungsi matematika yang kompleks
(Attwood, dan Parry,1999).
Bioinformatik berbeda dari komputasi biologi. Bioinformatik terbatas pada
analisis sekuens, struktur dan fungsi gen dan genom dan produknya, sedangkan
komputasi biologi meliputi semua area penelitian biologi yang memerlukan
komputer, seperti memodelkan ekosistem, populasi, dinamika, perilaku ataupun
kekerabatannya (Rao, 2008).
DiIndonesia perkembangan bioinformatika belum cukup menggembirakan
karena hanya sebatas dipahami dan diaplikasikan oleh peneliti biomolekuler yang
mengharuskan mereka untuk menggunakan perangkat bioinformatika sebagai
tools dalam analisis data. Aplikasi TI dalam bidang biomolekuler telah melahirkan
bioinformatika dan kajiannya tidak bisa lepas dari perkembangan biomolekuler
modern yang ditandai dengan kemampuan manusia untuk memahami genom,
yaitu cetak biru informasi genetik yang menentukan sifat setiap makhluk hidup
yang disandi dalam bentuk pita molekul DNA. Kemampuan untuk memahami dan
memanipulasi kode genetik DNA ini sangat didukung oleh TI melalui perangkat
keras maupun lunak. Hal ini bisa dilihat pada upaya Celera Genomics, perusahaan
bioteknologi Amerika Serikat yang melakukan pembacaan sekuen genom manusia
yang secara maksimal memanfaatkan TI sehingga bisa melakukan perjalanannya

dalam waktu singkat, dibanding usaha konsorsium lembaga riset publik AS,
Eropa, dan lain-lain yang memakan waktu lebih dari 10 tahun (Michelia, 2011).
Permasalahan pangan di Indonesia bukanlah suatu hal yang dapat
dianggap remeh. Kompleksitas masalahnya dimulai dari kecilnya lahan pertanian,
minimnya produktivitas tanaman pangan, birokrasi pertanian yang kurang
menguntungkan petani, mahalnya harga komponen pertanian, kegagalan program
diversifikasi pangan, dan segudang masalah lainnya. Berkaitan dengan
permasalahan produktivitas pangan, mungkin Indonesia patut mencontoh negaranegara maju seperti Amerika Serikat, negara-negara Eropa Barat, dan Jepang.
Mereka merupakan negara yang sangat meningkatkan produktivitas tanaman
pangannya karena sangat menerapkan ilmu bioteknologi pertanian dan
bioinformatika (Michelia, 2011).
1.2 Rumusan Masalah
Dari latar belakang di atas, maka dapat ditarik rumusan masalah sebagai
berikut :
a. Apa yang dimaksud dengan Bioinformatika?
b. Bagaiamana peran bioinformatika pada buah kakao?
c. Bagaimana karakterisasi sekuen gen inhibitor proteinase pada buah
kakao?
1.3 Tujuan
Tujuan penyusunan makalah ini adalah,untuk mengetahui-hari. Selain
itu,penyusunan makalah ini digunakan untuk mengetahui peran bioinformatika
pada kehidupan seharanalisis dan karakterisasi sekuen gen inhibitor proteinase
pada kulit buah kakao.

