J. Vet. Med.

B 49, 4954 (2002)

2002 Blackwell Wissenschafts-Verlag, Berlin
ISSN 09311793

Institute for Medical Microbiology, Infectious and Epidemic Diseases, Veterinary Faculty, Ludwig-Maximilians University,
Munich, Germany

Specic Detection of Chikungunya Virus Using a RT-PCR/Nested PCR

Combination
M. PFEFFER1,4, B. LINSSEN1, M. D. PARKER2 and R. M. KINNEY3
Addresses of authors: 1Institute for Medical Microbiology, Infectious and Epidemic Diseases, Veterinary Faculty, LudwigMaximilians University, Munich, Germany; 2Department of Viral Biology, Virology Division, U.S. Army Medical Research
Institute of Infectious Diseases (USAMRIID), Fort Detrick, Frederick, MD, USA; 3Division of Vector-Borne Infectious
Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention (CDC), Public Health Service,
U.S. Department of Health and Human Services, Fort Collins, CO, USA; 4Corresponding author: Tel.: +49 89 2180 2593;
fax: +49 89 2180 2597, e-mail: Martin.Pfeer@micro.vetmed.uni-muenchen.de
With 3 gures and 3 tables

Received for publication October 17, 2001

Summary
Chikungunya (CHIK) virus is enzootic in many countries in
Asia and throughout tropical Africa. In Asia the virus is
transmitted from primates to humans almost exclusively by
Aedes aegypti, while various aedine mosquito species are
responsible for human infections in Africa. The clinical picture
is characterized by a sudden onset of fever, rash and severe
pain in the joints which may persist in a small proportion of
cases. Although not listed as a haemorrhagic fever virus, illness
caused by CHIK virus can be confused with diseases such as
dengue or yellow fever, based on the similarity of the
symptoms. Thus, laboratory conrmation of suspected cases
is required to launch control measures during an epidemic.
CHIK virus diagnosis based on virus isolation is very sensitive,
yet requires at least a week in conjunction with virus
identication using monovalent sera. We developed a reverse
transcriptionpolymerase chain reaction (RT-PCR) assay
which amplies a 427-bp fragment of the E2 gene. Specicity
was conrmed by testing representative strains of all known
alphavirus species. To verify further the viral origin of the
amplicon and to enhance sensitivity, a nested PCR was
performed subsequently. This RT-PCR/nested PCR combination was able to amplify a CHIK virus-specic 172-bp
amplicon from a sample containing as few as 10 genome
equivalents. This assay was successfully applied to four CHIK
virus isolates from Asia and Africa as well as to a vaccine
strain developed by USAMRIID. Our method can be
completed in less than two working days and may serve as a
sensitive alternative in CHIK virus diagnosis.

Introduction
Chikungunya (CHIK) virus was rst isolated from human
serum and Aedes aegypti mosquitoes during an epidemic in
Tanzania in 1953 (Ross, 1956). Since then, CHIK virus has
caused occasional outbreaks and some larger epidemics
throughout most of sub-Saharan Africa and tropical Asia
including India and the Western Pacic. Some of these
epidemics apparently involved hundreds of thousands of
people (Rao, 1966). Historic evidence points to the spread of
Dedication: This work is dedicated to Professor Anton Mayr on his 80th
birthday.
U. S. Copyright Clearance Center Code Statement:

