Anda di halaman 1dari 135

UNILASALLE

CENTRO UNIVERSITARIO LASALLE

Disciplina 02775

BIOLOGIA CELULAR E MOLECULAR

Regente: Prof. Mauricio Pereira Almerão
AULA 9
Organização gênica em eucariotos e procariotos
Extração de DNA, PCR e Sequenciamento

ORGANIZAÇÃO
GÊNICA:
Procariotos
Eucariotos

GENES

http://passel.unl.edu/pages/printinformationmodule.php?idinformationmodule=957882007

info/thoughts/genetic_engineering.GENES http://jp.senescence.html .

6x103 kb (Escherichia coli) PRATICAMENTE SEM INTRONS (colinearidade) DNA NÃO ASSOCIADO A HISTONAS APRESENTA OPERONS SUPERPOSIÇÃO de GENES GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO DNA ACESSÓRIOS Plasmídeos. Bacteriófagos e Elementos transponíveis .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS HAPLÓIDE e CIRCULAR Pequeno: 4.

org/wiki/index.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS IMPORTÂNCIA da HAPLOIDIA EXPRESSÃO DE TODOS OS GENES SEM RELAÇÃO DE DOMINÂNCIA MUTAÇÕES SÃO SEMPRE EXPRESSADAS SELEÇÃO NATURAL http://www.proteopedia.php/User:Alexei_Ilinykh/Sandbox_1 .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS http://slideplayer.br/slide/50886/ .com.

discoveryandinnovation.com/BIOL202/notes/lecture13.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS COLINEARIDADE: Nucleotídeos x Aminoácidos Seqüência de Códons (DNA) “IGUAL” à seq. de AA Não há processamento de RNA (geralmente) Não há INTRONS (geralmente) “Economia de espaço” http://www.html .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS OPERON Conjunto de genes nos procariotos (e em alguns eucariotos) que se encontram funcionalmente relacionados. sendo todos expressos em apenas um mRNA. contíguos e controlados coordenadamente. .

o operador. Quando o repressor está ligado ao operador. ele impede estericamente que a RNA polimerase transcreva os genes estruturais do Operon. o gene regulador. as regiões operadoras estão geralmente situadas entre os promotores e os genes estruturais que eles regulam. onde a transcrição de um conjunto de genes estruturais contíguos regulados por dois elementos controladores.CONSIDERAÇÕES OPERON O modelo do Operon foi desenvolvido para explicar a regulação dos genes que codificam as enzimas necessárias para o uso de lactose em E. O operador é sempre contíguo ao(s) gene(s) estrutural(ais) cuja expressão ele regula. que. sob condições apropriadas. Sendo assim. codifica um repressor. . se liga ao segundo elemento. Um destes elementos. A transcrição é iniciada em promotores que precedem os genes estruturais na extremidade 5’ e são contíguos à regiões operadoras. coli.

ufmg.com/watch?v=oBwtxdI1zvk .youtube.html https://www.icb.CONSIDERAÇÕES OPERON Operon lac http://www.br/labs/lbcd/grupo7/iniciar/aulaexp/exp1-2.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS SUPERPOSIÇÃO DE GENES COMPACTAÇÃO DO GENOMA PRODUÇÃO DE DIFERENTES PROTEÍNAS .

fr/erocha/research/order.html .jussieu.snv.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO AUMENTO NO NÍVEL DA EXPRESSÃO GÊNICA Genes mais importantes http://wwwabi.

org/wiki/Plasmid .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS DNA ACESSÓRIO (plasmídeos) http://en.wikipedia.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS DNA ACESSÓRIO (plasmídeos) Extracromossômico .várias cópias (multicópia) Função não essencial à vida: Fixação de nitrogênio – PLASMÍDEOS COL Reprodutivos – PLASMÍDEOS F Resistência a antibióticos – PLASMÍDEOS R Metais pesados e toxinas bacterianas – OUTROS PLASMÍDEOS.1 a 200 kb Replicação Autônoma Tem sua própria origem de replicação Plasmídeos Grandes .únicos (cópia-única) Plasmídeos Pequenos . .

html .blogspot.com.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS COL Relacionados à fixação do nitrogênio no solo. http://oquimiajuda.br/2011/05/especial-moleculas-gas-nitrogenio.

CONJUGAÇÃO Transferência do material .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS F Transferem genes (plasmídeos) para outras bactérias Codificação o pilli F ou sexual Promoção contato ou conexão entre células .

com/ watch?v=VU7brO7A36w .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS F https://www.youtube.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS R Relacionados à resistência antimicrobiana.com.br/meiodecultura/tag/plasmideo/ . http://scienceblogs.

0085487 .1371%2Fjournal.pone.org/article/info%3Adoi%2F10.plosone.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS OUTROS PLASMÍDEOS Metais pesados e toxinas bacterianas http://www.

Agricultura: plantas transgênicas http://soumaisenem.br/biologia/engenharia-genetica/tecnologia-do-dna-recombinante Veterinária: animais transgênicos .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS (DNA RECOMBINANTE) Clonagem molecular Engenharia genética Indústria: produção de biofármos.com. enzimas de interesse comercial.

net/profiles/blogs/the-capture-of-cytos-by http://wikiciencias.php/Bacteri%C3%B3fago .audrn.incorporação do próprio material Transdução restrita reprodução Transdução generalizada http://people.reprodução do próprio material Ciclo lisogênico .org/wiki/index.casadasciencias.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS BACTERIÓFAGOS (vírus de bactérias) Ciclo lítico .

audrn.net/profiles/blogs/the-capture-of-cytos-by .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS BACTERIÓFAGOS (vírus de bactérias) http://people.

ELEMENTOS GENÉTICOS TRANSPONÍVEIS .

