Mannan-hydrolysis by hemicellulases

Enzyme-polysaccharide interaction of a modular -mannanase

Per Hgglund

Department of Biochemistry
Lund University
Sweden
2002

AKADEMISK AVHANDLING
som fr avlggande av filosofie doktorsexamen vid Matematisk-Naturvetenskapliga fakulteten vid
Lunds Universitet offentligt kommer att frsvaras i hrsal C, Kemicentrum,
Getingevgen 60, fredagen den 31:a maj 2002, kl 10.15
Fakultetsopponent: Prof. R. Anthony J. Warren, Department of Microbiology and Immunology,
University of British Columbia, Vancouver, BC, Canada

Denna avhandling tillgnas min Mormor

Alice Rnnberg

Mannan-hydrolysis by hemicellulases
Enzyme-polysaccharide interaction of a modular -mannanase

Per Hgglund

Department of Biochemistry
Lund University
Sweden
2002

 2002 Per Hgglund

Lund University
Dep. of Biochemistry
Center for Chemistry and Chemical engineering
Lund University
P.O. Box 124
S-221 00 LUND
Sweden
ISBN: 91-628-5203-5
LUNKDL/(NKBK-1074)/ 1-176 /2002
Printed by JaBe Offset, Lund, Sweden

Table of contents
Publication List
Abbreviations ...
Summary
Introduction .
General background .
Mannan-based polysaccharides ...

5
6
7
9
13
13

Mannans in wood: hemicelluloses ..

Algal mannans
Mannan-based storage polysaccharides
Crystalline mannans .

13
14
14
15

Polysaccharide-degrading enzymes: an introduction 15

Polysaccharide-degrading microorganisms .... 15
Industrially important fungi . 16
Modularity of polysaccharide-degrading enzymes .. 16

Glycoside hydrolases

...

16

General catalytic features . 16

Family classification ... 17
Structural features .. 17

Carbohydrate-binding modules .... 18

Family classification ... 18
Structure and function ... 18
Cellulose-binding CBMs 19

Galactoglucomannan-degrading enzymes . 21
-Mannanase ...
Biochemical properties .
Occurrence and regulation
Family classification and structural determination ..
Modular -mannanases ...
Applications .

21
21
23
23
24
25

Exo-acting enzymes .. 25
-Mannosidase . 25
Other exo-acting enzymes . 26

Present investigation .. 29
Outline ... 29

Mannan-degrading enzymes

.......

30

Aspergillus niger -mannosidase, AnMan2A 30

The M. edulis -mannanase, MeMan5A 31
The modular T. reesei -mannanase, TrMan5A .. 32

The CBM of TrMan5A

......

33

Sequence and structure 33

Binding properties of the CBM .... 34
Effect on hydrolysis .... 35
Why a cellulose-binding CBM on a -mannanase? 36

The catalytic module of TrMan5A

37

The active site cleft 37

Characterisation of mutants .. 37
Mutant Glu169Ala . 38

Mannan-hydrolysis .. 38
Degradation of unsubstituted mannan ..
Crystallisation of mannan ......
Degradation of mannan crystals .....
Degradation of heteromannans .....

39
39
39
40

Conclusions & future perspectives . 43

Acknowledgements ..... 45
References 55
Papers I-VII

Publication List
This thesis is based on the following papers, referred to in the text by their Roman numerals.

I.

Ademark, P., Lundqvist, J., Hgglund, P., Tenkanen, M., Torto, N., Tjerneld, F.
and Stlbrand, H. (1999) Hydrolytic properties of a -mannosidase purified from
Aspergillus niger. J. Biotechnol. 75, 281-289. 1

II.

Ademark, P., de Vries, R. P., Hgglund, P., Stlbrand, H. and Visser, J. (2001)
Cloning and characterization of Aspergillus niger genes encoding an -galactosidase and a -mannosidase involved in galactomannan degradation. Eur. J.
Biochem. 268, 2982-2990. 2

III.

Hgglund, P., Sabini, E., Boisset, C., Wilson, K., Chanzy, H. and Stlbrand, H.
(2001) Degradation of mannan I and II crystals by fungal endo--1,4-mannanases
and a -1,4-mannosidase studied with transmission electron microscopy.
Biomacromolecules 2, 694-699. 3

IV.

Hgglund, P., Eriksson, T., Colln, A., Nerinckx, W., Claeyssens, M. and
Stlbrand, H. (2002) A cellulose-binding module of the Trichoderma reesei mannanase Man5A increases the mannan-hydrolysis of complex substrates. Submitted for publication in J. Biotechnol.

V.

Xu, B., Hgglund, P., Stlbrand, H. and Janson, J. C. (2002) endo--1,4Mannanases from blue mussel, Mytilus edulis: purification, characterization, and
mode of action. J. Biotechnol. 92, 267-277. 1

VI.

Lundqvist, J., Hgglund, P., Eriksson. T., Persson, P., Stoll, D., Siika-aho, M.,
Gorton, L. and Stlbrand, H. Degradation of glucomannan and O-acetylgalactoglucomannan by mannoside- and glucoside-hydrolases. Manuscript.

VII.

Hgglund, P., Anderson, L. and Stlbrand, H. The active site cleft of Trichoderma
reesei -mannanase Man5A: analysis of mutants of the catalytic glutamates and
arginine 171 positioned in the +2 subsite. Manuscript.

Reprinted with permission from Elsevier Science, Ltd.

Reprinted with permission from Blackwell Publishing
3
Reproduced with permission from Biomacromolecules. Copyright American Chemical Society.
2

Abbreviations
3D
A. niger
AnMan2A
Arg
C. fimi
CBM
CfMan26A
DP
E. coli
EC
GH-A
Gln
Glu
gpdA
LBG
Lys
M. edulis
MeMan5A
O-acetyl-GGM
P. cellulosa
P. pastoris
S. cerevisae
SLH
sp.
T. reesei
TrMan5A
TrMan5ACBM
Trp
Tyr

Three-dimensional
Aspergillus niger
A. niger -mannosidase
Arginine
Cellulomonas fimi
Carbohydrate-binding module
C. fimi -mannanase
Degree of Polymerisation
Escherichia coli
Enzyme Commission
Glycoside Hydrolase clan A
Glutamine
Glutamate
glyceraldehyde-3-phosphate dehydrogenase
Locust Bean Gum
Lysine
Mytilus edulis
M. edulis -mannanase
O-acetyl-galactoglucomannan
Pseudomonas cellulosa
Pichia pastoris
Saccharomyces cerevisae
S-Layer Homology
Species
Trichoderma reesei
T. reesei -mannanase
Catalytic module of TrMan5A
Trypophan
Tyrosine

Summary
The enzymatic degradation of plant polysaccharides is a process of fundamental importance in nature. Furthermore, polysaccharide-degrading enzymes are very important in
many industrial processes. Therefore, the study of these enzymes is an important field of
research. The degradation of the plant cell wall is a complex process that involves a wide
range of enzymes, mainly produced by microorganisms. These enzymes include those
which degrade cellulose and hemicellulose two of the main components in plant cell
walls. Such enzymes are often composed of two or several separated modules which
perform different functions. Carbohydrate-binding modules (CBMs) are frequently present
and are known to be important for efficient hydrolysis of cellulose. However, the role of
CBMs in hemicellulose degradation is less clear.
In this work, the structure and function of hemicellulose-degrading enzymes was investigated. The focus was on enzymes which degrade mannan and heteromannans such as
galactoglucomannan, the major softwood hemicellulose. The main enzyme studied was
a -mannanase (TrMan5A) produced by the filamentous fungus Trichoderma reesei.
This enzyme is composed of a catalytic module and a CBM. In order to study the function of the two modules, a mutant lacking the C-terminal CBM was constructed (Paper
IV). By use of this mutant and the full-length enzyme, the binding properties of the
CBM and its effect on hydrolysis of different substrates was investigated. The results of
this study demonstrate that the CBM of TrMan5A has a positive influence on the hydrolysis of complex mannan substrates containing cellulose. Furthermore, this increase
in hydrolysis could be linked to binding of the CBM to the substrate. Binding studies
revealed that the CBM binds to cellulose, but not to mannan.
The enzyme-polysaccharide interaction in the active site cleft of the catalytic module of
TrMan5A was also studied in this work (Paper VII). Several mutants of specific amino
acids were designed, based on the previously solved structure of the catalytic module.
The enzymatic activity of the catalytic residue mutants was very low or abolished. In
contrast, a mutant of Arg171 (Arg171Lys) displayed activity in the same range as the
wild-type enzyme. Interestingly, this mutant also appears to have a more alkaline pHoptimum than the wild-type. However, the Arg171Lys mutant was impaired in hydrolysis of small substrates.
In addition to TrMan5A, the properties of a -mannanase (MeMan5A) from blue mussel
(Mytilus edulis) and a -mannosidase (AnMan2A) from the fungus Aspergillus niger,
were studied in this work (Papers I, II and V). MeMan5A belongs to the same enzyme
family as TrMan5A. Also, the -mannosidase is related to the -mannanases since they
are members of the same enzyme clan (GH-A). Studies on the catalytic properties of the
enzymes showed that all three enzymes are capable of degrading polymeric mannan
7

(Papers I, V and VI). Furthermore, TrMan5A and AnMan2A also degraded highly crystalline mannan, which was visualised by transmission electron microscopy (Paper III).
Also included in the present study is a comparative investigation of the enzymatic degradation of heteromannans (Paper VI). Here, glucomannan and galactoglucomannan were
degraded by several polysaccharide-degrading enzymes involved in the breakdown of
cellulose and hemicellulose. The results show that these substrates can be hydrolysed by
both mannoside- and glucoside-hydrolases.
In conclusion, this work showed that the enzyme-polysaccharide interaction in the two
modules of TrMan5A is important in determining overall enzymatic efficiency and
specificity in the hydrolysis of complex substrates. Altogether, the results presented demonstrate the need to use complex substrates in order to reveal the mechanisms of plant
polysaccharide degradation.

Introduction
Carbohydrates are essential for life on earth.
They function as long-term storage depots of the energy captured in photosynthesis, and as integral parts of genetic information carried in DNA. Furthermore, carbohydrates play many other
important roles in nature: for example, they are involved in intercellular communication and host/
pathogen recognition. Moreover, carbohydrates in the form of polysaccharides are the main structural elements of plants.
In terms of biomass, cellulose and hemicellulose are the most abundant polysaccharides on earth
and are synthesised in huge amounts: it has been estimated that 1012 tonnes of cellulose are produced per annum [60]. Thus, these polymers are powerful renewable resources. However, in
order to maintain a balance in the ecosystem, these polysaccharides must eventually be degraded.
Even though the spontaneous degradation of polysaccharides under physiological conditions is
thermodynamically favourable, it is exceedingly slow; it has been estimated that the half-life of
cellulose is almost 5 million years [282]. In nature, the rate of turnover of plant polysaccharides is
enhanced by polysaccharide-degrading enzymes, produced mainly by various soil-living
decomposers which degrade decaying plant material (Figure 1).

Figure 1. Synthesis and degradation of plant polysaccharides.

The plant cell wall is mainly composed of tightly associated cellulose, hemicellulose and lignin.
Due to this complex structural composition, the degradation of the plant cell wall is a difficult
task. Accordingly, a complex mixture of enzymes is required in order to degrade the cell wall
components. Many of these enzymes have modular structures with separate carbohydrate-binding modules (CBMs) which anchor the enzymes to different components in the cell wall [278].

In several cases, these CBMs are very important for efficient substrate hydrolysis. For example,
generally cellulose-binding CBMs linked to cellulases mediate an increase in rate of cellulose
degradation [268]. However, cellulose-binding CBMs are also found in many hemicellulosedegrading enzymes and their function in these enzymes is more elusive [95].
Hemicelluloses comprise a family of diverse polysaccharides. Generally, hemicelluloses have a
complex chemical structure and are often referred to as mannans, xylans and galactans on the
basis of the predominant sugar type in the main chain. One of the most common mannans is Oacetyl-galactoglucomannan which comprises up to 25 % of the dry weight in softwood [263].
However, a range of other mannan-type polysaccharides are synthesised by a wide variety of
plants, and are found in different types of plant tissue [185]. Their main role is often to function as
structural polysaccharides and/or as reserve energy.
Due to the complex structure of hemicellulose, several different hemicellulose-degrading enzymes (usually referred to as an enzyme system) are produced for the complete degradation of
these polymers into their monomeric components [26, 61]. Such a system often includes a combination of endo- and exo-acting enzymes. Two of the major endo-acting enzymes involved in
degradation of hemicellulose are -mannanase and -xylanase. In the case of O-acetylgalactoglucomannan, -mannanase is the major depolymerising enzyme. In addition, the exoacting enzymes -mannosidase, -galactosidase and -glucosidase are needed for a complete
degradation of galactoglucomannan.
In addition to their importance in nature, hemicellulases are important in many industrial applications [183, 280, 284]. Polysaccharide-degrading enzymes in general are the second largest group
of commercially produced enzymes [100]. Furthermore, cellulases and hemicellulases account
for approximately 20 % of the world enzyme market [193]. In particular, hemicellulases have
several existing and potential uses in the pulp and paper industry [280]. Environmental concerns
have been raised against the use of large quantities of chlorinated compounds in pulp bleaching
processes. Treatment of pulp with -xylanases prior to bleaching reduces the amount of bleaching chemicals needed in the process, thus providing an environment-friendly alternative [280]. In
addition, -mannanases also have potential uses in pulp-bleaching [45, 249].
From prehistoric time, wood have been used by humans as building material and as an energy
source. The more refined industrial uses of wood have been focused on the cellulose component.
However, in recent years it has been realised that hemicelluloses also have many potential industrial applications [89]. As environmental problems increase, it is likely that recyclable
polysaccharides will be attractive for industrial applications in the future [16]. In order to study
the structure of hemicelluloses, and to modify their properties, hemicellulose-degrading enzymes
are important tools [158]. Thus, research in these enzymes is of vital interest.
The general aim of the current work was to increase the understanding of the molecular mechanisms in mannan-degrading hemicellulases. In particular the enzyme-polysaccharide interaction
in a number of mannan-degrading enzymes was investigated. The main enzyme studied was a
modular -mannanase (TrMan5A) from Trichoderma reesei, which contains a catalytic module
and a CBM. In this work, the binding properties of the CBM and its effect on the overall activity
of this enzyme was studied (Paper IV). Moreover, the substrate interaction in the active site cleft
of the catalytic module of TrMan5A was investigated (Paper VII).

10

In addition, the molecular properties of a -mannosidase (Papers I and II) from the fungus Aspergillus niger and a -mannanase (Paper V) from the blue mussel (Mytilus edulis)
were studied. Furthermore, the activity of these enzymes and TrMan5A were investigated, with
an emphasis on their ability to degrade mannan polymers (Papers I, III and VI).
This thesis is divided into two major parts (see Table of contents, page 3)
In the first part of this thesis (General background), the mannan-degrading enzymes are described in the context of plant cell-wall degradation. First, the mannan-containing polysaccharides
are presented. Then, an overview of polysaccharide-degrading enzymes is given. Finally, the
mannan-degrading enzymes are introduced, with an emphasis on -mannanases.
In the second part (Present investigation), the results described in Papers I-VII (listed on page 5)
are presented and discussed.

11

12

General background
Mannan-based polysaccharides
Mannans in wood: hemicelluloses
Wood comprises the bulk of the tree trunk and is essentially composed of the cell walls of xylem
cells. The major constituents of these cell walls are cellulose, hemicellulose and lignin [83]. The
relative amounts of cellulose, hemicellulose and lignin can vary to some degree, depending on
the species (Table 1). Furthermore, the chemical composition of wood depends on the tissue, cell
type and growth rate [226].
Table 1. Composition of woods from some representative species. Data from Timell [263]

Species
Acer rubrum
Betula papyrifera
Fagus grandifora
Pinus strobus
Picea glauca

Cellulose (%)
45
42
45
41
41

Hemicellulose (%)
29
38
29
27
31

Lignin (%)
24
19
22
29
27

The concept of hemicellulose was introduced by Schulze in 1891, to define alkali-extractable

plant polysaccharides [83]. Hemicelluloses are a group of heteropolysaccharides with a degree of
polymerisation (DP) around 100-200 [263]. They are built up by a main chain composed of one
or several types of sugar monomers. In addition, different types of side-groups are frequently
attached to the main chain [234].
As seen in Table 2, different hemicelluloses are found in wood derived from gymnosperms
(softwoods) and angiosperms (hardwoods) [263]. The amounts of the different hemicelluloses
can also vary considerably depending on the cell type and the stage in development. In softwoods,
the major hemicelluloses are O-acetyl-galactoglucomannan and arabino-4-Omethylglucuronoxylan, an exception being larchwood where arabinogalactan is the predominant
hemicellulose [263]. In hardwoods, the major hemicellulose component is O-acetyl-4-Omethylglucuronoxylan, but a smaller amount of glucomannan is also found (Table 2).

13

Table 2. Hemicelluloses in hardwoods and softwoods. Data from Timell [263].

Hemicellulose
Amount (% of wood )
Hardwood
Glucomannan
3-5
O-acetyl-4-O-methylglucuronoxylan
10-35
Softwood
Arabino-4-O-methylglucuronoxylan
10-15
O-acetyl-galactoglucomannan
15-25
a
Arabinogalactan
10-20
a
In larchwood only

Degree of polymerisation
>70
~200
>120
>100
~220

Hardwood glucomannan is built up by a linear chain of -(14)-linked mannose and glucose

residues. The mannose/glucose ratio in glucomannans is typically in the range 1/1-2/1 [263].
Galactoglucomannan is built up by a glucomannan main chain, but also includes -(16)-linked
galactosyl side-groups attached at some mannose residues (Figure 2). In softwood
galactoglucomannan, acetyl groups have been reported to be attached at the C-2 and C-3 positions of some mannose residues [150, 158], in an apparently random fashion [139].
O-acetyl galactoglucomannan can be divided in two fractions: one soluble in water, which has a
galactose/glucose/mannose ratio of 1/1/3 and one soluble in aqueous alkali, which has a galactose/glucose/mannose ratio of 0.1/1/3 [263].

Figure 2. A schematic view of O-acetyl-galactoglucomannan.

Algal mannans
A range of different polysaccharides are produced by algae [208], some of which have industrial
importance [79]. In vivo, two of the main roles of these polysaccharides in the algae are to function as reserve energy and as structural material. Linear -(14) mannan is present in the cell
walls of several siphonaceous green algae in the families Acetabularia, Codium and Halicoryne
[88, 126, 157]. Furthermore, mannan is also found in some red algae, such as Porphyra umbilicalis
14

[135]. In some of these algae, mannan is the main structural polymer and displays a microfibrillar
morphology [51, 166]. Some algal mannans display a high degree of polydispersity: the mannan
from Codium fragile has a degree of polymerisation between 20 and 10 000 [167].

Mannan-based storage polysaccharides

Besides amylose and amylopectin, which are the most widespread storage polysaccharides in
plants, there is a diverse group of mannan-based storage polysaccharides found in the seeds,
roots, bulbs and tubers of various plants [185]. These include the mannans, galactomannans and
glucomannans which are discussed below.
Mannan: Linear chains of -(14) mannan are found in the plant seed endosperms of certain
plant species [18, 184, 283]. Mannan has been isolated from ivory nut (Phytelephas macrocarpa),
date (Phoenix dactylifera) and green coffee bean (Coffea arabica). In most cases, these
polysaccharides are highly insoluble in water and very dense. Accordingly, it has been suggested
that the mannan forms the molecular basis for the hardness which is characteristic for palm kernels, such as the ivory nut. In the cell wall of the seed endosperm of ivory nut, mannan is the
major component and it has been characterised in some detail. Based on their solubility in alkali,
two different fractions of mannan have been isolated from the ivory nut [162]. These fractions
differ mainly in their DP [18, 184] and morphology [51, 184].
Galactomannan: Galactomannans are reserve polysaccharides in the seed endosperm of leguminous plants (Leguminosae) [217]. In contrast to unsubstituted mannans, the galactomannans
are water soluble and can imbibe water, thus providing a water-holding function for the seed
[217]. They are composed of -(14)-linked mannan chains with -(16)-linked galactosyl
side groups [179]. Both the solubility and the viscosity of the galactomannans are influenced by
the mannose/galactose ratio, which can vary from 1 to 5 [217]. Furthermore, the distribution of
the substituents can vary considerably [67], which also affects the physical properties of
galactomannans [73]. Two of the most well characterised galactomannans are those found in
locust bean gum and guar gum, isolated from the seeds of Ceratonia siliqua and Cyanaposis
tetragonolobus, respectively [101, 220]. Locust bean gum galactomannan has a mannose/galactose ratio of approximately 5/1 and a molecular weight of 310 000 [220]; guar gum galactomannan
has a mannose/galactose ratio of 2/1 and a molecular weight of 220 000 [101]. In combination
with other polysaccharides, these galactomannans have strong gelling properties and are thus
used as thickeners in the food and feed industries. Galactomannans and their derivatives are also
used in paper making, mining and in the textile industry [101, 220].
Glucomannan: Some glucomannans are found as storage polysaccharides in the seeds of certain
annual plants, for example some lilies (Liliaceae) and irises (Iridaceae) [185]. Furthermore,
glucomannans are found in the bulbs, roots and tubers of several other types of plants [185].
Many of these glucomannans are water soluble and have the same general structure as
glucomannans found in wood: they are composed of a -(14)-linked mannan chain with interspersed glucose residues in the main chain and are often acetylated [185]. The mannose/glucose
ratio ranges from 4/1 to below 1/1 [185]. One of the most thoroughly characterised of these
glucomannans is the so-called konjac mannan isolated from the tubers of Amorphophallus
konjac [198]. This polysaccharide has a mannose/glucose ratio of 1.6/1 and a degree of polymerisation above 6000. [198].
15

Crystalline mannans
Polysaccharides in nature can be organised in more or less regular structures; ranging from irregular or amorphous structures to highly organised and crystalline structures. The most abundant polysaccharide in nature, cellulose, is partially crystalline. In addition to cellulose, X-ray
analysis has yielded information about the structures of a number of other polysaccharides such
as chitin, xylan, amylose and mannan [169].
Crystalline linear -(14) D-mannan has been found in the cell walls of ivory nuts and in the
algae Acetabularia crenulata and Codium fragile [51, 88, 184]. Two polymorphs mannans I
and II have been observed in these cell walls. The morphologies of mannan I and mannan II are
granular and fibrillar, respectively [51]. Crystalline glucomannan from wood can be obtained,
but only after partial degradation or modification [262]. After dissolution of glucomannan in
alkali it can be recrystallised as mannan I or mannan II, depending on the crystallisation conditions [50]. Furthermore both mannan and glucomannan can be recrystallised onto cellulose fibers,
yielding the so-called shish/kebab (cellulose/mannan) morphology [50]. Native glucomannan
and O-acetyl-galactoglucomannan appear to be mostly non-crystalline in nature, probably due to
their more complex structures [169].

