Anda di halaman 1dari 135

UNILASALLE

CENTRO UNIVERSITARIO LASALLE

Disciplina 02775

BIOLOGIA CELULAR E MOLECULAR

Regente: Prof. Mauricio Pereira Almerão
AULA 9
Organização gênica em eucariotos e procariotos
Extração de DNA, PCR e Sequenciamento

ORGANIZAÇÃO
GÊNICA:
Procariotos
Eucariotos

GENES

http://passel.unl.edu/pages/printinformationmodule.php?idinformationmodule=957882007

GENES http://jp.senescence.info/thoughts/genetic_engineering.html .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS HAPLÓIDE e CIRCULAR Pequeno: 4.6x103 kb (Escherichia coli) PRATICAMENTE SEM INTRONS (colinearidade) DNA NÃO ASSOCIADO A HISTONAS APRESENTA OPERONS SUPERPOSIÇÃO de GENES GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO DNA ACESSÓRIOS Plasmídeos. Bacteriófagos e Elementos transponíveis .

org/wiki/index.proteopedia.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS IMPORTÂNCIA da HAPLOIDIA EXPRESSÃO DE TODOS OS GENES SEM RELAÇÃO DE DOMINÂNCIA MUTAÇÕES SÃO SEMPRE EXPRESSADAS SELEÇÃO NATURAL http://www.php/User:Alexei_Ilinykh/Sandbox_1 .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS http://slideplayer.br/slide/50886/ .com.

discoveryandinnovation.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS COLINEARIDADE: Nucleotídeos x Aminoácidos Seqüência de Códons (DNA) “IGUAL” à seq.com/BIOL202/notes/lecture13.html . de AA Não há processamento de RNA (geralmente) Não há INTRONS (geralmente) “Economia de espaço” http://www.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS OPERON Conjunto de genes nos procariotos (e em alguns eucariotos) que se encontram funcionalmente relacionados. contíguos e controlados coordenadamente. sendo todos expressos em apenas um mRNA. .

Quando o repressor está ligado ao operador. Sendo assim. . Um destes elementos. sob condições apropriadas. as regiões operadoras estão geralmente situadas entre os promotores e os genes estruturais que eles regulam. O operador é sempre contíguo ao(s) gene(s) estrutural(ais) cuja expressão ele regula. se liga ao segundo elemento. A transcrição é iniciada em promotores que precedem os genes estruturais na extremidade 5’ e são contíguos à regiões operadoras. coli. ele impede estericamente que a RNA polimerase transcreva os genes estruturais do Operon.CONSIDERAÇÕES OPERON O modelo do Operon foi desenvolvido para explicar a regulação dos genes que codificam as enzimas necessárias para o uso de lactose em E. o operador. onde a transcrição de um conjunto de genes estruturais contíguos regulados por dois elementos controladores. o gene regulador. que. codifica um repressor.

html https://www.br/labs/lbcd/grupo7/iniciar/aulaexp/exp1-2.icb.youtube.com/watch?v=oBwtxdI1zvk .ufmg.CONSIDERAÇÕES OPERON Operon lac http://www.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS SUPERPOSIÇÃO DE GENES COMPACTAÇÃO DO GENOMA PRODUÇÃO DE DIFERENTES PROTEÍNAS .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO AUMENTO NO NÍVEL DA EXPRESSÃO GÊNICA Genes mais importantes http://wwwabi.fr/erocha/research/order.html .jussieu.snv.

wikipedia.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS DNA ACESSÓRIO (plasmídeos) http://en.org/wiki/Plasmid .

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS DNA ACESSÓRIO (plasmídeos) Extracromossômico . .1 a 200 kb Replicação Autônoma Tem sua própria origem de replicação Plasmídeos Grandes .únicos (cópia-única) Plasmídeos Pequenos .várias cópias (multicópia) Função não essencial à vida: Fixação de nitrogênio – PLASMÍDEOS COL Reprodutivos – PLASMÍDEOS F Resistência a antibióticos – PLASMÍDEOS R Metais pesados e toxinas bacterianas – OUTROS PLASMÍDEOS.

ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS COL Relacionados à fixação do nitrogênio no solo.com.html .blogspot. http://oquimiajuda.br/2011/05/especial-moleculas-gas-nitrogenio.

CONJUGAÇÃO Transferência do material .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS F Transferem genes (plasmídeos) para outras bactérias Codificação o pilli F ou sexual Promoção contato ou conexão entre células .

com/ watch?v=VU7brO7A36w .youtube.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS F https://www.

br/meiodecultura/tag/plasmideo/ . http://scienceblogs.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS R Relacionados à resistência antimicrobiana.com.

0085487 .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS OUTROS PLASMÍDEOS Metais pesados e toxinas bacterianas http://www.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.plosone.

com. enzimas de interesse comercial.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS PLASMÍDEOS (DNA RECOMBINANTE) Clonagem molecular Engenharia genética Indústria: produção de biofármos.br/biologia/engenharia-genetica/tecnologia-do-dna-recombinante Veterinária: animais transgênicos . Agricultura: plantas transgênicas http://soumaisenem.

net/profiles/blogs/the-capture-of-cytos-by http://wikiciencias.reprodução do próprio material Ciclo lisogênico .casadasciencias.org/wiki/index.ORGANIZAÇÃO GÊNICA DE PROCARIOTOS BACTERIÓFAGOS (vírus de bactérias) Ciclo lítico .incorporação do próprio material Transdução restrita reprodução Transdução generalizada http://people.php/Bacteri%C3%B3fago .audrn.

audrn.net/profiles/blogs/the-capture-of-cytos-by .ORGANIZAÇÃO GÊNICA DE PROCARIOTOS BACTERIÓFAGOS (vírus de bactérias) http://people.

ELEMENTOS GENÉTICOS TRANSPONÍVEIS .