RECOMBINAÇÃO SÍTIO-ESPECÍFICA RECOMBINAÇÃO SÍTIO-ESPECÍFICA GUIADA por uma ENZIMA de RECOMBINAÇÃO RECONHECE SEQUÊNCIAS ESPECÍFICAS NÃO NECESSITA PAREAMENTO de BASES (homologia) DESCOBERTA em BACTÉRIAS/vírus CAPACIDADE de CERTOS VÍRUS de INTEGRAR seu GENOMA ao da BACTÉRIA GENES que CODIFICAM “INTEGRASES” RESPONSÁVEIS pela “TRANSPOSIÇÃO” .

ORGANIZAÇÃO GÊNICA
ELEMENTOS TRANSPONÍVEIS (TRANSPOSONS)
GENES QUE MUDAM DE POSIÇÃO NO GENOMA
PROCARIOTOS (e EUCARIOTOS)

MESMO CROMOSSOMO

DESLOCAM-SE no GENOMA
CROMOSSOMOS DIFERENTES
LONGOS PERÍODOS de QUIESCÊNCIA

NÃO ABANDONAM a CÉLULA
SEM CAPACIDADE INFECCIOSA

ORGANIZAÇÃO GÊNICA
CARACTERÍSTICAS (TRANSPOSONS)
% nos procariotos? (46% do Genoma Eucariótico)
AMBAS as EXTREMIDADES com SEQUÊNCIAS SIMILARES
REPETIÇÕES TERMINAIS – SÍTIOS para ENZIMAS
NORMALMENTE CODIFICAM a ENZIMA para a TRANSPOSIÇÃO
TRANSPOSASES
CRIAM “DUPLICAÇÕES” do SÍTIO de INSERÇÃO, no DNA ALVO
REPETIÇÕES DIRETAS = orientadas no mesmo sentido
EXISTEM em CÓPIAS MÚLTIPLAS no GENOMA
PRINCIPAL FONTE de MUTAÇÕES no GENOMA

ORGANIZAÇÃO GÊNICA
MECANISMO GERAL de TRANSPOSIÇÃO

https://www.youtube.com/watch?v=0d76-gbOYtg

ORGANIZAÇÃO GÊNICA .

ORGANIZAÇÃO GÊNICA Importância (TRANSPOSONS) .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS HAPLÓIDE e CIRCULAR DIPLÓIDE E LINEAR Cromossomos (organizados em pares de homólogos). .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS PRATICAMENTE SEM INTRONS (colinearidade) PRESENÇA DE INTRONS http://pt.wikipedia.org/wiki/Usu%C3%A1rio:Yleite/DNA_n%C3%A3o-codificante .

edu.ORGANIZAÇÃO GÊNICA DE EUCARIOTOS DNA NÃO ASSOCIADO A HISTONAS DNA ASSOCIADO A HISTONAS http://colegioamerica.uy/MATERIAL/BIOLOGIA/Seccion%203/3%20-%20Capitulo%2017.htm .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS APRESENTA OPERONS AUSÊNCIA (raras exceções) DE OPERONS Exceção Caenorhabditis elegans Nematódeo: 15-25% dos genes .

de/dissertationen/pietas-agnieszka-2004-11-22/HTML/chapter1.expansion http://edoc.hu-berlin.org/content/30/20/4432/F1.html .ORGANIZAÇÃO GÊNICA DE EUCARIOTOS SUPERPOSIÇÃO de GENES NÃO HÁ SUPERPOSIÇÃO de GENES http://nar.oxfordjournals.

org/html/Prokaryotic_DNA_Replication3-E_coli_DNA_Replication.masters.grkraj.htm .ORGANIZAÇÃO GÊNICA DE EUCARIOTOS ACÚMULO DE GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO NÃO HÁ ACÚMULO GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO http://mol-biol4masters.

htm#didyouknowout http://evolutionaryroutes.com/what-is-mitochondrial-dna-analysis.ORGANIZAÇÃO GÊNICA DE EUCARIOTOS DNA ACESSÓRIOS DNA ACESSÓRIOS http://www.wordpress.com/2011/08/31/the-taming-of-the-chloroplast/ .wisegeek.

pequenos. poucos genes.ORGANIZAÇÃO GÊNICA PROCARIOTOS EUCARIOTOS  Procariotos → genomas menos complexos.  Eucariotos → genomas mais complexos. muitos genes. lineares. sem operons e sem unidades genéticas acessórias. circulares. operons e unidades genéticas acessórias. grandes. .

ufrgs.br/labimet/membros/apoio-tecnico/ .LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) http://www.

lance-ufrj.  Sala para PCR.org/estrutura-e-arredores. http://www.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Diferentes salas. . Sala para extração.  Sala para revelação do gel.html Diferentes finalidades (manipulações e equipamentos). Diferentes bancadas.

br/2011_05_01_archive. http://apendiciencia.com.  EVACUAÇÃO . vapores agressivos. partículas ou líquidos em quantidades e concentrações perigosas.produtos químicos.html . prejudiciais para a saúde.blogspot. tóxicos.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Capela de exaustão  EPC.

com.php?an=7d06ca3e128bc079be1349975e0f6b98&Bid=p46c062c88277d .analiticaweb.br/produtos_detalhe. http://www.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Capela de Fluxo laminar  Câmara quase isolada onde ar filtrado é constantemente injetado em uma só direção na área de trabalho por um motor. garantindo um ambiente renovado e limpo.

vocedeolhoemtudo.REAGENTES.lojasbrejao.br/utensilios/freezer-vertical/  Atividades de enzimas de degradação (DNAases e RNAases).br/ofertas/geladeira-arnofacilite-crb39-342lts/ http://decoracao.  -20ºC (freezer) – DNA/RNA. http://www.com.com. .LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Estocagem de reagentes e amostras  4ºC (geladeira) .

br/portal/departamentos/de c/labmes/equipamentos. ÁGUAS PURAS http://www.  MilliQ® (água milli-Q ou água deionizada ou água ultrapura).joinville.php .udesc.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Destilador de laboratório  Água destilada (bidestilada ou tridestilada).

