Institute for Medical Microbiology, Infectious and Epidemic Diseases, Veterinary Faculty, Ludwig-Maximilians University,
Munich, Germany
Summary
Chikungunya (CHIK) virus is enzootic in many countries in
Asia and throughout tropical Africa. In Asia the virus is
transmitted from primates to humans almost exclusively by
Aedes aegypti, while various aedine mosquito species are
responsible for human infections in Africa. The clinical picture
is characterized by a sudden onset of fever, rash and severe
pain in the joints which may persist in a small proportion of
cases. Although not listed as a haemorrhagic fever virus, illness
caused by CHIK virus can be confused with diseases such as
dengue or yellow fever, based on the similarity of the
symptoms. Thus, laboratory conrmation of suspected cases
is required to launch control measures during an epidemic.
CHIK virus diagnosis based on virus isolation is very sensitive,
yet requires at least a week in conjunction with virus
identication using monovalent sera. We developed a reverse
transcriptionpolymerase chain reaction (RT-PCR) assay
which amplies a 427-bp fragment of the E2 gene. Specicity
was conrmed by testing representative strains of all known
alphavirus species. To verify further the viral origin of the
amplicon and to enhance sensitivity, a nested PCR was
performed subsequently. This RT-PCR/nested PCR combination was able to amplify a CHIK virus-specic 172-bp
amplicon from a sample containing as few as 10 genome
equivalents. This assay was successfully applied to four CHIK
virus isolates from Asia and Africa as well as to a vaccine
strain developed by USAMRIID. Our method can be
completed in less than two working days and may serve as a
sensitive alternative in CHIK virus diagnosis.
Introduction
Chikungunya (CHIK) virus was rst isolated from human
serum and Aedes aegypti mosquitoes during an epidemic in
Tanzania in 1953 (Ross, 1956). Since then, CHIK virus has
caused occasional outbreaks and some larger epidemics
throughout most of sub-Saharan Africa and tropical Asia
including India and the Western Pacic. Some of these
epidemics apparently involved hundreds of thousands of
people (Rao, 1966). Historic evidence points to the spread of
Dedication: This work is dedicated to Professor Anton Mayr on his 80th
birthday.
U. S. Copyright Clearance Center Code Statement:
09311793/2002/49010049 $15.00/0
www.blackwell.de/synergy
50
M. PFEFFER et al.
Location*
Orientation
Sequence (53)
Amplicon size
Chik-1
cChik-4
Chik-2
cChik-3
37463765
41514172
39623983
41114133
forward
reverse
forward
reverse
TAATGCTGAACTCGGGGACC
ACCTGCCACACCCACCATCGAC
GATCAGGTTAACCGTGCCGACT
CACTGACACAACTACCACAGTCA
427 bp
172 bp
not implemented by routine diagnostic laboratories (Karabatsos, 1975; Greiser-Wilke et al., 1991; Blackburn et al., 1995).
We describe here another alternative for the specic diagnosis
of CHIK virus based on a reverse transcriptionpolymerase
chain reaction (RT-PCR) method which can be completed
within a working day and which allows the detection of as few
as 10 genome equivalents, respectively.
RT-PCR
Nested PCR
0.2 lM dNTP
5 lM dithiotreitol
1.5 U TaqExtender
20 U Rnasin
8 U RAV-2 (RT)
1.5 U AmpliTaq polymerase
0.2 lM dNTP
5 lM dithiotreitol
1.5 U AmpliTaq polymerase
5 ll RNA template
2 ll RT-PCR template
30 cycles of:
94C for 25 s
64C for 45 s
72C for 30 s
30 cycles of:
94C for 20 s
56C for 35 s
72C for 20 s
Nested PCR
Results
Reactivity of alphaviruses in the CHIK virus-specic
RT-PCR/nested PCR assay
RNA of all 27 alphavirus species (Pfeer et al., 1998) was
investigated to demonstrate the CHIK virus-specicity of the
primers shown in Table 1. Only the CHIK virus reference
strain S27 yielded the expected 427-base pair (bp) amplicon in
the RT-PCR or the 172-bp amplicon in the subsequent nested
PCR (shown for ONN, Sindbis, and Barmah Forest viruses in
Fig. 1a,b). To investigate the sensitivity of this assay, RNA of
the CHIK virus vaccine candidate was serially diluted. The
427-bp amplicon was clearly visible in the 104 dilution and
slightly visible in the 10)5 dilution containing about 60 fg
RNA, which represents about 10 000 RNA molecules
(Fig. 1a). This sensitivity was enhanced 1000-fold in the
subsequently performed nested PCR (Fig. 1b), allowing
detection of as few as 10 CHIK virus genome equivalents.