RECOMBINAÇÃO SÍTIO-ESPECÍFICA RECOMBINAÇÃO SÍTIO-ESPECÍFICA GUIADA por uma ENZIMA de RECOMBINAÇÃO RECONHECE SEQUÊNCIAS ESPECÍFICAS NÃO NECESSITA PAREAMENTO de BASES (homologia) DESCOBERTA em BACTÉRIAS/vírus CAPACIDADE de CERTOS VÍRUS de INTEGRAR seu GENOMA ao da BACTÉRIA GENES que CODIFICAM “INTEGRASES” RESPONSÁVEIS pela “TRANSPOSIÇÃO” .

ORGANIZAÇÃO GÊNICA
ELEMENTOS TRANSPONÍVEIS (TRANSPOSONS)
GENES QUE MUDAM DE POSIÇÃO NO GENOMA
PROCARIOTOS (e EUCARIOTOS)

MESMO CROMOSSOMO

DESLOCAM-SE no GENOMA
CROMOSSOMOS DIFERENTES
LONGOS PERÍODOS de QUIESCÊNCIA

NÃO ABANDONAM a CÉLULA
SEM CAPACIDADE INFECCIOSA

ORGANIZAÇÃO GÊNICA
CARACTERÍSTICAS (TRANSPOSONS)
% nos procariotos? (46% do Genoma Eucariótico)
AMBAS as EXTREMIDADES com SEQUÊNCIAS SIMILARES
REPETIÇÕES TERMINAIS – SÍTIOS para ENZIMAS
NORMALMENTE CODIFICAM a ENZIMA para a TRANSPOSIÇÃO
TRANSPOSASES
CRIAM “DUPLICAÇÕES” do SÍTIO de INSERÇÃO, no DNA ALVO
REPETIÇÕES DIRETAS = orientadas no mesmo sentido
EXISTEM em CÓPIAS MÚLTIPLAS no GENOMA
PRINCIPAL FONTE de MUTAÇÕES no GENOMA

ORGANIZAÇÃO GÊNICA
MECANISMO GERAL de TRANSPOSIÇÃO

https://www.youtube.com/watch?v=0d76-gbOYtg

ORGANIZAÇÃO GÊNICA .

ORGANIZAÇÃO GÊNICA Importância (TRANSPOSONS) .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS HAPLÓIDE e CIRCULAR DIPLÓIDE E LINEAR Cromossomos (organizados em pares de homólogos). .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS PRATICAMENTE SEM INTRONS (colinearidade) PRESENÇA DE INTRONS http://pt.wikipedia.org/wiki/Usu%C3%A1rio:Yleite/DNA_n%C3%A3o-codificante .

htm .uy/MATERIAL/BIOLOGIA/Seccion%203/3%20-%20Capitulo%2017.ORGANIZAÇÃO GÊNICA DE EUCARIOTOS DNA NÃO ASSOCIADO A HISTONAS DNA ASSOCIADO A HISTONAS http://colegioamerica.edu.

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS APRESENTA OPERONS AUSÊNCIA (raras exceções) DE OPERONS Exceção Caenorhabditis elegans Nematódeo: 15-25% dos genes .

ORGANIZAÇÃO GÊNICA DE EUCARIOTOS SUPERPOSIÇÃO de GENES NÃO HÁ SUPERPOSIÇÃO de GENES http://nar.expansion http://edoc.oxfordjournals.de/dissertationen/pietas-agnieszka-2004-11-22/HTML/chapter1.hu-berlin.html .org/content/30/20/4432/F1.

masters.ORGANIZAÇÃO GÊNICA DE EUCARIOTOS ACÚMULO DE GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO NÃO HÁ ACÚMULO GENES PRÓXIMOS À ORIGEM DE REPLICAÇÃO http://mol-biol4masters.grkraj.org/html/Prokaryotic_DNA_Replication3-E_coli_DNA_Replication.htm .

wisegeek.htm#didyouknowout http://evolutionaryroutes.com/2011/08/31/the-taming-of-the-chloroplast/ .com/what-is-mitochondrial-dna-analysis.ORGANIZAÇÃO GÊNICA DE EUCARIOTOS DNA ACESSÓRIOS DNA ACESSÓRIOS http://www.wordpress.

pequenos. circulares. poucos genes. sem operons e sem unidades genéticas acessórias. .  Eucariotos → genomas mais complexos. operons e unidades genéticas acessórias. grandes.ORGANIZAÇÃO GÊNICA PROCARIOTOS EUCARIOTOS  Procariotos → genomas menos complexos. lineares. muitos genes.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) http://www.br/labimet/membros/apoio-tecnico/ .ufrgs.

Diferentes bancadas.lance-ufrj. http://www.  Sala para revelação do gel.org/estrutura-e-arredores.  Sala para PCR. Sala para extração.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Diferentes salas.html Diferentes finalidades (manipulações e equipamentos). .

com. prejudiciais para a saúde. tóxicos.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Capela de exaustão  EPC.  EVACUAÇÃO .blogspot. vapores agressivos.produtos químicos.br/2011_05_01_archive. partículas ou líquidos em quantidades e concentrações perigosas. http://apendiciencia.html .