Polysaccharide-degrading enzymes: an introduction

Polysaccharide-degrading microorganisms
Bacteria and fungi thriving on decaying plant material constitute an important part of the ecosystem. These microorganisms decompose polysaccharides and other plant materials, thus recycling
organic and inorganic material in the atmosphere and biosphere. Many of these polysaccharidedegrading microorganisms are soil- or water-living. However, some polysaccharide degrading
anaerobes degrade plant polysaccharides in the stomach of ruminants [55]. For several
decomposers, plant cell wall polysaccharides are the principal carbon and energy source. Accordingly, these organisms usually produce secreted enzymes which degrade the polysaccharides into
mono- and oligosaccharides which can be further metabolised in the cell.

Industrially important fungi

The ability of some soil-living fungi to produce large amounts of polysaccharide-degrading enzymes and other groups of extracellular enzymes (e.g. proteinases and lipases) makes them attractive for use in industrial enzyme production. Fungi from the genera Aspergillus and Trichoderma are examples of two families of industrially important fungi. Notably, Trichoderma reesei is
a potent producer of several cellulases and hemicellulases which are widely used in industrial
applications [279, 280]. Besides its high enzyme production capacity, T. reesei has the advantage
of being non-toxic and non-pathogenic which is important in large scale fermentation processes
[196]. In addition to endogenous enzymes, strains of both Aspergillus and Trichoderma have also
16

been used as hosts for expression of foreign eukaryotic proteins [142, 206]. For example, T.
reesei has been used for the production of single chain antibodies and mammalian interleukin
[206].

Modularity of polysaccharide-degrading enzymes

Polysaccharide-degrading enzymes often have a modular structure. By definition, modular enzymes are composed of two or more independently folded modules each formed from a contiguous sequence [37]. Furthermore, each module has a distinct structure which is related to its
function. The overall structures and the functionally important residues are often conserved amongst
similar modules. A modular architecture has been found amongst lipases, endonucleases, peptide
synthases and several other classes of enzymes [141]. Modular polysaccharide-degrading enzymes are commonly composed of a catalytic module connected to one or more additional catalytic or non-catalytic module [278]. In many cases, these modules are connected by linker sequences [96]. The most common modules are the catalytic O-glycoside hydrolases and the noncatalytic carbohydrate-binding modules (CBM), which are discussed below. However, several
additional non-catalytic modules have also been described [268]. Thermostabilizing modules
have been found in some xylanases [114], and S-layer homology (SLH) modules, involved in
cell-surface attachment, have been described in several types of polysaccharide-degrading enzymes [268]. Dockerin modules, found in polysaccharide-degrading enzymes from anaerobic
bacteria and fungi, attach the enzymes to the cellulosome a large multi-enzyme complex
composed of several different enzymatic activities [230]. This cellulosome is composed of a core
structure called a scaffold, onto which several types of enzymes can be attached.

Glycoside hydrolases
General catalytic features
The O-glycoside hydrolases constitute the main group of enzymes which participate in the degradation of plant polysaccharides. The diversity of carbohydrate structures is reflected in the wide
range of substrate specificity found amongst glycoside hydrolases. The structure and function of
glycoside hydrolases has been intensively studied: the first enzyme structure solved by X-ray
diffraction was a glycoside hydrolase (hen egg-white lysozyme), solved in 1965 [30]. Based on
kinetic data and later on structural information, a general mechanism for glycoside hydrolases
has been proposed [70, 144, 233]. According to this theory, two main mechanisms for glycoside
hydrolases exist. These are called retaining and inverting mechanisms, referring to the stereochemical outcome at the anomeric carbon in the product.
In both mechanisms, the hydrolysis of the glycosidic bond proceeds through general acid/base
catalysis involving two carboxylates (glutamates or aspartates) positioned in the active site [281].
The inverting mechanism proceeds through a single step reaction involving the direct attack by a
nucleophilic water on the anomeric carbon, and the simultaneous protonation of the glycosidic

17

oxygen and aglycone departure. The mechanism of retaining enzymes (double displacement)
includes a first step which involves the attack by a nucleophilic carboxylate on the anomeric
carbon and the concomitant release of the aglycone, resulting in a covalent enzyme-glycoside
intermediate. In the second step the covalent intermediate is attacked by a nucleophilic water
which releases the glycoside from the enzyme (Figure 3).

Figure 3. General mechanism for retaining glycoside hydrolases. The nucleophile (B) and acid/base (A)
catalytic residues are shown. The aglycone (R) is also indicated.

Family classification
A little more than a decade ago, Henrissat et al. presented a family classification of glycoside
hydrolases, based on sequence alignment and hydrophobic cluster analysis [115, 149]. As new
sequences have been reported, they have been annotated into different families and new families
have been added [116, 117]. A continuously updated database is available on the internet at: http:/
/afmb.cnrs-mrs.fr/~cazy/CAZY/index.html [63]. At this stage 87 families have been reported.
The relevance of this family classification has also been supported by the increasing amount of
structural information, which has accumulated in recent years [39, 119]. Based on structural
similarities, several families have been organised into clans. One of the major clans is the GH-A
clan comprising at least 16 families [118, 131, 137]. This clan shares the (/)8-barrel (TIMbarrel) fold, which is one of the most common protein folds [264]. In addition, the positions of
the catalytic residues are conserved in clan GH-A: the catalytic acid/base and nucleophile are
positioned at the C-termini of -strands 4 and 7, respectively [131].
18

Structural features
Glycoside hydrolases have been found to have one of two major cleavage preferences: exo-acting
enzymes hydrolyse residues at the chain ends and endo-acting enzymes hydrolyse glycosidic
bonds internally in the polysaccharide chain [233]. For several structurally determined enzymes
the cleavage preference is reflected by the active site architecture (Figure 4) [69]. Endo-acting
enzymes, such as endoglucanase and -mannnanase, often have cleft shaped active site surfaces
[76, 223]. On the other hand, pocket-shaped active site structures are found amongst several exoacting enzymes which release monosaccharides from non-reducing ends, such as -galactosidase
and glucoamylase [8, 136]. A tunnel-shaped active surface is found in cellobiohydrolases, which
release cellobiose from the reducing or non-reducing ends of cellulose [75]. However, it should
be pointed out that the architectures of the active sites of endo- and exo-acting enzymes does not
necessarily reflect the observed cleavage preference discrepancies may exist. Furthermore, the
boundaries between exo- and endo-acting enzymes are not absolute: enzymes which are mainly
endo-active may show exo-activivity and vice versa [241, 266].

Figure 4. Examples of active site topologies in glycoside hydrolases: (a) the pocket (glucoamylase from
Aspergillus awamori). (b) The cleft (endoglucanase from Clostridium thermocellum). (c) The tunnel
(cellobiohydrolase Cel6A from Trichoderma reesei). Adapted from [222].

In glycoside hydrolases, binding of several glycoside residues in the active site region is often
required. Accordingly the substrate binding surface can be divided into several subsites. According to the recommended nomenclature [72], these are numbered +4, +3, +2, +1, -1, -2 etc., from
the non-reducing end to the reducing end, with the O-glycosidic bond to be cleaved being positioned between subsite +1 and 1 (Figure 5).

Figure 5. A schematic overview of the sugar residue binding subsites in the active site region in glycoside
hydrolases. The arrow indicates the point of cleavage.

19

Carbohydrate-binding modules
Family classification
Carbohydrate-binding sites in general are common and are found in several types of proteins,
such as toxins, sugar transporters, lectins, antibodies and glycolytic enzymes [214]. Carbohydrate-binding modules (CBMs) however, are found mostly in polysaccharide-degrading enzymes.
CBMs have been widely studied in cellulose-degrading enzymes which bind tightly to cellulose
[257, 267, 269, 276]. These binding entities were originally referred to as cellulose-binding
domains (CBDs) [269]. However, more recently CBMs which bind to chitin, starch, xylan, mannan
and other polysaccharides have been described, not only in cellulases but also in other polysaccharide-degrading enzymes [278]. In order to encompass a broader binding specificity, the concept of the carbohydrate-binding module (CBM) was introduced [36]. By analogy to the glycoside hydrolases, CBMs are classified into families based on sequence similarities and when possible, 3D-structures [36, 39, 95, 269]. This classification is continuously updated and is available
at: http://afmb.cnrs-mrs.fr/~cazy/CAZY/index.html [63]. Presently, 30 families of CBMs have
been reported, some of which are listed in Table 3. A number of these families are closely related
and consequently were recently grouped into a superfamily [66, 247].

Structure and function

Depending on their binding properties, three types of CBMs have been identified [36]. Type A
CBMs bind to insoluble polysaccharides, such as cellulose and chitin with high affinity [155].
These types of CBMs, are found in e.g. family I, II, III and V. Type B binding modules, found in
e.g. family II and IV, bind soluble polysaccharides and oligosaccharides, and in some cases also
amorphous, insoluble polysaccharides [265]. In addition to poly- and oligosaccharides, type C
CBMs also have relatively high affinity for monosaccharides [34]. These CBMs are found in e.g.
family IX and XIII.
The structure of CBMs from several families has been solved by X-ray crystallography and NMR
spectroscopy [39, 95]. In most cases, the structures are built up mainly of -sheets, often with an
anti-parallel -strand topology [39]. In general, CBMs which bind crystalline polysaccharides
(type A) display a flat ligand-binding surface with exposed aromatic residues [145, 288] (Figure
6). On the other hand, several modules which bind amorphous polysaccharides and oligosaccharides
(Type B) display a groove-shaped binding surface lined with polar residues [132, 143]. Recently,
the structure of a Type C CBM from family IX was solved and it was found to have a slot-shaped
binding site, large enough to accommodate a disaccharide [34, 202].
Analyses of mutational and chemical modifications have demonstrated the importance of the
aromatic residues found on the flat surfaces of type A CBMs in ligand binding [41, 152, 218]. In
at least some type B CBMs, both aromatic and polar residues have been shown to contribute
significantly to ligand binding [143, 285]. The significance of aromatic and polar residues in
CBMs is not surprising; the presence of these types of residues is a recurring theme in proteincarbohydrate interactions [214]. A general scheme in protein-carbohydrate associations is that
20

aromatic residues are aligned face-to-face with the hydrophobic face of the sugar ring, thus providing stacking interactions. Polar residues, on the other hand, are thought to make hydrogen
bonds with the hydrophilic hydroxyl groups. Thermodynamic analyses of CBM binding have
shown that, generally, binding of soluble polysaccharides and oligosaccharides is promoted mainly
by a decrease in enthalpy, resulting from several hydrogen bonding contacts between the protein
and the ligand [34, 35, 42, 133, 250]. In contrast, binding of a type A CBM to crystalline cellulose
has been shown to be driven by an increase in entropy, partly due to dehydration of the ligandbinding surface [64].

Figure 6. Examples of structures of type A (a) and type B (b) CBMs. a. The family I CBM from the T. reesei
endoglucanase TrCel7A [145]. b. The family IV CBM from the C. fimi endoglucanase CfCel9B [42].
Residues implicated in binding are shown in red.

Cellulose-binding CBMs
Some of the most studied cellulose-binding CBMs are those from the fungus T. reesei, and from
the bacteria Cellulomonas fimi and Pseudomonas cellulosa [36, 114, 155, 269]. The cellulosebinding CBMs from T. reesei are relatively small (30-40 residues) and classified into family I. A
majority of the family I CBMs are connected to cellulases of fungal origin [155, 257]. However,
a few fungal hemicellulases, including the T. reesei -mannanase also carry family I CBMs [171,
244]. In T. reesei cellulases it has been shown that family I CBMs are important for efficient
hydrolysis of cellulose [257, 267, 276]. Two of the most studied T. reesei CBMs are those from
the endoglucanase Cel7B and the cellobiohydrolase Cel7A [151, 152, 154]. The solved 3D structures of these CBMs reveal that they share a similar overall fold [145, 174]. In addition, structural
and mutational work has shown that the three exposed aromatic residues on the flat binding
surfaces of the CBMs are important for binding [152, 173, 175, 218, 219]. However, the two
CBMs show different binding affinities for cellulose and it has been proposed that this difference
depends to a large degree on a single amino acid substitution on the flat binding surface [151].
Furthermore, substitution of the CBM in Cel7A with the CBM from Cel7B demonstrated that an
increased binding to cellulose of the hybrid enzyme could be linked to an increase in cellulose
hydrolysis [236].
The CBMs from C. fimi are mainly classified into family II and IV [36, 269]. The modules in
these families are found only in bacteria and are larger than those in family I (100-150 residues).
One of the most studied CBMs is the family II CBM from the C. fimi enzyme CfXyn10A which
21

Table 3. A list of CBM families, in accordance with the generally accepted classification system [36, 95,
269]. The CBMs in this table include those in which binding to cellulose and/or hemicellulose has been
indicated. References give examples of structural and functional studies
.
Familiesa Entriesb
Ligandsc
Binding
Amino
Catalytic modules Reference
surfaces
acids
attached c

87

Cellulose
Chitin

Flat

30-40

II

94

Cellulose
Xylan

III

61

Cellulose
Xylan

Flat

150

IV

18

Groove

150

71

Flat

60

VI

32

Cleft

120

IX

16

Slot

170

11

Cellulose
Cellulose (Der.d)
-1,3/1,4 Glucan
Oligosaccharides
Cellulose
Chitin
Cellulosa
Xylan
-1,3/1,4 Glucan
Oligosaccharides
Cellulose
Xylan
-Glucan
Oligosaccharides
Monosaccharides
Cellulose

Flat

45

XI
XV

3
2

XVII

XXII

41

XXIII

XXVII

XXVIII

XXIX

Flat (IIa)
Twisted (IIb)

100

Mannanase
Xylanase
Cellulase
Esterase
Cellulase
Xylanase
Chitinase
Mannanase
Xylanase
Cellulase
Xylanase
Cellulase
Cellulase
Chitinase
Xylanase
Cellulase
Esterase
Chitinase
Xylanase

[145, 152]

[231, 288]
[271]
[42, 132]

[43]
[66]

[34, 202]

180-200
160

Xylanase
Mannanase
Cellulase
Cellulase
Xylanase

[168]
[189,250]

200

Cellulase

[33, 201]

150

Xylanase

[52]

230

Mannanase

[237]

N.D.

180

Mannanase

[247]

Cellulose
N.D.
-1,3/1,4 Glucan
Oligosaccharides
Cellulose (Der.d) N.D.
Mannan

190

Cellulase

[35]

Non-catalytic

[87]

Cellulose
N.D.
Xylan
Groove
Oligosaccharides
Cellulose
Groove
Cellulose (Der.d) (shallow)
-Glucan
Oligosaccharides
Xylan
Groove
-1,3/1,4 Glucan
Oligosaccharides
Mannan
N.D.
Mannan

130-140

[215]

CBM families are typed in Roman numerals, to distinguish them from the glycoside hydrolase families
Based on those available at http://afmb.cnrs-mrs.fr/~cazy/CAZY/index.html [63]
c
This list is not complete, only some examples are included
d
Cellulose derivatives
b

22

display mixed glucanase/xylanase activity [97, 98, 288]. This CBM displays a ligand-binding
area somewhat resembling the flat surface in family I CBMs [288], and it has been shown to bind
tightly to cellulose [97]. Furthermore the hydrolysis of cellulose by CfXyn10A increases in the
presence of the attached CBM [98]. In constrast, another family II CBM from C. fimi module has
been proposed to promote non-hydrolytic disruption of cellulose surfaces, independent of the
catalytic module [74]. Family II has been divided into two subfamilies, on the basis of the preferred binding ligand: family IIa modules bind to cellulose and family IIb modules bind to xylan
[97, 231]. Remarkably, site-directed mutagenesis of a single amino acid residue on a family IIb
CBM changed its binding specificity from xylan to cellulose [232]. The two tandem family IV
CBMs in the C. fimi endoglucanase Cel9B bind to amorphous cellulose and oligosaccharides
[133, 265].
Cellulose-binding CBMs from family II and family X are ubiquitous among polysaccharidedegrading enzymes from P. cellulosa, and are found in both cellulases and several types of
hemicellulases [114]. In P. cellulosa, cellulose-binding CBMs from both cellulases and
hemicellulases have been shown to influence hydrolytic activity [28, 29, 109]. In some cases, two
CBMs are connected to the same enzyme. For example, the P. cellulosa xylanase Xyl10A contains one family II CBM and one family X CBM which bind to cellulose apparently independent
of each other [99].

Galactoglucomannan-degrading enzymes
Due to the complex chemical structure of hemicelluloses, multiple enzymes are often needed for
the complete degradation of these polymers. In the case of O-acetyl-galactoglucomannan, four
different glycoside hydrolases (-mannanase, -mannosidase, -galactosidase and -glucosidase)
and acetyl esterase are required for the complete conversion of the polymer into unsubstituted
monosaccharides (Figure 7). -Mannanase is the major endo-acting enzyme involved in
galactoglucomannan degradation [26, 180, 243]. This enzyme degrades the polymer into smaller
oligosaccharides, which are further hydrolysed to monosaccharides by -mannosidase, -galactosidase and -glucosidase.

Figure 7. Schematic overview of the enzymes involved in degradation of O-acetyl-galactoglucomannan.

23

-Mannanase
Biochemical properties
Endo--1,4-D-mannanase (-mannanase; EC 3.2.1.78) catalyses the random hydrolysis of mannoglycosidic bonds in mannan-based polysaccharides. Most -mannanases degrade mannooligosaccharides down to a DP of 4 [26, 180, 243]. In addition, some -mannanases are also
active on mannotriose, although at a much lower rate, thus indicating the presence of at least 4
subsites in several -mannanases [7, 112]. However, hydrolysis of oligosaccharides by some mannanases from anaerobic fungi and bacteria has indicated that binding is required over at least
6 subsites [82, 110, 190]. The main end-products of mannan hydrolysis by -mannanase are often
mannobiose and mannotriose [3, 57, 225, 245, 273], although minor amounts of mannose and
mannotetraose also are produced in some cases [273]. In the degradation of heteromannans, the
pattern of released oligosaccharides is often more complex, probably due to hindrance of the
enzymatic hydrolysis caused by the substituents [182, 210, 240, 259]. It has also been shown that
at least some -mannanases are capable of degrading crystalline mannan (Paper III).
In addition to hydrolysis, several -mannanases can also perform transglycosylation [62, 107,
111]. For example, the T. reesei -mannanase has been shown to form transglycosylation products with either mannose or mannobiose as glycosidic bond acceptors [111].
The pH and temperature optima of some -mannanases are shown in Table 4. Generally, mannanases have moderate temperature optima (40-70 C), except some -mannanases from
thermophiles which have higher temperature optima [93, 205, 209, 248]. The pH optima of most
-mannanases are found in the neutral or acidic region. Commonly, the molecular weights of mannanases are in the range of 30-80 kDa (Table 4).
However, some modular -mannanases have molecular weights near or above 100 kDa [46, 239,
248]. Typically, most -mannanases have isoelectric points between 4 to 8. Frequently, multiple
-mannanases with different isoelectric points and/or molecular weights are found in the same
organism [4, 125, 172, 190, 245, 270]. In some cases these enzymes are produced from different
genes [172, 190, 199], and in other cases, the enzymes are isoforms produced from the same gene
[4, 244]. These isoforms may be caused by differences in post-translational modifications.