Randomly selected CHIK virus isolates from the strain
collection of USAMRIID were subjected to the RT-PCR/nested
PCR. Figure 2(a) shows that CHIK virus isolates from Asia, the
Asian subcontinent and Africa yielded the 427-bp amplicon in
the RT-PCR using primers CHIK-1 and cCHIK-4. As with the
S27 reference and vaccine candidate strains, applying the nested
PCR to the RT-PCR-derived cDNA resulted in the amplication of a 172-bp fragment in all CHIK viruses investigated
(Fig. 2b).
Molecular analysis of CHIK virus amplicons
Because of the lack of any ambiguity in the nucleotide
sequence data from independently cloned RT-PCR products,
only two clones were analysed for each CHIK virus-specic
RT-PCR amplicon. Comparison of the nucleotide sequence
data revealed a high level of sequence identity with base
dierences found at 28 positions in the 427-nucleotide region
investigated. These nucleotide dierences accounted for nine
or fewer changes in the deduced amino acid sequences when
compared to CHIK reference virus strain S27. Amino acid
substitutions occurred only at 11 of the 142 positions in the E2
glycoprotein of the CHIK virus strains investigated (Fig. 3).
The three putative Asn-linked glycosylation sites (N-X-S or -T,
where X any of a number of amino acid residues) at
positions 18, 28 and 101 were not aected by these changes
(Fig. 3). As expected, the sequence of the CHIK vaccine
candidate clustered with the isolates from Thailand and
Indonesia, although a phylogenetic analysis was not performed. Distinct coding changes were observed for the Indian
51
isolate (40Ile to 40Thr) and the South African isolate (69His to
69Tyr). The CHIK S27 reference strain had four amino acid
residues that were not shared with any of the ve other strains
in the E2 region analysed (positions 23Met, 55Ser, 140Met and
142Val; Fig. 3).
Discussion
ONN virus, which shares a high degree of sequence identity
with CHIK virus, would be considered a subtype of
CHIK virus based on the formal parameters of the Subcommittee on Inter-Relationships Among Catalogued Arboviruses
(SIRACA) (Weaver et al., 2000). However, due to important
ecological dierences, especially concerning their arthropod
vectors, ONN and CHIK viruses are retained as distinct
species. Hence, we chose the most variable region of the
alphaviral genome, the E2 gene (Strauss and Strauss, 1994), to
demonstrate selective amplication of CHIK virus. The
sequence data shown in Fig. 3 illustrate the close relationship
between the CHIK and ONN viruses. The diagnostic RT-PCR
method described here clearly dierentiated CHIK virus
strains, which were isolated from dierent geographical
regions, from ONN virus. The general applicability of this
test may be further demonstrated by future testing of more
CHIK and ONN virus isolates. Because ONN virus thus far
has only been found in Africa, its discrimination from CHIK
virus is not an issue in Asia. CHIK virus was reported to be
more pathogenic for infant mice than ONN virus (Williams
and Woodall, 1961), but such testing may not be suitable for
diagnostic laboratories. The standard for virus isolation in
conjunction with virus identication by using monovalent sera
is undoubtedly the method of choice when it comes to
conrming suspected infections. Monoclonal antibodies,
which distinguish CHIK virus from other alphaviruses, have
been employed in CHIK virus identication (Woodall, 2001).
The molecular approach presented here may serve as an
eective alternative to virus isolation, because it is fast and
may permit early launch of appropriate counter measures
during outbreak investigations. In addition, our method was
quite sensitive, allowing the detection of as few as 10 genome
equivalents of CHIK virus. This detection limit is within the
range of RT-PCR assays established for other alphaviruses
(Sellner et al., 1994; Kuno, 1998; Linssen et al., 2000).
Although the sensitivity calculations are based on the measured amount of RNA, we expect this test to be sensitive
enough to detect a low level viraemia in CHIK virus-infected
patients (Pfeer et al., 1997).
Recent investigations on the molecular evolution of CHIK
virus support the hypothesis that it probably originated in
tropical Africa and was subsequently imported into Asia
(Powers et al., 2000). The authors found a strikingly higher
degree of homology among the Asian CHIK viruses than
among the isolates from Africa, which they consequently
divided into west and central/east African genotypes.