BAB 2. PEMBAHASAN
a. Definisi Bioinformatika
Bioinformatika berasal dari kata bio dan informatika yang merupakan
gabungan dari ilmu biologi dan teknik informasi (IT). Teknologi bioinformatika
ini bertujuan untuk mengaplikasikan data-data dari alat komputasi melalui suatu
analisa untuk menangkap dan menginterpretasikan data-data biologis yang
terkandung dibalik sistem nyata yang ada di setiap makhluk hidup.
Bioinformatika sekarang ini digolongkan sebagai disiplin ilmu baru yang
mencakup tak hanya ilmu komputer dan biologi sebagai dasar dunia kedokteran,
namun juga matematika dan fisika yang secara bersama-sama diintegrasikan pada
suatu aplikasi dalam membuka aspek-aspek yang belum terjelaskan dalam ilmu
terapi konvensional. Rujukan terbesarnya merupakan bentuk terkecil dari
makhluk hidup yang dikenal sebagai gen, yang meliputi DNA dan RNA sebagai
protein yang membentuk sel makhluk hidup itu sendiri. Perangkat pendukungnya
sendiri sebenarnya tak serumit penjelasan atas namanya. Ada software yang
dilahirkan dari banyak penelitian gabungan untuk mendeteksi bentuk biologis
terkecil itu, yang kemudian diaplikasikan dalam sejumlah software lain untuk
mempetakan setiap data yang tersedia (Cohen, 2004).
Latar belakang maraknya teknologi ini juga didorong oleh penemuan atas
pemetaan gen manusia yang dikenal sebagai genome project oleh para
pencetusnya yang hingga kini telah berhasil mendata pembacaan gen makhluk
hidup dari tingkat paling rendah ke yang paling tinggi, dimana gen manusia
sendiri terdiri dari 2.91 juta bp (pasangan basa dalam protein pembentuk gen
tersebut). Tingkat akurasinya dinilai banyak ahli cukup tinggi dalam menentukan

sifat-sifat biologis yang secara mendasar bisa berbeda-beda pada tiap individu,
dan nantinya akan berhubungan dengan penentuan terapi dan perjalanan penyakit.
Proses ke arah sana mungkin mutlak menjadi milik orang- orang yang memahami
sepenuhnya ilmu-ilmu terapan ini (Sofyan, 2012).

Teknologi rekayasa genetika merupakan salah satu bidang yang sangat


membutuhkan riset bioinformatika. Sekuens gen unggul pada suatu organisme
agar dapat disisipkan ke organisme lain yang diinginkan dapat ditentukan melalui
analisis genomik dari basis data genom organisme tersebut. Analisis genomik
merupakan salah satu ranah bioinformatika. Revolusi pertanian dapat mengubah
paradigma pertanian konvensional dengan menghasilkan spesies tanaman pangan
unggul hasil rekayasa genetika (Singh, 2011).
b. Peran Bioinformatika Pada Buah Kakao
Kakao adalah komoditas yang secara sosial maupun ekonomi penting bagi
Indonesia. Namun, usaha peningkatan produksi kakao di Indonesia terkendala
antara lain oleh adanya serangan hama penggerek buah kakao PBK
(Conopomorpha cramerella). Untuk menanggulangi serangan PBK tersebut perlu
adanya satu cara pengendalian yang efektif dan efisien, sehingga dapat
mendorong usaha pengembangan bahan tanaman yang tahan PBK. Karena sampai
saat ini belum ada cara yang efisien untuk mengendalikan hama PBK. Pemakaian
pestisida diyakini kurang efektif karena hama target dapat bersembunyi di dalam
buah yang tidak terjangkau oleh penyemprotan. Pemakaian agensia
sering

biologis

kurang konsisten hasilnya. Penerapan pangkas eradikasi kurang disukai

oleh para pekebun karena mengurangi pendapatan pekebun kecil. Sementara


itu,cara sarungisasi tergolong padat tenaga kerja yang kurang sesuai untuk
perkebunan besar. Serta masih banyak cara-cara yang masih belum memberikan
hasil yang nyata dan efektif terhadap hama PBK. Sulitnya pengendalian

hama

yang penyebarannya cepat ini, mendorong usaha penemuan tanaman kakao


tahan PBK (Sofyan, 2012).
Ada beberapa cara yang dapat dilakukan untuk menguji kembali ketahanan
klon-klon harapan tersebut. Efikasi bibit klonal dari klon-klon harapan tahan
terhadap

hama tersebut dengan cara penanaman kembali di daerah serangan

PBK hingga tanaman perbanyakan berbuah. Setelah


tingkat

itu dilakukan evaluasi

serangan PBK terhadap buah kakao. Cara ini

dapat memberikan

indikasi langsung mengenai ketahanan tanaman terhadap hara tersebut. Namun


demikian, hal ini memerlukan waktu yang relatif
proses perbanyakan tanaman dan

waktu

lama

karena

hingga tanaman

memerlukan

dapat

berbuah.