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Capela de Fluxo laminar  Câmara quase isolada onde ar filtrado é constantemente injetado em uma só direção na área de trabalho por um motor.com.php?an=7d06ca3e128bc079be1349975e0f6b98&Bid=p46c062c88277d .br/produtos_detalhe. http://www.analiticaweb. garantindo um ambiente renovado e limpo.

vocedeolhoemtudo.lojasbrejao.br/ofertas/geladeira-arnofacilite-crb39-342lts/ http://decoracao. .com.com. http://www.br/utensilios/freezer-vertical/  Atividades de enzimas de degradação (DNAases e RNAases).LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Estocagem de reagentes e amostras  4ºC (geladeira) .REAGENTES.  -20ºC (freezer) – DNA/RNA.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Destilador de laboratório  Água destilada (bidestilada ou tridestilada).  MilliQ® (água milli-Q ou água deionizada ou água ultrapura). ÁGUAS PURAS http://www.php .br/portal/departamentos/de c/labmes/equipamentos.udesc.joinville.

br/Departamentos/FBF/Disciplinas/Farmacotecnica/instrum entos/BEQUER1.br/vidrarias-para-laboratorio/frascos/frasco-reagentegraduado-tampa-azul- .prolab.fcf.usp.wikipedia.com.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Vidraria  Erlenmeyer  Bécker  Vidro borosilicato http://www.HTM http://pt.org/wiki/Erlenmeyer_(bal%C3%A3o) http://www.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Outros materiais  Pipetas  Ponteiras  Tubos http://www.br/pages/37159-boas-praticas-e-manuseio-das-pipetas-htl .jprolab.us.br/produtos_detalhe.es/cubo/ http://pos.php?idProdut o=16&Cat=1 http://personal.icb.com.ufg.

água destilada.  Ponteiras.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Esterilização  Autoclave (calor úmido sob pressão). http://labsetupsolutions. etc.com/autoclaves/ . meios de cultura. tubos eppendorfs.

com.br/v2/?wpsc-product=maquina-de-gelo-em-escamas-40kg-dia-hexicryo .LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Picotador de gelo (manutenção de DNA e RNA). http://econolab.

http://www.br/produtos/equipamentos-para-laboratorio/banho-maria-para-laboratorio .com.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Banho maria (5ºC acima da Tamb até 120 ºC).prolab.

analiticaweb.pt/default.labosistema.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Isolamento de ácidos nucléicos  Centrífugas (macro e microcentrífugas).com.br/produtos_detalhe.p hp?an=6291ba38f669ab42df583d33c40e80e1&Bid =p4519788614715 .aspx?tabid=67&c ategoryid=24&category=centrifugas_de_bancada&l anguage=en-us http://www. http://www.

LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Migração (ácidos nucléicos e amplificados)  Cubas de eletroforese. http://www.br/produtos/equipamentos-para-laboratorio/cubas-de-eletroforese .com.prolab.

scilifesolutions.uk/products-page/pcr/te-peltier-cooling-pcr-thermocycler/ .co. http://www.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica) Amplificação de genes  Termicicladores.

alphalabs.html http://www. Revelação (gel) http://dc388.4shared.LABORATÓRIO DE BIOLOGIA MOLECULAR ESTRUTURA (Básica)  Boa foto = bom “diasnóstico”.co.com/doc/BJ4wYJVY/preview.aspx .uk/product-information/molecular-biologyproducts/clarit-e-Electrophoresis-Systems/electrophoresisaccessories.

.  não cheirar soluções ou reagentes.  não comer ou beber na bancada.  etc.LABORATÓRIO DE BIOLOGIA MOLECULAR Regras gerais de segurança: – Bom senso:  nunca trabalhar sozinho (corpo técnico).  lavar imediatamente a pele após contato com reagentes químicos.  nunca pipetar com a boca.  sempre usar jaleco e luvas.

 Métodos.INTRODUÇÃO TÉCNICAS EM BM  Extração de DNA Objetivo.  Procedimentos gerais.  .

 Maximizar a qualidade de DNA extraído.  Remover ou inibir nucleases.  Remover o máximo de inibidores. .INTRODUÇÃO TÉCNICAS EM BM  Objetivo  Maior recuperação de DNA (ex: xng).

proteinase k) Liberação e separação dos ácidos nucléicos de proteínas (método de extração) Precipitação (ex. etanol e isopropanol) RNase (remover RNA) . solubilização com detergentes e sonicação) Agentes quelantes (EDTA.INTRODUÇÃO TÉCNICAS EM BM  Procedimentos gerais Ruptura ou lise celular (ex. ruptura mecânica. citrato) Removem cátions divalentes necessários para atividade de nucleases Desnaturação ou inativação de proteínas (ex.

com/microbiology/textbooks/boundless-microbiology-textbook/microbial-genetics7/tools-of-genetic-engineering-82/southern-blots-451-11697/ http://maswheat.boundless.htm .INTRODUÇÃO TÉCNICAS EM BM  Procedimentos gerais https://www.ucdavis.edu/education/animations/anim_dna.

sanguíneo.  Tecido vegetal (folhas)  Fezes. . ósseo.INTRODUÇÃO TÉCNICAS EM BM  Tipos de material  Tecidos animal (muscular.  Água. reprodutivo. etc).  Solo.

 Extração Chelex® (resina de troca iônica).  Kit comercial.INTRODUÇÃO TÉCNICAS EM BM o Métodos  Extração Fenol-Clorofórmio (orgânico).  Extração com NaCl (não-orgânico). .

. 4) Precipitação do DNA da solução aquosa. 3) Liberação de DNA na solução e remoção de DNA protéico.Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Procedimentos gerais 1) Lise celular. 5) Purificação do DNA. 6) Secagem e armazenamento. 2) Digestão de proteínas.

. 2) Digestão de proteínas: . .Proteinase k – enzima proteólítica usada para digerir.0 (NaOH). Extração: EDTA 0.EDTA (EthyleneDiamine Tetracetic Acid): agente quelante que remove cátions divalentes essenciais para atividade de nucleases. desnaturar ou inativar nucleases.5M pH=8.SDS (Sodium Dodecyl Sulfate): surfactante detergente aniônico.Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Reagentes (funções e composição) 1) Lise celular (tampão): .