CHIK virus from Africa to Asia, where it has caused

outbreaks in the Philippines, Thailand, Indonesia, India, Sri
Lanka, Vietnam, Kampuchea and Myanmar since 1954
(reviewed by Jupp and McIntosh, 1988). Although CHIK
virus is found in both Africa and Asia, the viral ecology and
zoonotic disease association dier considerably with geographical distribution. In Africa a feral transmission cycle
including wild primates and primatophilic aedine mosquitoes
exists in the tree canopy of rainforest and savannah-woodlands. This endemic sylvatic transmission cycle is mainly
vectored by Aedes africanus, while Ae. luteocephalus,
Ae. furcifer, Ae. taylori and Ae. aegypti are implicated in
human transmission (Diallo et al., 1999). In contrast,
Ae. aegypti is the vector of CHIK virus in Asia, although
Ae. albopictus may be involved to some extent (Turell et al.,
1992). The human-biting habits of domestic Ae. aegypti appear
to permit transmission of CHIK virus in the absence of a feral
transmission cycle in Asia. This is probably one of the main
reasons for the dierent dynamic in epidemics seen in rural
Africa and in urban Asia (Jupp, 1996; Jupp and McIntosh,
1988).
CHIK virus infections in humans are generally characterized
by a sudden onset of fever, nausea, headache, vomiting, rash,
myalgia and arthralgia. The latter seems to be the most
prominent symptom, with painful arthritis persisting for
months or even years. The pain in the joint(s) is described by
the word chikungunya, which is Swahili and can be translated
as `that which bends up' (Woodall, 2001). These rather
unspecic symptoms are shared with other arboviruses, such
as O'nyong-nyong (ONN) and Sindbis viruses, which are
related alphaviruses present in Africa, or dengue viruses in
Asia. Although not listed as a haemorrhagic fever virus, such
symptomatology was described during outbreaks in India and
Thailand (Halstead, 1966), further stressing the need for
diagnostic procedures which allow rapid conrmation of
suspected cases. As with most viruses, their isolation is the
gold standard. This method is very sensitive but in conjunction
with virus identication using monovalent sera, it takes at least
a week to obtain results. Alternatively, infected cells can be
negatively stained and examined for virus particles by electron
microscopy. An alphavirus genus-reactive antigen-capture
enzyme-linked immunosorbent assay and monoclonal antibodies useful in CHIK virus diagnosis have been described but

09311793/2002/49010049 $15.00/0

www.blackwell.de/synergy

50

M. PFEFFER et al.

Table 1. Oligonucleotide primers used in this study

Name

Location*

Orientation

Sequence (53)

Amplicon size

Chik-1
cChik-4
Chik-2
cChik-3

37463765
41514172
39623983
41114133

forward
reverse
forward
reverse

TAATGCTGAACTCGGGGACC
ACCTGCCACACCCACCATCGAC
GATCAGGTTAACCGTGCCGACT
CACTGACACAACTACCACAGTCA

427 bp
172 bp

*according to GenBank Acc.-No. L37661 (Parker, 1994)

not implemented by routine diagnostic laboratories (Karabatsos, 1975; Greiser-Wilke et al., 1991; Blackburn et al., 1995).
We describe here another alternative for the specic diagnosis
of CHIK virus based on a reverse transcriptionpolymerase
chain reaction (RT-PCR) method which can be completed
within a working day and which allows the detection of as few
as 10 genome equivalents, respectively.

Materials and Methods

Propagation of viruses and extraction of viral RNA
CHIK virus strain S27 (passage P176/SM3), isolated during
the rst recognized CHIK epidemic in Tanzania in 1953, was
propagated in BHK-21 cells cultured in minimal essential
medium containing 2% fetal calf serum. After a cytopathogenic eect became evident, the cell culture medium was
harvested, cleared of cell debris by centrifugation, and CHIK
S27 viral RNA was extracted as previously described (Pfeer
et al., 1997).
Five other CHIK virus strains, including a highly passaged
CHIK vaccine candidate, were randomly selected from the
virus collection of the U.S. Army Medical Research Institute
of Infectious Diseases (USAMRIID). As CHIK virus reveals a
widespread geographical distribution, we chose one isolate
each from India, Indonesia, Thailand and South Africa. These
four isolates were propagated in BHK-21 cells, while the
CHIK vaccine candidate (TSI-GSD-218, Lot 185, grown
from attenuated strain 181/Clone 25, derived from strain
15561, isolated in 1962 from a patient in Thailand) was grown
in MRC-5 (human lung) cells (Edelman et al., 2000). The

Table 2. Reaction components used in CHIK virus-specic RT-PCR

and nested PCR

viruses were claried of cell debris by centrifugation and then

concentrated by pelleting through a 25% sucrose cushion. The
viral pellets were suspended in Trizol LS (Gibco-BRL,
Karlsruhe, Germany). 7,8), and the RNA was extracted according to the
manufacturers standard protocol.