Selain itu juga memerlukan lahan yang luas. Cara yang lebih efisien dapat
ditempuh dengan menggunakan penanda molekuler. Penanda yang demikian
dapat dikembang-kan atas dasar sekuen gen yang menentukan gen ketahanan
hama semacam ini, seperti gen inhibitor proteinase (Park & Thornburg, 1996).
Beberapa

peneliti

telah

menemukan

cara

yang

lebih

efisien

penanggulangan serangan terhadap buah kakao yang ditempuh menggunakan


penanda molekuler. Penanda yang demikian dapat dikembangkan atas dasar
sekuen gen yang menentukan gen ketahanan hama semacam ini., seperti gen
inhibitor proteinase (PIN). PIN diketahui memiliki peranan yang penting dalam
sistem pertahanan tanaman terhadap predator dan pathogen. Protein yang temakan
oleh hama target akan berinteraksi dengan protease dalam usus hama target
sehingga akan terikat dan terkunci pada situs aktif protease. Dengan demikian
karena asam amino yang mudah diserap tidak dapat dihasilkan oleh proteasenya,
hama menjadi kekurangan nutrisi sehingga pertumbuhan dan perkembanganya
terhambat (Mollah, 2004).

c. Karakterisasi Sekuen Gen Inhibitor Proteinase Pada Buah Kakao


Bioinformatika sebenarnya merupakan ranah ilmu yang tergolong baru
dan belum banyak berkembang di Indonesia. Bioinformatika merupakan
gabungan antara ilmu biologi dengan informatika, dimana hasil penelitian biologi
dibentuk menjadi data digital dan kemudian diolah untuk menghasilkan suatu
informasi baru. Bioinformatika membantu kehidupan manusia dalam berbagai hal,
contohnya saja dalam peningkatan produksi pangan atau pertanian. Revolusi
pertanian

dapat

mengubah

paradigma

pertanian

konvensional

dengan

menghasilkan spesies tanaman pangan unggul hasil rekayasa genetika. Teknologi


rekayasa genetika merupakan salah satu bidang yang sangat membutuhkan riset
bioinformatika (Claveri, 2003).
Kakao merupakan komoditas yang secara sosial maupun ekonomi penting
bagi Indonesia. Namun perkebunan kakao mengalami permasalahan yang cukup
serius akibat hama penggerek buah kakao (PBK). Hingga saat inipun belum
ditemukan cara yang efektif untuk memberantas PBK. PIN (inhibitor proteinase)
merupakan gen yang membawa sifat ketahanan tanaman terhadap hama ulat
seperti PBK. Harapannya PIN dalam buah kakao akan diidentifikasi dan
diklonkan. Deteksi PIN di dalam kakao dikerjakan dengan PCR. Vektor kloning
pGEM-T digunakan untuk mengklon produk PCR. Analisis sekuen dilakukan
dengan program BLAST dari situs NCBI.

Sedangkan analisis penjajaran (alignment) untuk menentukan kemiripan


genetik menggunakan program CLUSTALW dari situs EBI.

Terlihat bahwa riset bioinformatika ternyata juga memegang peranan


penting dalam permasalahan pangan dan bionformatika sangat membantu dalam
peranan science. Deteksi PIN didalam kakao dikerjakan dengan PCR
menggunakan primer heterologous yang spesifik terhadap PIN dan DNA genomik
kakao sebagai templatenya. Kloning DNA fragmen produk PCR spesifik
dilakukan menggunakan pGEM-T dan sel inang E. coli. Elektro- foresis dari
hasil PCR beberapa klon kakao ditampilkan pada Gambar 1.
pb
600
400
200
1

10

11 12

13

14

15 16

17

Gambar 1. PCR DNA genomik kakao. Lini 1, 2-17 adalah Smart ladder, and MJ1-tahan, MJ1tahan, LW4- peka, LW4-peka, LW1-tahan, LW1-tahan, PN3-peka, PN3-peka,
PN6-tahan, PN6-tahan, MM2- peka, MM2-peka, MM1-tahan, MM1-tahan, MJ2peka dan MJ2-peka, masing-masing dengan pasangan primer pin-FR2 dan pinFR1.