2% b-mercaptoetanol (funções antioxidantes). . Informações adicionais: . Contem 0. . .Fenol: equilibrado com tampão (TE – Tris*/EDTA).Fenol .Clorofórmio – auxilia na eliminação de traços de fenol. .Álcool isoamílico – auxilia na separação da fase aquosa da fase com fenol. .1% hidroxiquinolina (cor amarelada) and 0.Solubilidade diferencial de proteínas.Clorofórmio/álcool isoamílico: frequentemente preparado a 24:1 (v/v). Auxilia na prevenção de formar “espuma”. lipídios e ácidos nucléicos.Introdução às técnicas de BM básicas *composto orgânico inibidor enzimático o Extração Fenol-Clorofórmio 3) Liberação de DNA na solução e remoção de DNA protéico .Fenol+clorofórmio – desnaturam as proteínas.

6) Secagem e armazenamento . .Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio 4) Precipitação do DNA da solução aquosa (concentração do DNA) .Sal: Acetato de sódio 5) Purificação do DNA .Isopropanol é menos volátil do que etanol e.Etanol 70%: auxilia na purificação do DNA.Isopropanol (álcool isopropílico) (1 volume) . . é mais difícil de ser eliminado. pois alguns solutos podem ser precipitados.Temperatura ambiente ou à vácuo. Além disso. Informações adicionais: .Armazenado em -20ºC (4ºC). . por isso.Ressuspendido em TE.Etanol 95% (frio) (2 volumes) . solutos como o Cloreto de Sódio são mais facilmente coprecipitados quando utilizado o isopropanol.

Introdução às técnicas de BM básicas o Extração Fenol-Clorofórmio  Na prática: http://www.com/watch?v=JNl1kjw9ZDQ .youtube.

Introdução às técnicas de BM básicas
o Extração orgânica (Fenol-Clorofórmio)
 Prós:
- produz quantidades relativamente puras de DNA de alto peso
molecular;
- DNA dupla fita;
 Contras:
- Demorado;
- Risco aumentado de contaminação da amsotra (muitas trocas de
tubos);
- Utilização de reagentes tóxicos;
Informações adicionais:
- Fenol: O fenol (hidroxibenzeno) é corrosivo e irritante das membranas mucosas.
Potencialmente fatal se ingerido, inalado ou absorvido pela pele. Causa queimaduras
severas e afeta o sistema nervoso central, fígado e rins (Wikipédia);
- Clorofórmio: Pode ser fatal se for aspirado ou inalado. Causa irritação à pele, olhos e
trato respiratório. Afeta o sistema nervoso central, rins, sistema cardiovascular e
fígado. Pode causar câncer dependendo do nível e duração de exposição (Wikipédia).

Introdução às técnicas de BM básicas
o Extração Chelex®
 Procedimentos gerais
1) Lise celular e remoção de contaminantes e inibidores;
2) Digestão de proteínas;
3) Armazenamento;

Introdução às técnicas de BM básicas
o Extração Chelex®
 Reagentes (funções e composição)
1) Lise celular e remoção de contaminantes e inibidores
- Solução de Chelex 5% (5g/100ml)
2) Digestão de proteínas
- Aquecimento à 95-100ºC;
3) Armazenamento
- Armazenado em -20ºC (4ºC);
Informações adicionais:
- Chelex® 100: composto de copolímeros de estireno divinilbenzeno contendo íons de
iminodiacetato que atuam como grupos quelantes, ligando íons polivalentes como Mg2+.
Através da remoção do Mg2+, as nucleases são inativadas e, o DNA é protegido.

Introdução às técnicas de BM básicas .

Introdução às técnicas de BM básicas o Extração Chelex®  Prós: 1) Método relativamente rápido. 2) Contaminação minimizada.  Contras: 1) Produz DNA fita simples. 3) Elimina inibidores de PCR. 2) O DNA degrada mais rápido com relação ao extraído por Fenol-Clorofórmio?!?!. .

 . . 1% .5%-2% (ex. agarose e agaropectina.Agarose.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 1) Preparação .3g agarose + 30ml TAE 1x). . ágar-ágar ou ágar: é um hidrocolóide extraído de diversos gêneros e espécies de algas marinhas vermelhas que consiste em uma mistura heterogênea de dois polissacarídeos.0.Concentração: 0.Preparação: agarose+solução tampão TE (TEB ou TAE).

 * *Ladders: marcadores de peso molecular . O DNA do bacteriófago  em concentrações conhecidas de 20. é aplicada também uma amostra cuja concentração é conhecida. 50. 100 e 200 ng/µL é geralmente utilizado.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 2) Aplicação .Com as amostras de DNA (~5µL).

.Tampão de colorido. fragmentos lineares simples migram mais rapidamente do que longos.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 3) Corrida . DNA fita simples migra mais rapidamente do que DNA fita dupla.Eletroforese (separação de fragmentos). . em uma matriz de separação (agarose ou acrilamida – meios porosos). Sob as mesmas condições.  . Sob condições apropriadas (tampão – TEB ou TAE) que são responsáveis pela desnaturação das conformações secundários e terciárias.Princípio: ácidos nucléicos possuem uma carga – devido a grupamentos fosfato.

*GelRedTM: Usa o mesmo princípio do Bet.Corantes intercalantes (fluorescem sob luz UV) *Brometo de etídio (Bet): Quando se expõe esta substância a luz ultravioleta. que se intensifica ~20 vezes depois de haver-se unido a uma cadeia de DNA. estável e seguro (ambiente e saúde humana)  Bet GelRed .É muito mais sensível. mas.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 4) Visualização .. emite uma luz vermelho alaranjada..

Direta. .Câmara.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza  Gel de agarose 5) Fotodocumentação . .

 Ladders Ladders Amostras .Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Gel de agarose 6) Interpretação .Resultado.