Although we sequenced only a small portion of the E2
gene of a few CHIK virus strains, our data conrm the high
degree of sequence conservation among CHIK virus strains
of the Asian genotype: the isolates from Indonesia and
Thailand diered only in three nucleotides (99.3% identity),
none of which resulted in a codon change. The CHIK virus
strains from Indonesia and Thailand showed 97.797.9%
nucleotide sequence identities with the Indian strain, but
52
M. PFEFFER et al.
Fig. 1. Ethidium bromide-stained agarose gels showing the results of CHIK virus-specic amplication. A 10-ll aliquot of each reaction was
loaded onto the 2% agarose gels. The 1-kb ladder (Gibco-BRL) was used as molecular weight marker and the amplicon sizes are depicted on the
right margin. (a) Serial dilutions containing RNA of CHIK vaccine candidate strain used as template for CHIK virus-specic RT-PCR with
primers CHIK-1 and cCHIK-4. A 10-pg RNA aliquot of CHIK virus reference strain S27 was used as positive control while the negative control
contained water instead of RNA in the reaction. To demonstrate CHIK virus-specic amplication, additional negative controls included a 50-ng
RNA aliquot each of O'nyong-nyong (UGMP-30 strain), Sindbis (C377 strain), and Barmah Forest (BH 2193 strain) viruses. The 427-bp
amplication product was visible down to the 10)5 dilution, which contained a calculated 10 000 RNA genome equivalents. (b) The CHIK virusspecic 172-bp amplication product resulting from nested PCR of the template cDNA derived from the RT-PCR shown in (a). An additional
negative control contained 2 ll of the RT-PCR negative control. The specic amplicon resulting from primers CHIK-2 and cCHIK-3 is visible
down to the 108 dilution, thus enhancing the sensitivity by a factor of one thousand.
53
(a)
(b)
Fig. 2. Ethidium bromide-stained agarose gels showing the results of CHIK virus-specic amplication. A 10-ll aliquot of each reaction was
loaded onto the 2% agarose gels. The 1-kb ladder (Gibco-BRL) was used as molecular weight marker and the amplicon sizes are depicted on the
left margin. (a) Results of CHIK virus-specic RT-PCR demonstrate the 427-bp sized amplicon for all CHIK viral RNAs investigated but not for
the closely related O'nyong-nyong virus (UGMP-30 strain). (b) Results of the nested PCR using a 2-ll aliquot of the RT-PCR derived template
cDNA shown in Fig. 2(a). Again, all CHIK viruses, but not O'nyong nyong virus, show the specic 172-bp amplication product. In (b), an
additional negative control was included which contained 2 ll of the RT-PCR negative control.
only 94.8% identity with the CHIK virus strain from South
Africa. The proposed genotypes may reect the dierent
ecology of CHIK viruses in Africa and Asia. Numerous
mosquito species transmit CHIK virus in Africa, whereas
only Ae. aegypti and Ae. albopictus are responsible for
vectoring this virus in Asia. The urban/peri-domestic habitat
of Ae. aegypti and Ae. albopictus, combined with their
exclusive anthropophilic feeding behaviour has resulted in
severe epidemics in large urban populations (Jupp and
McIntosh, 1988). Because CHIK and dengue viruses are
Acknowledgements
We thank Grit Kermes for expert technical assistance. This work was
supported by the Fraunhofer Gesellschaft, Munich, Germany (No.
0491-V-4393).
54
M. PFEFFER et al.
Fig. 3. Alignment of the deduced amino acid sequences of the RT-PCR products of the ve CHIK viruses as well as of CHIK virus reference
strain S27 (Parker, 1994, unpublished data), O'nyong-nyong (Levinson et al., 1990) and Igbo Ora viruses (Lanciotti et al., 1998). Putative Asnlinked glycosylation sites are highlighted by asterisks (positions 18, 28 and 101). The transmembrane domain of E2 is underlined (positions 122 to
the end; excluding the four C-terminal amino acids). Position 1 correlates to the amino acid residue at position 245 of the E2 glycoprotein of
CHIK virus.
References
Blackburn, N. K., T. G. Besselaar, and G. Gibson, 1995:
Antigenic relationship between chikungunya virus strains and
o'nyong nyong virus using monoclonal antibodies. Res. Virol.
146, 6973.
Diallo, M., J. Thonnon, M. Traore-Lamizana, and D. Fontenille,
1999: Vectors of Chikungunya virus in Senegal: current data and
transmission cycles. Am. J. Trop. Med. Hyg. 60, 281286.
Edelman, R., C. O. Tacket, S. S. Wasserman, S. A. Bodison, J. G.
Perry, and J. A. Mangiaco, 2000: Phase II safety and immunogenicity study of live Chikungunya virus vaccine TSI-GSD-218. Am. J.
Trop. Med. Hyg. 62, 681685.