Amplication and sequencing of CHIK virus-specic RNA

Oligonucleotide primers were chosen from the aligned nucleotide sequences encompassing the entire 26S RNA of alphaviruses representing the entire genus (Pfeer and Kinney,
unpublished results). The E2 gene was selected as the target
region for the RT-PCR because this gene shows a high degree
of divergence among the alphaviruses (Strauss and Strauss,
1994) and harbours virus-specic nucleotide stretches suitable
for primer design. The CHIK virus-specic sequences nally
chosen for primer design are shown in Table 1. The reaction
and cycling conditions of both the RT-PCR and the nested
PCR are listed in Tables 2 and 3, respectively. These conditions
were found to yield the best amplication results after varying
the following reagents: primers (0.11 lM, in 0.1 lM steps)
and both MgSO4 (RT-PCR) and MgCl2 (nested PCR;
14 mM, in 0.5 mM steps). Because 0.2 lM of each dNTP
(MBI Fermentas, St. Leon-Rot, Germany) revealed the best
results in similar assays (Linssen et al., 2000), its inuence on
the ecacy of the amplication was not investigated in this
study (Table 2). In order to determine the sensitivity of each
experiment, the amount of viral RNA was measured spectrophotometrically and the number of RNA molecules was
calculated on the basis of a genome length of 11 700 nucleotides
and an average weight for each nucleotide of 336.3 g/mol,
yielding a weight of 6.53 10)9 ng per RNA molecule.
RT-PCR amplicons and nested PCR products were run
through 2% agarose gels. A 2-ll aliquot of each amplied
cDNA was cloned into pCR2.1-TOPO-TA vector according to
the manufacturer's recommendations (Invitrogen, Groningen,
the Netherlands). Plasmid DNA of transformed Escherichia
coli (DH5aF) grown in LuriaBertani broth supplemented

RT-PCR

Nested PCR

0.3 lM each of Chik-1 and cChik-4

0.2 lM each of Chik-2 and

cChik-3

20 mM TrisHCl (pH 8.8)

10 mM KCl
10 mM (NH4)2SO4
2 mM MgSO4
0.1% Triton X-100
0.1 mg/ml nuclease-free BSA

10 mM TrisHCl (pH 8.3)

50 mM KCl
1.5 mM MgCl2
0.001% gelatine

0.2 lM dNTP
5 lM dithiotreitol
1.5 U TaqExtender
20 U Rnasin
8 U RAV-2 (RT)
1.5 U AmpliTaq polymerase

0.2 lM dNTP
5 lM dithiotreitol
1.5 U AmpliTaq polymerase

50C for 30 min

94C for 2 min

94C for 2 min

5 ll RNA template

2 ll RT-PCR template

30 cycles of:
94C for 25 s
64C for 45 s
72C for 30 s

30 cycles of:
94C for 20 s
56C for 35 s
72C for 20 s

ad 100 ll DEPC-treated Aqua

ad 100 ll DEPC-treated Aqua

72C for 4 min

4C until further use

72C for 4 min

4C until further use

Table 3. Temperature proles used in CHIK virus-specic RT-PCR

and nested PCR
RT-PCR

Nested PCR

Detection of Chikungunya Virus by RT-PCR

with ampicillin (50 lg/ml) was extracted using the Qiagen
plasmid mini kit accordingly (Qiagen, Hilden, Germany).
Bacterial clones harbouring cDNA inserts of the correct size
were sequenced using M13 sequencing primers. Both DNA
strands of at least two independent clones were determined for
each amplicon investigated.
Deduced amino acid sequences were compared with those of
the respective CHIK reference virus strain S27 as well as with
ONN and Igbo Ora virus sequences using the default settings of
the multiple sequence alignment option of the Heidelberg Unix
Sequence Analysis Resources (HUSAR) package available
through GeniusNet at the DKFZ in Heidelberg, Germany.

Results
Reactivity of alphaviruses in the CHIK virus-specic
RT-PCR/nested PCR assay
RNA of all 27 alphavirus species (Pfeer et al., 1998) was
investigated to demonstrate the CHIK virus-specicity of the
primers shown in Table 1. Only the CHIK virus reference
strain S27 yielded the expected 427-base pair (bp) amplicon in
the RT-PCR or the 172-bp amplicon in the subsequent nested
PCR (shown for ONN, Sindbis, and Barmah Forest viruses in
Fig. 1a,b). To investigate the sensitivity of this assay, RNA of
the CHIK virus vaccine candidate was serially diluted. The
427-bp amplicon was clearly visible in the 104 dilution and
slightly visible in the 10)5 dilution containing about 60 fg
RNA, which represents about 10 000 RNA molecules
(Fig. 1a). This sensitivity was enhanced 1000-fold in the
subsequently performed nested PCR (Fig. 1b), allowing
detection of as few as 10 CHIK virus genome equivalents.
Randomly selected CHIK virus isolates from the strain
collection of USAMRIID were subjected to the RT-PCR/nested
PCR. Figure 2(a) shows that CHIK virus isolates from Asia, the
Asian subcontinent and Africa yielded the 427-bp amplicon in
the RT-PCR using primers CHIK-1 and cCHIK-4. As with the
S27 reference and vaccine candidate strains, applying the nested
PCR to the RT-PCR-derived cDNA resulted in the amplication of a 172-bp fragment in all CHIK viruses investigated
(Fig. 2b).
Molecular analysis of CHIK virus amplicons
Because of the lack of any ambiguity in the nucleotide
sequence data from independently cloned RT-PCR products,
only two clones were analysed for each CHIK virus-specic
RT-PCR amplicon. Comparison of the nucleotide sequence
data revealed a high level of sequence identity with base
dierences found at 28 positions in the 427-nucleotide region
investigated. These nucleotide dierences accounted for nine
or fewer changes in the deduced amino acid sequences when
compared to CHIK reference virus strain S27. Amino acid
substitutions occurred only at 11 of the 142 positions in the E2
glycoprotein of the CHIK virus strains investigated (Fig. 3).
The three putative Asn-linked glycosylation sites (N-X-S or -T,
where X any of a number of amino acid residues) at
positions 18, 28 and 101 were not aected by these changes
(Fig. 3). As expected, the sequence of the CHIK vaccine
candidate clustered with the isolates from Thailand and
Indonesia, although a phylogenetic analysis was not performed. Distinct coding changes were observed for the Indian