HTM http://pt.com.br/Departamentos/FBF/Disciplinas/Farmacotecnica/instrum entos/BEQUER1.prolab.org/wiki/Erlenmeyer_(bal%C3%A3o) http://www.usp.br/vidrarias-para-laboratorio/frascos/frasco-reagentegraduado-tampa-azul- .wikipedia.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Vidraria  Erlenmeyer  Bécker  Vidro borosilicato http://www.fcf.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Outros materiais  Pipetas  Ponteiras  Tubos http://www.ufg.us.icb.com.br/produtos_detalhe.php?idProdut o=16&Cat=1 http://personal.es/cubo/ http://pos.jprolab.br/pages/37159-boas-praticas-e-manuseio-das-pipetas-htl .

água destilada. meios de cultura. tubos eppendorfs.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Esterilização  Autoclave (calor úmido sob pressão). etc.  Ponteiras. http://labsetupsolutions.com/autoclaves/ .

http://econolab.br/v2/?wpsc-product=maquina-de-gelo-em-escamas-40kg-dia-hexicryo .com.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Picotador de gelo (manutenção de DNA e RNA).

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Banho maria (5ºC acima da Tamb até 120 ºC).br/produtos/equipamentos-para-laboratorio/banho-maria-para-laboratorio . http://www.prolab.com.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Centrífugas (macro e microcentrífugas).labosistema.p hp?an=6291ba38f669ab42df583d33c40e80e1&Bid =p4519788614715 . http://www.br/produtos_detalhe.aspx?tabid=67&c ategoryid=24&category=centrifugas_de_bancada&l anguage=en-us http://www.com.pt/default.analiticaweb.

com. http://www.br/produtos/equipamentos-para-laboratorio/cubas-de-eletroforese .prolab.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Migração (ácidos nucléicos e amplificados)  Cubas de eletroforese.

uk/products-page/pcr/te-peltier-cooling-pcr-thermocycler/ . http://www.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Amplificação de genes  Termicicladores.co.scilifesolutions.

com/doc/BJ4wYJVY/preview.aspx .uk/product-information/molecular-biologyproducts/clarit-e-Electrophoresis-Systems/electrophoresisaccessories. Revelação (gel) http://dc388.4shared.co.alphalabs.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica)  Boa foto = bom “diasnóstico”.html http://www.

 nunca pipetar com a boca.  sempre usar jaleco e luvas.  lavar imediatamente a pele após contato com reagentes químicos.  etc.  não cheirar soluções ou reagentes. .LABORATÓRIO DE BIOLOGIA MOLECULAR Regras gerais de segurança: – Bom senso:  nunca trabalhar sozinho (corpo técnico).  não comer ou beber na bancada.

INTRODUÇÃO TÉCNICAS EM BM  Extração de DNA Objetivo.  Procedimentos gerais.  Métodos.  .

INTRODUÇÃO TÉCNICAS EM BM  Objetivo  Maior recuperação de DNA (ex: xng). .  Remover o máximo de inibidores.  Maximizar a qualidade de DNA extraído.  Remover ou inibir nucleases.

solubilização com detergentes e sonicação) Agentes quelantes (EDTA. citrato) Removem cátions divalentes necessários para atividade de nucleases Desnaturação ou inativação de proteínas (ex. proteinase k) Liberação e separação dos ácidos nucléicos de proteínas (método de extração) Precipitação (ex.INTRODUÇÃO TÉCNICAS EM BM  Procedimentos gerais Ruptura ou lise celular (ex. etanol e isopropanol) RNase (remover RNA) . ruptura mecânica.

ucdavis.edu/education/animations/anim_dna.htm .boundless.com/microbiology/textbooks/boundless-microbiology-textbook/microbial-genetics7/tools-of-genetic-engineering-82/southern-blots-451-11697/ http://maswheat.INTRODUÇÃO TÉCNICAS EM BM  Procedimentos gerais https://www.

reprodutivo. sanguíneo.INTRODUÇÃO TÉCNICAS EM BM  Tipos de material  Tecidos animal (muscular.  Tecido vegetal (folhas)  Fezes.  Água. ósseo. etc). .  Solo.

.  Extração Chelex® (resina de troca iônica).  Kit comercial.  Extração com NaCl (não-orgânico).INTRODUÇÃO TÉCNICAS EM BM o Métodos  Extração Fenol-Clorofórmio (orgânico).

6) Secagem e armazenamento. 3) Liberação de DNA na solução e remoção de DNA protéico. .Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Procedimentos gerais 1) Lise celular. 4) Precipitação do DNA da solução aquosa. 5) Purificação do DNA. 2) Digestão de proteínas.

Proteinase k – enzima proteólítica usada para digerir.0 (NaOH).Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Reagentes (funções e composição) 1) Lise celular (tampão): . desnaturar ou inativar nucleases. Extração: EDTA 0.EDTA (EthyleneDiamine Tetracetic Acid): agente quelante que remove cátions divalentes essenciais para atividade de nucleases.SDS (Sodium Dodecyl Sulfate): surfactante detergente aniônico. .5M pH=8. 2) Digestão de proteínas: . .