 Absorbância 260nm Equivalência ~50μg/ml dsDNA ~37μg/ml ssDNA ~40μg/ml ssRNA ~20μg/ml oligonucleótidos (ss) .0 (abaixo de 1.8 e 2. 2) A absorvância a 280nm é proporcional à quantidade de proteínas e fenol. 3) O grau de pureza é frequentemente estimado através da razão A260/A280 que deve ser entre 1.8 a amostra estaria contaminada com proteína e fenol). a 325nm é proporcional à quantidade de partículas em suspensão e outros e 230 nm é proporcional à quantidade de contaminantes orgânicos.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Método espectrofotométrico 1) A absorbância a 260nm é proporcional à quantidade de ácidos nucléicos.

Se esse reagente não está ligado à molécula de DNA não apresenta coloração e. de forma acurada a quantida de DNA. não é detectada fluorescência 2) São necessárias outras amostras com DNA já quantificado para calibrar a curva padrão.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza Picogreen ® (Invitrogen) 1) O PicoGreen® apenas emite fluorescência quando se liga com o DNA dupla  fita. consequentemente. é possível mensurar. 3) Através fa fluorescência emitida por essas amostras. .

contra: inacurácia e toxicidade (bet). consome muitas ponteiras (amostras para a curva padrão devem ser realizadas com réplicas ou tréplicas) . contras: inacurácia (calibragem) 3) Picogreen: prós – alta acurácia. 2) Espectrofotometria: prós – rápido e barato. contras: demorado.Introdução às técnicas de BM básicas  Determinação da concentração e grau de pureza  Prós e contras 1) Gel de agarose: prós – barato.

In situ. 2) Inventada em 1983 por Kary Mullis (Prêmio Nobel de Química 1993). . medicina forense e outros). testes de paternidade.Nested. .Hot start.Fast. .Touchdown. . 4) Tipos de PCR: 5) Apesar de ser amplamente utilizada ainda é . .Real-time.Inverse. . muito misteriosa. . . diagnósticos de doenças hereditárias e infecciosas. ..Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Geral 1) Processo termodinâmico e enzimático de polimerização do DNA através de reações cíclicas.(mal entendida?)!  . .Conventional.Multiplex. .Long.Competitive..Degenerate. 3) Uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas (sequenciamento de genes de interesse.

4) Inciadores (primers). DNA dATP 5) Solução tampão. Taq polimerase dCTP Primers 6) Água (destilada ou Milli-Q). 2) dNTPs (desoxirribonucleotídeos trifosfatos). 3) DNA polimerase (Taq DNA polimerase ou Taq – suporta elevadas T).Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Reagentes 1) DNA. dGTP Tampão  Água Thermus aquaticus Milli-Q dTTP (nucleotideos) .

.Mg++ é um co-fator enzimático que desempenha um papel de extrema importância na atividade da enzima Taq.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Reagentes 7) Magnésio (Mg++) . a PCR tem baixa especificidade e. .Se a concentração de Mg++ é muito baixa. . assim pode gerar um “arraste” (smear).Se a concentração de Mg++ é muito elevada. .Sua concentração em torno de 1.Adicionado no tampão ou jusnto com a reação. temos pouco ou nenhum produto.  .5 mM é aplicável a maioria das necessidades.

youtube.Através da adição de nucleotídeos nas extremidades 3’ dos iniciadores (normalmente à 70ºC – atividade ótima da DNApol). Termociclador . . 2) 50’’ (95ºC) D A 3) 50’’ (52ºC) 2) Associação (annealing) A x35 4) 1’ (72ºC) .Taq: 1000 nt a cada 30 s (72ºC).com/watch?v=2KoLnIwoZKU .Ligação e ativação da DNA . 6) i (4ºC) 3) Extensão (Extension) E polimerase (DNApol).O DNA é desnaturada a altas T (94-96ºC).Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Etapas 1) Desnaturação (desnaturation) D D 1) 2’ (95ºC) .  http://www.Ligação dos iniciadores (primers) nas regiões de 5) 5’’ (72ºC) E interesse.

288 1.216 33.000 1.580.152 4.192 16.217.435.000.096 8.870.Final: Número de cópias de 1 molécula de DNA após 34 ciclos: 1.304 8.554. CYCLE NUMBER AMOUNT OF DNA  0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 1 2 4 8 16 32 64 128 256 512 1.384 32.728 268.864 134.000.400.000 1.048 4.777.824 1.912 1.000 1.741.536 131.580.072 262.388.000 .000.108.576 2.000.097.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Etapas .768 65.432 67.073.144 524.000.608 16.194.456 536.024 2.500.048.000.550.

Evitar excesso.Complementaridade (dímeros).5 U (0.Sensível a descongelamento e agitação excessiva. . .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Problemas e comentários adicionais 1) Qualidade de DNA 2)Taq polimerase (diferentes tipos) .0-2. .Bom desenho de primers (programas – ex. Caso seja colocada uma quantidade muito maior isso pode inibir a reação. . Autocomplementaridade (alças). Primer3).  GAACTACCACTGAAGATACTTCAGT HOTGACTTC ACTGAA Tm = 71oC • Formação de “primer dimer” Temperatura de anelamento (Tm) Conteúdo GC (%GC) Primers de 20nt Tm= 4 x (C + G) +2 x (A + T) 5’ GAACTACCATAGACACACTGAAGGOH3’ 5 ‘ CTTCAGGTCAAGAACTTCCTTCAGTOH3’ 3’OHTGACTTCCTCAAGAACTGGACTTC GAACTACCATAGACACACTGAAGGOH 3’ . • Formação de alça 2) Primers .5 l) em um volume final de 100 l.Baixa fidelidade (incorporação de nucleotídeos errados – ausência de proofreading).Quantidade – 2.

 .A concentração numa reação pode variar de 20 a 200 µM sendo importante que as quatro devam variar em concentrações equivalentes. 4) Temparatura de anelamento. gerando cópias alteradas. .Quando estão em excesso (um nucleotídeo ou todos) podem ocorrer erros de incorporação de bases. .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction) Problemas e comentários adicionais 3) dNTPs .Sensíveis a descongelamentos consecutivos.