51
isolate (40Ile to 40Thr) and the South African isolate (69His to
69Tyr). The CHIK S27 reference strain had four amino acid
residues that were not shared with any of the ve other strains
in the E2 region analysed (positions 23Met, 55Ser, 140Met and
142Val; Fig. 3).

Discussion
ONN virus, which shares a high degree of sequence identity
with CHIK virus, would be considered a subtype of
CHIK virus based on the formal parameters of the Subcommittee on Inter-Relationships Among Catalogued Arboviruses
(SIRACA) (Weaver et al., 2000). However, due to important
ecological dierences, especially concerning their arthropod
vectors, ONN and CHIK viruses are retained as distinct
species. Hence, we chose the most variable region of the
alphaviral genome, the E2 gene (Strauss and Strauss, 1994), to
demonstrate selective amplication of CHIK virus. The
sequence data shown in Fig. 3 illustrate the close relationship
between the CHIK and ONN viruses. The diagnostic RT-PCR
method described here clearly dierentiated CHIK virus
strains, which were isolated from dierent geographical
regions, from ONN virus. The general applicability of this
test may be further demonstrated by future testing of more
CHIK and ONN virus isolates. Because ONN virus thus far
has only been found in Africa, its discrimination from CHIK
virus is not an issue in Asia. CHIK virus was reported to be
more pathogenic for infant mice than ONN virus (Williams
and Woodall, 1961), but such testing may not be suitable for
diagnostic laboratories. The standard for virus isolation in
conjunction with virus identication by using monovalent sera
is undoubtedly the method of choice when it comes to
conrming suspected infections. Monoclonal antibodies,
which distinguish CHIK virus from other alphaviruses, have
been employed in CHIK virus identication (Woodall, 2001).
The molecular approach presented here may serve as an
eective alternative to virus isolation, because it is fast and
may permit early launch of appropriate counter measures
during outbreak investigations. In addition, our method was
quite sensitive, allowing the detection of as few as 10 genome
equivalents of CHIK virus. This detection limit is within the
range of RT-PCR assays established for other alphaviruses
(Sellner et al., 1994; Kuno, 1998; Linssen et al., 2000).
Although the sensitivity calculations are based on the measured amount of RNA, we expect this test to be sensitive
enough to detect a low level viraemia in CHIK virus-infected
patients (Pfeer et al., 1997).
Recent investigations on the molecular evolution of CHIK
virus support the hypothesis that it probably originated in
tropical Africa and was subsequently imported into Asia
(Powers et al., 2000). The authors found a strikingly higher
degree of homology among the Asian CHIK viruses than
among the isolates from Africa, which they consequently
divided into west and central/east African genotypes.
Although we sequenced only a small portion of the E2
gene of a few CHIK virus strains, our data conrm the high
degree of sequence conservation among CHIK virus strains
of the Asian genotype: the isolates from Indonesia and
Thailand diered only in three nucleotides (99.3% identity),
none of which resulted in a codon change. The CHIK virus
strains from Indonesia and Thailand showed 97.797.9%
nucleotide sequence identities with the Indian strain, but