24

Table 4. Some properties of -mannanases from families 5 and 26

Organism
Agaricus bisporus C54-carb8
Agaricus bisporus D649
Aspergillus aculeatus c
Aspergillus niger
Bacillus circulans K-1
Caldibacillus cellulovorans d
C . saccharolyticus d
Clostridium cellulovorans d
G. stearothermophilus
Mytilus edulis
Lycopersicon esculentum
Streptomyces lividans 66
T&. polysaccharolyticum
Thermotoga maritima d
Trichoderma reesei
Vibrio sp. Strain MA-138
Bacillus sp. 5H
Bacillus sp. strain AM-001
Bacillus subtilis NM-39
C .saccharolyticus Rt8B.4 d
Cellulomonas fimi
Clostridium thermocellum d
Clostridium thermocellum F1
Dictyoglomus thermophilum d
Piromyces sp.d
Piromyces sp.
Piromyces sp.
Pseudomonas cellulosad
Rhodothermus marinus
$

Swissprota
Q9P893
Q92401
Q00012
O66185
Q9RFX5
P22533
O48540
P51529
Q9ZA17
Q9X0V4
Q99036
O69347
O83011
P166699
P55278
P77847
Q9XCV5
O30654
P55296
P55297
P55298
P49424
P49425

Mw$

Family
5
5
5
(5) *
5
5
5
5
5
5
5
5
5
5
5
5
26
26
26
26
26
26
26
26
26
26
26
26
26

N.D.
44.9 b
45
40
62
30.7 e
34 e
38
73
39
39 b
36
116
76.9 b
51-53
49
37
58
38
N.D.
100
70 g
55 h
40
68
N.D.
N.D.
46
113

N.D.
N.D.
4.5
3.7
Several
N.D.
N.D.
N.D.
N.D.
7.8
5.3 b
3.5
N.D.
N.D.
Several
3.8
N.D.
5.9
4.8
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D
N.D.
f

Molecular weights in kDa. Data from SDS-PAGE

sequence

Optima

pI
pH

Temp

N.D.
N.D.
5
3.5
6.9
6e
6
7
5.5-7.5
5.2
N.D.
6.8
5.8
7
3-4
6.5
N.D.
9
5
6-6.5
5.5
6.5e
7h
5
N.D.
N.D.
N.D.
7
5.4

N.D.
N.D.
60
N.D.
65
85 e
80
45
N.D.
50-55
N.D.
58
65/75 f
90
70
40
N.D.
60
55
60-65
42
65 e
75 h
80
N.D.
N.D.
N.D.
N.D.
85

Two optima observed

From Western blot
h
Lacking the dockerin module

Caldocellulosiruptor
&
Thermoanaerobacterium

Geobacillus

*
Similarity from N-terminal
a
Shown when available
b

Theoretical value from the amino acid sequence

Expressed in S. cerevisae
d
Expressed in E. coli
e
Catalytic module only
c

25

Reference
[256]
[289]
[56]
[3]
[293, 294]
[248]
[94, 160]
[255]
[78, 252]
[287](PaperV)
[25]
[15]
[46]
[205]
[244, 245]
[253, 254]
[140]
[4, 5, 7]
[186, 187]
[92]
[239]
[110]
[147]
[93]
[82]
[190]
[190]
[40]
[209]

Occurrence and regulation

-Mannanases have been isolated from a wide range of organisms, including bacteria [7, 40,
239], fungi [3, 56, 245], plants [25, 172] and animals (Paper V) [53]. Amongst bacteria, mannanases have been found amongst aerobes, anaerobes and different extremophiles such as
thermophiles, halophiles and psycrophiles [205, 274, 296]. Most -mannanases are extracellular,
however some appear to remain attached to the cell [91]. In plants, -mannanase activity has
been correlated with seed germination [77, 199, 200], and in some cases also with fruit ripening
[24, 38]. Some -mannanases from molluscs have been isolated from their digestive tract (Paper
V) [85].
Expression of many microbial -mannanases is induced by growth on mannan or galactomannan
[3, 13, 221]. -Mannanases from some microbes, including T. reesei, have also been produced by
growth on cellulose [221, 242]. However, expression of the T. reesei -mannanase is repressed on
glucose and several other monosaccharides [170, 228]. In plants, production of -mannanase has
been shown to be regulated by plant hormones, such as gibbrellins and abscisic acid [10, 104]

Family classification and structural determination

All -mannanases for which the genes have been cloned have been classified into families 5 or 26
of glycoside hydrolases [115, 119]. Both of these families are included in the GH-A clan of
glycoside hydrolases [32, 131] and the retaining mechanism has been confirmed for family 5 and
family 26 -mannanases [3, 32, 112]. Both bacterial and eukaryotic -mannanase have been
annotated to family 5. This family also includes endo- and exoglucanases, xylanases and
endoglycoceramidases. An alignment of the amino acid sequences of some family 5 -mannanases
mainly from eukaryotic sources is shown in Figure 8.
With the exception of a few anaerobic fungi, the -mannanases in family 26 are of bacterial
origin. Besides -mannanases, some endoglucanases and a few -1,3-xylanases are also found in
this family. In some cases, -mannanases from the same genus have been classified in different
families; -mannanases from different strains of Caldocellulosiruptor saccharolyticus have been
classified in both families 5 and 26 [92, 94], and those from different Bacillus species are also
found in both families [5, 187].

26

Figure 8. Sequence alignment of some -mannanases from family 5. The residues conserved within family
5 are boxed. Conserved (*) and similar residues (:) are indicated in the consensus line. For references, see
Paper VII (Figure 2).

27

The structures of two family 5 -mannanases those from T. reesei and T. fusca have been
determined by X-ray crystallography [121, 223]. The structures of the T. reesei and T. fusca mannanases share the overall (/)8 fold, which is conserved in clan GH-A (Figure 9). Interestingly, the T. reesei -mannanase also contained two additional -sheets which are not conserved
in other (/) 8 enzymes. Furthermore, four glycosylation sites are occupied with Nacetylglucosamine residues (Figure 9).
The active site in the -mannanase structures is located in a shallow cleft exposed to the solvent.
Within the active site, at least seven amino acids conserved in other family 5 enzymes (Figure 8)
are present. In the T. reesei -mannanase these correspond to Arg54, Asn168, Glu169, His241,
Tyr243, Glu276 and Trp306 [223, 244]. Structures of the T. fusca and T. reesei enzymes with
oligosaccharides bound their active site clefts have also been solved [121, 223]. These structures
reveal the presence of several substrate-enzyme interactions in the -2 and -3 (T. fusca) and +1 and
+2 (T. reesei) subsites. The structure of the family 26 -mannanase ManA from Pseudomonas
cellulosa has also been solved recently [124]. As expected, this -mannanase also exhibits the (/
)8 fold and the conserved positions of the catalytic residues in clan GH-A. Very recently, the
crystallisation of the family 5 -mannanase (studied in Paper V) from blue mussel was also
reported [286].

Figure 9. The structure of the catalytic module of family 5 -mannanase (TrMan5A) from T. reesei [223]. Helices are shown in gold, -sheets in light blue. The predicted acid/base and nucleophile residues are
shown in red and blue, respectively. The four N-acetylglucosamine residues are shown in green.

28

Modular -mannanases
Several -mannanases display a modular architecture (Figure 10). Amongst -mannanases from
aerobic fungi, the enzymes from T. reesei and A. bisporus are composed of a family 5 catalytic
module linked to a family I CBM [244, 256, 289]. Some bacterial -mannanases from families 5
and 26 have more complex structures: the C. fimi -mannanase Man26A contains both a mannanbinding family XXIII CBM, a putative SLH-module and a module of unknown function [237,
239, 240]. The family 5 -mannanase from Thermoanaerobacterium polysaccharolyticum also
contain an SLH-module and, in addition, two internal family XVI CBMs [46]. Several mannanases from anaerobic bacteria and fungi contain dockerin modules which attach the mannanases to multienzyme complexes [82, 110, 190, 255]. A family 26 -mannanase from
Caldocellulosiruptor saccharolyticus contains two family XXVII mannan-binding modules [247].

Figure 10. A schematic picture of the modular organisation in some -mannananses. Catalytic modules are
shown as boxes, CBMs as ellipses. Other modules are shown as pentagons. The -mannanases are those
from Trichoderma reesei [244], Agaricus bisporus [256], Cellulomonas fimi [239] Thermoanaerobacterium
polysaccharolyticum [46], Caldocellulosiruptor saccharolyticus [247] and Caldibacillus cellulovorans [248].

29

Applications
-Mannanases have several existing and potential industrial applications. They have been shown
to be effective in increasing the brightness of pulps in bleaching experiments [45, 192, 249, 280],
most notably in combination with xylanases [45, 58]. In the food and feed industries, -mannanases
are used in the production of fruit juices and soluble coffee [102, 108, 224], and also in the
preparation of poultry diets [128]. -Mannanases have also been shown to have a strong potential
as viscosity reducers of hydraulic fracturing fluids used in oil and gas production [183]. Furthermore, -mannanases have potential applications in recycling of copra and coffee wastes [216].

Exo-acting enzymes
-Mannosidase
-Mannosidase (EC 3.2.1.25; -1,4-D-mannoside mannohydrolase) catalyses the hydrolysis of
mannose units from the non-reducing end of mannosides. However, some -mannosidases are
active both on glucosides and mannosides [21, 80]. The most commonly employed substrate for
analysis of -mannosidase activity is a chromogenic monosaccharide. In addition, several mannosidases are also capable of degrading longer manno-oligosaccharides, with DP over 4 [6,
12, 113]. However, only a few -mannosidases have been shown to release mannose from the
non-reducing end of mannan-based polymers [14, 122, 146] (Papers I, III and VI).
-Mannosidases have been isolated from widely different types of organisms, including eubacteria,
archaebacteria, plants, fungi and animals [12, 21, 53, 176, 239]. -mannosidase appears to carry
out different functions, depending on the producing organism. -Mannosidases from microbes
are often employed in the degradation of mannans and heteromannanas from decaying plant material for nutritional purposes. -Mannosidases in plants are involved in the release of storage
polysaccharides in the seed endosperm during germination [178]. In contrast, mammalian mannosidases appear to function mainly as lysosomal enzymes involved in degradation of protein-linked glycans. -Mannosidosis is a congenital disorder, which results from the lack of a
functional -mannosidase activity. This disease was first found in ruminants, but has more recently also been described in humans [134].
Despite their functional difference, many -mannosidases are related to each other and are classified in family 2 of glycoside hydrolases, which is included in the GH-A clan [115, 119, 131]. The
molecular weights of most -mannosidases, as determined from SDS-PAGE, are in the range 50130 kDa (Table 5). However, some -mannosidases appear to consist of several subunits [21,
204]. The isoelectric points of most -mannosidases are in the acidic range, except for some
bacterial enzymes which have isoelectric points near neutrality (Table 5). Most -mannosidases
show maximal activity at acidic or neutral pH, and with the exception of some thermophilic
enzymes, most -mannosidases show their maximal activity in the temperature range 40-70 C.
No three-dimensional structure of a -mannosidase has been determined at this stage although the
crystallisation of a T. reesei -mannosidase has been reported [11]. However, the structures of two

30

other family 2 enzymes, those of the tetrameric E. coli -galactosidase and the human -glucuronidase, have been solved [129, 130]. In the E. coli -galactosidase, the active site pocket is
situated at a subunit interface [136].

Table 5. Properties of some -mannosidases

Organism

Swissprot a

Family

Mw b

pI

Optima
pH

Aspergillus aculeatus
Aspergillus awamori
Aspergillus niger
Bacillus sp. AM-001
Cellulomonas fimi
C$. tetragonolobus
Helix aspera Mller
Helix pomatia
Homo sapiens
Polyporus sulfureus
Pyrococcus furiosus
Rhizopus niveus
Sclerotium rolfsii
Thermotoga neapolitana
Tremella fuciformis
Trichoderma reesei
Pomacea canaliculata
Trichosporon cutaneum

O741682
Q9UUZ3
O00462
Q51733
-

2
2
2
2
1
2
-

130
96-100
135
94
103
59
77.8
94
110c
64
59
N.D
57.5
95
140
105
90
114

4
4.55
5
5.5
N.D.
9.4
N.D.
4.7
4.7 c
3.9
6.9
N.D.
4.5
5.6
N.D.
4.8
4.3
N.D.

2
3.8
2.5-5
6
7
5-6
3.3
4
4.5 c
2.4-3.4
7.4
5
2.5
7.7
5
3.5
5
6.5

Ref

Temp
70
66
70
50
55
52
37-42
55
N.D
N.D.
105
40
55
87
N.D.
N.D.
45
40

[12, 251]
[195]
Paper I & II
[6]
[239]
[176, 181]
[53]
[177]
[9, 127]
[275]
[21]
[113]
[106]
[204, 205]
[235]
[146]
[122]
[203]

Swiss-prot accession numbers are shown when available

Molecular weights in kDa. Data from SDS-PAGE (i.e. monomer size)
c
Determined from -mannosidase isolated from human placenta
$
Cyamopsis
b

Other exo-acting enzymes

-Galactosidase (EC 3.2.1.22) cleaves -(16)-linked non-reducing galactose residues. These
enzymes have been classified into families 4, 27, 36 and 57 of glycoside hydrolases [115].
Eukaryotic -galactosidases are found in family 27 and most of the bacterial -galactosidases are
found in families 4 and 36 [1]. In hemicellulose degradation, -galactosidases release galactosyl
side-groups from oligomeric and polymeric mannan substrates. Some of the -galactosidases in
family 27 can release galactose from polymeric substrates [2]. However, most of the galactosidases in family 36 lack this ability [2, 159].
-Glucosidase (EC 3.2.1.21) catalyses the hydrolysis of non-reducing terminal glucose residues.
Most -glucosidases have been classified into families 1 and 3 of glycoside hydrolases [290]. Glucosidase is an ubiquitous enzyme found in most types of organisms. In hemicellulose degradation, -glucosidase releases non-reducing end glucose from oligosaccharides released by 31

mannanase. In a few cases it has been shown to release glucose residues from polymeric
glucomannan (Paper VI). -Glucosidase is also important in the degradation of cellulose; it degrades cellobiose released by cellobiohydrolase and endoglucanase
In addition to glycoside hydrolases, acetyl esterases also participate in the degradation of
acetylated heteromannans. Acetyl esterase catalyses the hydrolysis of acetyl groups from various
substrates. In the context of hemicellulose degradation, most studies on deacetylation have been
conducted with acetylxylan esterase [26]. However, a few examples of acetyl esterases active on
acetylated mannans have been reported [210, 260, 261].

32

Present investigation
Outline
In this text, the results from Papers I-VII of the thesis are presented and discussed (see List of
papers, page 5). The text is divided into four parts:
In the first part (Mannan-degrading enzymes), the major enzymes studied in this work are
presented. The enzymatic characterisation (Paper I) and cloning (Paper II) of a -mannosidase
(AnMan2A) is presented. Next, the characterisation of a -mannanase (MeMan5A) from blue
mussel is described (Paper V). After this, the modular organisation of the -mannanase (TrMan5A)
from T. reesei is presented (Papers IV and VII). Finally, the expression of TrMan5A in T. reesei
(Paper IV) and Pichia pastoris (Paper VII) is described.
In the second part of the text (The CBM of TrMan5A), the characterisation of the CBM from
TrMan5A is presented (Paper IV). In this work, the binding properties of the CBM was studied
and its influence on the catalytic performance of this enzyme was investigated. Furthermore the
possible role of cellulose-binding modules in -mannanases is discussed.
The third part (The catalytic module of TrMan5A) describes the mutagenesis of specific amino
acids in the active site cleft of the TrMan5A catalytic module (Paper VII).
In the fourth part (Mannan-hydrolysis), the specificities in mannan-hydrolysis of several
hemicellulases are discussed (Papers I, III, VI, V and VI). The hydrolysis of mannan and
heteromannans by AnMan2A is presented (Papers I and VI). In addition, the hydrolysis of crystalline mannan by -mannanase and -mannosidase is described (Paper III). Finally, the degradation of different heteromannans by hemicellulases and cellulases is compared (Paper VI).

33

Mannan-degrading enzymes
Aspergillus niger -mannosidase, AnMan2A
Aspergillus niger produces several enzymes involved in hemicellulose degradation [1, 86]. In
this work a -mannosidase isolated from A. niger was purified and characterised (Paper I). In
accordance with the recommended nomenclature for glycoside hydrolases [120], this enzyme is
referred to as AnMan2A (it has earlier been called Mnd2A). The investigation of the molecular
organisation and the enzymatic specificity of AnMan2A which has been conducted in this work
(Papers I, II, III and VI) reveals some interesting features which are discussed in this section and
later (see pages 45, 46 and 48).
In this work, AnMan2A was purified to homogeneity in three steps (Paper I). The molecular
weight of the purified enzyme was analysed by gel filtration and SDS-PAGE. Interestingly, the
results suggest that the -mannosidase is a homodimer. This is an unusual observation since most
other -mannosidases analysed to date are monomeric. Only in a few previous cases have oligomeric -mannosidases been described [21, 204]. One example is the tetrameric -mannosidase
from Pyrococcus furiosus [21].
Furthermore, an investigation of the enzymatic properties of AnMan2A showed that this enzyme
is able to degrade manno-oligosaccharides (Paper I). The standard substrate used in many mannosidase studies is a small substrate composed of a chromophore linked to a mannosyl residue. In this work we showed that oligosaccharides up to a DP of 6 are degraded by AnMan2A
(Paper I). An assessment of the activity of AnMan2A on longer saccharides was not made. However, as will be described later (see page 45) AnMan2A was also active on polymeric mannan
substrates. Thus, it can be speculated that AnMan2A probably also degrades longer
oligosaccharides. AnMan2A was also active on galactosyl-substituted manno-oligosaccharides
(Papers I and II). However, galactosyl groups appear to pose some restrictions on AnMan2A,
since hydrolysis is blocked at the point of the first substituent. Degradation of oligosaccharides
above DP 3 and galactosyl substituted substrates has previously only been reported for a few mannosidases [6, 12, 113, 240].
Further in this work, the gene encoding AnMan2A was cloned (Paper II). Most -mannosidase
genes analysed previously have been isolated from mammals (Bos taurus, Mus musculus, Homo
sapiens, Capra hircus) and bacteria (C. fimi, Thermotoga maritima, Thermotoga neapolitana) [9,
22, 54, 148, 205, 239]. Apart from the -mannosidase from the archaeon Pyrococcus furiosus
which has been assigned to family 1 [21], all -mannosidases with known sequences have been
classified into family 2. In the present case, AnMan2A was assigned to family 2 of glycoside
hydrolases on the basis of sequence analysis (Paper II). Besides man2A, the only previously
described gene encoding a fungal -mannosidase was isolated from Aspergillus aculeatus [251].
The catalytic acid and nucleophile of AnMan2A were predicted to be Glu479 and Glu584, respectively (Paper II). The only experimentally identified catalytic residue among -mannosidases
is the catalytic nucleophile (Glu519) in the -mannosidase from C. fimi, which was identified by
mass-spectrometry using a mannosyl fluoride inhibitor [238]. Analysis of the AnMan2A sequence

34

also revealed 13 putative N-glycosylation sites (Paper II). The presence of N-linked glycans was
also indicated by enzymatic deglycosylation of AnMan2A, which yielded a decrease in molecular weight of the enzyme (Paper I).

The M. edulis -mannanase, MeMan5A

Both in terms of species and individuals, the molluscs (Phylum Mollusca) constitute one of the
largest groups of animals and display a wide diversity in terms of feeding habits [65]. Filterfeeding mussels (Polysyringia) are a group of molluscs which thrive on microscopic algae and
dissolved organic matter. As part of their digestive system, these organisms produce digestive
enzymes which are secreted into the stomach from a style sac [212]. Several polysaccharidedegrading enzymes, including cellulases and amylases, have been found in the digestive tract of
filter-feeding mussels [212], but there has been no previous report on -mannanases in these
organisms. In this work (Paper V), -mannanase from the common blue mussel (Mytilus edulis)
was purified and characterised. Two -mannanase variants with approximately similar molecular
weights and isoelectric points were identified. Both variants also had similar pH and temperature
optima (Paper V). Furthermore, the N-terminal sequences of both variants were identical and
showed significant similarity to two unclassified -mannanases from the molluscs Littorina
brevicula and Pomacea insularus [291, 292].
Very recently the corresponding -mannanase gene was cloned [287]. Sequence analysis revealed
similarities to family 5 of glycoside hydrolases and the encoded gene product will hereafter be
referred to as MeMan5A. Furthermore, since the gene was isolated from a tissue separate from
the digestive tract, possible contaminations from organisms inhabiting these organs were avoided
and unequivocal proofs of the endogenous nature of the -mannanase was gained. Variants of mannanases apparently encoded by one gene have been observed in several other organisms,
including T. reesei [244]. For other organisms different -mannanases appear to be encoded by
several genes [172, 190].
The hydrolysis of manno-oligosaccharides by MeMan5A was analysed in this work (Paper V).
MeMan5A showed no activity on manno-oligosaccharides of DP up to 3. Moreover, mannotetraose
was degraded at a lower rate than mannopentaose. Thus, it was concluded that binding in at least
five subsites is probably required for optimal activity. It was recently reported by others that crystals
of this -mannanase has been obtained [286]. A 3D structure of this enzyme will possibly provide
some information about the specific enzyme-polysaccharide interactions in the active site cleft.
Mannan-degrading enzymes have previously been found in several other types of molluscs. A
majority of these have been isolated from snails [53, 85, 122, 177, 246]. Due to the variability of
molluscs in terms of nutrition, it is tempting to believe that these enzymes are used for different
purposes. In the case of M. edulis it could be speculated that the -mannanase participate in the
degradation of mannan from algal cell walls [88, 156, 208].