Introdução às técnicas de BM básicas  Purificação dos produtos de PCR Porque purificar o DNA? 1) Evitar problemas no sequenciamento (a PCR deve estar limpa e sem contaminantes).  Bandas inespecíficas A C+ .

Introdução às técnicas de BM básicas  Purificação dos produtos de PCR Como purificar o DNA? 1) Kits comerciais (geralmente mais eficientes mas.5 l de Exo I (10U/l) + 1 l SAP (1U/ l). que degrada os nucleotídeos não incorporados e a Exonuclease I (EXO). mais caros) . . Incubar em termociclador por 1 hora à 37°C e 15 minutos a 80°C. 2) Protocolo ExoSap: . que degrada primers residuais e demais produtos simples fita não desejáveis.Combinação de duas enzimas: Shrimp Alkaline Phosphatase (SAP).  . Conservar a 4°C.Protocolo: 8 L de PCR + 0.

durante a montagem do experimento.  Hot Start permite a inibição da atividade da polimerase durante o preparo da reação: A DNApol esta ligada a anticorpos (ant) e não funciona a temperatura ambiente. . levando depois a degradação da extremidade 5`(a DNApol possui atividade exonuclease) e.  O aumento da temperatura libera os ant e a reação se inicia. assim destruindo o primer e o substrato.  Pode catalisar a extensão da extremidade 3`.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Hot Start PCR  A enzima DNA polimerase pode demonstrar uma pequena atividade à temperatura ambiente.

htm .cz/Projekty/prusa-dna/newlook/defa4.  Pode ser realizado em células ou tecidos fixados. http://www.lf2.cuni.  Útil para acompanhar infecções.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  In situ PCR  Reação de PCR que ocorre dentro da célula numa lâmina.

http://link.  DNA novamente tratado com enzimas de restrição – gera produtos com sequencia interna conhecida. que pode ser usada na PCR.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Inverse PCR (IPCR)c  DNA cortado em pequenos fragmentos por enzimas de restrição.  PCR é realizada com primers complementares às sequências internas de interesse.  Ligação do produto – DNA circular.springer.com/protocol/10.1385%2F1-59259-686-X%3A79#page-1 .

Clonagem de cDNA de longos transcritos.  Objetivos: .sigmaaldrich.alta fidelidade (6. http://www. .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Long PCR  PCR cuja extensão é mais longa que as PCR convencionais (> 5Kpb).PCR de genoma mitocondrial.Mapeamento de sequências.  DNApol amplifica alvos maiores.html . . .com/technical-documents/protocols/biology/long-and-accurate-dna-amplification.5x) prooreading.

identificação de vários vírus . para amplificação de diferentes fragmentos de uma mesma amostra.com/tech_notes/multiplex-pcr.  Objetivos: .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Multiplex PCR  PCR com dois ou mais conjuntos de primers.identificação de deleções em genes em doenças degenerativas (Distrofia muscular de Duchenne) http://www.premierbiosoft.html .

com.com%2Ftag%2Fvir us%2F&h=0&w=0&tbnid=TTbFAmfH6NcGJM&zoom=1&tbnh=209&tbnw=241&docid=ucIn BEbhhcINM&tbm=isch&ei=tbgIVIa6H4jEggSnpILgBg&ved=0CAUQsCUoAQ .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Nested PCR  É uma variação da PCR convencional. na qual são utilizados dois pares de primers (ao invés de um) para amplificar um mesmo fragmento.wordpress. em seguida em uma segunda PCR com a fita menor.br/imgres?imgurl=&imgrefurl=https%3A%2F%2Flaikaspoetnik.  Aumenta a especificidade! http://www.  Duas PCR: primeira com a fita parental.google.

 Quantidade de DNA-alvo pode ser derterminada pela razão Alvo (T) / competidor (C) .  Esse competidor deve conter sequências para os mesmos primers utilizados para amplificar o alvo.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Competitive PCR  É adicionada a reação uma quantidade conhecida de um fragmento de DNA (competidor).

 Objetivo: Aumentar a especificidade.  Temperatura de anelamento .começa mais alta que e temperatura ótima de anelamento dos primers. . . até atingir a temperatura específica. .após atingir essa temperatura ela é mantida nos ciclos restantes.diminuição de 1ºC a cada um ou dois ciclos. evita amplificação errônea.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Touchdown PCR  Modificação da PCR convencional que pode resultar na diminuição de amplificações não especificas.

TCGAATTCVCCYAAYTGRCCNT-3´ A+C+G =V C+T= Y A+C+G+T= N  Objetivo: avaliar polimorfismo .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Degenerate PCR  O que são primers degenerados? Primers que possuem um numero de opções em várias posições na sequência Exemplo: 5´.cs.tau.il/hyden/ . http://acgt.ac.

genotipagem de animais transgênicos. . GeneAmp Fast PCR Master Mix).PCR de colônia. Change the initial template denaturation/enzyme activation step to 98°C for 30 sec • Change the denaturation step at each cycle to 92°C for 1 sec • Combine annealing and extension steps into a single step at 70°C for 20 sec” .  PCR pode ser realizado de forma mais rápida. tais como: . para algumas aplicações.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Fast PCR  Kits específicos (ex. “Select primers with Tms of 64–69°C.

 - Como foi resolvido? Diluição seriada (end-point solution) Padrão externo Controle interno (competitivo).CAUSAS: * Perda de atividade da Taqpol. ocorre uma SATURAÇÃO. * Todas as enzimas disponíveis estão “ocupadas” com a síntese de DNA.prompt. .O crescimento linear no número de cópias ocorre até um determinado número de ciclos.hu/sites/default/files/tananyagok/microbiology/ch05s03. ou seja. * Acúmulo de produtos amplificados que pareiam entre si (produtos inespecíficos).html .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Porque a PCR convencional não é uma técnica quantitativa? . * etc. http://elte.