52

M. PFEFFER et al.

Fig. 1. Ethidium bromide-stained agarose gels showing the results of CHIK virus-specic amplication. A 10-ll aliquot of each reaction was
loaded onto the 2% agarose gels. The 1-kb ladder (Gibco-BRL) was used as molecular weight marker and the amplicon sizes are depicted on the
right margin. (a) Serial dilutions containing RNA of CHIK vaccine candidate strain used as template for CHIK virus-specic RT-PCR with
primers CHIK-1 and cCHIK-4. A 10-pg RNA aliquot of CHIK virus reference strain S27 was used as positive control while the negative control
contained water instead of RNA in the reaction. To demonstrate CHIK virus-specic amplication, additional negative controls included a 50-ng
RNA aliquot each of O'nyong-nyong (UGMP-30 strain), Sindbis (C377 strain), and Barmah Forest (BH 2193 strain) viruses. The 427-bp
amplication product was visible down to the 10)5 dilution, which contained a calculated 10 000 RNA genome equivalents. (b) The CHIK virusspecic 172-bp amplication product resulting from nested PCR of the template cDNA derived from the RT-PCR shown in (a). An additional
negative control contained 2 ll of the RT-PCR negative control. The specic amplicon resulting from primers CHIK-2 and cCHIK-3 is visible
down to the 108 dilution, thus enhancing the sensitivity by a factor of one thousand.

Detection of Chikungunya Virus by RT-PCR

53

(a)

(b)

Fig. 2. Ethidium bromide-stained agarose gels showing the results of CHIK virus-specic amplication. A 10-ll aliquot of each reaction was
loaded onto the 2% agarose gels. The 1-kb ladder (Gibco-BRL) was used as molecular weight marker and the amplicon sizes are depicted on the
left margin. (a) Results of CHIK virus-specic RT-PCR demonstrate the 427-bp sized amplicon for all CHIK viral RNAs investigated but not for
the closely related O'nyong-nyong virus (UGMP-30 strain). (b) Results of the nested PCR using a 2-ll aliquot of the RT-PCR derived template
cDNA shown in Fig. 2(a). Again, all CHIK viruses, but not O'nyong nyong virus, show the specic 172-bp amplication product. In (b), an
additional negative control was included which contained 2 ll of the RT-PCR negative control.

only 94.8% identity with the CHIK virus strain from South
Africa. The proposed genotypes may reect the dierent
ecology of CHIK viruses in Africa and Asia. Numerous
mosquito species transmit CHIK virus in Africa, whereas
only Ae. aegypti and Ae. albopictus are responsible for
vectoring this virus in Asia. The urban/peri-domestic habitat
of Ae. aegypti and Ae. albopictus, combined with their
exclusive anthropophilic feeding behaviour has resulted in
severe epidemics in large urban populations (Jupp and
McIntosh, 1988). Because CHIK and dengue viruses are

transmitted by the same mosquito species and simultaneous

infections with both viruses have been reported (Halstead,
1966), our method might prove useful in dierentiating
infections caused by these two viruses.

Acknowledgements
We thank Grit Kermes for expert technical assistance. This work was
supported by the Fraunhofer Gesellschaft, Munich, Germany (No.
0491-V-4393).

54

M. PFEFFER et al.

Fig. 3. Alignment of the deduced amino acid sequences of the RT-PCR products of the ve CHIK viruses as well as of CHIK virus reference
strain S27 (Parker, 1994, unpublished data), O'nyong-nyong (Levinson et al., 1990) and Igbo Ora viruses (Lanciotti et al., 1998). Putative Asnlinked glycosylation sites are highlighted by asterisks (positions 18, 28 and 101). The transmembrane domain of E2 is underlined (positions 122 to
the end; excluding the four C-terminal amino acids). Position 1 correlates to the amino acid residue at position 245 of the E2 glycoprotein of
CHIK virus.

