Gene 554 (2015) 2531

Contents lists available at ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Cloning and functional characterization of -1, 3-glucanase gene from

Podophyllum hexandrum A high altitude Himalayan plant
Vivek Dogra, Yelam Sreenivasulu
Biotechnology Division, CSIR-Institute of Himalayan Bioresource Technology, Palampur 176061, HP, India

a r t i c l e

i n f o

Article history:
Received 7 March 2014
Received in revised form 30 September 2014
Accepted 6 October 2014
Available online 7 October 2014
Keywords1:
Podophyllum
Glucanase
Cell wall hydrolases
Germination
Proteins

a b s t r a c t
Podophyllum hexandrum is a high-altitude medicinal plant exploited for its etoposides which are potential anticancer
compounds. -1, 3-glucanase cDNA was cloned from the germinating seeds of Podophyllum (Ph-glucanase).
Glucanases belong to pathogenesis related glycohydralase family of proteins, which also play an important role in
endosperm weakening and testa rupture during seed germination. Analysis of cloned nucleotide sequence revealed
Ph-glucanase with an open reading frame of 852 bp encoding a protein of 283 amino acids with a molecular mass of
31 kDa and pI of 4.39. In-silico structure prediction of Ph-glucanase showed homology with that of Hevea brasiliensis
(3em5B). Structural stability and enhanced catalytic efciency in harsh climatic conditions possibly due to the presence of glycosyl hydrolase motif (LGIVISESGWPSAG) and a connecting loop towards inner side and well exposed
carbohydrate metabolism domain-COG5309, can readily hydrolyse cell wall sugar moieties. Seeds from the transgenic Arabidopsis plants over-expressing Ph-glucanase showed better germination performance against a wide
range of temperatures and abscisic acid (ABA) stress. This can be attributed to the accumulation of Ph-glucanase
at both transcript and protein levels during the seed germination in transgenic Arabidopsis. Results conrm that
the cloned novel seed specic glucanase from a cold desert plant Podophyllum could be used for the manipulation
of different plant species seeds against various harsh conditions.
2014 Elsevier B.V. All rights reserved.

1. Introduction
Seed germination is a complex process. It comprises a fascinating
chain of events and is considered as the initiation of a new phase in
the life cycle of a higher plant. During seed germination, loss of cellular
integrity of the endosperm cells in the micropylar region is the prior requirement, which facilitates radicle protrusion through the testa. Cell
wall hydrolysing proteins play a crucial role in the weakening of micropylar endosperm and/or testa during seed germination (Leubner-Metzger
et al., 1995; Wu et al., 2001; Nonogaki et al., 2000; Morris et al., 2011;
Gimeno-Gillesa et al., 2009; Gong et al., 2005). -1, 3-glucanase is one
of the known important cell wall hydrolases which belong to the
glycohydralase family-17 of proteins, and play a vital role in growth
and developmental processes such as cell division, microsporogenesis,
pollen germination, pollen tube growth, fertilization, embryogenesis,
fruit ripening, seed germination, and mobilization of storage reserves
in the endosperm of cereal grains, in environmental stress, wounding
responses and in defense against pathogens (Leubner-Metzger et al.,
Abbreviations: Podophyllum -1, 3-glucanase, Ph-glucanase; kDa, kilo Dalton; XET,
xyloglucan endotrans-glycosylase; ABA, abscisic acid; cDNA, complementary DNA.
Corresponding author.
E-mail addresses: sreenivasulu@ihbt.res.in, sree_yelam@yahoo.com (Y. Sreenivasulu).
1
Key message: Glucanase gene was cloned from a high altitude plant Podophyllum,
which showed activity in a wide range of temperatures besides enhancing the seed germination in different stress conditions.

http://dx.doi.org/10.1016/j.gene.2014.10.012
0378-1119/ 2014 Elsevier B.V. All rights reserved.