Contem 0.1% hidroxiquinolina (cor amarelada) and 0. .Álcool isoamílico – auxilia na separação da fase aquosa da fase com fenol.Fenol . Auxilia na prevenção de formar “espuma”.Clorofórmio – auxilia na eliminação de traços de fenol. Informações adicionais: .Introdução às técnicas de BM básicas *composto orgânico inibidor enzimático o Extração Fenol-Clorofórmio 3) Liberação de DNA na solução e remoção de DNA protéico .2% b-mercaptoetanol (funções antioxidantes).Fenol+clorofórmio – desnaturam as proteínas. . .Solubilidade diferencial de proteínas.Clorofórmio/álcool isoamílico: frequentemente preparado a 24:1 (v/v). . lipídios e ácidos nucléicos.Fenol: equilibrado com tampão (TE – Tris*/EDTA). .

solutos como o Cloreto de Sódio são mais facilmente coprecipitados quando utilizado o isopropanol. é mais difícil de ser eliminado.Etanol 95% (frio) (2 volumes) . por isso.Etanol 70%: auxilia na purificação do DNA.Isopropanol (álcool isopropílico) (1 volume) .Ressuspendido em TE.Sal: Acetato de sódio 5) Purificação do DNA . . Informações adicionais: . pois alguns solutos podem ser precipitados. 6) Secagem e armazenamento .Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio 4) Precipitação do DNA da solução aquosa (concentração do DNA) . . Além disso.Temperatura ambiente ou à vácuo.Isopropanol é menos volátil do que etanol e. .Armazenado em -20ºC (4ºC).

youtube.com/watch?v=JNl1kjw9ZDQ .Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Na prática: http://www.

Introdução às técnicas de BM básicas
o Extração orgânica (Fenol-Clorofórmio)
 Prós:
- produz quantidades relativamente puras de DNA de alto peso
molecular;
- DNA dupla fita;
 Contras:
- Demorado;
- Risco aumentado de contaminação da amsotra (muitas trocas de
tubos);
- Utilização de reagentes tóxicos;
Informações adicionais:
- Fenol: O fenol (hidroxibenzeno) é corrosivo e irritante das membranas mucosas.
Potencialmente fatal se ingerido, inalado ou absorvido pela pele. Causa queimaduras
severas e afeta o sistema nervoso central, fígado e rins (Wikipédia);
- Clorofórmio: Pode ser fatal se for aspirado ou inalado. Causa irritação à pele, olhos e
trato respiratório. Afeta o sistema nervoso central, rins, sistema cardiovascular e
fígado. Pode causar câncer dependendo do nível e duração de exposição (Wikipédia).

Introdução às técnicas de BM básicas
o Extração Chelex®
 Procedimentos gerais
1) Lise celular e remoção de contaminantes e inibidores;
2) Digestão de proteínas;
3) Armazenamento;

Introdução às técnicas de BM básicas
o Extração Chelex®
 Reagentes (funções e composição)
1) Lise celular e remoção de contaminantes e inibidores
- Solução de Chelex 5% (5g/100ml)
2) Digestão de proteínas
- Aquecimento à 95-100ºC;
3) Armazenamento
- Armazenado em -20ºC (4ºC);
Informações adicionais:
- Chelex® 100: composto de copolímeros de estireno divinilbenzeno contendo íons de
iminodiacetato que atuam como grupos quelantes, ligando íons polivalentes como Mg2+.
Através da remoção do Mg2+, as nucleases são inativadas e, o DNA é protegido.

Introdução às técnicas de BM básicas .

2) O DNA degrada mais rápido com relação ao extraído por Fenol-Clorofórmio?!?!.Introdução às técnicas de BM básicas o Extração Chelex®  Prós: 1) Método relativamente rápido. 2) Contaminação minimizada. . 3) Elimina inibidores de PCR.  Contras: 1) Produz DNA fita simples.

Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 1) Preparação .0.5%-2% (ex.Agarose.3g agarose + 30ml TAE 1x).  . agarose e agaropectina. .Concentração: 0. ágar-ágar ou ágar: é um hidrocolóide extraído de diversos gêneros e espécies de algas marinhas vermelhas que consiste em uma mistura heterogênea de dois polissacarídeos.Preparação: agarose+solução tampão TE (TEB ou TAE). 1% . .

50.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 2) Aplicação .Com as amostras de DNA (~5µL).  * *Ladders: marcadores de peso molecular . O DNA do bacteriófago  em concentrações conhecidas de 20. é aplicada também uma amostra cuja concentração é conhecida. 100 e 200 ng/µL é geralmente utilizado.

Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 3) Corrida . Sob condições apropriadas (tampão – TEB ou TAE) que são responsáveis pela desnaturação das conformações secundários e terciárias. fragmentos lineares simples migram mais rapidamente do que longos. Sob as mesmas condições. em uma matriz de separação (agarose ou acrilamida – meios porosos). .  .Tampão de colorido.Eletroforese (separação de fragmentos). . DNA fita simples migra mais rapidamente do que DNA fita dupla.Princípio: ácidos nucléicos possuem uma carga – devido a grupamentos fosfato.

. estável e seguro (ambiente e saúde humana)  Bet GelRed .Corantes intercalantes (fluorescem sob luz UV) *Brometo de etídio (Bet): Quando se expõe esta substância a luz ultravioleta. mas. que se intensifica ~20 vezes depois de haver-se unido a uma cadeia de DNA. *GelRedTM: Usa o mesmo princípio do Bet.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 4) Visualização .. emite uma luz vermelho alaranjada.É muito mais sensível.

Câmara.Direta. .Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza  Gel de agarose 5) Fotodocumentação . .

 Ladders Ladders Amostras .Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 6) Interpretação .Resultado.