References
Blackburn, N. K., T. G. Besselaar, and G. Gibson, 1995:
Antigenic relationship between chikungunya virus strains and
o'nyong nyong virus using monoclonal antibodies. Res. Virol.
146, 6973.
Diallo, M., J. Thonnon, M. Traore-Lamizana, and D. Fontenille,
1999: Vectors of Chikungunya virus in Senegal: current data and
transmission cycles. Am. J. Trop. Med. Hyg. 60, 281286.
Edelman, R., C. O. Tacket, S. S. Wasserman, S. A. Bodison, J. G.
Perry, and J. A. Mangiaco, 2000: Phase II safety and immunogenicity study of live Chikungunya virus vaccine TSI-GSD-218. Am. J.
Trop. Med. Hyg. 62, 681685.
Greiser-Wilke, I. M., V. Moennig, O.-R. Kaaden, and R. E. Shope,
1991: Detection of alphaviruses in a genus-specic antigen capture
enzyme immunoassay using monoclonal antibodies. J. Clin. Microbiol. 29, 131137.
Halstead, S. B., 1966: Mosquito-borne haemorrhagic fevers of South
and South-East Asia. Bull. WHO 35, 315.
Jupp, P. G., 1996: Mosquitoes of Southern Africa. Ekogilde Publishers, Hartebeespoort.
Jupp, P. G., and B. M. McIntosh, 1988: Chikungunya virus disease. In:
The Arboviruses: Epidemiology and Ecology, (Monath, T. P., ed.),
Vol. II, pp. 137157. CRC Press, Boca Raton, FL.
Karabatsos, N., 1975: Antigenic relationships of group A arboviruses
by plaque reduction neutralization testing. Am. J. Trop. Med. Hyg.
24, 527532.
Kuno, G., 1998: Universal diagnostic RT-PCR protocol for arboviruses. J. Virol. Meth. 72, 2741.
Lanciotti, R. S., M. L. Ludwig, E. B. Rwaguma, J. J. Lutwama, T. M.
Kram, N. Karabatsos, B. C. Cropp, and B. R. Miller, 1998:
Emergence of epidemic O'nyong nyong fever in Uganda after a 35year absence: genetic characterization of the virus. Virology 252,
258268.
Levinson, R. S., J. H. Strauss, and E. G. Strauss, 1990: Complete
sequence of the genomic RNA of O'nyong-nyong virus and its use in
the construction of alphavirus phylogenetic trees. Virology 175,
110123.
Linssen, B., R. M. Kinney, P. Aguilar, K. L. Russell, D. M. Watts,
O.-R. Kaaden, and M. Pfeer, 2000: Development of reverse

transcription-PCR assays specic for detection of equine encephalitis viruses. J. Clin. Microbiol. 38, 15271535.
Pfeer, M., B. Proebster, R. M. Kinney, and O.-R. Kaaden, 1997:
Genus-specic detection of alphaviruses by a semi-nested reverse
transcription-polymerase chain reaction. Am. J. Trop. Med. Hyg.
57, 709718.
Pfeer, M., R. M. Kinney, and O.-R. Kaaden, 1998: The alphavirus
3-nontranslated region: size heterogeneity and arrangement of
repeated sequence elements. Virology 240, 100108.
Powers, A. M., A. C. Brault, R. B. Tesh, and S. C. Weaver, 2000:
Re-emergence of chikungunya and o'nyong-nyong viruses: evidence
for distinct geographical lineages and distant evolutionary relationships. J. Gen. Virol. 81, 471479.
Rao, T. R., 1966: Recent epidemics caused by Chikungunya virus in
India, 1963195. Scientic Culture 32, 215.
Ross, R. W., 1956: The Newala epidemic. III. The virus: isolation,
pathogenic properties and relationship to the epidemic. J. Hyg. 54,
177191.
Sellner, L. N., R. J. Coelen, and J. S. Mackenzie, 1994: Sensitive
detection of Ross River virus a one tube nested RT-PCR. J. Virol.
Meth. 49, 4758.
Strauss, J. H., and E. G. Strauss, 1994: Alphaviruses. Microbiol. Rev.
58, 491562.
Turell, M. J., J. R. Beaman, and R. F. Tammariello, 1992: Susceptibility
of selected strains of Aedes aegypti and Aedes albopictus (Diptera:
Culicidae) to chikungunya virus. J. Med. Entomol. 29, 4953.
Weaver, S. C., L. Dalgarno, T. K. Frey, H. V. Huang, R. M. Kinney, C.
M. Rice, J. T. Roehrig, R. E. Shope, and E. G. Strauss, 2000: Family
Togaviridae. In: van Regenmortel, M. H. V., C. M. Fauquet, D. H. L.
Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Manilo, M. A.
Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner, (eds), Virus
Taxonomy, Seventh Report of the International Committee on
Taxonomy of Viruses, pp. 879889. Academic Press, San Diego.
Williams, M. C. and J. P. Woodall, 1961: O'nyong-nyong fever: an
epidemic virus disease in East Africa. II. Isolation and some
properties of the virus. Trans. R. Soc. Trop. Med. Hyg. 55, 135141.
Woodall, J., 2001: Chikungunya virus. In: The Encyclopedia of
Arthropod-Transmitted Infections, (Service, M. W., ed.), pp. 115
119. CABI Publishing, Oxford.