The modular T. reesei -mannanase, TrMan5A

The filamentous fungus T. reesei is a potent producer of hemicellulose-degrading enzymes involved in the degradation of different mannans and xylans [26]. One of the major hemicellulases
35

produced by this fungus is a -mannanase (TrMan5A), which is expressed in media containing

cellulose and galactomannan [221, 242]. Previously it was shown that several -mannanase
isoforms with different molecular weights and isoelectric points are produced by T. reesei [245].
Later, a -mannanase encoding gene (man1) was isolated from T. reesei and it was concluded that
the different isoforms are products of the same gene [242, 244]. Thus, it was suggested that the
isoforms are likely to differ mainly in their patterns of glycosylation or other types of post-translational modifications. Analysis of the -mannanase sequence suggested that it is a modular en
zyme comprised of a N-terminal catalytic module and a C-terminal CBM connected by a Ser/
Thr/Pro rich linker sequence. On the basis of sequence alignment and hydrophobic cluster analysis the catalytic module was classified into family 5 of glycosyl hydrolases according to the
classification by Henrissat et al [115]. The C-terminal module showed extensive sequence similarity with CBMs from T. reesei cellulases and was classified [244] into family I according to the
classification of Tomme et al. [269].
TrMan5A appears to be specific for mannosidic linkages [244, 245]. Furthermore, in the present
work, no hydrolysis was observed when TrMan5A was incubated with cellulose or cellooligosaccharides (unpublished results).
In this study (Papers III, IV, VI and VII), the functions of the two modules of the T. reesei mannanase TrMan5A were investigated. In order to study the properties of the modules, a mutant
lacking the C-terminal CBM (TrMan5ACBM), was constructed, and expressed in T. reesei as
described below (Paper IV). The full-length enzyme was also expressed under the same conditions and both enzymes were purified to electrophoretic homogeneity. Furthermore, several mutants of specific amino acids in the active site of TrMan5ACBM were expressed in Pichia
pastoris and characterised, along with the wild type TrMan5ACBM (Paper VII).
Homologous expression in T. reesei. As stated earlier, T. reesei is a very efficient producer of
secreted enzymes and was thus an attractive candidate as a host for gene expression of TrMan5A.
Furthermore, since T. reesei is the native host of TrMan5A, correct processing of the enzyme is
more likely. Since T. reesei is utilised as a host for heterologous expression [206], several methods
for transformation of foreign genes into T. reesei have been developed [164], which can be employed also for the expression of homologous proteins. The main problem posed for expression of
mutated homologous enzymes, such as TrMan5ACBM, is to avoid the expression of the endogenous chromosomal gene. However, it has been shown that -mannanase expression in T. reesei is
repressed when it is grown in a medium with glucose as the sole carbon source [170]. Furthermore,
it is known that genes under the control of the Aspergillus nidulans glyceraldehyde phosphate dehydrogenase (gpdA) promoter are constitutively expressed in the presence of glucose [211].
Thus, in this work, the gpdA promoter was utilised for expression of mutants of T. reesei mannanase (Paper IV), as has been done previously with other glucose-repressed enzymes [59,
207]. The expression of TrMan5A and TrMan5ACBM in T. reesei under the control of the gpdA
promoter was successful and enzyme yields of approximately 5 mg/ml were obtained (Paper IV).
Furthermore, the culture filtrate was composed of a limited number of proteins and protein purification was thus facilitated. Pure enzyme preparations were isolated in one or sometimes two
chromatographic steps.
Expression in Pichia pastoris: Traditionally, Saccharomyces cerevisae has been the model
organism for yeast expression and also used for heterologous expression. In this specific case,
36

TrMan5A was previously expressed in S. cerevisae but the enzyme yield was very low [244]. The
molecular weight of TrMan5A expressed in S. cerevisae was higher (75 kDa) than that of the T.
reesei expressed enzyme (52-54 kDa) and it was suggested that the enzyme was likely to be
overglycosylated [242]. Expression of a -mannanase from Aspergillus aculeatus also resulted in
a higher molecular weight compared to the enzyme expressed in the wild-type organism [229].
Expression in the methylotrophic yeast P. pastoris shares many of the advantages of S. cerevisae,
such as high expression yields of extracellular enzymes and simple techniques for molecular
genetic manipulations. Furthermore, P. pastoris has been reported to attach glycans of lower
molecular weight than those found in S. cerevisae [103].
In the present case, an expression system which utilises the alcohol oxidase promoters in P. pastoris
was used. This promoter is strongly induced when the organisms are grown on methanol as sole
carbon source. In this work, TrMan5ACBM and a number of mutants thereof were expressed
and secreted by P. pastoris using the native signal sequence from the T. reesei enzyme (Paper
VII). The expression levels were approximately 10 mg/ml and pure enzyme preparations were
achieved after two chromatographic steps

The CBM of TrMan5A

Sequence and structure
Family I CBMs are common among polysaccharide-degrading enzymes from T. reesei and other
fungi. A majority of the T. reesei cellulases carry family I CBMs either at their N- or C-termini
[155, 257]. Amongst T. reesei hemicellulases, family I CBMs have been found only in TrMan5A
[244] and an acetyl xylan esterase [171]. However, family I CBMs have also been found in some
xylanases from Humicola insolens [68] and in -mannanases from Agaricus bisporus [256, 289].
The C-terminal family I CBM of TrMan5A is proposed to be composed of 37 amino acids [242].
Figure 11 shows a sequence alignment of the CBM from TrMan5A with several other family I
CBMs derived from T. reesei endoglucanases and cellobiohydrolases. The three aromatic residues
which are exposed on the flat binding surface in the structure of TrCel7A (Figure 12a) are conserved in this alignment in TrMan5A these residues correspond to Tyr378, Trp403 and Tyr404.
The importance of these conserved aromatic residues in several family I CBMs linked to T. reesei
cellulases has been extensively studied by site-directed mutagenesis [151-153, 218, 219].

Figure 11. Sequence alignment of family I CBMs from TrMan5A and a number of T. reesei cellulases. The
three conserved aromatic residues are boxed. Identical residues are also indicated (). The numbers of the
amino acids at the N- and C-termini are shown. Adapted from [244].

37

Based on the structure of the CBM from TrCel7A [145], the structures of the CBMs of the T.
reesei cellulases TrCel6A, TrCel7B, TrCel45A and TrCel5A were studied by molecular dynamics
and were predicted to display a relatively similar structure [123]. Subsequently, the structure of
the CBM from TrCel7B was solved and the similarity with the CBM from TrCel7A was validated
[174]. In the current study, a model of the CBM from TrMan5A was generated using the program
Swiss-PdbViewer [105]. The modelling was based on the structure of the CBM from TrCel7A
[145]. As seen in Figure 12b, the flat surface from the CBM of TrCel7A is preserved in this
model. Interestingly, two bulky tyrosines protrude from the surface on the rough side of the CBM
model. One of these tyrosines (Tyr399) is present in a roughly similar position in the TrCel7B
structure [174]. The other tyrosine (Tyr402) appears to be unique for TrMan5A as no counterpart
could be found in an extensive sequence alignment [222]. However, it should be pointed out that
this is a preliminary model. The positions of these two residues and their possible involvement in
polysaccharide binding need to be further studied.

Binding properties of the CBM

Binding to cellulose and kraft fibers with TrMan5A has been observed previously [3, 90, 258],
and it was postulated that this binding is mediated by the C-terminal CBM [242]. In this work, the
quantitative and qualitative binding properties of the CBM were studied (Paper IV). TrMan5A
and TrMan5ACBM were incubated with cellulose and the amount of free enzyme was analysed. Only TrMan5A adsorbed significantly to cellulose and it could thus be inferred that the
binding of TrMan5A to cellulose is indeed mediated by its C-terminal CBM.
The binding of TrMan5A to cellulose was also visualised by immuno-gold labelling (Figure 13).
Again, TrMan5A and TrMan5ACBM were incubated with cellulose. After several washes and
incubations with primary antibodies and protein A conjugated to gold-particles, the cellulose
samples were analysed by transmission electron microscopy. As seen in Figure 13, cellulose
microfibrils incubated with TrMan5A were more strongly labelled in comparison with those incubated with TrMan5ACBM.

38

Figure 12. a. Structure of the CBM from TrCel7A. b. Model of the CBM from TrMan5A, based on the
structure of the CBM from TrCel7A. The numbers of the aromatic residues on the flat sides of the CBM
from TrCel7A and the model of the TrMan5A CBM are indicated. The numbers of the tyrosines on the
rough side of the model of the CBM from TrMan5A are also indicated.

39

Figure 13. Visualisation of the adsorption of TrMan5A to ribbons of bacterial cellulose by gold labelling
and transmission electron microscopy. Electron micrographs of cellulose labelled with TrMan5A (a) and
TrMan5ACBM (b) are shown.

40

A quantitative comparison of cellulose binding with a T. reesei cellulase carrying a family I CBM,
TrCel7B, was made (Paper IV, Figure 4). Analysis of the binding permitted an estimation of the
relative binding constant (Kr) for the two enzymes. The results showed that the values of this
constant were fairly similar with TrCel7B (1.05) and TrMan5A (0.84). This similarity indicates
that the C-terminal CBM is a true cellulose-binding CBM. Thus, it can be suggested that TrMan5A
shares some of the properties which have been observed in other family I CBMs.
An investigation of the binding of TrMan5A toward mannan-based polysaccharides was also
conducted (Paper IV). Earlier, a Clostridium thermocellum -mannanase was shown to bind insoluble mannan [110]. Furthermore, the -mannanase Man26A from Cellulomonas fimi and a mannanase from Caldicellulosiruptor saccharolyticus were shown to bind to soluble galactomannan
via mannan-binding modules from families XXIII and XXVII, respectively [237, 247]. In contrast, no binding of TrMan5A to insoluble mannan, soluble galactomannan and crystalline mannan
was detected in the current work (Paper IV). However, TrMan5A did bind to a mannan sample
which contained some cellulose (Paper IV, Figure 6b). This mannan/cellulose complex had been
isolated from ivory nut and contained approximately 15 % cellulose. Further binding analysis
with an in vitro mixture of mannan and cellulose, suggested that TrMan5A binds to the cellulose
component in this mannan/cellulose complex (Paper IV).

Effect on hydrolysis
In cellulose degradation, cellulose-binding CBMs are very important for efficient hydrolysis [98,
109, 267, 276]. In particular, several family I CBMs have been shown to increase the activity
towards insoluble cellulose substrates [155, 257]. The effect of hemicellulase-linked CBMs has
been investigated only to a limited extent and most studies have been related to xylan degradation. The presence of cellulose-binding CBMs have been shown to influence the hydrolysis of
complex cellulose/xylan substrates by a xylanase and an arabinofuranosidase from P. cellulosa
[28, 29, 99]. Also, xylan-binding CBMs from family VI and XXII have been shown to potentiate
the hydrolysis of insoluble but not soluble xylan by xylanases from Clostridium thermocellum
[52, 84]. Amongst -mannanases, the mannan-binding CBM of Man26A from Clostridium
thermocellum has been shown to increase the activity towards insoluble ivory nut mannan [110].
Furthermore, hydrolysis of soluble galactomannan by a family 5 -mannanase from
Caldicellulosiruptor saccharolyticus was reduced in the absence of the two internal family III
CBMs [92].
In the present case, the possible influence of the family I CBM of TrMan5A on the hydrolysis of
mannan substrates was investigated by comparing the catalytic activity of TrMan5A and
TrMan5ACBM on a range of mannan-containing substrates (Paper IV). Analysis of the hydrolysis of ivory nut mannan and galactomannan showed that the CBM had no effect on degradation of
either insoluble or soluble mannan. On the contrary, in the hydrolysis of a mannan/cellulose complex, an increased hydrolysis rate was observed for TrMan5A in comparison with TrMan5ACBM
(Paper IV, Figure 5b). Thus, it was concluded that the CBM has a positive influence on the degradation of this substrate under the conditions used.
Interestingly, the results from these hydrolysis experiments fit well with the data from the binding
experiments: binding of the CBM to the mannan/cellulose complex could be correlated to the
41

increase in activity towards this substrate (Paper IV, Figures 5b and 6b). In the cases where no
binding was detected, there was no influence on hydrolysis (Paper IV, Figures 5a and 6a). The
lack of influence on hydrolysis of soluble substrates agrees with what has been observed with
family I CBMs linked to cellulases where no major influence of the CBMs on hydrolysis of
soluble cellulose derivatives has been observed [155].

Why a cellulose-binding CBM on a -mannanase?

In cellulose-degrading enzymes, the presence of cellulose-binding CBMs makes clear sense since
the CBM binds to the preferred substrate of the enzyme, thus increasing the effective substrate
concentration. The rationale behind the presence of cellulose-binding CBMs in hemicellulosedegrading enzymes is more ambigious. Previous results have indicated that some cellulose-binding CBMs may promote non-hydrolytic disruption of cellulose surfaces [74]. It could be speculated that such activities of a CBM in a plant cell wall could reveal previously inaccessible parts
of the hemicellulose to mannan-degrading enzymes.
On the contrary, results with some other CBMs have shown that, when isolated, these CBMs
cannot enhance hydrolysis independently of their catalytic modules [31, 191]. Hence, it has been
suggested that the increased hydrolysis obtained with CBMs is due to an increase in effective
substrate concentration [31]. Furthermore, it has been postulated that cellulose functions as a
general receptor for CBMs of both cellulases and hemicellulases [191]. Since cellulose is a major
component in the plant cell wall it might be an easy available target for CBMs. Moreover, since
cellulose has a uniform chemical composition it is possible that it displays a large number of
similar binding sites for CBMs.
Several studies have shown that mannan and cellulose are closely associated in the plant cell wall
[227, 297]. Therefore, it could be speculated that the binding to cellulose of the CBM in TrMan5A
positions the catalytic module in the close vicinity of accessible mannan chains. There are some
indications that at least some CBMs bind to different sites on cellulose [47]. However, more
studies need to be carried out in order to assess any possible cellulose binding preferences of the
CBM from TrMan5A.
It is instructive to compare the modular structure of TrMan5A with those in other -mannanases.
CBMs have been predicted for several -mannanases from family 5 and family 26 (Figure 10).
However, only in a few cases has the binding been experimentally confirmed. In addition to
TrMan5A, family I CBMs have been indicated in the fungal -mannanases from Agaricus bisporus
[256, 289]. However, the -mannanases from Aspergillus aculeatus and A. niger appear to lack
cellulose-binding CBMs [3, 56].
Some other family 5 -mannanases have CBMs which have been classified into family III and
XVI (Figure 10). Moreover, some family 26 -mannanases, have family XXIII and XXVII CBMs
which have been shown to bind to mannan [237, 247]. However, many -mannanases from both
families 5 and 26 appear to be sole catalytic modules. Thus, at present, it is difficult to establish
any obvious patterns in modularity among -mannanases. It clearly appears as if several different
strategies in mannan-hydrolysis exists.

42

The catalytic module of TrMan5A

The active site cleft
The specificity of catalytic modules is governed mostly by its interaction with the substrate in the
active site cleft. Thus, an understanding of the function of specific amino acid residues positioned
at the active site or in its vicinity, is essential to an in-depth understanding of the function of an
enzyme. In order to pinpoint the function of a given amino acid, site-directed mutagenesis is a
powerful method which allows for comparative analyses with the wild-type enzyme. In the present
study, a number of mutants (listed in Paper VII, Table 1) of specific amino acids in the active site
of the catalytic module of TrMan5A were designed (Paper VII). The basis for the choices of
mutants was the solved structure of the catalytic module of TrMan5A, in complex with mannobiose
[223].
Figure 1 (Paper VII) shows a close up of the active site of TrMan5A, highlighting the catalytic
residues and one of the residues involved in mannobiose binding. As predicted from sequence
analysis [244], the catalytic residues (Glu169 and Glu276) are positioned in the active site in the
positions conserved within family 5 of glycoside hydrolases [71, 76, 121]. Also shown in Figure
1 (Paper of VII), is the mannobiose molecule positioned in subsites +1 and +2 [223]. Interestingly, the mannose residue in subsite +2 is predicted to hydrogen bond to an arginine residue
(Arg171) [223]. The donor in this hydrogen bond is the C-2 hydroxyl of the mannose residue. The
conformation of the C-2 hydroxyl (which is axial in mannose) is the only conformatory difference from its C-2 epimer glucose (in which the C-2 hydroxyl is equatorial). Thus, the hydrogen
bond between Arg171 and the mannose residue in the +2 subsite, can potentially be an interaction
which is important in determining mannan specificity.
Previous kinetic studies on oligosaccharide hydrolysis with TrMan5A has indicated that the +2
subsite is likely to be occupied in substrate binding, at least in the case of saccharides of DP
higher than 3 [112]. Furthermore, analysis of the transglycosylation pattern of TrMan5A indicates that the enzyme can produce transglycosylation products of DP n+2 after incubation with a
substrate of DP n=5 [111]. Thus, it can be envisaged that the interaction between mannose in the
+2 subsite and Arg171 influences the rate of transglycosylation and potentially also the hydrolytic activity of the enzyme.
In summary, Arg171 is likely to be involved in substrate binding and was thus a strong candidate
for mutagenesis. In order to maintain the charge balance, a lysine mutant was constructed
(Arg171Lys). Furthermore, mutants of the catalytic residues were constructed in order to confirm
their role in catalysis. The aim was also to construct an inactive mutant for use in crystallisation
of an enzyme/substrate complex.

Characterisation of mutants
The analysis of the catalytic rate for the active site mutants constructed in this work (Paper VII)
gave interesting results. Comparison with the wild-type enzyme indicated that the Arg171Lys
43

mutant was almost equally active on polymeric galactomannan: kcat values of 262 and 241 s-1
were obtained for Arg171Lys and the wild-type, respectively (Paper VII, Table 2). However,
the apparent KM value for the mutant (1.3 g/l) was somewhat higher than the corresponding
value for the wild-type (0.59 g/l). Furthermore, a reduction in hydrolysis rate of this mutant
was observed on an oligomeric substrate (mannopentaose). It could be speculated that the catalytic activity of the mutant is impaired only on shorter substrates, and that a certain DP higher
than 5 is required for this mutant to show activity in a range close to the wild-type enzyme.
Thus, it would be interesting to study the rate of degradation of a range of oligosaccharides
with different DP.
Interestingly, an indication of a shift in the activity optimum of Arg171Lys toward a more alkaline pH was detected (Paper VII). Alkaline conditions are preferred in several industrial processes
in which cellulases and hemicellulases can be used [44]. Accordingly, there is an interest to engineering these enzymes to increase their pH optima. Several previous studies have focused on
mutating charged or polar residues in the close vicinity of the catalytic residues [23, 81]. In the
present case, the mutated residue is located at the +2 subsite. However, it is also at hydrogen bond
distance to Glu205, which is situated closer to the catalytic acid/base (Paper VII, Figure 1). However, further kinetic studies need to be carried out in order to elucidate the mechanisms behind the
observed activity pH-optimum shift.
The activities of the mutants of the predicted catalytic residues (Glu169 and Glu276) were largely
reduced (Paper VII). No activity at all was detected for these mutants, with the exception of a
mutant of the acid/base (Glu169Gln) which did display activity, albeit very low (a 25-fold decrease in kcat (Paper VII, Table 2)). The low or abolished activities of these mutants support the
postulated involvement of Glu169 and Glu276 in the catalytic mechanism. In accordance with
the current observations, previous site-directed mutagenesis of either the nucleophile or the catalytic acid/base residue of glycoside hydrolases has often resulted in a dramatic decrease in activity and frequently no activity was detected [161]. In several family 5 enzymes, the role of catalytic residues has been established by site-directed mutagenesis [20, 48, 194, 213] or by mass
spectrometry, using covalently linked inhibitors [165, 277].

Mutant Glu169Ala
A 3D-structure of an enzyme can provide important information concerning the overall structure
of the enzyme and the position of its active site. However, in order to gain knowledge about
specific substrate interactions, it is often necessary to achieve a structure of the enzyme in a
complex with a substrate analogue. As stated earlier, TrMan5A has previously been crystallised
with a substrate in subsites +1 and +2 [223]. In order to get more information about the substrate
interactions in the active site cleft, it would be of interest to crystallise TrMan5A in the presence
of a substrate which covers more subsites. In particular, a structure with a substrate residue bound
in the 1 subsite might provide information about the catalytic mechanisms of mannoside hydrolysis. However, due to the hydrolytic activity of the wild-type enzyme, there is a big risk that
the substrate is degraded in the crystallisation process. Therefore, it was of interest to construct a
catalytically inactive mutant. In this work, one of the mutants (Glu169Ala) of the catalytic acid/
base residue which did not display any catalytic activity (Paper VII) was chosen as a candidate
for crystallisation.
44

Mannan-hydrolysis
Degradation of unsubstituted mannan
In this work, the hydrolysis of unsubstituted mannan by different mannoside-hydrolases was investigated (Papers I, IV and V). MeMan5A, TrMan5A and AnMan2A were incubated with mannan and
the amount of hydrolysis was analysed. Mannan was degraded by TrMan5A (Paper IV), MeMan5A
(Paper V) and, interestingly also by AnMan2A (Paper I). The mannan used in these studies was the
ivory nut mannan extracted from seeds of Phytelephas macrocarpa. This mannan has been reported
to have a DP of 20 [184] and was shown in the current work to be free of oligosaccharides of DP
lower than 7 (Paper I). AnMan2A was capable of releasing approximately 25 % of the mannose
residues in ivory nut mannan from the non-reducing end (Paper I). The ability of -mannosidases to
degrade polymeric mannan has been studied only to a limited extent and very few previous reports
have revealed the hydrolysis of mannan by -mannosidases [14].

The main products formed after extensive hydrolysis of mannan with TrMan5A were mannobiose
and mannotriose (Paper IV). This product pattern agrees with previous reports on TrMan5A [245],
and other fungal -mannanases [3, 229]. MeMan5A also degraded mannan to mainly mannobiose
and mannotriose, but also produced significant amounts of mannotetraose (Paper V). Production
of mannotetraose has previously been reported after limited hydrolysis of ivory nut mannan with
a -mannanase from A. niger [272, 273].

Crystallisation of mannan
As stated earlier (page 16), two polymorphs of crystalline mannan are found in the native state
mannan I and mannan II [51]. These two crystal forms can also be obtained upon recrystallisation
of mannan from solution. Recrystallisation of mannan in either polymorph is dependant on the
crystallisation conditions: a high molecular weight of the polysaccharide, a high polarity of the
crystallisation medium and a low temperature favour the formation of mannan II crystals, and the
reverse conditions favour the formation of mannan I [50, 51]. In this study, mannans from ivory
nut and Acetabularia crenulata were crystallised as mannan I and mannan II, respectively (Paper
III). The morphologies of mannan I and mannan II crystals are strikingly different. Crystallisation in the mannan I form yields lozenge-shaped, laminated single crystals (Paper III, Figure 1c).
Mannan II, on the other hand, shows a ribbon-like morphology (Paper III, Figure 3).
The molecular structure of mannan I has been studied with electron diffraction and X-ray diffraction [19, 49, 88, 197]. Mannan I crystals are composed of anti-parallel sheets of mannan chains
packed with their molecular axes perpendicular to the base plane of the crystal (Figure 14). The
molecular structure of mannan II is less well known. However, based on X-ray diffraction analysis a model has been proposed [188, 295], in which the mannan chains are packed anti-parallel
within sheets which themselves are anti-parallel to neighbouring sheets.