8 a amostra estaria contaminada com proteína e fenol). a 325nm é proporcional à quantidade de partículas em suspensão e outros e 230 nm é proporcional à quantidade de contaminantes orgânicos.8 e 2. 2) A absorvância a 280nm é proporcional à quantidade de proteínas e fenol.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Método espectrofotométrico 1) A absorbância a 260nm é proporcional à quantidade de ácidos nucléicos.0 (abaixo de 1.  Absorbância 260nm Equivalência ~50μg/ml dsDNA ~37μg/ml ssDNA ~40μg/ml ssRNA ~20μg/ml oligonucleótidos (ss) . 3) O grau de pureza é frequentemente estimado através da razão A260/A280 que deve ser entre 1.

de forma acurada a quantida de DNA. 3) Através fa fluorescência emitida por essas amostras.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Picogreen ® (Invitrogen) 1) O PicoGreen® apenas emite fluorescência quando se liga com o DNA dupla  fita. consequentemente. . Se esse reagente não está ligado à molécula de DNA não apresenta coloração e. é possível mensurar. não é detectada fluorescência 2) São necessárias outras amostras com DNA já quantificado para calibrar a curva padrão.

Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza  Prós e contras 1) Gel de agarose: prós – barato. consome muitas ponteiras (amostras para a curva padrão devem ser realizadas com réplicas ou tréplicas) . contras: inacurácia (calibragem) 3) Picogreen: prós – alta acurácia. 2) Espectrofotometria: prós – rápido e barato. contra: inacurácia e toxicidade (bet). contras: demorado.

.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Geral 1) Processo termodinâmico e enzimático de polimerização do DNA através de reações cíclicas. .Nested. .Real-time.Degenerate.In situ.(mal entendida?)!  . . diagnósticos de doenças hereditárias e infecciosas.Inverse.Long. muito misteriosa. . .Conventional. 2) Inventada em 1983 por Kary Mullis (Prêmio Nobel de Química 1993). . . 3) Uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas (sequenciamento de genes de interesse.Multiplex.Competitive. . . 4) Tipos de PCR: 5) Apesar de ser amplamente utilizada ainda é .Touchdown. .Hot start. testes de paternidade.Fast.. medicina forense e outros)..

Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Reagentes 1) DNA. DNA dATP 5) Solução tampão. dGTP Tampão  Água Thermus aquaticus Milli-Q dTTP (nucleotideos) . 2) dNTPs (desoxirribonucleotídeos trifosfatos). Taq polimerase dCTP Primers 6) Água (destilada ou Milli-Q). 4) Inciadores (primers). 3) DNA polimerase (Taq DNA polimerase ou Taq – suporta elevadas T).

.Adicionado no tampão ou jusnto com a reação.Se a concentração de Mg++ é muito elevada. temos pouco ou nenhum produto. .Sua concentração em torno de 1.  . .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Reagentes 7) Magnésio (Mg++) . assim pode gerar um “arraste” (smear).5 mM é aplicável a maioria das necessidades. a PCR tem baixa especificidade e.Se a concentração de Mg++ é muito baixa.Mg++ é um co-fator enzimático que desempenha um papel de extrema importância na atividade da enzima Taq. .

Ligação e ativação da DNA . 6) i (4ºC) 3) Extensão (Extension) E polimerase (DNApol). .  http://www.Taq: 1000 nt a cada 30 s (72ºC).Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Etapas 1) Desnaturação (desnaturation) D D 1) 2’ (95ºC) .O DNA é desnaturada a altas T (94-96ºC). 2) 50’’ (95ºC) D A 3) 50’’ (52ºC) 2) Associação (annealing) A x35 4) 1’ (72ºC) . Termociclador .Através da adição de nucleotídeos nas extremidades 3’ dos iniciadores (normalmente à 70ºC – atividade ótima da DNApol).youtube.com/watch?v=2KoLnIwoZKU .Ligação dos iniciadores (primers) nas regiões de 5) 5’’ (72ºC) E interesse.

000.608 16.536 131.000 .000.580.304 8.048.768 65.500.000.456 536.217.777.432 67.000.864 134.048 4.288 1.000 1.192 16. CYCLE NUMBER AMOUNT OF DNA  0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 1 2 4 8 16 32 64 128 256 512 1.554.870.000 1.912 1.435.741.000 1.097.728 268.550.108.384 32.216 33.072 262.194.400.000.073.096 8.576 2.152 4.580.000.024 2.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Etapas .Final: Número de cópias de 1 molécula de DNA após 34 ciclos: 1.824 1.144 524.388.

5 U (0.Complementaridade (dímeros).0-2. .  GAACTACCACTGAAGATACTTCAGT HOTGACTTC ACTGAA Tm = 71oC • Formação de “primer dimer” Temperatura de anelamento (Tm) Conteúdo GC (%GC) Primers de 20nt Tm= 4 x (C + G) +2 x (A + T) 5’ GAACTACCATAGACACACTGAAGGOH3’ 5 ‘ CTTCAGGTCAAGAACTTCCTTCAGTOH3’ 3’OHTGACTTCCTCAAGAACTGGACTTC GAACTACCATAGACACACTGAAGGOH 3’ .Sensível a descongelamento e agitação excessiva.Evitar excesso.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Problemas e comentários adicionais 1) Qualidade de DNA 2)Taq polimerase (diferentes tipos) . . Caso seja colocada uma quantidade muito maior isso pode inibir a reação. • Formação de alça 2) Primers . . Primer3).Quantidade – 2.Bom desenho de primers (programas – ex.5 l) em um volume final de 100 l. Autocomplementaridade (alças). .Baixa fidelidade (incorporação de nucleotídeos errados – ausência de proofreading).

A concentração numa reação pode variar de 20 a 200 µM sendo importante que as quatro devam variar em concentrações equivalentes. . .  .Quando estão em excesso (um nucleotídeo ou todos) podem ocorrer erros de incorporação de bases. gerando cópias alteradas.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Problemas e comentários adicionais 3) dNTPs .Sensíveis a descongelamentos consecutivos. 4) Temparatura de anelamento.