Amplifikasi

DNA genomic kakao menggunakan PCR dengan primer

spesifik PIN menghasilkan pita-pita DNA yang intensitasnya bervariasi. Secara


umum PCR DNA namun intensitasnya relatif sangat lemah. ). Bervariasinya
intensitas pita DNA ini mungkin karena tingkat kemurnian DNA yang tidak
sama, jumlah copy gen, atau afinitas primer dengan templet berbeda-beda. Untuk
memastikan lebih lanjut mana yang benar perlu dilaku- kan pengujian. Hasil ini

mengindikasikan bahwa gen target penyandi protein 21kDa yang diekspresikan


pada biji kakao dapat dijadikan dasar dalam perancangan primer heterologous
spesifik PIN (Santoso, 2001). Selain itu primer tersebut dapat digunakan untuk
mendeteksi PIN kakao harapan tahan asal Sulawesi Selatan yang diuji. klon-klon
harapan tahan PBK, memberikan pita DNA yang relatif kuat sedangkan PCR
klon-klon kontrol yang peka tidak mem- berikan pita DNA atau menghasilkan
pita.
Beberapa tanaman kakao sampel menghasilkan amplikon dari analisis
PCR dengan menggunakan primer heterologous spesifik PIN. Elektroforesis
pada gel agarosa hasil

PCR tersebut

terlihat

seperti

menunjukkan bahwa sebagian besar menghasilkan

pada

amplikon

Gambar 2,

sesuai

dengan

yang diperkirakan.
A

pb
600
400
200
1

10

Gambar 2. Profil elektroforesis dari klon terseleksi. Lini 1, 2-9 (A), dan
10 (B) adalah Smart Ladder, hasil PCR dengan primer universal
FR M13 dari koloni putih yang tumbuh pada media seleksi, dan
plasmid rekombinan hasil miniprep.

Analisis homologi dari sekuen DNA spesifik yang diperoleh, dilakukan


dengan pendekatan teknik bioinformatika melalui program BLAST yang dapat
diakses pada situs NCBI yaitu hhttp://www.ncbi.nlm.nih.ov/BLAST/. Berikut ini
merupakan hasil analisis sekuen DNA menggunakan program Blast :

Score E
Sequencesproducingsignificantalignments:
gi|21909|emb|CAA39860.1| 21 kDa seed protein [Theobroma cacao
gi|19171719|gb|AAL85654.1| trypsin inhibitor [Theobroma cacao]
gi|2654440|gb|AAC63057.1| Lemir [Lycopersicon esculentum]..
gi|37625527|gb|AAQ96377.1| miraculin-like protein [Solanum .
gi|12083240|gb|AAG48779.1| putative lemir (miraculin) prote.
gi|5689166|dbj|BAA82842.1| miraculin homologue [Taraxacum o
gi|5689164|dbj|BAA82841.1| miraculin homologue [Youngia jap.
gi|688430|dbj|BAA05474.1| tumor-related protein [Nicotiana .
gi|23198316|gb|AAN15685.1| putative trypsin inhibitor [Arab.
gi|7438251|pir||S74136 latex proteinase inhibitor - papaya
gi|1708872|sp|P80691|LSPI_CARPA Latex serine proteinase inh.
gi|11596180|gb|AAG38518.1| miraculin-like protein 2 [Citrus.
gi|6538776|gb|AAF15901.1| putative proteinase inhibitor [Ni.

(bits)
268
value
266
106
102
96
95
93
86
78
75
72
71
66

3e-71
1e-70
2e-22
2e-21
3e-19
5e-19
3e-18
2e-16
6e-14
5e-13
5e-12
8e-12
3e-10

Gambar 3. Hasil BlastX dengan entri sekuen fragmen DNA dari klon harapan MJ-1.

Gambar 3 menunjukkan bahwa

sekuen asam amino klon kakao dengan

Theobroma yang lain dan spesies tanaman lainnya yang ada pada data base
memiliki distribusi perbandingan sangat tinggi. Hasil BlastX memperlihatkan
kecenderungan tingkat homologi yang relatif tinggi yang berkisar pada daerah
sekuen > 200 bp. Secara teoritis kisaran skor > 50 bits dengan E-value > e-04
pada analisis blast menunjuk- kan tingkat kemiripan yang tinggi (Claveri et al.,
2003; Santoso 2001).