Greiser-Wilke, I. M., V. Moennig, O.-R. Kaaden, and R. E. Shope,
1991: Detection of alphaviruses in a genus-specic antigen capture
enzyme immunoassay using monoclonal antibodies. J. Clin. Microbiol. 29, 131137.
Halstead, S. B., 1966: Mosquito-borne haemorrhagic fevers of South
and South-East Asia. Bull. WHO 35, 315.
Jupp, P. G., 1996: Mosquitoes of Southern Africa. Ekogilde Publishers, Hartebeespoort.
Jupp, P. G., and B. M. McIntosh, 1988: Chikungunya virus disease. In:
The Arboviruses: Epidemiology and Ecology, (Monath, T. P., ed.),
Vol. II, pp. 137157. CRC Press, Boca Raton, FL.
Karabatsos, N., 1975: Antigenic relationships of group A arboviruses
by plaque reduction neutralization testing. Am. J. Trop. Med. Hyg.
24, 527532.
Kuno, G., 1998: Universal diagnostic RT-PCR protocol for arboviruses. J. Virol. Meth. 72, 2741.
Lanciotti, R. S., M. L. Ludwig, E. B. Rwaguma, J. J. Lutwama, T. M.
Kram, N. Karabatsos, B. C. Cropp, and B. R. Miller, 1998:
Emergence of epidemic O'nyong nyong fever in Uganda after a 35year absence: genetic characterization of the virus. Virology 252,
258268.
Levinson, R. S., J. H. Strauss, and E. G. Strauss, 1990: Complete
sequence of the genomic RNA of O'nyong-nyong virus and its use in
the construction of alphavirus phylogenetic trees. Virology 175,
110123.
Linssen, B., R. M. Kinney, P. Aguilar, K. L. Russell, D. M. Watts,
O.-R. Kaaden, and M. Pfeer, 2000: Development of reverse
transcription-PCR assays specic for detection of equine encephalitis viruses. J. Clin. Microbiol. 38, 15271535.
Pfeer, M., B. Proebster, R. M. Kinney, and O.-R. Kaaden, 1997:
Genus-specic detection of alphaviruses by a semi-nested reverse
transcription-polymerase chain reaction. Am. J. Trop. Med. Hyg.
57, 709718.
Pfeer, M., R. M. Kinney, and O.-R. Kaaden, 1998: The alphavirus
3-nontranslated region: size heterogeneity and arrangement of
repeated sequence elements. Virology 240, 100108.
Powers, A. M., A. C. Brault, R. B. Tesh, and S. C. Weaver, 2000:
Re-emergence of chikungunya and o'nyong-nyong viruses: evidence
for distinct geographical lineages and distant evolutionary relationships. J. Gen. Virol. 81, 471479.
Rao, T. R., 1966: Recent epidemics caused by Chikungunya virus in
India, 1963195. Scientic Culture 32, 215.
Ross, R. W., 1956: The Newala epidemic. III. The virus: isolation,
pathogenic properties and relationship to the epidemic. J. Hyg. 54,
177191.
Sellner, L. N., R. J. Coelen, and J. S. Mackenzie, 1994: Sensitive
detection of Ross River virus a one tube nested RT-PCR. J. Virol.
Meth. 49, 4758.
Strauss, J. H., and E. G. Strauss, 1994: Alphaviruses. Microbiol. Rev.
58, 491562.
Turell, M. J., J. R. Beaman, and R. F. Tammariello, 1992: Susceptibility
of selected strains of Aedes aegypti and Aedes albopictus (Diptera:
Culicidae) to chikungunya virus. J. Med. Entomol. 29, 4953.
Weaver, S. C., L. Dalgarno, T. K. Frey, H. V. Huang, R. M. Kinney, C.
M. Rice, J. T. Roehrig, R. E. Shope, and E. G. Strauss, 2000: Family
Togaviridae. In: van Regenmortel, M. H. V., C. M. Fauquet, D. H. L.
Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Manilo, M. A.
Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner, (eds), Virus
Taxonomy, Seventh Report of the International Committee on
Taxonomy of Viruses, pp. 879889. Academic Press, San Diego.
Williams, M. C. and J. P. Woodall, 1961: O'nyong-nyong fever: an
epidemic virus disease in East Africa. II. Isolation and some
properties of the virus. Trans. R. Soc. Trop. Med. Hyg. 55, 135141.
Woodall, J., 2001: Chikungunya virus. In: The Encyclopedia of
Arthropod-Transmitted Infections, (Service, M. W., ed.), pp. 115
119. CABI Publishing, Oxford.