45

Figure 14. Structure of mannan I viewed as a projection of the unit cell onto the ab plane. The unit cell
dimensions are a=8.92 , b=7.21 and c=10.27 . Adapted from [222].

Degradation of mannan crystals

In the present study (Paper III), crystals of mannan I and II were degraded by TrMan5A,
TrMan5ACBM and AnMan2A. In addition, mannan I crystals were also degraded by the A.
niger -mannanase (AnMan5A). The enzymatic degradation of the crystals was studied with
transmission electron microscopy, electron diffraction and sugar analysis. The results show that
both mannan I and mannan II crystals can be degraded with the enzymes used in this study.
However, only a limited degradation was seen with AnMan2A, especially in the case of mannan
II. Based on the results from these enzymatic degradations and the established structure of mannan
I crystals, a model for degradation of mannan I crystals by the mannan-degrading enzymes was
proposed (Paper III, Figure 6). According to this model, the initial sites of degradation by the
mannan-degrading enzymes are the corners of the crystal lamellae. After the initial degradation
of the corners, the endo-acting -mannanase will continue to hydrolyse the interior of the lamellae. -Mannosidase, on the other hand, will be unable to degrade the crystals after the initial
attack on the corner chains. Due to the antiparallel chain packing of the mannan I crystal every
other layer of mannan chains will have its non-reducing end buried in the interior of the crystal
and thus is unavailable for attack by -mannosidase (Paper III, Figure 6).

46

The proposed enzymatic attack at the crystal corners was further supported by immuno-gold
labelling with -mannanase (Figure 15). TrMan5A and TrMan5ACBM were incubated with
mannan I crystals and subsequently analysed by transmission electron microscopy. As seen in
Figure 15, the labelling appears to be clustered at the crystal corners to some extent.

Figure 15. Visualisation of the adsorption of TrMan5A to mannan I crystals by gold labelling and transmission electron microscopy. Electron micrographs of crystals labelled with TrMan5A (a) and TrMan5ACBM
(b) are shown.

47

The degradation of mannan II crystals by TrMan5ACBM altered the morphology of the crystal
samples (Paper III, Figure 4). After prolonged incubation, the ribbon-like crystallites disappeared
and a granular matrix remained. However, the electron diffraction pattern of the degraded sample
is similar to the pattern prior to degradation which is typical of crystalline mannan II. Thus, it
seems possible that the obtained granular matrix consists of undegraded mannan II crystals.

Degradation of heteromannans
In this study, the degradation of different types of heteromannans by mannoside-hydrolases was
studied (Papers I, V, VI and VII). These investigations revealed several interesting features concerning the catalytic properties of mannoside-hydrolases, in particular regarding -mannosidase.
AnMan2A was able to liberate mannose from galactomannan, glucomannan and
galactoglucomannan (Paper I and VI). Furthermore, AnMan2A also released acetyl-substituted
mannose from the non-reducing end of O-acetyl-galactoglucomannan (O-acetyl-GGM) (Paper
VI). The hydrolysis of heteromannans by -mannosidase has previously only been studied to a
very limited extent [106, 122, 146], and this is the first indication that a -mannosidase have the
ability to liberate acetyl-substituted mannose. However, as was described in Paper I, AnMan2A is
restricted by galactosyl substituents.
Degradation of heteromannans also enabled some comparisons between several -mannanases.
In these studies TrMan5A, MeMan5A and the -mannanase from C. fimi (CfMan26A) were used
(Papers V, VI and VII). Hydrolysis of LBG galactomannan by TrMan5A and MeMan5A under
assay conditions permitted an estimation of the Michaelis constant (KM) for the two enzymes
(Paper V and Paper VII). The apparent KM value for LBG obtained with MeMan5A was 3.95 g/l
(Paper V). This was considerably higher than the corresponding value obtained with TrMan5A
0.6-0.7 g/l (Paper VII, Table 2). Interestingly, the KM values for LBG in previous reports on mannanases from molluscs are generally considerably higher than those in reports on fungal mannanases. The KM values for three -mannanases from snails lie in the range (1.4-3 g/l) [53,
85, 180]. In constrast, reports on fungal -mannanases from Trichoderma and Aspergillus have
given values between 0.0015-0.7 g/l [17, 56, 57, 229].
The degradation of glucomannan by CfMan26A and TrMan5A was also compared in the present
study (Paper VII, Figure 2). Analysis of the DP of the products formed after prolonged hydrolysis
revealed relatively similar patterns with the two enzymes; in both cases, mannobiose and
mannotriose were the major products formed. Slightly more mannotriose was formed with
CfMan26A in comparison with TrMan5A. Thus, no major difference in the product formation of
glucomannan degradation was observed under the conditions used. This may indicate that the
two -mannanases from families 5 and 26 have similar binding requirements with respect to
mannose and glucose residues. However, it must be stated that the products were analysed only
with respect to their DP. In order to further assess any possible differences/similarities in substrate
binding requirements between family 5 and family 26 -mannanases, a larger number of enzymes should be included and a more detailed product analysis should be made.
In the context of mannan degradation, investigations on the hydrolysis of isolated glucomannans
and galactoglucomannans have previously been conducted, which have provided information
about the specific enzyme-polysaccharide interactions of -mannanases. In particular, the subsite
48

specificity of the T. reesei and A. niger -mannanases has been investigated to some extent [182,
259]. In both these enzymes glucose is allowed in the +1 subsite, but not in the -1 site.
In the present study, a comparison of hydrolysis of glucomannan and O-acetyl-GGM by TrMan5A
was made (Paper VII). Analysis of the hydrolysis products showed that the DP profiles were
different for O-acetyl-GGM (mainly DP 2-5) and glucomannan (mainly DP 2-3). This indicates
that some restrictions exist for the -mannanase with regard to either galactosyl- or acetylsubstituents. The restrictions of galactosyl-substituents for TrMan5A [259] and the A. niger mannanase [182], has previously been observed and it has been concluded that galactose
substituents can be accommodated in the 1 subsite, but not in the +1 subsite [182, 259]. Moreover, Puls et al. [210] demonstrated that acetyl-groups appears to limit hydrolysis of
galactoglucomannan by the A. niger -mannanase. However, a more detailed study on the restrictions of acetyl-substituents on -mannanase activity has not yet been made. The degradation
of O-acetyl-GGM by -mannanases is important, not only from an enzymologic point of view.
Previous work in our group has shown that -mannanases can be used as tools to analyse the
structure of heteromannans [158].
Interestingly, results from analysis of O-acetyl-GGM hydrolysis also indicated that an
endoglucanase (TrCel7B) from T. reesei has a limited depolymerisation activity on this polymer
(Paper VII). It has previously been shown that TrCel7B and several other T. reesei cellulases are
active on glucomannan [138]. Furthermore, it has been reported that TrCel7B is active on xylan
[27]. In addition, the endoglucanase TrCel5A from T. reesei display activity on galactomannan
[163]. These cross-activities of cellulases are interesting in view of the close association between
cellulose and hemicellulose in the plant cell wall. A more detailed product analysis will possibly
reveal more information about specific enzyme-polysaccharide interactions in the degradation of
O-acetyl-GGM by TrCel7B. Of special interest here is to detect the specificity of interactions in
the -1 subsite.

49

50

Conclusions & future perspectives

In this thesis, new results concerning the enzyme-substrate interaction of mannan-degrading enzymes have been presented and discussed. In particular, novel information has been put forward
regarding the function of a modular -mannanase (TrMan5A). It was shown that the CBM of
TrMan5A binds to cellulose and potentiate the hydrolysis of complex substrates. Thus, the substrate
preference of this enzyme is influenced by interactions in both modules. An interesting fact is
that, in the present case, the binding of the CBM is not directed to the mannan-substrate per se.
However, these results may be a reflection of the tight and complex organisation of cellulose and
hemicellulose in the plant cell wall.
This observation opens up new questions regarding the role of CBMs in -mannanases and other
hemicellulases. It would be interesting to investigate if the cellulose-binding CBMs in these
enzymes bind to cellulose at specific positions where the cellulose and hemicellulose are closely
associated. It would also be interesting to compare the T. reesei -mannanase with other modular
-mannanases and other hemicellulases. CfMan26A, which carries a family XXIII mannan-binding
CBM, is an example of an interesting candidate for such a study.
The results presented here concerning the roles of specific amino acid in a -mannanase is somewhat unique in the area of -mannanases. Few studies of this kind have been carried out with
these enzymes. The results presented here have given some hints about the influence of Arg171,
positioned in the +2 subsite, on hydrolysis. Therefore, it would be interesting to study this residue
and further assess its role in substrate recognition. Furthermore, a new complex-structure with an
inactive mutant will potentially provide new information about the specific enzyme/carbohydrate interactions in the active site cleft.
This work has also included studies on mannan hydrolysis by different mannan-degrading enzymes. The investigation of degradation patterns from hydrolysis of different heteromannans has
provided new insights into the specificity of different enzymes on these substrates. Interestingly,
a -mannosidase was capable of degrading both mannans and heteromannans. A limited amount
of degradation of mannan crystals was also detected with this -mannosidase. These observations indicate that the A. niger -mannosidase can participate in the direct enzymatic attack on
polymeric substrates. However, the nature of the enzyme-polysaccharide interaction remains to
be elucidated.
Due to the complex nature of the plant cell wall and mannan-based substrates, several issues need
to be addressed in order to achieve a better understanding of mannan-degradation. Firstly, the
enzyme-polysaccharide interaction of mannoside-hydrolases in the degradation of the more complex heteromannans, like O-acetyl-galactoglucomanan, should be studied in more detail. In particular, the influence of different substituents on the rate of hydrolysis needs to be investigated
further. Secondly, a larger comparative study of mannan-degrading enzymes from different enzyme families would possibly reveal any differences or similarities in substrate specificity. In
general, improved methods for the separation and detection of polysaccharides and oligosaccharides
would be very useful in these types of investigations.

51

Furthermore, the results from this work indicate that an endoglucanase from T. reesei can
depolymerise galactoglucomannan. This observation is interesting to discuss in the framework of
modular enzymes. Several modular enzymes possess both cellulase and hemicellulase catalytic
modules. Furthermore, modular enzymes may contain multiple CBMs with affinity for both cellulose and hemicellulose. Thus, it appears that, at least in some cases, the enzymatic degradations
of cellulose and hemicellulose are interlinked with each other. These connections between catalytic modules and CBMs with affinity for cellulose and hemicellulose are in accordance with the
observed enzyme-polysaccharide interaction of the modular -mannanase from T. reesei and clearly
illustrate the complexity of the plant cell wall.
In the study of complex substrates, integrated approaches including several other types of cell
wall-degrading enzymes, might prove to be useful. Since the results in this work showed that an
endoglucanase is capable of depolymerising isolated galactoglucomannans, it would be interesting to assess if the enzyme also perform this activity in the plant cell wall. Possibly, such an
activity may facilitate the degradation of mannans by hemicellulases.
In summary, the work presented here has provided new information about enzyme-polysaccharide interaction in the modular -mannanase from T. reesei which will be valuable for further
studies on this enzyme and other modular enzymes. Furthermore, hydrolysis of mannans by
mannoside- and glycoside-hydrolases has opened up new questions regarding the substrate
specificity in the subsites of these enzymes. Hopefully, the work presented in this thesis will be an
incitement for continued studies on the specific polysaccharide interactions in modular enzymes.

52

Acknowledgements
This work would of course not have been possible without the help and support of others.
First, I would like to thank my supervisor Henrik Stlbrand for his great support and guidance during these years. You have been a very ambitious supervisor, which I appreciate, and
you have always had time to spare for talks and discussions. It has been a pleasure working
with you.
I would also like to acknowledge all the collaborators in the different projects. Special thanks
to: Henri Chanzy, who is a great scientist and an enormous knowledge which I admire.
Elisabetta Sabini, who is good at crystallography and also a nice person. Claire Boisset, who
introduced me to immuno-gold labelling. Keith Wilson, who has provided fruitful discussions
on the mannanase structure. I would also like to thank Jan-Christer Janson and Bingze Xu,
for the work on the mussel mannanase and Marc Claeyssens and Wim Nerinckx for providing interesting substrates.
I also want to thank all the people at the department who I have had the pleasure to work with:
Jon and Torny (Jrngnget), we have been working together a lot and we have also had a lot of
fun Stureplan nsta! Lars, who did an excellent masters thesis. I am glad you took the right
decision and continued in our group. Its been very nice working with you. Pia, who I worked
with on the -mannosidase. Thanks also to Anna for help with Trichoderma transformation.
My acknowledgements also go to all other past and present members of the groups of Henrik
Stlbrand and Folke Tjerneld.
Diploma students and project-workers: Magnus, who did a very good job on the Pichia system
during his master thesis. Ulrika and Esther who worked with the -mannosidase.
I would also like to thank everybody at the department for providing a relaxed and stimulating
atmosphere. A special thank to the football and innebandy players: Ravi, Johan B, Henrik P,
Tomas and others. Thank you to everybody who has met up at the pub and other social events:
Jonathan, Irene, Johan K, Jrgen, Mia and many others.
A special thank to Jonathan Park for proof reading the text.
Gavelin klanen: Alf, Birgitta, Nicklas, Jonas, Helen, Ulf, Anna, Tove och Simon. Tack fr
alla goda minnen vi delat i Malm och i Vitemlla.
Min syster Pernilla, du vet vad det hr innebr. Du har verkligen varit en frebild. Tack fr
ditt std och din uppmuntran. Torbjrn, som varit som en storebror under delar av min uppvxt. Adam och Amanda som r ljusglimtar i tillvaron. Generse Torsten.
Mamma och pappa: tack fr allt std ni har gett mig genom ren.
Slutligen vill jag tacka min lskade Erika. Tack fr att du finns och fr att du har sttt ut med
alla sena kvllar och helger.
53

54

References
1. Ademark, P. 2000. Galactoglucomannan-degrading enzymes from Aspergillus niger. Doctoral thesis.
Lund University, Lund.
2. Ademark, P., M. Larsson, F. Tjerneld, and H. Stlbrand. 2001. Multiple -galactosidase from
Aspergillus niger: purification, characterization, and substrate specificities. Enzyme Microb. Technol. 29:
441-448.
3. Ademark, P., A. Varga, J. Medve, V. Harjunp, T. Drakenberg, F. Tjerneld, and H. Stlbrand.
1998. Softwood hemicellulose-degrading enzymes from Aspergillus niger: purification and properties of a
-mannanase. J. Biotechnol. 63(3): 199-210.
4. Akino, T., C. Kato, and K. Horikoshi. 1989. The cloned -mannanase gene from alkalophilic Bacillus
sp. AM-001 produces two -mannanases in Escherichia coli. Arch. Microbiol. 152(1): 10-15.
5. Akino, T., C. Kato, and K. Horikoshi. 1989. Two Bacillus -mannanases having different COOH
termini are produced in Escherichia coli carrying pMAH5. Appl. Environ. Microbiol. 55(12): 3178-3183.
6. Akino, T., N. Nakamura, and K. Horikoshi. 1988. Characterization of -mannosidase of an
Alkalophilic Bacillus sp. Agric. Biol. Chem. 52(6): 1459-1464.
7. Akino, T., N. Nakamura, and K. Horikoshi. 1988. Characterization of three -mannanases of an
alkalophilic Bacillus sp. Agric. Biol. Chem. 52(3): 773-779.
8. Aleshin, A. E., L. M. Firsov, and R. B. Honzatko. 1994. Refined structure for the complex of acarbose
with glucoamylase from Aspergillus awamori var. X100 to 2.4- resolution. J. Biol. Chem. 269(22): 1563115639.
9. Alkhayat, A. H., S. A. Kraemer, J. R. Leipprandt, M. Macek, W. J. Kleijer, and K. H. Friderici.
1998. Human -mannosidase cDNA characterizatioon and first identificatioon of a mutation associatied
with human -mannosidosis. Hum. Mol. Genet. 7: 75-83.
10. Alvarado, V., H. Nonogaki, and K. J. Bradford. 2000. Expression of endo--mannanase and SNFrelated protein kinase genes in true potato seeds in relation to dormancy, gibberellin and abscisic acid, p. 347364. In J. D. Vimont and J. Crabb (ed.), Dormancy in Plants. C. A. B. International, Wallingford, U. K.
11. Aparicio, R., E. V. Eneiskaya, A. A. Kulminskaya, A. N. Savel'ev, A. M. Golubev, K. N. Neustroev,
J. Kobarg, and I. Polikarpov. 2000. Crystallization and preliminary X-ray study of -mannosidase from
Trichoderma reesei. Acta Crystallogr., Sect. D: Biol. Crystallogr. 56(Pt 3): 342-343.
12. Arai, M., H. Fujimoto, T. Ooi, S. Ogura, and S. Murao. 1995. Purification and properties of mannosidase from Aspergillus aculeatus. Oyo Toshitsu Kagaku. 42: 49-51.
13. Araujo, A., and O. P. Ward. 1990. Extracellular mannanases and galactanases from selected fungi. J.
Ind. Microbiol. 6(3): 171-178.
14. Araujo, A., and O. P. Ward. 1990. Purification and some properties of the mannanases from Thielavia
terrestris. J. Ind. Microbiol. 6: 269-274.
15. Arcand, N., D. Kluepfel, F. W. Paradis, R. Morosoli, and F. Shareck. 1993. -mannanase of
Streptomyces lividans 66: cloning and DNA sequence of the manA gene and characterization of the enzyme.
Biochem. J. 290: 857-863.
16. Arima, T. 2001. Recycling of Wood and Fiber Products, p. 849-858. In D. N. S. Hon and N. Shiraishi
(ed.), Wood and Cellulosic Chemistry, 2nd ed. Marcel Dekker, Inc., New York.
17. Arisan-Atac, I., R. Hodits, D. Kristufek, and C. P. Kubicek. 1993. Purification and characterization
of a -mannanase of Trichoderma reesei C-30. Appl. Microbiol. Biotechnol. 39(1): 58-62.
18. Aspinall, G. O., E. L. Hirst, E. G. V. Percival, and I. R. Williamson. 1953. The Mannans of Ivory
Nut (Phytelephas macrocarpa). Part I. The Methylation of Mannan A and Mannan B. J. Chem. Soc. Part
III: 3184-3188.
19. Atkins, E. D. T., S. Farnell, C. Burden, W. Mackie, and B. Sheldrick. 1988. Crystalline structure
and packing of mannan I. Biopolymers. 27(7): 1097-1105.
20. Baird, S. D., M. A. Hefford, D. A. Johnson, W. L. Sung, M. Yaguchi, and V. L. Seligy. 1990. The
Glu residue in the conserved Asn-Glu-Pro sequence of two highly divergent endo--1,4-glucanases is essential for enzymatic activity. Biochem. Biophys. Res. Commun. 169(3): 1035-1039.
21. Bauer, M. W., E. J. Bylina, R. V. Swanson, and R. M. Kelly. 1996. Comparison of a -glucosidase
and a -mannosidase from the hyperthermophilic archaeon Pyrococcus furiosus. Purification, characterization, gene cloning and sequence analysis. J. Biol. Chem. 271: 23749-23755.