Selanjutnya untuk mengetahui tingkat kekerabatan antara klon kakao uji


(MJ-1 dan LW-1) dengan kakao lain dan spesies tanaman lain yang ada
pada data base, dilakukan analisis ClustalW dalam bentuk dendogram.
Analisis

kekerabatan

(filo- genetik) untuk asam nukleat dan protein blast

tentang tingkat kemiripan dari MJ-1, LW-1

yang

sama-sama

tahan

sebagai

tanaman uji dan beberapa spesies kakao lain dan spesies tanaman lain yang ada
pada data base relatif tinggi. Hal ini memperlihatkan bahwa tingkat kemiripan
gen antar spesies yang dianalisis
yang sangat dekat, agak dekat,

menggambarkan tingkat kekerabatan, ada


dan ada pula yang jauh tidak berdekatan

kekerabatan. Klon MJ-1 dan LW-1 masih dalam satu kekerabatan yang sangat
dekat dibandingkan dengan spesies dari di base. Data ini memberikan suatu
asumsi bahwa gen TcPIN yang ada pada MJ-1 masih kerabat dengan TcPIN
pada LW-1, demikian pula dengan

PIN dari data base yang lebih dekat

dibandingkan dengan spesies-spesies tanaman lain CpPIN, AtPIN, IbPIN, StPIN,


CrPIN dan GmPIN Selanjutnya untuk melihat kemiripan antara sekuen TcPIN
dari klon harapan tahan PBK. LW-1 dan MJ-1 dilakukan analisis Blast Spesial
terhadap sekuen TcPIN dari kedua klon tersebut. Hasil analisis menunjukkan
bahwa gen PIN yang terkandung pada kedua klon tersebut

memiliki tingkat

kemiripan sangat tinggi yakni mencapai sekitar 96%. Dengan Score bits 671, E
value mencapai sempurna 0,0.
Pada Gambar 5 terlihat bahwa sekuen nukleotida dari gen TcPIN LW-1
dengan TcPIN MJ-1 yang masing-masing merupa- kan klon harapan tahan PBK
teridentifikasi mengandung

gen penyandi proteinase inhibitor yang memiliki

tingkat kemiripan yang sangat tinggi. Hasil analisis di tingkat DNA ini dan
sebelumnya mengindikasikan bahwa proteinase inhibitor terkait dengan ketahanan
kakao terhadap PBK.

Analisis penjajaran(alignment) untuk menentukan kemiripan genetik


menggunakan program ClustalW dari situs EBI yaitu htp://www.ebi.ac.uk/egibin/CLUSTALW/. Dan hasilnya adalah :

MjPIN:0.034
LwPIN:0.02852
TcPINdb:0.06354
CpPINdb:0.32683
AtPINdb:0.33351
IbPINdb:0.41068
StPINdb:0.37180
CrPINdb:0.36016
GmPINdb:0.40290

Gambar 4 . Analisis homologi dengan ClustalW dari sekuen PIN beberapa spesies dan kakao
klon harapan tahan PBK MJ1 (MjPIN) dan LW1 (LwPIN). Tc dari kakao tidak
diketahui sifat tahan PBK.