1995). -1, 3-glucanase exists as multiple structural isoforms that differ

in size, isoelectric point, primary structure, cellular localization, and pattern of regulation (Leubner-Metzger et al., 1995). -1, 3-glucanase disassembles cell wall components by hydrolysing cell wall polysaccharide
callose, a linear (1 3)--linked polymer of D-glucose (Lashbrook
et al., 1994). This results in endosperm weakening at the site of radicle
protrusion (Leubner-Metzger et al., 1995; Vogeli-Lange et al., 1994;
Leubner-Metzger and Meins, 1999), which is an important step in
seed germination in endospermic seeds such as tobacco (LeubnerMetzger, 2003) and tomato (Wu et al., 2001). The role of xyloglucan
endotrans-glycosylase (XET) in endosperm cap weakening is a key process regulating tomato seed germination reported by Chen et al. (2002).
Podophyllum hexandrum Royle (Syn. SinoP. hexandrum) also known
as Indian mayapple, is an important medicinal herb growing in the
sub-alpine and alpine regions of the Himalayas. The regions where
Podophyllum grows have prolonged winters covered with snow
(89 months; temperature 04 C or even less). Thus seeds have to sustain freezing temperatures and to germinate soon after the snow melts
at onset of summer when the temperature is quite low (mean temperature of 12 C). The plant gets 34 months of time to complete its life
cycle (from seed germination to senescence) (Kushwaha et al., 2007).
As an adaptive mechanism, the embryo of the seed is surrounded by
multi-thick-layered endosperm tissue and in turn surrounded by a hard
coated testa, which functions as a physical barrier for the radicle protrusion during germination (Sreenivasulu et al., 2009). 2-DE analysis of

26

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

Podophyllum seed germination protein proles, revealed the upregulation

of endosperm weakening proteins such as -1, 3-glucanase, xyloglucan
endotrans-glycosylase, pectinesterase and expansin (Dogra et al., 2013).
As such the conditions where the P. hexandrum grows are adverse for
seed germination because of the prevailing environmental conditions besides the presence of thick extra embryonic envelopes. Hence, the cell
wall hydrolases of such plant species are expected to have hydrolytic activities under low temperatures and other germination opposing factors
such as abscisic acid (ABA) a phytohormone, which leads to dormancy
in natural habitats. Thus, cloning and characterization of these specic cell
wall hydrolases from P. hexandrum could provide us tools to cope up with
the seed germination problems of other plants. In the present study, the
-1, 3-glucanase gene from P. hexandrum was cloned. Data on in-silico,
functional and structure characterizations of the cloned gene is presented.
2. Materials and methods
2.1. Seed collection and germination
Mature fruits of Podophyllum were collected from the alpine zone of
Koksar (32 22 21 N; 77 14 05 E; 3350 m asl) located in the upper
part of Chandra river valley of the western Himalayan region (Himachal
Pradesh) of India. Seeds were manually removed from the fruits,
washed in de-ionized water and dried at room temperature between
layers of lter papers. The seeds were air dried at room temperature
until the seed moisture content reached to 1012% (fresh weight
basis) and stored in air tight containers at 4 C until further use. Seeds
were kept for germination on Whatman No. 1 lter papers moistened
with 5 ml distilled water, at 20 1 C in four replicates, 25 seeds per
replicate. Germination was recorded daily up to 26 days.
Transgenic Arabidopsis seeds over-expressing ph-glucanase gene is
being germinated and the methods for engineering transgenic Arabidopsis
were as per the methods given in the following sections. Transgenic
Arabidopsis seeds were surface sterilized, placed in Petri dishes containing
either Murashige and Skoog (MS) medium or MS medium supplemented
with abscisic acid (ABA) (0.5, 1.0, 1.5, 2.0, 3.0 and 10.0 M). Agar (0.8%)
was used as solidifying agent. Germination tests were conducted using
four replicates of 25 seeds each. The plates were kept at 4 C for 48 hour
in dark and then shifted to 20 1 C under a 16 hour light cycle and
8 hour dark cycle. For temperature stress, MS agar plates with seeds
were kept at 4 C for 48 hour in the dark and then shifted to different
temperatures i.e. 0, 5, 10, 15, 20 and 30 C under abovementioned light
regime. Germination was recorded from day 3 onwards under the
above said conditions up to day 8. Seeds were considered as germinated
when a radicle of 1 mm long protruded the testa. Germination experiment was repeated three times and the averages were presented. Seed
germination data was analyzed using analysis of variance (ANOVA) to detect signicant difference between means. Means were compared using
Duncan's Multiple Range Test (DMRT) at P b 0.05 with STATISTICA ver.
7.0 (Statsoft Wipro).
2.2. Cloning of full length gene sequence of Ph-glucanase
Total RNA was isolated from the germinating Podophyllum seeds
using RNA extraction kit (Real Genomics, USA). Two micrograms of
total RNA was used for the amplication of cDNA ends by using RACE
(Rapid Amplication of cDNA Ends) reaction with SMART RACE cDNA
amplication kit (Clontech Laboratories, Inc., USA) in a 20 l reaction
with Superscript III reverse transcriptase (Invitrogen, USA). Separate
reactions were set for amplication of 5- and 3- of cDNA ends using
different sets of specic primers designed on the basis of Expressed Sequence Tag (EST) (149 bp) information available on Podophyllum -1,3glucanase. A list of primer sequences used for the RACE reactions were
given in Supplementary Table 1. The amplied cDNA fragments were
cloned into the pGEM-T Easy vector (Promega, USA) and sequenced.
The obtained nucleotide sequence information was aligned for identifying