 Bandas inespecíficas A C+ .Introdução às técnicas de BM básicas  Purificação dos produtos de PCR Porque purificar o DNA? 1) Evitar problemas no sequenciamento (a PCR deve estar limpa e sem contaminantes).

Combinação de duas enzimas: Shrimp Alkaline Phosphatase (SAP).Protocolo: 8 L de PCR + 0. mais caros) . que degrada os nucleotídeos não incorporados e a Exonuclease I (EXO).Introdução às técnicas de BM básicas  Purificação dos produtos de PCR Como purificar o DNA? 1) Kits comerciais (geralmente mais eficientes mas. que degrada primers residuais e demais produtos simples fita não desejáveis.  . Conservar a 4°C. Incubar em termociclador por 1 hora à 37°C e 15 minutos a 80°C. . 2) Protocolo ExoSap: .5 l de Exo I (10U/l) + 1 l SAP (1U/ l).

 Pode catalisar a extensão da extremidade 3`. .  O aumento da temperatura libera os ant e a reação se inicia. durante a montagem do experimento. levando depois a degradação da extremidade 5`(a DNApol possui atividade exonuclease) e.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Hot Start PCR  A enzima DNA polimerase pode demonstrar uma pequena atividade à temperatura ambiente. assim destruindo o primer e o substrato.  Hot Start permite a inibição da atividade da polimerase durante o preparo da reação: A DNApol esta ligada a anticorpos (ant) e não funciona a temperatura ambiente.

Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  In situ PCR  Reação de PCR que ocorre dentro da célula numa lâmina.  Útil para acompanhar infecções.lf2. http://www.  Pode ser realizado em células ou tecidos fixados.htm .cuni.cz/Projekty/prusa-dna/newlook/defa4.

 PCR é realizada com primers complementares às sequências internas de interesse.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Inverse PCR (IPCR)c  DNA cortado em pequenos fragmentos por enzimas de restrição. que pode ser usada na PCR.springer.  DNA novamente tratado com enzimas de restrição – gera produtos com sequencia interna conhecida.  Ligação do produto – DNA circular.com/protocol/10. http://link.1385%2F1-59259-686-X%3A79#page-1 .

alta fidelidade (6.Clonagem de cDNA de longos transcritos.Mapeamento de sequências. .sigmaaldrich.PCR de genoma mitocondrial. . . http://www.com/technical-documents/protocols/biology/long-and-accurate-dna-amplification.5x) prooreading.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Long PCR  PCR cuja extensão é mais longa que as PCR convencionais (> 5Kpb).  DNApol amplifica alvos maiores.  Objetivos: .html .

premierbiosoft.identificação de deleções em genes em doenças degenerativas (Distrofia muscular de Duchenne) http://www.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Multiplex PCR  PCR com dois ou mais conjuntos de primers.  Objetivos: .identificação de vários vírus . para amplificação de diferentes fragmentos de uma mesma amostra.com/tech_notes/multiplex-pcr.html .

Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Nested PCR  É uma variação da PCR convencional.com.br/imgres?imgurl=&imgrefurl=https%3A%2F%2Flaikaspoetnik.com%2Ftag%2Fvir us%2F&h=0&w=0&tbnid=TTbFAmfH6NcGJM&zoom=1&tbnh=209&tbnw=241&docid=ucIn BEbhhcINM&tbm=isch&ei=tbgIVIa6H4jEggSnpILgBg&ved=0CAUQsCUoAQ .  Duas PCR: primeira com a fita parental. na qual são utilizados dois pares de primers (ao invés de um) para amplificar um mesmo fragmento.wordpress.  Aumenta a especificidade! http://www. em seguida em uma segunda PCR com a fita menor.google.

 Quantidade de DNA-alvo pode ser derterminada pela razão Alvo (T) / competidor (C) .  Esse competidor deve conter sequências para os mesmos primers utilizados para amplificar o alvo.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Competitive PCR  É adicionada a reação uma quantidade conhecida de um fragmento de DNA (competidor).

. evita amplificação errônea.começa mais alta que e temperatura ótima de anelamento dos primers.após atingir essa temperatura ela é mantida nos ciclos restantes. até atingir a temperatura específica. .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Touchdown PCR  Modificação da PCR convencional que pode resultar na diminuição de amplificações não especificas. .  Temperatura de anelamento .  Objetivo: Aumentar a especificidade.diminuição de 1ºC a cada um ou dois ciclos.

Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Degenerate PCR  O que são primers degenerados? Primers que possuem um numero de opções em várias posições na sequência Exemplo: 5´.ac.tau.il/hyden/ .TCGAATTCVCCYAAYTGRCCNT-3´ A+C+G =V C+T= Y A+C+G+T= N  Objetivo: avaliar polimorfismo . http://acgt.cs.

GeneAmp Fast PCR Master Mix). “Select primers with Tms of 64–69°C.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Fast PCR  Kits específicos (ex. para algumas aplicações.PCR de colônia. .  PCR pode ser realizado de forma mais rápida. tais como: .genotipagem de animais transgênicos. Change the initial template denaturation/enzyme activation step to 98°C for 30 sec • Change the denaturation step at each cycle to 92°C for 1 sec • Combine annealing and extension steps into a single step at 70°C for 20 sec” .

hu/sites/default/files/tananyagok/microbiology/ch05s03. * etc.CAUSAS: * Perda de atividade da Taqpol. ocorre uma SATURAÇÃO. * Acúmulo de produtos amplificados que pareiam entre si (produtos inespecíficos). http://elte.prompt. * Todas as enzimas disponíveis estão “ocupadas” com a síntese de DNA.  - Como foi resolvido? Diluição seriada (end-point solution) Padrão externo Controle interno (competitivo).html .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Porque a PCR convencional não é uma técnica quantitativa? . .O crescimento linear no número de cópias ocorre até um determinado número de ciclos. ou seja.

quantificação e amplificação de DNA em uma única etapa. . -Agilidade na obtenção de resultados.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Metodologia de PCR + Sistema de detecção de sinais Fluorescentes.  Detecção.  Técnica quantitativa .Quantificação do número de moléculas produzidas a cada ciclo.