55

22. Beccari, T., L. Bibi, S. Stinchi, J. L. Stirling, and A. Orlacchio. 2001. Mouse -mannosidase: cDNA
cloning, expression, and chromosomal localization. Biosci. Rep. 21(3): 315-323.
23. Becker, D., C. Braet, H. Brumer III, M. Claeyssens, C. Divne, B. R. Fagerstrom, M. Harris, T. A.
Jones, G. J. Kleywegt, A. Koivula, S. Mahdi, K. Piens, M. L. Sinnott, J. Sthlberg, T. T. Teeri, M.
Underwood, and G. Wohlfahrt. 2001. Engineering of a glycosidase Family 7 cellobiohydrolase to more
alkaline pH optimum: the pH behaviour of Trichoderma reesei Cel7A and its E223S/ A224H/L225V/T226A/
D262G mutant. Biochem. J. 356(Pt 1): 19-30.
24. Bewley, J. D., M. Banik, R. Bourgault, J. A. Feurtado, P. Toorop, and H. W. Hilhorst. 2000. Endo-mannanase activity increases in the skin and outer pericarp of tomato fruits during ripening. J. Exp. Bot.
51(344): 529-538.
25. Bewley, J. D., R. A. Burton, Y. Morohashi, and G. B. Fincher. 1997. Molecular cloning of a cDNA
encoding a (1->4)--mannan endohydrolase from the seeds of germinated tomato (Lycopersicon esculentum).
Planta. 203(4): 454-459.
26. Biely, P., and M. Tenkanen. 1998. Enzymology of hemicellulose degradation, p. 25-47. In G. E.
Harman and C. P. Kubicek (ed.), Trichoderma & Gliocladium, vol. 2. Taylor and Francis Ltd., London.
27. Biely, P., M. Vrsanska, and M. Claeyssens. 1991. The endo-1,4--glucanase I from Trichoderma
reesei. Action on -1,4-oligomers and polymers derived from D-glucose and D-xylose. Eur. J. Biochem.
200(1): 157-163.
28. Black, G. W., J. E. Rixon, J. H. Clarke, G. P. Hazlewood, L. M. Ferreira, D. N. Bolam, and H. J.
Gilbert. 1997. Cellulose binding domains and linker sequences potentiate the activity of hemicellulases
against complex substrates. J. Biotechnol. 57(1-3): 59-69.
29. Black, G. W., J. E. Rixon, J. H. Clarke, G. P. Hazlewood, M. K. Theodorou, P. Morris, and H. J.
Gilbert. 1996. Evidence that linker sequences and cellulose-binding domains enhance the activity of
hemicellulases against complex substrates. Biochem. J. 319(Pt 2): 515-520.
30. Blake, C. C. F., D. F. Koenig, G. A. Mair, A. C. T. North, D. C. Phillips, and V. R. Sarma. 1965.
Structure of hen egg-white lysozyme a three-dimensional Fourier synthesis at 2 resolution. Nature.
206(4986): 757-761.
31. Bolam, D. N., A. Ciruela, S. McQueen-Mason, P. Simpson, M. P. Williamson, J. E. Rixon, A.
Boraston, G. P. Hazlewood, and H. J. Gilbert. 1998. Pseudomonas cellulose-binding domains mediate
their effects by increasing enzyme substrate proximity. Biochem. J. 331(Pt 3): 775-781.
32. Bolam, D. N., N. Hughes, R. Virden, J. H. Lakey, G. P. Hazlewood, B. Henrissat, K. L. Braithwaite,
and H. J. Gilbert. 1996. Mannanase A from Pseudomonas fluorescens ssp. cellulosa is a retaining glycosyl
hydrolase in which E212 and E320 are the putative catalytic residues. Biochemistry. 35(50): 16195-16204.
33. Boraston, A. B., P. Chiu, R. A. Warren, and D. G. Kilburn. 2000. Specificity and affinity of substrate
binding by a family 17 carbohydrate-binding module from Clostridium cellulovorans cellulase 5A. Biochemistry. 39(36): 11129-11136.
34. Boraston, A. B., A. L. Creagh, M. M. Alam, J. M. Kormos, P. Tomme, C. A. Haynes, R. A. Warren, and D. G. Kilburn. 2001. Binding specificity and thermodynamics of a family 9 carbohydrate-binding
module from Thermotoga maritima xylanase 10A. Biochemistry. 40(21): 6240-6247.
35. Boraston, A. B., M. Ghaffari, R. A. Warren, and D. G. Kilburn. 2002. Identification and glucanbinding properties of a new carbohydrate-binding module family. Biochem. J. 361(Pt 1): 35-40.
36. Boraston, A. B., B. W. McLean, J. M. Kormos, M. Alam, N. R. Gilkes, C. A. Haynes, P. Tomme,
D. G. Kilburn, and R. A. J. Warren. 1999. Carbohydrate-binding modules: diversity of structure and
function, p. 202-211. In H. J. Gilbert, G. J. Davies, B. Henrissat, and B. Svensson (ed.), Recent Advances in
Carbohydrate Bioengineering, vol. 246. Royal Society of Chemistry, Cambridge.
37. Bork, P., A. K. Downing, B. Kieffer, and I. D. Campbell. 1996. Structure and distribution of modules in extracellular proteins. Q. Rev. Biophys. 29(2): 119-167.
38. Bourgault, R., J. D. Bewley, A. Alberici, and D. Decker. 2001. Endo--mannanase activity in tomato and other ripening fruits. HortScience. 36(1): 72-75.
39. Bourne, Y., and B. Henrissat. 2001. Glycoside hydrolases and glycosyltransferases: families and
functional modules. Curr. Opin. Struct. Biol. 11(5): 593-600.
40. Braithwaite, K. L., G. W. Black, G. P. Hazlewood, B. R. Ali, and H. J. Gilbert. 1995. A nonmodular endo--1,4-mannanase from Pseudomonas fluorescens subspecies cellulosa. Biochem. J. 305(Pt
3): 1005-1010.
41. Bray, M. R., P. E. Johnson, N. R. Gilkes, L. P. McIntosh, D. G. Kilburn, and R. A. Warren. 1996.

56

Probing the role of tryptophan residues in a cellulose-binding domain by chemical modification. Protein
Sci. 5(11): 2311-2318.
42. Brun, E., P. E. Johnson, A. L. Creagh, P. Tomme, P. Webster, C. A. Haynes, and L. P. McIntosh.
2000. Structure and binding specificity of the second N-terminal cellulose-binding domain from Cellulomonas
fimi endoglucanase C. Biochemistry. 39(10): 2445-2458.
43. Brun, E., F. Moriaud, P. Gans, M. J. Blackledge, F. Barras, and D. Marion. 1997. Solution structure of the cellulose-binding domain of the endoglucanase Z secreted by Erwinia chrysanthemi. Biochemistry. 36(51): 16074-16086.
44. Buchert, J., T. Oksanen, J. Pere, M. Siika-Aho, A. Suurnakki, and L. Viikari. 1998. Applications
of Trichoderma reesei enzymes in the pulp and paper industry, p. 343-363. In G. E. Harman and C. P.
Kubicek (ed.), Trichoderma Gliocladium, vol. 2. Taylor and Francis Ltd., London.
45. Buchert, J., J. Salminen, M. Siika-aho, M. Ranua, and L. Viikari. 1993. The role of Trichoderma
reesei xylanase and mannanase in the treatment of softwood kraft pulp prior to bleaching. Holzforschung.
47(6): 473-478.
46. Cann, I. K. O., S. Kocherginskaya, M. R. King, B. A. White, and R. I. Mackie. 1999. Molecular
Cloning, Sequencing, and Expression of a Novel Multidomain Mannanase Gene from Thermoanaerobacterium polysaccharolyticum. J. Bacteriol. 181(5): 1643-1651.
47. Carrard, G., A. Koivula, H. Sderlund, and P. Beguin. 2000. Cellulose-binding domains promote
hydrolysis of different sites on crystalline cellulose. Proc. Natl. Acad. Sci. U. S. A. 97(19): 10342-10347.
48. Chambers, R. S., A. R. Walden, G. S. Brooke, J. F. Cutfield, and P. A. Sullivan. 1993. Identification of a putative active site residue in the exo--(1,3)-glucanase of Candida albicans. FEBS Lett. 327(3):
366-369.
49. Chanzy, H., S. Prez, D. P. Miller, G. Paradossi, and W. T. Winter. 1987. An electron diffraction
study of the mannan I crystal and molecular structure. Macromolecules. 20(10): 2407-2013.
50. Chanzy, H. D., A. Grosrenaud, J. P. Joseleau, M. Dub, and R. H. Marchessault. 1982. Crystallization behavior of glucomannan. Biopolymers. 21(2): 301-319.
51. Chanzy, H. D., A. Grosrenaud, R. Vuong, and W. Mackie. 1984. The crystalline polymorphism of
mannan in plant cell walls and after recrystallization. Planta. 161(4): 320-329.
52. Charnock, S. J., D. N. Bolam, J. P. Turkenburg, H. J. Gilbert, L. M. Ferreira, G. J. Davies, and
C. M. Fontes. 2000. The X6 thermostabilizing domains of xylanases are carbohydrate-binding modules:
structure and biochemistry of the Clostridium thermocellum X6b domain. Biochemistry. 39(17): 5013-5021.
53. Charrier, M., and C. Rouland. 2001. Mannan-degrading enzymes purified from the crop of the
brown garden snail Helix aspersa Mller (Gastropoda pulmonata). J. Exp. Zool. 290(2): 125-135.
54. Chen, H., J. R. Leipprandt, C. E. Traviss, B. L. Sopher, M. Z. Jones, K. T. Cavanagh, and K. H.
Friderici. 1995. Molecular cloning and characterization of bovine -mannosidase. J. Biol. Chem. 270(8):
3841-3848.
55. Chesson, A., and C. W. Forsberg. 1988. Polysaccharide Degradation by Rumen Microorganisms, p.
251-284. In P. N. Hobson (ed.), The Rumen Microbial Ecosystem. Elsevier Science Publishers Ltd., London.
56. Christgau, S., S. Kauppinen, J. Vind, L. V. Kofod, and H. Dalboge. 1994. Expression cloning,
purification and characterization of a -1,4-mannanase from Aspergillus aculeatus. Biochem. Mol. Biol. Int.
33(5): 917-925.
57. Civas, A., R. Eberhard, P. Le Dizet, and F. Petek. 1984. Glycosidases induced in Aspergillus tamarii.
Secreted -D-galactosidase and -D-mannanase. Biochem. J. 219(3): 857-863.
58. Clarke, J. H., K. Davidson, J. E. Rixon, J. R. Halstead, M. P. Fransen, H. J. Gilbert, and G. P.
Hazlewood. 2000. A comparison of enzyme-aided bleaching of softwood paper pulp using combinations of
xylanase, mannanase and -galactosidase. Appl. Microbiol. Biotechnol. 53(6): 661-667.
59. Colln, A., M. Ward, F. Tjerneld, and H. Stlbrand. 2001. Genetically engineered peptide fusions
for improved protein partitioning in aqueous two-phase systems. Effect of fusion localization on endoglucanase
I of Trichoderma reesei. J. Chromatogr. A. 910(2): 275-284.
60. Colvin, J. R. 1980. The biosynthesis of cellulose, p. 543-570. In P. K. Stumpf and E. E. Conn (ed.),
The Biochemisty of Plants, vol. 3. Academic Press, London.
61. Coughlan, M. P., M. G. Touhy, E. X. F. Filho, J. Puls, M. Claeyssens, M. Vrsanska, and M. M.
Hughes. 1993. Enzymological aspects of microbial hemicellulases with emphasis on fungal systems, p. 5384. In M. P. Coughlan and G. P. Hazlewood (ed.), Hemicellulose and Hemicellulases, vol. 4. Portland Press
Res. Monogr., London.

57

62. Coulombel, C., S. Clermont, M. J. Foglietti, and F. Percheron. 1981. Transglycosylation reactions
catalysed by two -mannanases. Biochem. J. 195(1): 333-335.
63. Coutinho, P. M., and B. Henrissat. 1999. Carbohydrate-active enzymes: an integrated database
approach, p. 3-12. In H. J. Gilbert, G. J. Davies, B. Henrissat, and B. Svensson (ed.), Recent Advances in
Carbohydrate Bioengineering, vol. 246. Royal Society of Chemistry, Cambridge.
64. Creagh, A. L., E. Ong, E. Jervis, D. G. Kilburn, and C. A. Haynes. 1996. Binding of the cellulosebinding domain of exoglucanase Cex from Cellulomonas fimi to insoluble microcrystalline cellulose is
entropically driven. Proc. Natl. Acad. Sci. U. S. A. 93(22): 12229-12234.
65. Curtis, H., and N. S. Barnes. 1989. Biology, 5th ed. Worth publishers Inc., New York.
66. Czjzek, M., D. N. Bolam, A. Mosbah, J. Allouch, C. M. Fontes, L. M. Ferreira, O. Bornet, V.
Zamboni, H. Darbon, N. L. Smith, G. W. Black, B. Henrissat, and H. J. Gilbert. 2001. The location of
the ligand-binding site of carbohydrate-binding modules that have evolved from a common sequence is not
conserved. J. Biol. Chem. 276(51): 48580-48587.
67. Daas, P. J., H. A. Schols, and H. H. de Jongh. 2000. On the galactosyl distribution of commercial
galactomannans. Carbohydr. Res. 329(3): 609-619.
68. Dalboge, H., and H. P. Heldt-Hansen. 1994. A novel method for efficient expression cloning of
fungal enzyme genes. Mol. Gen. Genet. 243(3): 253-260.
69. Davies, G., and B. Henrissat. 1995. Structures and mechanisms of glycosyl hydrolases. Structure.
3(9): 853-859.
70. Davies, G., M. L. Sinnott, and S. G. Withers. 1998. Glycosyl transfer, p. 119-208. In M. L. Sinnott
(ed.), Comprehensive biological catalysis, vol. 1. Academic Press, New York.
71. Davies, G. J., M. Dauter, A. M. Brzozowski, M. E. Bjornvad, K. V. Andersen, and M. Schulein.
1998. Structure of the Bacillus agaradherans family 5 endoglucanase at 1.6 A and its cellobiose complex at
2.0 A resolution. Biochemistry. 37(7): 1926-1932.
72. Davies, G. J., K. S. Wilson, and B. Henrissat. 1997. Nomenclature for sugar-binding subsites in
glycosyl hydrolases. Biochem. J. 321(Pt 2): 557-559.
73. Dea, I. C. M., A. H. Clark, and B. V. McCleary. 1986. Effect of the molecular fine structure of
galactomannans on their interaction properties - the role of unsubstituted sides. Food Hydrocolloids. 1(2):
129-140.
74. Din, N., N. R. Gilkes, B. Tekant, R. C. Miller, A. J. Warren, and D. G. Kilburn. 1991. NonHydrolytic Disruption of Cellulose Fibers By the Binding Domain of a Bacterial Cellulase. Bio/Technol.
9(11): 1096-1099.
75. Divne, C., J. Sthlberg, T. Reinikainen, L. Ruohonen, G. Pettersson, J. K. Knowles, T. T. Teeri,
and T. A. Jones. 1994. The three-dimensional crystal structure of the catalytic core of cellobiohydrolase I
from Trichoderma reesei. Science. 265(5171): 524-528.
76. Dominguez, R., H. Souchon, S. Spinelli, Z. Dauter, K. S. Wilson, S. Chauvaux, P. Beguin, and P.
M. Alzari. 1995. A common protein fold and similar active site in two distinct families of -glycanases. Nat.
Struct. Biol. 2(7): 569-576.
77. Dutta, S., K. J. Bradford, and D. J. Nevins. 1997. Endo--mannanase activity present in cell wall
extracts of lettuce endosperm prior to radicle emergence. Plant Physiol. 113(1): 155-161.
78. Ethier, N., G. Talbot, and J. Sygusch. 1998. Gene cloning, DNA sequencing, and expression of thermostable -mannanase from Bacillus stearothermophilus. Appl. Environ. Microbiol. 64(11): 4428-4432.
79. Evans, L. V., and D. M. Butler. 1988. Seaweed biotechnology - current status and future prospects,
p. 335-350. In L. J. Rogers and J. R. Gallon (ed.), Biochemistry of the Algae and Cyanobacteria, vol. 28.
Oxford University Press, Oxford.
80. Ezaki, S., K. Miyaoku, K.-I. Nishi, T. Tanaka, S. Fujiwara, M. Takagi, H. Atomi, and T. Imanaka.
1999. Gene analysis and enzymatic properties of thermostable -glycosidase from Pyrococcus kodakaraensis
KOD1. J. Biosci. Bioeng. 88(2): 130-135.
81. Fang, T. Y., and C. Ford. 1998. Protein engineering of Aspergillus awamori glucoamylase to increase its pH optimum. Protein Eng. 11(5): 383-388.
82. Fanutti, C., T. Ponyi, G. W. Black, G. P. Hazlewood, and H. J. Gilbert. 1995. The conserved
noncatalytic 40-residue sequence in cellulases and hemicellulases from anaerobic fungi functions as a protein docking domain. J. Biol. Chem. 270(49): 29314-29322.
83. Fengel, D., and G. Wegener. 1989. Wood: Chemistry, Ultrastructure, Reactions. Walter de Gruyter,
New York.

58

84. Fernandes, A. C., C. M. Fontes, H. J. Gilbert, G. P. Hazlewood, T. H. Fernandes, and L. M.

Ferreira. 1999. Homologous xylanases from Clostridium thermocellum: evidence for bi-functional activity,
synergism between xylanase catalytic modules and the presence of xylan-binding domains in enzyme complexes. Biochem. J. 342(Pt 1): 105-110.
85. Flari, V., M. Matoub, and C. Rouland. 1995. Purification and characterization of a -mannanase
from the digestive tract of the edible snail Helix lucorum L. Carbohydr. Res. 275(1): 207-213.
86. Fogarty, W. M. 1994. Enzymes of the Genus Aspergillus, p. 177-218. In J. E. Smith (ed.), Aspergillus,
vol. 7. Plenum Press, New York.
87. Freelove, A. C., D. N. Bolam, P. White, G. P. Hazlewood, and H. J. Gilbert. 2001. A novel carbohydrate-binding protein is a component of the plant cell wall-degrading complex of Piromyces equi. J. Biol.
Chem. 276(46): 43010-43017.
88. Frei, E., and R. D. Preston. 1968. Noncellulosic structural polysaccharides in algal cell walls. III.
Mannan in siphoneous green algae. Proc. R. Soc. London, Ser. B. 169(1015): 127-145.
89. Gabrielii, I. 1998. Hydrogels based on hardwood hemicelluloses.Licentiate thesis. Chalmers University of Technology, Gteborg.
90. Gerber, P. J., J. A. Heitmann, T. W. Joyce, J. Buchert, and M. Siika-aho. 1999. Adsorption of
hemicellulases onto bleached kraft fibers. J. Biotechnol. 67(1): 67-75.
91. Gherardini, F. C., and A. A. Salyers. 1987. Characterization of an outer membrane mannanase from
Bacteroides ovatus. J. Bacteriol. 169(5): 2031-2037.
92. Gibbs, M. D., A. U. Elinder, R. A. Reeves, and P. L. Bergquist. 1996. Sequencing, cloning and
expression of a -1,4-mannanase gene, manA, from the extremely thermophilic anaerobic bacterium,
Caldicellulosiruptor Rt8B.4. FEMS Microbiol. Lett. 141(1): 37-43.
93. Gibbs, M. D., R. A. Reeves, A. Sunna, and P. L. Bergquist. 1999. Sequencing and expression of a mannanase gene from the extreme thermophile Dictyoglomus thermophilum Rt46B.1, and characteristics of
the recombinant enzyme. Curr. Microbiol. 39(6): 351-357.
94. Gibbs, M. D., D. J. Saul, E. Luthi, and P. L. Bergquist. 1992. The -mannanase from Caldocellum
saccharolyticum is part of a multidomain enzyme. Appl. Environ. Microbiol. 58(12): 3864-3867.
95. Gilbert, H. J., D. N. Bolam, L. Szabo, H. Xie, M. P. Williamson, P. J. Simpson, S. Jamal, A. B.
Boraston, D. G. Kilburn, and R. A. J. Warren. 2002. An update on carbohydrate binding modules, p. 8998. In T. Teeri, B. Svensson, H. J. Gilbert, and T. Freizi (ed.), Carbohydrate Bioengineering: Interdisciplinary approaches, vol. 275. Royal Society of Chemistry, Cambridge.
96. Gilkes, N. R., B. Henrissat, D. G. Kilburn, R. C. Miller, Jr., and R. A. Warren. 1991. Domains in
microbial -1, 4-glycanases: sequence conservation, function, and enzyme families. Microbiol. Rev. 55(2):
303-315.
97. Gilkes, N. R., E. Jervis, B. Henrissat, B. Tekant, R. C. Miller, Jr., R. A. Warren, and D. G.
Kilburn. 1992. The adsorption of a bacterial cellulase and its two isolated domains to crystalline cellulose.
J. Biol. Chem. 267(10): 6743-6749.
98. Gilkes, N. R., R. A. Warren, R. C. Miller, Jr., and D. G. Kilburn. 1988. Precise excision of the
cellulose binding domains from two Cellulomonas fimi cellulases by a homologous protease and the effect
on catalysis. J. Biol. Chem. 263(21): 10401-10407.
99. Gill, J., J. E. Rixon, D. N. Bolam, S. McQueen-Mason, P. J. Simpson, M. P. Williamson, G. P.
Hazlewood, and H. J. Gilbert. 1999. The type II and X cellulose-binding domains of Pseudomonas xylanase
A potentiate catalytic activity against complex substrates by a common mechanism. Biochem. J. 342(Pt 2):
473-480.
100. Godfrey, T., and S. I. West. 1996. Introduction to industrial enzymology, p. 1-8. In T. Godfrey and S.
I. West (ed.), Industrial Enzymology, 2nd ed. Stockton press, New York.
101. Goldstein, A. M., E. N. Alter, and J. K. Seaman. 1973. Guar gum, p. 303-321. In R. Whistler and J.
M. BeMiller (ed.), Industrial Gums. Academic Press, New York.
102. Grassin, C., and P. Fauquembergue. 1996. Fruit juices, p. 225-264. In T. Godfrey and S. I. West
(ed.), Industrial Enzymology, 2nd ed. Stockton Press, New York.
103. Grinna, L. S., and J. F. Tschopp. 1989. Size Distribution and General Structural Features of NLinked Oligosaccharides from the Methylotrophic Yeast, Pichia pastoris. Yeast. 5: 107-115.
104. Groot, S. P. C., B. Kieliszewska-Rokicka, E. Vermeer, and C. M. Karssen. 1988. Gibberellin-induced hydrolysis of endosperm cell walls in gibberellin-deficient tomato seeds prior to radicle protrusion.
Planta. 174(4): 500-504.