overlaps using BLAST algorithm of NCBI (http://www.ncbi.nlm.nih.gov/).

ORF nder in NCBI was used to determine the 5 UTR, ORF and 3 UTR.
2.3. In-silico structure analysis
Multiple sequence alignment was done by ClustalW (version
2.0.9) multiple sequence alignment program (http://www.ebi.ac.
uk/clustalw/). Glucanase protein sequences of different plants were
extracted from NCBI and used in phylogenetic analysis. The NeighborJoining tree was constructed using the bootstrap test (1000 replicates)
with MEGA 5.05. Structure and function prediction was carried out
using Expasy's SWISS MODEL (http://swissmodel.expasy.org/) an automated protein homology-modeling server. In order to verify the condence of homology modeling, predicted structures were aligned with
endo--1, 3-glucanase of Hevea brasiliensis and root mean square deviation values (rmsdv) were calculated. Podophyllum -1, 3-glucanase
was further characterized in-silico by comparing its predicted structure
with Arabidopsis thaliana -1, 3-glucanase. Protein sub-cellular localization was predicted using ProtComp 9.0 (http://linux1.softberry.com/
berry.phtml) which compares Ph-glucanase to proteins in the LocDB
and PotLocDB databases that hold proteins with known or reliably predicted localization.
2.4. Semi-quantitative RT-PCR analysis
Total RNA was isolated from water imbibed seeds at different time
points during their germination i.e. from Phase I (1st day), early, mid
and late Phase II (4th, 10th and 14th day of imbibition) and Phase III
(16th day of imbibition). First-strand cDNA synthesis was done by
using 1 g of RNA with oligo(dT) primer, Superscript III reverse transcriptase (Invitrogen, USA) in a 20 l reaction. Double strand cDNA
was amplied by using gene specic primers. To monitor that equal
amounts of cDNA has been used, a fragment of the constitutively
expressed 26S rRNA gene was amplied simultaneously. RT-PCR was
conducted twice with three biological replicates each.
2.5. Estimation of Ph-glucanase activity during germination
Expression of Ph-glucanase enzyme was further conrmed by
two step microplate optimized assay based on di-nitro salicylic acid
(DNSA) according to Ramada et al. (2010), with some modications.
-1, 3-glucanase catalyzes endo-type hydrolytic cleavage of the 1,3-D-glucosidic linkages in -1, 3-glucans. In the present study laminarin, a polysaccharide of glucose was used as substrate for -1, 3glucanase, which is hydrolyzed into reducing sugars. These reducing
sugars were estimated spectrophotometrically at 540 nm after adding
the reaction with DNSA reagent. Total proteins were isolated from
water imbibed seeds, from Phase I (1st day), early, mid and late Phase
II (4th, 10th and 14th day of incubation) and Phase III (16th day of incubation) of germination. Briey, germinated and ungerminated seeds
were homogenized in 15 mM sodium acetate buffer (pH 5.5) and centrifuged twice for 5 min at 10,000 rpm. Supernatant was used as enzyme extract. Protein contents were estimated following the dye-binding method
(Bradford, 1976), BSA as a standard. Ten microliters of supernatant was
incubated with 0.25% laminarin at 37 C for 1 hour, 100 l of DNSA
reagent (DNS 0.687%, Phenol 1.28%, Na-K-tartarate 19.92% and NaOH
1.226% in sodium acetate buffer, pH 5.5) was then added and incubated
at 95 C for 5 min. Reactions were then cooled and absorbance was
taken at 540 nm in a spectrophotometer (Biotek multiplate reader). Specic enzyme activity was estimated using glucose standard curve.
2.6. Preparation of expression vector constructs
For the functional validation of Ph-glucanase gene, full length cDNA
was amplied using forward primer 5- GGATCCATGCGAATCTATGATC
CAG -3 and reverse primer 5- GTCGACAGAGAAATTAATGTCATAAGC-