-Agilidade na obtenção de resultados.  Detecção.Quantificação do número de moléculas produzidas a cada ciclo.  Técnica quantitativa . quantificação e amplificação de DNA em uma única etapa. .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Metodologia de PCR + Sistema de detecção de sinais Fluorescentes.

Termociclador + Sistema Óptico.Computador com software para aquisição de dados e análise final.Curva de dissociação.  Reagentes de uma PCR convencional + Corante .  Plataforma de instrumentação .Intercalantes de DNA de dupla fita (dsDNA).Oligonucleotídeos marcados.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Etapas de amplificação de uma PCR convencional .  Coleta de dados . . . .Temperaturas e tempos diferentes.Fase exponencial da reação. .

. . . sensibilidade e precisão.Tempo de reação reduzido.Requer concentrações de DNA/cDNA 1000 x menor.Resultados quantitativos.Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  PCR em Tempo Real .Maior reprodutibilidade.SEM manipulação pósPCR. .Coleta de dados na fase Exponencial. . .

 Testes de eficiência terapêutica.  Quantificação de carga viral.  Quantificação de expressão gênica.  Caracterização de agentes (Genotipagem) .Introdução às técnicas de BM básicas  Amplificação via PCR (Polymerase Chain Reaction)  Real-time quantitative PCR  Todas as aplicações da PCR tradicional.  Detecção de agentes infecciosos.

 Plataformas 1) Roche® /454 FLX: 2004. 5) Pacific Biosciencies SMRT: 2010 . 3) Pyrosequencing. 2) Shotgun. 2) Illumina ®Solexa Genome Analyzer: 2006 3) Applied Biosystems SOLiDTM System: 2007. 4) Helicos HeliscopeTM : recently available.Introdução às técnicas de BM básicas  Sequenciamento  Métodos 1) Sanger.

ligação do primer e extensão de bases.Etapas: desnaturação.youtube.com/watch?v=JHv7IxxgxW4 T OH . eletroforese e leitura. terminação.Introdução às técnicas de BM básicas  Sequenciamento Técnica de didesoxi ou dideoxi (chain termination or dideoxy methodSanger) (1980-1995) .  P P T P T H P H G deoxinucleotídeo OH G dideoxinucleotídeo H P P H H ? P P P P T OH http://www.

método caro e demorado.  .Introdução às técnicas de BM básicas  Sequenciamento Técnica de didesoxi ou dideoxi (chain termination or dideoxy methodSanger): .Prós e contras: funciona bem para sequenciamento de 500-750 pb.

. . os clones são sequenciados diversas vezes e criação de um mapa físico para ordenar as sequências.Introdução às técnicas de BM básicas  Sequenciamento  Shotgun sequencing method (1995-2005) 1) Princípios . clonagem de fragmentos em vetores.Etapas: fragmentação.Digere parcialmente o genoma (ou grande fitas de DNA).

mas o processo de montagem requer muito mais capacidade computacional. menor precisão (que é compensada pela alta cobertura). mas em número muito maior em pouco tempo. alta cobertura. .Introdução às técnicas de BM básicas  Sequenciamento  Shotgun sequencing method (1995-2005) 2) Prós e contras: Produz leituras menores (25-500bp).

Duas moléculas de fostato são liberadas como (PPi).Diferentes etapas.Introdução às técnicas de BM básicas Sequenciamento  Pirosequenciamento (segunda geração) 1) Princípios . . dNTPs são fixados a extremidade 3’ da fita sintetizada. na qual luz visível é gerada e sua intensidade é proporcional ao número de nucleotídeos incorporados. .Durante a síntese de DNA.Sequenciamento por síntese.  1 .

liberar luz (a quantidade de luz liberada é proporcional ao número de nucleotídeos adicionados a nova fita de DNA). . se a sequência tem 2As seguidos. a enzima apirase destrói qualquer traço de dNTPs. duas vezes mais luz é liberada. .. Assim.A enzima ATP sulfurilase utiliza PPi e adenosiae 5’-fosfosulfato para produzir ATP . -A enzima Luciferase utiliza ATP para converter luciferina em oxiluciferina e assim.Introdução às técnicas de BM básicas Sequenciamento  Pirosequenciamento 1) Princípios  2 .Depois da reação completa.

Leitura (a luz é detectada através de uma câmera CCD especial). .Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciamento 1) Princípios  3 .

Adaptadores são aderidos a cada extremidade. . Ao final.Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciemanto 2) Preparação de amostras  . .O DNA é fragmentado em (300-800 bp) e as extremidades são “polidas” através da remoção de qualquer base não pareada. .Adaptadores contêm biotina a qual se liga a uma bead que contém na sua superfície (cada bead contém um único fragmento de fita simples de DNA). cada bead produz milhões de cópias idênticas de DNA. .A PCR é então realizada dentro de cada microreator. -Óleo é aderido as beads e uma solução de emulsão é criada (microreator).

youtube. .A placa está acoplada a um chip de fibra óptica.As enzimas vistas anteriormente. http://www. ligada a uma câmera CCD. o óleo é removido e as beads são colocadas em uma placa “picotiter” (em cada poço cabe somente uma única bead). são aderidas as beads dentro de cada poço.Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciemanto 2) Preparação de amostras  .Depois da PCR em emulsão.com/watch?v=nFfgWGFe0aA . .

 .Introdução às técnicas de BM básicas  Sequenciamento Pirosequenciamento 3) Prós e contras: . . mais automatizado.Contras: produz sequências menores e não tem uma resposta luminosa boa depois de 5-6 nucleotídeos idênticos.Prós: Alta acurácia. não necessita de eletroforese. elimina a necessidade de primers marcados.