. .Fase exponencial da reação.  Reagentes de uma PCR convencional + Corante .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Etapas de amplificação de uma PCR convencional .Oligonucleotídeos marcados.Curva de dissociação.  Coleta de dados .Intercalantes de DNA de dupla fita (dsDNA).  Plataforma de instrumentação .Termociclador + Sistema Óptico.Temperaturas e tempos diferentes.Computador com software para aquisição de dados e análise final. . .

. .Requer concentrações de DNA/cDNA 1000 x menor.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  PCR em Tempo Real .SEM manipulação pósPCR.Maior reprodutibilidade.Coleta de dados na fase Exponencial. .Resultados quantitativos. .Tempo de reação reduzido. sensibilidade e precisão. . .

 Detecção de agentes infecciosos.  Caracterização de agentes (Genotipagem) .  Quantificação de expressão gênica.  Testes de eficiência terapêutica.  Quantificação de carga viral.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Todas as aplicações da PCR tradicional.

Introdução às técnicas de BM básicas  Sequenciamento  Métodos 1) Sanger.  Plataformas 1) Roche® /454 FLX: 2004. 2) Illumina ®Solexa Genome Analyzer: 2006 3) Applied Biosystems SOLiDTM System: 2007. 4) Helicos HeliscopeTM : recently available. 3) Pyrosequencing. 2) Shotgun. 5) Pacific Biosciencies SMRT: 2010 .

terminação.  P P T P T H P H G deoxinucleotídeo OH G dideoxinucleotídeo H P P H H ? P P P P T OH http://www.youtube. eletroforese e leitura.Etapas: desnaturação.Introdução às técnicas de BM básicas  Sequenciamento Técnica de didesoxi ou dideoxi (chain termination or dideoxy methodSanger) (1980-1995) . ligação do primer e extensão de bases.com/watch?v=JHv7IxxgxW4 T OH .

Introdução às técnicas de BM básicas  Sequenciamento Técnica de didesoxi ou dideoxi (chain termination or dideoxy methodSanger): .  .Prós e contras: funciona bem para sequenciamento de 500-750 pb. método caro e demorado.

Digere parcialmente o genoma (ou grande fitas de DNA). os clones são sequenciados diversas vezes e criação de um mapa físico para ordenar as sequências. .Introdução às técnicas de BM básicas  Sequenciamento  Shotgun sequencing method (1995-2005) 1) Princípios . clonagem de fragmentos em vetores. .Etapas: fragmentação.

menor precisão (que é compensada pela alta cobertura). mas o processo de montagem requer muito mais capacidade computacional. alta cobertura. .Introdução às técnicas de BM básicas  Sequenciamento  Shotgun sequencing method (1995-2005) 2) Prós e contras: Produz leituras menores (25-500bp). mas em número muito maior em pouco tempo.

Duas moléculas de fostato são liberadas como (PPi). na qual luz visível é gerada e sua intensidade é proporcional ao número de nucleotídeos incorporados. .Introdução às técnicas de BM básicas Sequenciamento  Pirosequenciamento (segunda geração) 1) Princípios . dNTPs são fixados a extremidade 3’ da fita sintetizada.Diferentes etapas. .Durante a síntese de DNA.Sequenciamento por síntese.  1 .

A enzima ATP sulfurilase utiliza PPi e adenosiae 5’-fosfosulfato para produzir ATP .Depois da reação completa. duas vezes mais luz é liberada. a enzima apirase destrói qualquer traço de dNTPs.Introdução às técnicas de BM básicas Sequenciamento  Pirosequenciamento 1) Princípios  2 . -A enzima Luciferase utiliza ATP para converter luciferina em oxiluciferina e assim. . Assim.. se a sequência tem 2As seguidos. . liberar luz (a quantidade de luz liberada é proporcional ao número de nucleotídeos adicionados a nova fita de DNA).

.Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciamento 1) Princípios  3 .Leitura (a luz é detectada através de uma câmera CCD especial).

.Adaptadores contêm biotina a qual se liga a uma bead que contém na sua superfície (cada bead contém um único fragmento de fita simples de DNA). .O DNA é fragmentado em (300-800 bp) e as extremidades são “polidas” através da remoção de qualquer base não pareada. Ao final. . -Óleo é aderido as beads e uma solução de emulsão é criada (microreator).A PCR é então realizada dentro de cada microreator. . cada bead produz milhões de cópias idênticas de DNA.Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciemanto 2) Preparação de amostras  .Adaptadores são aderidos a cada extremidade.

youtube.A placa está acoplada a um chip de fibra óptica.Depois da PCR em emulsão.Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciemanto 2) Preparação de amostras  . .As enzimas vistas anteriormente. o óleo é removido e as beads são colocadas em uma placa “picotiter” (em cada poço cabe somente uma única bead). são aderidas as beads dentro de cada poço. http://www. ligada a uma câmera CCD. .com/watch?v=nFfgWGFe0aA .

Prós: Alta acurácia. mais automatizado.  .Contras: produz sequências menores e não tem uma resposta luminosa boa depois de 5-6 nucleotídeos idênticos. não necessita de eletroforese. elimina a necessidade de primers marcados. .Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciamento 3) Prós e contras: .