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

3 (underlined sequence represents restriction sites BglII and Spe1, respectively). Amplied product was cloned into cloning vector pGEMTeasy and then sub-cloned into binary expression vector pCAMBIA 1302.
This construct was mobilized into Arabidopsis plants via Agrobacterium
mediated vacuum inltration method (Bechtold et al., 1993). Seeds
were collected from these plants and screened for putative transgenic
plants on MS agar plates supplemented with hygromycin (20 mg/L). Putative transgenic plants which showed a 3:1 segregation ratio were assumed as a single copy insert and allowed to grow to T3 generation for
getting homozygous lines. Expression of transgene in transgenic lines
was further conrmed by estimating its transcripts through semiquantitative RT-PCR.
2.7. Statistical analysis
The results presented in the tables and gures are the means of SE
of at least three measurements each performed on independent biological samples collected at independent times.
3. Results and discussion
Seed germination begins with water uptake and terminates with the
elongation of embryonic axes through seed coverings i.e. perisperm, endosperm and testa. Increase in growth potential of the embryonic axis
along with the endosperm weakening is prerequisite for radicle protrusion. The later event may be associated with cell wall-loosening activities. Cell wall hydrolase proteins play a signicant role in weakening
of the extra embryonic envelopes (Leubner-Metzger et al., 1996). It
was reported that in Podophyllum, multilayered thick-walled micropylar endosperm prevents the protrusion of expanding embryonic
axis (Sreenivasulu et al., 2009). Thus germination might be associated
with the increased activities of certain cell wall loosening enzymes.
3.1. Increased expression of cell wall hydrolases promotes seed germination
in Podophyllum
In earlier studies, it was reported that in Podophyllum increased expression in cell wall hydrolases such as -1, 3-glucanase, xyloglucan

27

endotransglycosylase/hydrolase (XET), pectinesterase and expansin

causes radicle emergence Dogra et al. (2013). This was also evidenced
through proteomic and transcript analysis.
3.2. Podophyllum seed germination associated with high levels of -1,
3-glucanase
Accumulation of -1, 3-glucanase transcripts were observed during
Podophyllum seed germination, especially in late Phase II and early
Phase III (Fig. 1). No or little levels of -1, 3-glucanase transcripts
were detected in Phase I (1st day) of seed germination. Whereas, gradual increase in transcript levels was recorded as the seed proceeds towards the end of Phase II (1314th day) and signicantly increased
during Phase III (16th day). The function of -1, 3-glucanase activity,
isolated at different time points of Podophyllum seed germination, as a
function of hydrolysis of laminarin starch, also conrmed the gradual
accumulation of this protein with the progress of germination (Fig. 1).
Specic glucanase activity of 0.028, 0.0290.040 and 0.061 U/mg protein was recorded during Phase I, Phase II and Phase III, respectively.
Earlier studies reported that -1, 3-glucanase and other cell wall hydrolases are required for the weakening of micropylar endosperm in tomato (Wu et al., 2001), in tobacco (Leubner-Metzger et al., 1995) and in
Arabidopsis (Ogawa et al., 2003), which allow the embryonic axis to protrude through the extra embryonic coverings. In the present study, up
accumulation of -1, 3-glucanase as evidenced by the transcript and
protein levels, conrmed that this might be involved in weakening of
thick walled micropylar endosperm tissue in Podophyllum. Data on cloning and functional analysis of -1, 3-glucanase gene from Podophyllum
is presented.
3.3. Cloning and sequence analysis of Ph-glucanase
Full length coding sequence of -1, 3-glucanase of Podophyllum was
cloned by two rounds of RACE reactions (both 5 and 3) with different
sets of gene specic primers which were designed on the basis of EST information. An amplicon of 1092 bp was searched for the coding region,
5 and 3 UTRs with the help of NCBI ORF nder. This resulted to 852 bp
of coding region with 79 bp of 5 UTR, and 161 bp of 3 UTR and