Três tipos principais MORFOLÓGICOS BIOQUÍMICOS DNA polimorfismo .Marcadores moleculares (marcadores genético-moleculares) .Um marcador molecular é definido como qualquer fenótipo molecular oriundo de um gene expresso ou de um segmento específico de DNA (Ferreira & Grattapaglia.Entidades genéticas que manifestam herdáveis de maneira mendeliana. 1998). .

Até os meados da década de 60.: plantas. pleiotropia e epistasia PLANTAS PLANTA INTEIRA OU ADULTA . ex. efeito ambiental. os marcadores utilizados em estudos de genética e melhoramento eram controlados por genes associados a caracteres morfológicos. como fenótipos de fácil identificação visual. . características fenotípicas de variação discreta são utilizadas como marcadores morfológicos desde os tempos de Mendel.MARCADORES MORFOLÓGICOS . São afetados pela ação gênica de dominância.Em geral.

Por outro lado. etc. podem ser utilizados a partir de amostras de células ou de tecidos de partes da planta (folhas. embriões.) e também em qualquer estágio de desenvolvimento da planta ELETROFORESE . marcadores bioquímicos ou de DNA. pólen. cotilédones.

Na década de 1960. presente num mesmo indivíduo (Markert & Moller. 1959). apresentando função idêntica ou similar.É o resultado da presença de mais de um gene codificando cada uma das enzimas. . um novo tipo de marcador genético (proteico/enzimático) foi desenvolvido: as isoenzimas (isozimas) .MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) .Isoenzimas foram definidas como diferentes formas moleculares (variantes) de uma mesma enzima. (2003) . Castro et al.

que podem ser alelos de um mesmo loco (aloenzimas). e) ausência de efeitos epistáticos. d) herança Mendeliana simples com codominância entre alelos na maioria dos locos. O controle genético das isoenzimas ocorre através de vários genes. ou estar situados em diferentes locos.A premissa básica de se utilizar dados enzimáticos é que diferenças na mobilidade de isoenzimas em um campo elétrico são resultantes de diferenças ao nível de sequências de DNA que codificam tais enzimas. assumese que estas diferenças possuem base genética e sejam herdáveis. . c) ausência de efeitos deletérios associados com alelos isoenzímicos. se os padrões de bandas de dois indivíduos diferem.MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) . . Vantagens em relação aos marcadores morfológicos: a) determinação genotípica dos locos em qualquer da planta ou indivíduo. b) ocorrência de um número razoável de alelos. pleiotrópicos e ambientais.Assim.

MARCADORES BIOQUÍMICOS (isoenzimas ou isozimas) Desvantagens das isoenzimas em relação aos marcadores de DNA: a) Sofrem influência ambiental. . b) Limitado em número.

Não é objeto de influências ambientais. *Maior desvantagem é a necessidade de técnicas e equipamentos mais complexos.Polimorfismo detectado na seqüência de DNA. .Potencialmente ilimitado em número.MARCADORES DE DNA .Marcadores de DNA são derivados de pequenas regiões regiões do DNA que apresentam polimorfismo entre indivíduos dentro de uma espécie. Vantagens em relação aos marcadores bioquímicos : . . .

ANÁLISES BIOLOGIA MOLECULAR SEQUENCIAMENTO SEQUÊNCIA DE DNA/RNA MARCADOR MOLECULAR .

http://en.ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Variável em ORGANIZAÇÃO e TAMANHO (ex: 16Kb em humanos a 500 kb em algumas plantas).20 genes codificadores de proteínas (envolvidos na respiração celular).org/wiki/Human_mitochondrial_genetics .wikipedia.  12 .

. relações filogenéticas e o entendimento de vários aspectos biológicos e evolutivos de uma grande variedade de organismos. senão da maioria dos estudos envolvendo estrutura populacional. o mtDNA passou a fazer parte de muitos.ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Desde as décadas de 70-80. Características vantajosas. do século passado.

. . .Genes sem introns e regiões intergênicas curtas.ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Característica vantajosas (práticas): .N de cópias: cada célula contêm centenas e cada mitocôndria.Regiões bem conservadas (exs: citocromo b e citocromo oxidase I). dezenas de cópias.

Taxa evolutiva tipo relógio (clock-like) (ausência de seleção positiva).Evolução de forma neutra (não relacionados a Adaptação). .Altamente variável em pop. . . naturais devido à alta taxa de mutação.Molécula clone (herança materna).ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA)  Característica vantajosas (genético-evolutivas): . .

ANÁLISES BIOLOGIA MOLECULAR MARCADORES MOLECULARES DNA mitocondrial (mtDNA) .

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
Procambarus clarkii

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
 Ponto de introdução;

 Várias populações;
 Pergunta:

- Relação de parentesco
entre
indivíduos
das
diferentes populações?
- marcador
mtDNA;

molecular:

ANÁLISES BIOLOGIA
MOLECULAR
ESTUDO DE CASO
 Passos para obtenção das sequências:
Extração de DNA;
 Amplificação do gene de interesse (coI);
 Purificação do produtos de PCR;
 Sequenciamento
- Duas fitas FORWARD/REVERSE: confirmação de algumas
posições;

com.br/2011_01_01_archive.ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  CROMATOGRAMAS OU ELETROFEROGRAMAS http://viagene.html .blogspot.

ANÁLISES BIOLOGIA MOLECULAR PRÁTICA  National Center for Biotechnology Information (NCBI) .

por homologia. .ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  National Center for Biotechnology Information (NCBI) .Analisar. a validade da nossa sequência.

ac. http://www.massey.nz/~strewick/Text%20Files/DNA%20Toolkit.ANÁLISES BIOLOGIA MOLECULAR ESTUDO DE CASO  ALINHAMENTO .htm .Alinhar as sequências no banco de dados.

 INSERÇÃO*.Alteração na sequência de nucleotídeos do DNA.  .ANÁLISES BIOLOGIA MOLECULAR  Mutação . PONTUAL.  TRANSLOCAÇÃO.  INVERSÃO.  DELEÇÃO*.