Um marcador molecular é definido como qualquer fenótipo molecular oriundo de um gene expresso ou de um segmento específico de DNA (Ferreira & Grattapaglia. Três tipos principais MORFOLÓGICOS BIOQUÍMICOS DNA polimorfismo . .Marcadores moleculares (marcadores genético-moleculares) . 1998).Entidades genéticas que manifestam herdáveis de maneira mendeliana.

Em geral. características fenotípicas de variação discreta são utilizadas como marcadores morfológicos desde os tempos de Mendel. efeito ambiental. São afetados pela ação gênica de dominância. como fenótipos de fácil identificação visual.Até os meados da década de 60. pleiotropia e epistasia PLANTAS PLANTA INTEIRA OU ADULTA . .: plantas. ex. os marcadores utilizados em estudos de genética e melhoramento eram controlados por genes associados a caracteres morfológicos.MARCADORES MORFOLÓGICOS .

Por outro lado. podem ser utilizados a partir de amostras de células ou de tecidos de partes da planta (folhas. etc. pólen. cotilédones. marcadores bioquímicos ou de DNA. embriões.) e também em qualquer estágio de desenvolvimento da planta ELETROFORESE .

MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) . Castro et al. um novo tipo de marcador genético (proteico/enzimático) foi desenvolvido: as isoenzimas (isozimas) . . presente num mesmo indivíduo (Markert & Moller. 1959).Na década de 1960.Isoenzimas foram definidas como diferentes formas moleculares (variantes) de uma mesma enzima. (2003) . apresentando função idêntica ou similar.É o resultado da presença de mais de um gene codificando cada uma das enzimas.

O controle genético das isoenzimas ocorre através de vários genes. e) ausência de efeitos epistáticos. d) herança Mendeliana simples com codominância entre alelos na maioria dos locos.Assim. c) ausência de efeitos deletérios associados com alelos isoenzímicos. Vantagens em relação aos marcadores morfológicos: a) determinação genotípica dos locos em qualquer da planta ou indivíduo.A premissa básica de se utilizar dados enzimáticos é que diferenças na mobilidade de isoenzimas em um campo elétrico são resultantes de diferenças ao nível de sequências de DNA que codificam tais enzimas. pleiotrópicos e ambientais. ou estar situados em diferentes locos. b) ocorrência de um número razoável de alelos. assumese que estas diferenças possuem base genética e sejam herdáveis.MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) . . se os padrões de bandas de dois indivíduos diferem. . que podem ser alelos de um mesmo loco (aloenzimas).

MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) Desvantagens das isoenzimas em relação aos marcadores de DNA: a) Sofrem influência ambiental. b) Limitado em número. .

Marcadores de DNA são derivados de pequenas regiões regiões do DNA que apresentam polimorfismo entre indivíduos dentro de uma espécie.Não é objeto de influências ambientais. . *Maior desvantagem é a necessidade de técnicas e equipamentos mais complexos. . .Potencialmente ilimitado em número.MARCADORES DE DNA .Polimorfismo detectado na seqüência de DNA. Vantagens em relação aos marcadores bioquímicos : .

ANÁLISES BIOLOGIA MOLECULAR SEQUENCIAMENTO SEQUÊNCIA DE DNA/RNA MARCADOR MOLECULAR .

 12 .wikipedia. http://en.20 genes codificadores de proteínas (envolvidos na respiração celular).ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Variável em ORGANIZAÇÃO e TAMANHO (ex: 16Kb em humanos a 500 kb em algumas plantas).org/wiki/Human_mitochondrial_genetics .

.ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Desde as décadas de 70-80. relações filogenéticas e o entendimento de vários aspectos biológicos e evolutivos de uma grande variedade de organismos. Características vantajosas. senão da maioria dos estudos envolvendo estrutura populacional. do século passado. o mtDNA passou a fazer parte de muitos.

Regiões bem conservadas (exs: citocromo b e citocromo oxidase I). .N de cópias: cada célula contêm centenas e cada mitocôndria. . dezenas de cópias. .ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Característica vantajosas (práticas): .Genes sem introns e regiões intergênicas curtas.

ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Característica vantajosas (genético-evolutivas): . . .Molécula clone (herança materna).Altamente variável em pop. naturais devido à alta taxa de mutação. .Taxa evolutiva tipo relógio (clock-like) (ausência de seleção positiva). .Evolução de forma neutra (não relacionados a Adaptação).

ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA) .

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
Procambarus clarkii

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
 Ponto de introdução;

 Várias populações;
 Pergunta:

- Relação de parentesco
entre
indivíduos
das
diferentes populações?
- marcador
mtDNA;

molecular:

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
 Passos para obtenção das sequências:
Extração de DNA;
 Amplificação do gene de interesse (coI);
 Purificação do produtos de PCR;
 Sequenciamento
- Duas fitas FORWARD/REVERSE: confirmação de algumas
posições;

html .br/2011_01_01_archive.blogspot.ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  CROMATOGRAMAS OU ELETROFEROGRAMAS http://viagene.com.

ANÁLISES BIOLOGIA MOLECULAR PRÁTICA  National Center for Biotechnology Information (NCBI) .

por homologia.Analisar.ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  National Center for Biotechnology Information (NCBI) . . a validade da nossa sequência.

htm .nz/~strewick/Text%20Files/DNA%20Toolkit.massey.ac.ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  ALINHAMENTO .Alinhar as sequências no banco de dados. http://www.

 INSERÇÃO*.ANÁLISES BIOLOGIA MOLECULAR  Mutação .  DELEÇÃO*.Alteração na sequência de nucleotídeos do DNA. PONTUAL.  INVERSÃO.  TRANSLOCAÇÃO.  .