Fig. 1. Activity of -1, 3-glucanase during Podophyllum seed germination. (A) Ph-glucanase activity. Total proteins were isolated, from the seeds imbibed for different time periods on DW,
specic glucanase activity was estimated. Results were plotted on water uptake pattern of earlier reported graph (Dogra et al., 2013). (B) Total RNA was isolated from the similarly imbibed
seeds and transcript levels of glucanase were estimated by semi-quantitative RT-PCR. 26S rRNA gene was used as a control for equal loading. Error bars indicated SE.

28

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

Fig. 2. Deduced gene and encoded amino acid sequence of Ph-glucanase. Underlined T and NPS residues represent the potential O-glycosylation and N-glycosylation sites, respectively.

successfully aligned in the NCBI Protein-BLAST algorithm also. This

852 bp of coding sequence encodes a protein of 283 amino acids with
a molecular weight of 31 kDa (isoelectric point of 4.39) (Fig. 2). The deduced amino acid sequence demonstrated one potential N-linked glycosylation site (AsnProSer) at position 110, one potential O-linked
glycosylation site (Thr) at position 68 and 14 probable phosphorylation
sites (7 at serine, 3 at threonine and 4 at tyrosine positions) (Fig. 3).

Fig. 3. Predicted tertiary protein structure of the Ph-glucanase. Helices are represented by
round cyan arrows, -sheets by at magenta arrows and loops linking secondary structures are represented in tint. Predicted N-linked (N110) and O-linked (T68) glycosylation
sites and signature motif of glycosyl hydrolases family 17 (202-LGIVISESGWPSAG-214)
are indicated (yellow) by arrows.

Motif analysis of Ph-glucanase using PROSITE (release 20.81), revealed presence of signature motif -LGIVISESGWPSAG- of glycosyl hydrolases family 17, which showed conservation to consensus pattern
[LIVMKS]-x-[LIVMFYWA](3)-[STAG]-E-[STACVI]-G-[WY]-P-[STN]-x[SAGQ]. Conserved domain search in NCBI, revealed the presence of
carbohydrate transport and metabolism domain (COG5309) between
205 to 270 residues (Fig. 4). Multiple alignment analysis of Ph-glucanase
conrmed that Ph-glucanase is different from others and has 62%
similarity with that of Vitis vinifera (Fig. 4). This also showed 61% homology with banana (Musa balbisiana), 51% with Arabidopsis (A. thaliana)
and tomato (Solanum lycopersicum) while only 36% with tobacco
(Nicotiana tabacum) with more conservation towards C-terminal,
while N-terminal residues are very much different. This might be due
to the variability in the length of the sequences. Sequence length of
Ph-glucanase is equal in Sesbania rostrata with 56% similarity.
Sub-cellular localization prediction analysis showed that Ph-glucanase
is a secretary protein and is localized in the extra cellular matrix, in accordance with the earlier reported -1, 3-glucanases (Leubner-Metzger and
Meins, 1999). Secondary structure analysis using Self-Optimized Prediction Method with Alignment (SOPMA) (Geourjon and Deleage, 1995),
revealed the presence of 33.9% alpha helices, 20.85% extended strands
(-sheets), 6.71% beta turns and 38.52% random coils (loops) in -1, 3glucanase (Supplementary Table 2). Structurally, Ph-glucanase is different
from that of Arabidopsis which contains 34.43% alpha helices, 19.67%
extended strands, 8.52% beta turns and 37.38% random coils. Predicted
secondary structure showed that Ph-glucanase constitutes of high proportions of -sheets, probably provides structure stability under harsh
climatic conditions. Predicted tertiary structure showed maximum
homology of 61.32% with endo--1, 3-glucanase of H. brasiliensis
(3em5B). A. thaliana shared lesser, about 49.21% similarities with
3em5B. Root mean square deviation values (rmsdv) were calculated
for the model structures against already known structure in protein
data bank using 3D-match (http://linux1.softberry.com/berry.phtml).