59

105. Guex, N., and M. C. Peitsch. 1997. Swiss-model and the Swiss-PdbViewer: An environment for
comparative protein modelling. Electrophoresis. 18: 2714-2723.
106. Gbitz, G. M., M. Hayn, M. Sommerauer, and W. Steiner. 1996. Mannan-Degrading Enzymes
from Sclerotium rolfsii: Characterisation and synergism of two Endo -Mannanases and a -Mannosidase.
Bioresour. Technol. 58: 127-135.
107. Gbitz, G. M., M. Hayn, G. Urbanz, and W. Steiner. 1996. Purification and properties of an acidic
-mannanase from Sclerotium rolfsii. J. Biotechnol. 45(2): 165-172.
108. Gbitz, G. M., A. Sachslehner, and D. Haltrich. 2001. Microbial Mannanases: Substrates, Production and Applicantions, p. 236-262. In M. E. Himmel, J. O. Baker, and M. E. Himmel (ed.), Glycosyl
Hydrolases for Biomass Conversion, vol. 769. American Chemical Society, Washington D. C.
109. Hall, J., G. W. Black, L. M. Ferreira, S. J. Millward-Sadler, B. R. Ali, G. P. Hazlewood, and H. J.
Gilbert. 1995. The non-catalytic cellulose-binding domain of a novel cellulase from Pseudomonas fluorescens
subsp. cellulosa is important for the efficient hydrolysis of Avicel. Biochem. J. 309(Pt 3): 749-756.
110. Halstead, J. R., P. E. Vercoe, H. J. Gilbert, K. Davidson, and G. P. Hazlewood. 1999. A family 26
mannanase produced by Clostridium thermocellum as a component of the cellulosome contains a domain
which is conserved in mannanases from anaerobic fungi. Microbiology (Reading U.K.). 145(Pt 11): 31013108.
111. Harjunp, V., J. Helin, A. Koivula, M. Siika-aho, and T. Drakenberg. 1999. A comparative study
of two retaining enzymes of Trichoderma reesei: transglycosylation of oligosaccharides catalysed by the
cellobiohydrolase I, Cel7A, and the -mannanase, Man5A. FEBS Lett. 443(2): 149-153.
112. Harjunp, V., A. Teleman, M. Siika-aho, and T. Drakenberg. 1995. Kinetic and stereochemical
studies of manno-oligosaccharide hydrolysis catalysed by -mannanases from Trichoderma reesei. Eur. J.
Biochem. 234: 278-283.
113. Hashimoto, Y., and J. Fukumoto. 1969. Enzymic treatment of coffee beans. II. Purification and
properties of -mannosidase of Rhizopus niveus. J. Agric. Chem. Soc. Jpn. 43(8): 564-569.
114. Hazlewood, G. P., and H. J. Gilbert. 1998. Structure and function analysis of Pseudomonas plant
cell wall hydrolases. Prog. Nucleic. Acid Res. Mol. Biol. 61: 211-241.
115. Henrissat, B. 1991. A classification of glycosyl hydrolases based on amino acid sequence similarities.
Biochem. J. 280(Pt 2): 309-316.
116. Henrissat, B., and A. Bairoch. 1993. New families in the classification of glycosyl hydrolases based
on amino acid sequence similarities. Biochem. J. 293(Pt 3): 781-788.
117. Henrissat, B., and A. Bairoch. 1996. Updating the sequence-based classification of glycosyl hydrolases.
Biochem. J. 316(Pt 2): 695-696.
118. Henrissat, B., I. Callebaut, S. Fabrega, P. Lehn, J. P. Mornon, and G. Davies. 1995. Conserved
catalytic machinery and the prediction of a common fold for several families of glycosyl hydrolases. Proc.
Natl. Acad. Sci. U. S. A. 92: 7090-7094.
119. Henrissat, B., and G. Davies. 1997. Structural and sequence-based classification of glycoside
hydrolases. Curr. Opin. Struct. Biol. 7(5): 637-644.
120. Henrissat, B., T. T. Teeri, and R. A. J. Warren. 1998. A scheme for designating enzymes that hydrolyze
the polysaccharides in the cell walls of plants. FEBS Lett. 425(2): 352-354.
121. Hilge, M., S. M. Gloor, W. Rypniewski, O. Sauer, T. D. Heightman, W. Zimmermann, K.
Winterhalter, and K. Piontek. 1998. High-resolution native and complex structures of thermostable betamannanase from Thermomonospora fusca - substrate specificity in glycosyl hydrolase family 5. Structure.
6(11): 1433-1444.
122. Hirata, K., Y. Aso, and M. Ishiguro. 1998. Purification and some properties of -mannosidase, -Nacetylglucosaminidase, and -galactosidase from apple snails (Pomacea canaliculata). J. Fac. Agric., Kyushu
Univ. 42(3-4): 463-472.
123. Hoffrn, A. M., T. T. Teeri, and O. Teleman. 1995. Molecular dynamics simulation of fungal cellulose-binding domains: differences in molecular rigidity but a preserved cellulose binding surface. Protein
Eng. 8(5): 443-450.
124. Hogg, D., E.-J. Woo, D. N. Bolam, V. A. McKie, H. J. Gilbert, and R. W. Pickersgill. 2001. Crystal
structure of mannanase 26A from Pseudomonas cellulosa and analysis of residues involved in substrate
binding. J. Biol. Chem. 276(33): 31186-31192.
125. Hossain, M. Z., J.-i. Ab, and S. Hizukuri. 1996. Multiple forms of -mannanase from Bacillus sp.
KK01. Enzyme Microb. Technol. 18(2): 95-98.

60

126. Ikiri, Y., and T. Miwa. 1960. Chemical Nature of the cell wall of the green algae, Codium, Acetabularia
and Halicoryne. Nature. 185: 178-179.
127. Iwasaki, Y., A. Tsuji, K. Omura, and Y. Suzuki. 1989. Purification and characterization of mannosidase from human placenta. J. Biochem. (Tokyo). 106(2): 331-335.
128. Jackson, M. E., D. W. Fodge, and H. Y. Hsiao. 1999. Effects of -mannanase in corn-soybean meal
diets on laying hen performance. Poult. Sci. 78(12): 1737-1741.
129. Jacobson, R. H., X. J. Zhang, R. F. DuBose, and B. W. Matthews. 1994. Three-dimensional structure of -galactosidase from E. coli. Nature. 369(6483): 761-766.
130. Jain, S., W. B. Drendel, Z. W. Chen, F. S. Mathews, W. S. Sly, and J. H. Grubb. 1996. Structure of
human -glucuronidase reveals candidate lysosomal targeting and active-site motifs. Nat. Struct. Biol. 3(4):
375-381.
131. Jenkins, J., L. Lo Leggio, G. Harris, and R. Pickersgill. 1995. -glucosidase, -galactosidase, family A cellulases, family F xylanases and two barley glycanases form a superfamily of enzymes with 8-fold /
architecture and with two conserved glutamates near the carboxy-terminal ends of -strands four and
seven. FEBS Lett. 362(3): 281-285.
132. Johnson, P. E., M. D. Joshi, P. Tomme, D. G. Kilburn, and L. P. McIntosh. 1996. Structure of the
N-terminal cellulose-binding domain of Cellulomonas fimi CenC determined by nuclear magnetic resonance spectroscopy. Biochemistry. 35(45): 14381-14394.
133. Johnson, P. E., P. Tomme, M. D. Joshi, and L. P. McIntosh. 1996. Interaction of soluble
cellooligosaccharides with the N-terminal cellulose-binding domain of Cellulomonas fimi CenC 2. NMR
and ultraviolet absorption spectroscopy. Biochemistry. 35(44): 13895-13906.
134. Johnson, W. G. 1997. Disorders of Glycoprotein Degradation: Sialidosis, Fucosidosis, -Mannosidosis,
-Mannosidosis, and Aspartylglycosaminuria, p. 355-369. In R. N. Rosenberg (ed.), Molecular and genetic
basis of neurological disease. Butterworth-Heinemann, Boston.
135. Jones, J. K. N. 1950. Structure of the mannan present in Porphyra umbilicalis. J. Chem. Soc.: 32923295.
136. Juers, D. H., T. D. Heightman, A. Vasella, J. D. McCarter, L. Mackenzie, S. G. Withers, and B. W.
Matthews. 2001. A structural view of the action of Escherichia coli (lacZ) -galactosidase. Biochemistry.
40(49): 14781-14794.
137. Juers, D. H., R. E. Huber, and B. W. Matthews. 1999. Structural comparisons of TIM barrel proteins
suggest functional and evolutionary relationships between -galactosidase and other glycohydrolases. Protein Sci. 8(1): 122-136.
138. Karlsson, J. 2000. Fungal Cellulases: Study of hydrolytic properties of endoglucanases from Trichoderma reesei and Humicola insolens.Doctoral thesis. Lund University, Lund.
139. Kenne, L., K.-G. Rosell, and S. Svensson. 1975. Studies on the distribution of the O-acetyl groups in
pine glucomannan. Carbohydr. Res. 44: 69-76.
140. Khanongnuch, C., T. Ooi, and S. Kinoshita. 1999. Cloning and nucleotide sequence of -mannanase
and cellulase genes from Bacillus sp. 5H. World J. Microbiol. Biotechnol. 15(2): 221-228.
141. Khosla, C., and P. B. Harbury. 2001. Modular enzymes. Nature. 409(6817): 247-252.
142. Kinghorn, J. R., and S. E. Unkles. 1994. Molecular Genetics and Expression of Foreign Proteins in the
Genus Aspergillus, p. 65-100. In J. E. Smith (ed.), Aspergillus, vol. 7. Plenum Press, New York.
143. Kormos, J., P. E. Johnson, E. Brun, P. Tomme, L. P. McIntosh, C. A. Haynes, and D. G. Kilburn.
2000. Binding site analysis of cellulose binding domain CBD(N1) from endoglucanase C of Cellulomonas
fimi by site-directed mutagenesis. Biochemistry. 39(30): 8844-8852.
144. Koshland, D. E. J. 1953. Stereochemistry and the mechanism of enzymic reactions. Biol. Revs. Cambridge Phil. Soc. 28: 416-436.
145. Kraulis, J., G. M. Clore, M. Nilges, T. A. Jones, G. Pettersson, J. Knowles, and A. M. Gronenborn.
1989. Determination of the three-dimensional solution structure of the C-terminal domain of cellobiohydrolase
I from Trichoderma reesei. A study using nuclear magnetic resonance and hybrid distance geometry-dynamical simulated annealing. Biochemistry. 28(18): 7241-7257.
146. Kulminskaya, A. A., E. V. Eneiskaya, L. S. Isaeva-Ivanova, A. N. Savelev, I. A. Sidorenko, K.
Shabalin, A., A. M. Golubev, and K. N. Neustroev. 1999. Enzymatic activity and -galactomannan binding property of -mannosidase from Trichoderma reesei. Enzyme Microb.Technol. 25: 372-377.
147. Kurokawa, J., E. Hemjinda, T. Arai, S. Karita, T. Kimura, K. Sakka, and K. Ohmiya. 2001.
Sequence of the Clostridium thermocellum mannanase gene man26B and characterization of the translated
product. Biosci. Biotechnol. Biochem. 65(3): 548-554.

61

148. Leipprandt, J. R., S. A. Kraemer, B. E. Haithocock, H. Chen, J. L. Dyme, K. T. Cavanagh, K. H.

Friderici, and M. Z. Jones. 1996. Caprine -mannosidase: sequencing and characterization of the cDNA
and identification of the molecular defect of caprine -mannosidosis. Genomics. 37: 51-56.
149. Lemesle-Varloot, L., B. Henrissat, C. Gaboriaud, V. Bissery, A. Morgat, and J. P. Mornon. 1990.
Hydrophobic cluster analysis: procedures to derive structural and functional information from 2-D-representation of protein sequences. Biochimie. 72(8): 555-574.
150. Lindberg, B., K.-G. Rosell, and S. Svensson. 1973. Position of the O-acetyl groups in pine
glucomannan. Svensk Papperstidning. 76: 383-384.
151. Linder, M., G. Lindeberg, T. Reinikainen, T. T. Teeri, and G. Pettersson. 1995. The difference in
affinity between two fungal cellulose-binding domains is dominated by a single amino acid substitution.
FEBS Lett. 372(1): 96-98.
152. Linder, M., M. L. Mattinen, M. Kontteli, G. Lindeberg, J. Sthlberg, T. Drakenberg, T.
Reinikainen, G. Pettersson, and A. Annila. 1995. Identification of functionally important amino acids in
the cellulose-binding domain of Trichoderma reesei cellobiohydrolase I. Protein Sci. 4(6): 1056-1064.
153. Linder, M., T. Nevanen, and T. T. Teeri. 1999. Design of a pH-dependent cellulose-binding domain.
FEBS Lett. 447(1): 13-16.
154. Linder, M., I. Salovuori, L. Ruohonen, and T. T. Teeri. 1996. Characterization of a double cellulosebinding domain. Synergistic high affinity binding to crystalline cellulose. J. Biol. Chem. 271(35): 2126821272.
155. Linder, M., and T. T. Teeri. 1997. The roles and function of cellulose-binding domains. J. Biotechnol.
57: 15-28.
156. Loos, E., and D. Meindl. 1982. Composition of the cell wall of Chlorella fusca. Planta. 156(3): 270273.
157. Love, J., and E. Percival. 1964. The polysaccharides of the green seaweed Codium fragile Part III. A
-1,4-linked mannan. J. Chem. Soc.: 3345-3350.
158. Lundqvist, J., A. Teleman, L. Junel, G. Zaachi, O. Dahlman, F. Tjerneld, and H. Stlbrand. 2002.
Isolation and characterization of galactoglucomannan from Spruce (Picea abies). Carbohydr. Polym. 48(1):
29-39.
159. Luonteri, E., M. Tenkanen, and L. Viikari. 1998. Substrate Specificities of Penicillium simplicissimum
-galactosidases. Enzyme Microb. Technol. 22: 192-198.
160. Luthi, E., D. R. Love, J. McAnulty, C. Wallace, P. A. Caughey, D. Saul, and P. L. Bergquist. 1990.
Cloning, sequence analysis, and expression of genes encoding xylan-degrading enzymes from the thermophile Caldocellum saccharolyticum. Appl. Environ. Microbiol. 56(4): 1017-1024.
161. Ly, H. D., and S. G. Withers. 1999. Mutagenesis of glycosidases. Annu. Rev. Biochem. 68: 487-522.
162. Ldtke, M. 1927. Zur Kenntnins der pflanzlichen Zellmembran. ber die Kohlenhydrate des
Steinnusamens. Ann. Chem. 456: 201-224.
163. Macarrn, R., C. Acebal, M. P. Castilln, and M. Claeyssens. 1996. Mannanase activity of
Endoglucanase III from Trichoderma reesei QM9414. Biotechnol. Lett. 18(5): 599-602.
164. Mach, R.L., and S. Zeilinger. 1998. Genetic transformation of Trichoderma and Gliacladium, p. 225241. In C.P. Kubicek and G. E. Harman (ed.), Trichoderma & Gliocladikum, vol. 1. Taylor & Francis Ltd.,
London.
165. Mackenzie, L. F., G. S. Brooke, J. F. Cutfield, P. A. Sullivan, and S. G. Withers. 1997. Identification of Glu-330 as the catalytic nucleophile of Candida albicans exo--(1,3)-glucanase. J. Biol. Chem.
272(6): 3161-3167.
166. Mackie, W., and R. D. Preston. 1968. The occurrence of mannan microfibrils in the green algae
Codium fragile and Acetabularia crenulata. Planta. 79: 249-253.
167. Mackie, W., and D. B. Sellen. 1969. Degree of polymerization and polydispersity of mannan from the
cell wall of the green seaweed Codium fragile. Polymer. 10(8): 621-632.
168. Malburg, S. R., L. M. Malburg, Jr., T. Liu, A. H. Iyo, and C. W. Forsberg. 1997. Catalytic properties of the cellulose-binding endoglucanase F from Fibrobacter succinogenes S85. Appl. Environ. Microbiol.
63(6): 2449-2453.
169. Marchessault, R. H., and A. Sarko. 1967. X-ray structure of polysaccharides. Advan. Carbohyd.
Chem. Biochem. 22: 421-482.
170. Margolles-Clark, E., M. Ilmn, and M. Penttil. 1997. Expression patterns of ten hemicellulase genes
of the filamentous fungus Trichoderma reesei on various carbon sources. J. Biotechnol. 57(1-3): 167-179.

62

171. Margolles-Clark, E., M. Tenkanen, H. Sderlund, and M. Penttil. 1996. Acetyl xylan esterase
from Trichoderma reesei contains an active-site serine residue and a cellulose-binding domain. Eur. J. Biochem.
237(3): 553-560.
172. Marraccini, P., W. J. Rogers, C. Allard, M. L. Andre, V. Caillet, N. Lacoste, F. Lausanne, and S.
Michaux. 2001. Molecular and biochemical characterization of endo--mannanases from germinating coffee (Coffea arabica) grains. Planta. 213(2): 296-308.
173. Mattinen, M. L., M. Kontteli, J. Kerovuo, M. Linder, A. Annila, G. Lindeberg, T. Reinikainen,
and T. Drakenberg. 1997. Three-dimensional structures of three engineered cellulose-binding domains of
cellobiohydrolase I from Trichoderma reesei. Protein Sci. 6(2): 294-303.
174. Mattinen, M. L., M. Linder, T. Drakenberg, and A. Annila. 1998. Solution structure of the cellulosebinding domain of endoglucanase I from Trichoderma reesei and its interaction with cello-oligosaccharides.
Eur. J. Biochem. 256(2): 279-286.
175. Mattinen, M. L., M. Linder, A. Teleman, and A. Annila. 1997. Interaction between cellohexaose and
cellulose binding domains from Trichoderma reesei cellulases. FEBS Lett. 407(3): 291-296.
176. McCleary, B. V. 1982. Purification and properties of a -D-mannoside mannohydrolase from guar.
Carbohydr. Res. 101(1): 75-92.
177. McCleary, B. V. 1983. -D-Mannosidase from Helix pomatia. Carbohydr. Res. 111(2): 297-310.
178. McCleary, B. V. 1983. Enzymic interactions in the hydrolysis of galactomannan in germinating guar:
the role of exo--mannanase. Phytochemistry. 22(3): 649-658.
179. McCleary, B. V. 1985. The Fine Structure of Carob and Guar Galactomannans. Carbohydr. Res. 139:
237-260.
180. McCleary, B. V. 1988. -D-Mannanse. Methods Enzymol. 160: 596-610.
181. McCleary, B. V. 1988. Exo--D-mannanase from Cyamopsis tetragonolobus guar seed. Methods
Enzymol. 160(Biomass, Pt. A): 589-595.
182. McCleary, B. V., and N. K. Matheson. 1983. Action Patterns and Substrate-Binding Requirements of
-D-Mannanase with Mannosaccharides and Mannan-type Polysaccharides. Carbohydr. Res. 119: 191-219.
183. McCutchen, C. M., G. D. Duffaud, P. Leduc, A. R. H. Petersen, A. Tayal, S. A. Khan, and R. M.
Kelly. 1996. Characterization of extremely thermostable enzymic breakers (-1,6-galactosidase and -1,4mannanase) from the hyperthermophilic bacterium Thermotoga neapolitana 5068 for hydrolysis of guar
gum. Biotechnol. Bioeng. 52(2): 332-339.
184. Meier, H. 1958. On the structure of cell walls and cell wall mannans from ivory nuts and from dates.
Biochim. Biophys. Acta. 28: 229-240.
185. Meier, H., and J. S. G. Reid. 1982. Reserve Polysaccharides Other Than Starch in Higher Plants, p.
418-471. In F. A. Loewus and W. Tanner (ed.), Encyclopaedia of Plant Physiology New Ser., vol. 13A.
Springer Verlag, Berlin.
186. Mendoza, N. S., M. Arai, T. Kawaguchi, T. Yoshida, and L. M. Joson. 1994. Purification and properties of mannanase from Bacillus subtilis. World J. Microbiol. Biotechnol. 10(5): 551-555.
187. Mendoza, N. S., M. Arai, K. Sugimoto, M. Ueda, T. Kawaguchi, and L. M. Joson. 1995. Cloning and
sequencing of -mannanase gene from Bacillus subtilis NM-39. Biochim. Biophys. Acta. 1243(3): 552-554.
188. Millane, R. P., and T. L. Hendrixson. 1994. Crystal structures of mannan and glucomannans. Carbohydr.
Polym. 25(4): 245-251.
189. Millward-Sadler, S. J., K. Davidson, G. P. Hazlewood, G. W. Black, H. J. Gilbert, and J. H. Clarke.
1995. Novel cellulose-binding domains, NodB homologues and conserved modular architecture in xylanases
from the aerobic soil bacteria Pseudomonas fluorescens subsp. cellulosa and Cellvibrio mixtus. Biochem. J.
312(Pt 1): 39-48.
190. Millward-Sadler, S. J., J. Hall, G. W. Black, G. P. Hazlewood, and H. J. Gilbert. 1996. Evidence
that the Piromyces gene family encoding endo-1,4-mannanases arose through gene duplication. FEMS
Microbiol. Lett. 141(2-3): 183-188.
191. Millward-Sadler, S. J., D. M. Poole, B. Henrissat, G. P. Hazlewood, J. H. Clarke, and H. J. Gilbert. 1994. Evidence for a general role for high-affinity non-catalytic cellulose binding domains in microbial
plant cell wall hydrolases. Mol. Microbiol. 11(2): 375-382.
192. Montiel, M. D., M. Hernandez, J. Rodriguez, and M. E. Arias. 2002. Evaluation of an endo-mannanase produced by Streptomyces ipomoea CECT 3341 for the biobleaching of pine kraft pulps. Appl.
Microbiol. Biotechnol. 58(1): 67-72.
193. Mntyl, A., M. Paloheimo, and P. Suominen. 1998. Industrial mutants and recombinant strains of