Score = 671 bits (349), Expect = 0.0, Identities = 374/386 (96%), Gaps = 2/386 (0%), Strand = Plus/Plus
Query: 87 gggttcaatattacgtcttgtcatcgatatcgggtgctgggggtggagggctagccctag
146
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5 gggttcaatattacgtcttgtcatcgatatcgggtgctgggggtggagggctagccctag 64
Query: 147 gaagggctacangtcaaagctgcccagaaattgttgtccaaagacgatccgaccttgaca 206
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65 gaagggctacaggtcaaagctgcccagaaattgttgtccaaagacgatccgaccttgaca 124
Query: 207 atggtactcc-tgtaatcttttcaaatgcggatagcaaagatgatgttgtcc-gcntatc 264
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct:125 atggtactccctgtaatcttttcaaatgcggatagcaaagatgatgttgtcccgcgtatc
184
Query: 265 tactgatgtaaacatanagttcgttcccatcagagacagactctgctcaacgtcaactgt 324
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 185 tactgatgtaaacatagagttcgttcccatcagagacagactctgctcaacgtcaactgt
244
Query: 325 gtggaggcttgacaattatgacaactcggcaggcaaatggtgggtgacaactgatggggt 384
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 245 gtggaggcttgacaattatgacaactcggcaggcaaatggtgggtgacaactgatggggt
304
Query: 385 taaaggtgaacctggtcctaacactttgtgcngttggtttaanattganaaggccggagt 444
|||||||||||| |||||||||||||||||| |||||||||| ||||| |||||||||||
Sbjct: 305 taaaggtgaaccaggtcctaacactttgtgcagttggtttaagattgagaaggccggagt
364
Query: 445 actcggntacnaattcangttctgtc 470
|||||| ||| |||||| ||||||||
Sbjct: 365 actcggttacaaattcaggttctgtc 390
Gambar 5 . Hasil Blast spesial sekuen fragmen TcPIN dari klon harapan tahan PBK LW-1 dan MJ-1.

BAB 3. KESIMPULAN
Tiga belas dari 18 klon kakao yang diuji, menunjukkan adanya homolog
PIN. Dua DNA fragmen dari klon harapan tahan, MJ-1, dan LW-1 telah
ditentukan sekuen nukleotidanya. Satu diantaranya, MJ-1 berhasil diklon. Analisis
sekuen kedua klon tersebut menunjukkan identitas sebagai homolog PIN dan
keduanya memiliki kemiripan genetik yang tinggi.
Terlihat bahwa riset bioinformatika ternyata juga memegang peranan
penting dalam permasalahan pangan. Indonesia yang saat ini banyak tertinggal
riset dasar dan terapannya harus berbenah diri dengan meningkatkan jumlah dan
kompetensi riset demi mengejar ketertinggalan di berbagai sektor dari negara
maju, bahkan negara berkembang seperti China dan India.

DAFTAR PUSTAKA
Attwood, T.K., dan D.J.Parry-Smith.1999. Introduction to Bioinformatics.
Harlow: Pearson Education.
Cohen, Jacques. 2004. BioinformaticsAn Introduction for Computer Scientists.
Waltham: Brandeis University press.
Claveri, J.M. & C. Notredame (2003). Bioinformatics For Dummies. 2nd
ed., New York, Wiley Publ. Inc., p, 215-238.
Michelia,Rynda.2011.http://ryndamichelia.wordpress.com/2011/08/17/bioinforma
tik-vs-biologi-komputasi/. diakses 02 Mei 2013 [12.29]
Mollah, Abdul. 2004. Deteksi dan Analisis Sekuen Gen Inhibitor Proteinase pada
Beberapa Klon Kakao Harapan Tahan Penggerek Buah Kakao dari
Sulawesi Selatan. 72(1), 1-10
Park, S. & R.W. Thornburg (1996). Loss of Specific Sequences in a Natural
Variant of Potato Proteinase Inhibitor II Gene Results in a Loss of
Wound-Inducible Gene Expression. Agric. Chem. Biotech., 39, 104-111.
Rao, Vaddi Srinivasa, dkk. 2008. Recent developments in life sciences research:
Role of Bioinformatics. India: ISSN 16845315.
Santoso, D. (2001). Pengembangan

Pelacak DNA spesifik gen melalui

bioinformatika: Identifikasi gen penyandi protein biji 21kDa pada kakao


UAH Indonesia. Menara Perkebunan, 69 (1), 10-17.

Sofyan,AbiGhifari.2012.http://www.chem-istry.org/artikel_kimia/ bioinformatikadan-revolusi-pertanian/. diakses pada tanggal 02 Mei 2013 [14.15]

V. K. Singh, dkk. 2011.Role of Bioinformatics in Agriculture adn Sustainable


Development. India: ISSN: 09753087.