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

29

Fig. 4. Alignment of the deduced Ph-glucanase sequence (JX560176) with homologous -1, 3-glucanases of different plant species. Highly conserved amino acid motifs are highlighted in
dark gray and consensus residues in light gray background. Conserved consensus signature motif (*LGIVISESGWPSAG*-) of glycosyl hydrolase family 17 protein is underlined and
marked. The carbohydrate transport and metabolism domain COG5309, as deduced by conserved domain search in NCBI, is underlined and shown in red.

Homology modeling structures were veried using RMSDV (b 2 ) as a

signature of signicance. For the predicted structure to be considered,
rmsdv should be b 2 . When predicted structures of Ph-glucanase and
of Arabidopsis were aligned against the available structure of endo-1, 3-glucanase of Hevea, RMSD values were calculated as 0.622 for Podophyllum and 0.712 for Arabidopsis (Supplementary Table 2).
In order to investigate the evolutionary relationship of Ph-glucanase,
a phylogenetic tree (Fig. 5) was constructed with the protein sequences

Fig. 5. Phylogenetic analysis of Ph-glucanase (JX560176). Different plants' glucanase amino

acid sequences from the databases were used to construct the phylogenetic tree. The
Neighbor-Joining tree was constructed using MEGA 5.05. Numbers shown next to the
branches are the percentages of replicate trees with associated taxa clustered together
in the bootstrap test (1000 replicates).

of other known plant glucanases from the NCBI database. Phylogenetic

analysis conrmed that Podophyllum is closest to V. vinifera and
O. europaea among all other plant species.
3.4. Arabidopsis seeds over-expressing Ph-glucanase perform better
germination
In order to assess the functional role of Ph-glucanase in seed germination, expression construct was prepared in pCAMBIA1302 and transformed into WT A. thaliana (Fig. 6A). Two independent T3 homozygous
lines with single copy insertion were selected and conrmed the expression of transgene by estimating its transcripts (Fig. 6B). Glucanase
transgenic 1 (GT1) showed more Ph-glucanase gene transcripts than
the GT3 line. Similarly these lines showed better glucanase activity
than the WT during seed germination (Fig. 6C). Localization of Phglucanase expression, as a function of fusion gene expression i.e. green
uorescent protein (GFP) gene, was found at the micropylar end of
the transgenic Arabidopsis seeds during their germination (Fig. 6C
inset). This conrmed that the Ph-glucanase gene acts on the micropylar
tissue of Arabidopsis seeds and facilitates the early radicle protrusion.
Seeds from the transgenic plants started germination after 18 and
21 hour in GT1 and GT2, respectively, in comparison to 24 hour in WT,
after the completion of imbibition in water at 20 C. Maximum germination was achieved in between 45 and 51 hour in transgenic seeds whereas
WT seeds attained maximum germination after 96 hour. Faster germination response might be because of the over-expression of Ph-glucanase
only. It was also found that the transgenic Arabidopsis seeds could
also enhance the germination against temperature and ABA stresses
(Fig. 7A). Faster and higher percent seed germination was achieved in
transgenic seeds when compared to WT and found statistically signicant
(P b 0.05) at all the temperatures tested (from 530 C). Enhanced germination was more pronounced in GT1 and GT2 at lower temperatures i.e.
5 C, where no germination was recorded in WT. Similarly seeds from
transgenic Arabidopsis plants showed more tolerance against all the concentrations of ABA stress (010 M). Seeds from GT1 and GT2 could sustain 10 M ABA and managed 1525% seed germination, whereas, no
germination was recorded in seeds from WT plants (Fig. 7B). The results

30

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

Fig. 6. Functional validation of Ph-glucanase in Arabidopsis. A) Diagrammatic representation of construct prepared in pCAMBIA1302 for expression in Arabidopsis. B) Conrmation of Phglucanase expression in transgenic Arabidopsis plants. Total RNA was isolated from the leaves of the transgenic plants and rst strand cDNA synthesis was done by reverse transcriptase
with oligo dT primers. Specic cDNA of Ph-glucanase was amplied by using gene specic primers. 26SrRNA was used as a reference to show that equal amounts of RNA were used in the
analysis. C) Germination of transgenic Arabidopsis seeds overexpressing Ph-glucanase at 20 1 C. Errors bars represent SE.

conrmed that over-expression of Ph-glucanase in Arabidopsis enhanced

the stress tolerance against temperature and ABA stresses during seed
germination. Lower temperatures and ABA are known to inhibit seed
germination. ABA acts as an inhibitor of -1, 3-glucanase and thus prevents endosperm weakening and subsequent endosperm rupture. The
Ph-glucanase transgenic lines exhibited a signicantly higher and faster
germination as compared to WT seeds, at both temperature and ABA
stresses. Thus, the transgenic seeds signicantly outperformed the WT,
due to the over-expression of an extra copy of a novel -1, 3-glucanase
from Podophyllum. The data clearly conrms that glucanase from
Podophyllum is a novel enzyme which hastens/or improves seed germination even in harsh and inhibitory conditions. This enzyme thus can be
exploited for developing strategies for manipulating seed germination
related issues in other plant species also.
Over-expression of Ph-glucanase gene from the high altitude medicinally important plant-Podophyllum, promoted Arabidopsis seed germination in different stress conditions like in low and high temperatures
and ABA stress. Further biochemical and structural characterizations
need to be done for better understanding and utilization of this important gene in agriculture as well as for commercial applications.

Acknowledgments

Fig. 7. Pattern of germination of transgenic Arabidopsis seeds over-expressing Phglucanase as a function of temperature and ABA stress. A) Seeds were kept for germination
at different temperatures (0, 5, 10, 15, 20 and 30 C) and B) in different ABA concentrations (0, 0.5, 1.0, 1.5, 2, 3, 5 and 10 M) and the number of seeds germinated was recorded
each day up to 8 days. Each value is a mean of three separate biological replicates. Error
bars represent SE. Seed germination percentages were analyzed using ANOVA to detect
signicant difference between means. Means were compared using Duncan's Multiple
Range Test (DMRT) at P b 0.05.

This work was supported by grants from the Department of Science

and Technology (SR/FT/L-156/2004), New Delhi, India and the Council
of Scientic and Industrial Research (CSIR), New Delhi, India in the
form of Network Projects PlaGen (BSC-0107), SIMPLE (BSC-0109) and
Developmental biology (MLP-072) at the CSIR-IHBT. The manuscript
represents CSIR-IHBT communication number 3666. VD acknowledges
CSIR, New Delhi for providing Senior Research Fellowship.

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.gene.2014.10.012.

V. Dogra, Y. Sreenivasulu / Gene 554 (2015) 2531

References
Bechtold, N., Ellis, J., Pelletier, G.C., 1993. In planta Agrobacterium mediated gene transfer
by inltration of adult Arabidopsis plants. CR Acad. Sci. Paris 316, 11941199.
Bradford, M.M., 1976. A rapid and sensitive method for quantitation of microgram quantities
of protein utilizing the principle of protein-dye-binding. Anal. Biochem. 72, 248254.
Chen, F., Nonogaki, H., Bradford, K.J., 2002. A gibberellin regulated xyloglucan
endotransglycosylase gene is expressed in the endosperm cap during seed germination. J. Exp. Bot. 53, 215223.
Dogra, V., Ahuja, P.S., Sreenivasulu, Y., 2013. Change in protein content during seed germination of a high altitude plant Podophyllum hexandrum Royle. J. Proteomics 78,
2638.
Geourjon, C., Deleage, G., 1995. SOPMA: signicant improvements in protein secondary
structure prediction by consensus prediction from multiple alignments. Comput.
Appl. Biosci. 11, 681684.
Gimeno-Gillesa, C., Lelievrea, E., Viaua, L., Malik-Ghulama, M., Ricoulta, C., et al., 2009.
ABA-mediated inhibition of germination is related to the inhibition of genes encoding
cell-wall biosynthetic and architecture: modifying enzymes and structural proteins in
Medicago truncatula embryo axis. Mol. Plant 2, 108119.
Gong, X., Bassel, G.W., Wang, A., Greenwood, J.S., Bewley, J.D., 2005. The emergence
of embryos from hard seeds is related to the structure of the cell walls of the micropylar endosperm, and not to endo--mannanase activity. Ann. Bot. 96,
11651173.
Kushwaha, R., Pandey, S., Chanda, S., Bhattacharya, A., Ahuja, P.S., 2007. GA3 induced
changes in slow growing endangered Himalayan plant Podophyllum hexandrum and
hastening of vegetative growth. Plant Growth Regul. 51, 207215.
Lashbrook, C.C., Gonzalez-Bosch, C., Bennett, A.B., 1994. Two divergent endo-P-1,4glucanase genes exhibit overlapping expression in ripening fruit and abscising
owers. Plant Cell 6, 14851493.

31

Leubner-Metzger, G., 2003. Functions and regulation of -1,3-glucanases during seed germination, dormancy release and after-ripening. Seed Sci. Res. 13, 1734.
Leubner-Metzger, G., Meins, F., 1999. Functions and regulation of plant -1,3-glucanases
(PR-2). In: Datta, S.K., Muthukrishnan, S. (Eds.), Pathogenesis-Related Proteins in
Plants. CRC Press LLC, Boca Raton, Florida, pp. 4976.
Leubner-Metzger, G., Frundt, C., Vogeli-Lange, R., Meins, F., 1995. Class I -1,3-glucanases
in the endosperm of tobacco during germination. Plant Physiol. 109, 751759.
Leubner-Metzger, G., Frundt, C., Meins, F., 1996. Effects of gibberellins, darkness and
osmotica on endosperm rupture and class I -1,3-glucanase induction in tobacco
seed germination. Planta 199, 282288.
Morris, K., Linkies, A., Muller, K., Oracz, K., Wang, X., et al., 2011. Regulation of seed germination in the close Arabidopsis relative Lepidium sativum: a global tissue-specic transcript analysis. Plant Physiol. 155, 18511870.
Nonogaki, H., Gee, O.H., Bradford, K.J., 2000. A germinationspecic endo--mannanase
gene is expressed in the micropylar endosperm cap of tomato seeds. Plant Physiol.
123, 12351245.
Ogawa, M., Hanada, A., Yamauchi, Y., Kuwahara, A., Kamiya, Y., et al., 2003. Gibberellin
biosynthesis and response during Arabidopsis seed germination. Plant Cell 15,
15911604.
Ramada, M.H.S., Lopes, F.A.C., Ulhoa, C.J., Silva, R.N., 2010. Optimized microplate -1,3glucanase assay system for Trichoderma spp. screening. J. Microbiol. Methods 81, 610.
Sreenivasulu, Y., Chanda, S.K., Ahuja, P.S., 2009. Endosperm delays seed germination in
Podophyllum hexandrum Royle an important medicinal herb. Seed Sci. Technol.
37, 1016.
Vogeli-Lange, R., Frundt, C., Hart, C.M., Beffa, R., Nagy, F., et al., 1994. Evidence for a role of
-1,3-glucanase in dicot seed germination. Plant J. 5, 273278.
Wu, C.T., Leubner-Metzger, G., Meins, F., Bradford, K.J., 2001. Class I -1,3-glucanase and
chitinase are expressed in the micropylar endosperm of tomato seeds prior to radicle
emergence. Plant Physiol. 126, 12991313.