63

Trichoderma reesei, p. 291-309. In G. E. Harman and C. P. Kubicek (ed.), Trichoderma & Gliocladium, vol.
2. Taylor & Francis Ltd., London.
194. Navas, J., and P. Beguin. 1992. Site-directed mutagenesis of conserved residues of Clostridium
thermocellum endoglucanase CelC. Biochem. Biophys. Res. Commun. 189(2): 807-812.
195. Neustroev, K. N., A. S. Krylov, L. M. Firsov, and O. N. Abroskina. 1991. Isolation and properties of
-mannosidase from Aspergillus awamori. Biokhimiya. 56: 1406-1412.
196. Nevalainen, H., and D. Neethling. 1998. The Safety of Trichoderma and Gliocladium, p. 193-205. In
C. P. Kubicek and G. E. Harman (ed.), Trichoderma & Gliocladium, vol. 1. Taylor & Francis Ltd., London.
197. Nieduszynski, I., and R. H. Marchessault. 1972. Crystal Structure of Poly-,D-(1 ->4')-mannose:
Mannan I. Can. J. Chem. 50(13): 2130-2138.
198. Nishinari, K., P. A. Williams, and G. O. Phillips. 1992. Review of the physico-chemical characteristics and properties of konjac mannan. Food Hydrocolloids. 6(2): 199-222.
199. Nonogaki, H., O. H. Gee, and K. J. Bradford. 2000. A germination-specific endo--mannanase gene is
expressed in the micropylar endosperm cap of tomato seeds. Plant. Physiol. 123(4): 1235-1246.
200. Nonogaki, H., and Y. Morohashi. 1999. Temporal and spatial pattern of the development of endo-mannanase activity in germinating and germinated lettuce seeds. J. Exp. Bot. 50(337): 1307-1313.
201. Notenboom, V., A. B. Boraston, P. Chiu, A. C. J. Freelove, D. G. Kilburn, and D. R. Rose. 2001.
Recognition of Cello-oligosaccharides by a Family 17 Carbohydrate-binding Module: An X-Ray
Crystallographic, Thermodynamic and Mutagenic Study. J. Mol. Biol. 314(4): 797-806.
202. Notenboom, V., A. B. Boraston, D. G. Kilburn, and D. R. Rose. 2001. Crystal structures of the
family 9 carbohydrate-binding module from Thermotoga maritima xylanase 10A in native and ligand-bound
forms. Biochemistry. 40(21): 6248-6256.
203. Oda, Y., and K. Tonomura. 1996. Characterization of -mannanase and -mannosidase secreted
from the yeast Trichosporon cutaneum JCM 2947. Lett. Appl. Microbiol. 22(2): 173-178.
204. Parker, K. N., S. Chhabra, D. Lam, M. A. Snead, E. J. Mathur, and R. M. Kelly. 2001. Mannosidase from Thermotoga species. Methods Enzymol. 330: 238-246.
205. Parker, K. N., S. R. Chhabra, D. Lam, W. Callen, G. D. Duffaud, M. A. Snead, J. M. Short, E. J.
Mathur, and R. M. Kelly. 2001. Galactomannanases Man2 and Man5 from Thermotoga species: growth
physiology on galactomannans, gene sequence analysis, and biochemical properties of recombinant enzymes. Biotechnol. Bioeng. 75(3): 322-333.
206. Penttil, M. 1998. Heterologous protein production in Trichoderma, p. 365-382. In G. E. Harman and
C. P. Kubicek (ed.), Trichoderma & Gliocladium, vol. 2. Taylor & Francis Ltd., London.
207. Penttil, M., H. Nevalainen, M. Rtt, E. Salminen, and J. Knowles. 1987. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene. 61(2): 155-164.
208. Percival, E. 1970. Algal polysaccharides, p. 537-568. In A. Herp (ed.), The Carbohydrates, vol. 2B.
Academic Press, New York.
209. Politz, O., M. Krah, K. K. Thomsen, and R. Borriss. 2000. A highly thermostable endo--mannanase
from the marine bacterium Rhodothermus marinus. Appl. Microbiol. Biotechnol. 53(6): 715-721.
210. Puls, J., and J. Schuseil. 1993. Chemistry of hemicelluloses: relationship between hemicellulose
structure and enzymes required for hydrolysis, p. 1-27. In M. P. Coughlan and G. P. Hazlewood (ed.), Hemicellulose and Hemicellulases, vol. 4. Portland Press Res. Monogr., London.
211. Punt, P. J., M. A. Dingemanse, A. Kuyvenhoven, R. D. Soede, P. H. Pouwels, and C. A. van den
Hondel. 1990. Functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding
glyceraldehyde-3-phosphate dehydrogenase. Gene. 93(1): 101-109.
212. Purchon, R. D. 1977. The biology of the mollusca, 2nd ed, vol. 57. Pergamon Press Ltd., Oxford.
213. Py, B., I. Bortoli-German, J. Haiech, M. Chippaux, and F. Barras. 1991. Cellulase EGZ of Erwinia
chrysanthemi: structural organization and importance of His98 and Glu133 residues for catalysis. Protein
Eng. 4(3): 325-333.
214. Quiocho, F. A., and N. K. Vyas. 1999. Atomic Interactions Between Proteins/Enzymes and Carbohydrates, p. 441-457. In M. Hecht (ed.), Bioorganic chemistry: Carbohydrates, vol. 1. Oxford University
Press, Oxford.
215. Raghothama, S., P. J. Simpson, L. Szabo, T. Nagy, H. J. Gilbert, and M. P. Williamson. 2000.
Solution structure of the CBM10 cellulose binding module from Pseudomonas xylanase A. Biochemistry.
39(5): 978-984.
216. Regalado, C., B. E. Garcia-Almendarez, L. M. Venegas-Barrera, A. Tellez-Jurado, G. RodriguezSerrano, S. Huerta-Ochoa, and J. R. Whitaker. 2000. Production, partial purification and properties of -

64

mannanases obtained by solid substrate fermentation of spent soluble coffee wastes and copra paste using
Aspergillus oryzae and Aspergillus niger. J. Sci. Food Agric. 80(9): 1343-1350.
217. Reid, J. S. G. 1985. Galactomannans, p. 265-288. In P. M. Dey and R. A. Dixon (ed.), Biochemistry of
Storage Carbohydrates in Green Plants. Academic Press, London.
218. Reinikainen, T., L. Ruohonen, T. Nevanen, L. Laaksonen, P. Kraulis, T. A. Jones, J. K. Knowles,
and T. T. Teeri. 1992. Investigation of the function of mutated cellulose-binding domains of Trichoderma
reesei cellobiohydrolase I. Proteins. 14(4): 475-482.
219. Reinikainen, T., O. Teleman, and T. T. Teeri. 1995. Effects of pH and high ionic strength on the
adsorption and activity of native and mutated cellobiohydrolase I from Trichoderma reesei. Proteins. 22(4):
392-403.
220. Rol, F. 1973. Locust bean gum, p. 323-327. In R. Whistler and J. M. BeMiller (ed.), Industrial gums.
Academic Press, New York.
221. Rtt, M., and K. Poutanen. 1988. Production of Mannan-Degrading Enzymes. Biotechnol. Lett.
10(9): 661-664.
222. Sabini, E. 2001. Structural Investigation of hemicellulose degrading enzymes. Doctoral thesis. University of York, York.
223. Sabini, E., H. Schubert, G. Murshudov, K. S. Wilson, M. Siika-Aho, and M. Penttil. 2000. The
three-dimensional structure of a Trichoderma reesei -mannanase from glycoside hydrolase family 5. Acta
Crystallogr., Sect. D: Biol. Crystallogr. 56(Pt 1): 3-13.
224. Sachslehner, A., G. Foidl, N. Foidl, G. Gbitz, and D. Haltrich. 2000. Hydrolysis of isolated coffee
mannan and coffee extract by mannanases of Sclerotium rolfsii. J. Biotechnol. 80(2): 127-134.
225. Sachslehner, A., and D. Haltrich. 1999. Purification and some properties of a thermostable acidic endo-1,4-D-mannanase from Sclerotium (Athelia) rolfsii. FEMS Microbiol. Lett. 177(1): 47-55.
226. Saka, S. 2001. Chemical Composition and distribution, p. 51-82. In D. N. S. Hon and N. Shiraishi
(ed.), Wood and Cellulosic Chemistry, 2nd ed. Marcel Dekker Inc., New York.
227. Salmn, L., and A.-M. Olsson. 1998. Interaction Between Hemicelluloses, Lignin and Cellulose:
Structure-Property Relationships. J. Pulp Pap. Sci. 24(3): 99-103.
228. Saloheimo, A., M. Ilmn, N. Aro, E. Margolles-Clark, and Penttil. 1998. Regulatory Mechanisms
Involved in Expression of Extracellular Hydrolytic Enzymes of Trichoderma reesei, p. 267-273. In M.
Claeyssens, W. Nerinckx, and P. K. (ed.), Carbohydrases from Trichoderma reesei and other microorganisms: Structure, Biochemistry, Genetics and Applications, vol. 219. Royal Society of Chemistry, Cambridge.
229. Setati, M. E., P. Ademark, W. H. van Zyl, B. Hahn-Hagerdal, and H. Stlbrand. 2001. Expression
of the Aspergillus aculeatus endo-beta-1,4-mannanase encoding gene (man1) in Saccharo myces cerevisiae
and characterization of the recombinant enzyme. Protein Expr. Purif. 21(1): 105-114.
230. Shoham, Y., R. Lamed, and E. A. Bayer. 1999. The cellulosome concept as an efficient microbial
strategy for the degradation of insoluble polysaccharides. Trends Microbiol. 7(7): 275-281.
231. Simpson, P. J., D. N. Bolam, A. Cooper, A. Ciruela, G. P. Hazlewood, H. J. Gilbert, and M. P.
Williamson. 1999. A family IIb xylan-binding domain has a similar secondary structure to a homologous
family IIa cellulose-binding domain but different ligand specificity. Structure Fold. Des. 7(7): 853-864.
232. Simpson, P. J., H. Xie, D. N. Bolam, H. J. Gilbert, and M. P. Williamson. 2000. The structural basis
for the ligand specificity of family 2 carbohydrate-binding modules. J. Biol. Chem. 275(52): 41137-41142.
233. Sinnott, M. L. 1990. Catalytic Mechanism of Enzymic Glycosyl Transfer. Chem. Rev. 90: 1171-1202.
234. Sjstrm, E. 1993. Wood chemistry, fundamentals and applications, 2nd ed. Academic Press, San
Diego.
235. Sone, Y., and A. Misaki. 1978. Purification and characterization of a -D-mannosidase and -Nacetyl-D-hexosaminidase of Tremella fuciformis. J. Biochem. 83: 1135-1144.
236. Srisodsuk, M., J. Lehtio, M. Linder, E. Margolles-Clark, T. Reinikainen, and T. T. Teeri. 1997.
Trichoderma reesei cellobiohydrolase I with an endoglucanase cellulose-binding domain: action on bacterial microcrystalline cellulose. J. Biotechnol. 57(1-3): 49-57.
237. Stoll, D., A. Boraston, H. Stlbrand, B. W. McLean, D. G. Kilburn, and R. A. Warren. 2000.
Mannanase Man26A from Cellulomonas fimi has a mannan-binding module. FEMS Microbiol. Lett. 183(2):
265-269.
238. Stoll, D., S. He, S. G. Withers, and R. A. J. Warren. 2000. Identification of Glu-519 as the catalytic
nucleophile in -mannosidase 2A from Cellulomonas fimi. Biochem. J. 351(3): 833-838.

65

239. Stoll, D., H. Stlbrand, and R. A. Warren. 1999. Mannan-degrading enzymes from Cellulomonas
fimi. Appl. Environ. Microbiol. 65(6): 2598-2605.
240. Stoll, D., H. Stlbrand, and R. A. J. Warren. 2000. Hydrolysis of mannans by Cellulomons fimi, p.
91-98. In M. E. Himmel, J. O. Baker, and J. N. Saddler (ed.), Glycosyl Hydrolases for Biomass Conversion,
vol. 769. American Chemical Society, Washington, D. C.
241. Sthlberg, J., G. Johansson, and G. Pettersson. 1993. Trichoderma reesei has no true exo-cellulase:
all intact and truncated cellulases produce new reducing end groups on cellulose. Biochim. Biophys. Acta.
1157(1): 107-113.
242. Stlbrand, H. 1995. Hemicellulose-degrading enzymes from fungi: Characterization of mannanase
and the man1 gene of Trichoderma reesei. Doctoral thesis. Lund University, Lund.
243. Stlbrand, H. 2002. Enzymology of endo-1,4--Mannanases, p. 961-969. In Whitaker, Voragen, and
Wong (ed.), Handbook of Food Enzymology. Marcel Dekker, Inc., New York.
244. Stlbrand, H., A. Saloheimo, J. Vehmaanpera, B. Henrissat, and M. Penttil. 1995. Cloning and
expression in Saccharomyces cerevisiae of a Trichoderma reesei -mannanase gene containing a cellulose
binding domain. Appl. Environ. Microbiol. 61(3): 1090-1097.
245. Stlbrand, H., M. Siika-aho, M. Tenkanen, and L. Viikari. 1993. Purification and characterization
of two -mannanases from Trichoderma reesei. J. Biotechnol. 29: 229-242.
246. Sugahara, K., T. Okumura, and I. Yamashina. 1972. Purification of -mannosidase from snail,
Achatina fulica and its action on glycopeptides. Biochim. Biophys. Acta. 268: 488-496.
247. Sunna, A., M. D. Gibbs, and P. L. Bergquist. 2001. Identification of novel -mannan- and -glucanbinding modules: evidence for a superfamily of carbohydrate-binding modules. Biochem. J. 356(Pt 3): 791798.
248. Sunna, A., M. D. Gibbs, C. W. Chin, P. J. Nelson, and P. L. Bergquist. 2000. A gene encoding a
novel multidomain -1,4-mannanase from Caldibacillus cellulovorans and action of the recombinant enzyme on kraft pulp. Appl. Environ. Microbiol. 66(2): 664-670.
249. Suurnkki, A., T. Clark, R. Allison, J. Buchert, and L. Viikari. 1996. Mannanase aided bleaching of
soft-wood kraft pulp, p. 69-74. In K. Messner and E. Srebotnik (ed.), Biotechnology in Pulp and Paper
Industry - Advances in Applied and Fundamental Research. WUA Universittsverlag, Vienna.
250. Szabo, L., S. Jamal, H. Xie, S. J. Charnock, D. N. Bolam, H. J. Gilbert, and G. J. Davies. 2001.
Structure of a family 15 carbohydrate-binding module in complex with xylopentaose: Evidence that xylan
binds in an approximate three-fold helical conformation. J. Biol. Chem. 11: 49061-49065.
251. Takada, G., T. Kawaguchi, T. Kaga, J. Sumitani, and M. Arai. 1999. Cloning and sequencing of mannosidase gene from Aspergillus aculeatus NO. F-50. Biosci. Biotechnol. Biochem. 63: 206-209.
252. Talbot, G., and J. Sygusch. 1990. Purification and characterization of thermostable -mannanase and
-galactosidase from Bacillus stearothermophilus. Appl. Environ. Microbiol. 56(11): 3505-3510.
253. Tamaru, Y., T. Araki, H. Amagoi, H. Mori, and T. Morishita. 1995. Purification and characterization of an extracellular -1,4-mannanase from a marine bacterium, Vibrio sp. strain MA-138. Appl. Environ.
Microbiol. 61(12): 4454-4458.
254. Tamaru, Y., T. Araki, T. Morishita, T. Kimura, K. Sakka, and K. Ohmiya. 1997. Cloning, DNA
sequencing, and expression of the -1,4-mannanase gene from a marine bacterium, Vibrio sp. strain MA138. J. Ferment. Bioeng. 83(2): 201-205.
255. Tamaru, Y., and R. H. Doi. 2000. The engL gene cluster of Clostridium cellulovorans contains a gene
for cellulosomal ManA. J. Bacteriol. 182(1): 244-247.
256. Tang, C. M., L. D. Waterman, M. H. Smith, and C. F. Thurston. 2001. The cel4 gene of Agaricus
bisporus encodes a -mannanase. Appl. Environ. Microbiol. 67(5): 2298-2303.
257. Teeri, T., T. Reinikainen, L. Ruohonen, T. A. Jones, and J. K. C. Knowles. 1992. Domain Function
in Trichoderma reesei Cellobiohydrolases. J. Biotechnol. 24(2): 169-176.
258. Tenkanen, M., J. Buchert, and L. Viikari. 1995. Binding of hemicellulases on isolated polysaccharide substrates. Enzyme Microb. Technol. 17: 499-505.
259. Tenkanen, M., M. Makkonen, M. Perttula, L. Viikari, and A. Teleman. 1997. Action of Trichoderma
reesei mannanase on galactoglucomannan in pine kraft pulp. J. Biotechnol. 57(1-3): 191-204.
260. Tenkanen, M., J. Puls, M. Ratt, and L. Viikari. 1993. Enzymic deacetylation of galactoglucomannans.
Appl. Microbiol. Biotechnol. 39(2): 159-165.
261. Tenkanen, M., J. Thornton, and L. Viikari. 1995. An acetylglucomannan esterase of Aspergillus
oryzae; purification, characterization and role in the hydrolysis of O-acetyl-galactoglucomannan. J. Biotechnol.
42(3): 197-206.

66

262. Timell, T. E. 1965. Wood Hemicelluloses: Part II. Adv. Carbohydr. Chem. 20: 409-483.
263. Timell, T. E. 1967. Recent Progress in the chemistry of Wood Hemicellulose. Wood Sci. Technol. 1:
45-70.
264. Todd, A. E., C. A. Orengo, and J. M. Thornton. 1999. Evolution of protein function, from a structural perspective. Curr. Opin. Chem. Biol. 3(5): 548-556.
265. Tomme, P., A. L. Creagh, D. G. Kilburn, and C. A. Haynes. 1996. Interaction of polysaccharides
with the N-terminal cellulose-binding domain of Cellulomonas fimi CenC. 1. Binding specificity and calorimetric analysis. Biochemistry. 35(44): 13885-13894.
266. Tomme, P., E. Kwan, N. R. Gilkes, D. G. Kilburn, and R. A. J. Warren. 1996. Characterization of
CenC, an enzyme from Cellulomonas fimi with both endo- and exoglucanase activities. J. Bacteriol. 178(14):
4216-4223.
267. Tomme, P., H. Van Tilbeurgh, G. Pettersson, J. Van Damme, J. Vandekerckhove, J. Knowles, T.
Teeri, and M. Claeyssens. 1988. Studies of the cellulolytic system of Trichoderma reesei QM 9414. Analysis of domain function in two cellobiohydrolases by limited proteolysis. Eur. J. Biochem. 170(3): 575-581.
268. Tomme, P., R. A. Warren, and N. R. Gilkes. 1995. Cellulose hydrolysis by bacteria and fungi. Adv.
Microb. Physiol. 37: 1-81.
269. Tomme, P., R. A. J. Warren, R. C. J. Miller, D. G. Kilburn, and N. R. Gilkes. 1995. CelluloseBinding Domains: Classification and Properties, p. 142-163. In J. M. Saddler and M. Penner (ed.), Enzymatic
Degradation of Insoluble Polysaccharides. American Chemical Society, Washington, DC.
270. Toorop, P. E., A. C. van Aelst, and H. W. Hilhorst. 2000. The second step of the biphasic endosperm
cap weakening that mediates tomato (Lycopersicon esculentum) seed germination is under control of ABA.
J. Exp. Bot. 51(349): 1371-1379.
271. Tormo, J., R. Lamed, A. J. Chirino, E. Morag, E. A. Bayer, Y. Shoham, and T. A. Steitz. 1996.
Crystal structure of a bacterial family-III cellulose-binding domain: a general mechanism for attachment to
cellulose. EMBO J. 15(21): 5739-5751.
272. Torto, N., T. Buttler, L. Gorton, G. Marko-Varga, H. Stlbrand, and F. Tjerneld. 1995. Monitoring of enzymic hydrolysis of ivory nut mannan using online microdialysis sampling and anion-exchange
chromatography with integrated pulsed electrochemical detection. Anal. Chim. Acta. 313(1-2): 15-24.
273. Torto, N., G. Marko-Varga, L. Gorton, H. Stlbrand, and F. Tjerneld. 1996. Online quantitation of
enzymic mannan hydrolyzates in small-volume bioreactors by microdialysis sampling and column liquid chromatography-integrated pulsed electrochemical detection. J. Chromatogr. A. 725(1): 165-175.
274. Waino, M., and K. Ingvorsen. 1999. Production of halostable -mannanase and -mannosidase by
strain NN, a new extremely halotolerant bacterium. Appl. Microbiol. Biotechnol. 52(5): 675-680.
275. Wan, C., J. Muldry, Y. Li, and Y. Lee. 1976. -Mannosidase from the mushroom Polyporous sulfureus.
J. Biol. Chem. 251: 4384-4388.
276. van Tilbeurgh, H., P. Tomme, M. Claeyssens, R. Bhikhabhai, and G. Pettersson. 1986. Limited
proteolysis of the cellobiohydrolase I from Trichoderma reesei. FEBS. 204(2): 223-227.
277. Wang, Q., D. Tull, A. Meinke, N. R. Gilkes, R. A. Warren, R. Aebersold, and S. G. Withers. 1993.
Glu280 is the nucleophile in the active site of Clostridium thermocellum CelC, a family A endo--1,4glucanase. J. Biol. Chem. 268(19): 14096-14102.
278. Warren, R. A. 1996. Microbial hydrolysis of polysaccharides. Annu. Rev. Microbiol. 50: 183-212.
279. Viikari, L., J. Pere, A. Suurnkki, T. Oksanen, and J. Buchert. 1998. Use of cellulases in pulp and
paper applications, p. 245-254. In M. Claeyssens, W. Nerinckx, and K. Piens (ed.), Carbohydrases from
Trichoderma reesei and other microorganisms: Structure, Biochemistry, Genetics and Applications, vol.
219. Royal Society of Chemistry, Cambridge.
280. Viikari, L., M. Tenkanen, J. Buchert, M. Rtt, M. Bailey, M. Siika-aho, and M. Linko. 1993.
Hemicellulases for Industrial Applications, p. 131-182. In J. N. Saddler (ed.), Bioconversion of forest and
agricultural plant residues, vol. 9. C. A. B. International, Wallingford, UK.
281. Withers, S. G. 2001. Mechanisms of glycosyl transferases and hydrolases. Carbohydr. Polym. 44(4):
325-337.
282. Wolfenden, R., X. Lu, and G. Young. 1998. Spontaneous Hydrolysis of Glycosides. J. Am. Chem.
Soc. 120(27): 6814-6815.
283. Wolfrom, M. L., M. L. Layer, and D. L. Patin. 1961. Carbohydrates of the coffee bean. II. Isolation
and characterization of a mannan. J. Org. Chem. 26: 4533-4535.
284. Wong, K. K. Y., and J. N. Saddler. 1993. Applications of hemicellulases in the food, feed, and pulp

67

and paper industries, p. 127-143. In M. P. Coughlan and G. P. Hazlewood (ed.), Hemicellulose and
Hemicellulases, vol. 4. Portland Press Res. Monogr., London.
284. Wong, K. K. Y., and J. N. Saddler. 1993. Applications of hemicellulases in the food, feed, and pulp
and paper industries, p. 127-143. In M. P. Coughlan and G. P. Hazlewood (ed.), Hemicellulose and
Hemicellulases, vol. 4. Portland Press Res. Monogr., London.
285. Xie, H., D. N. Bolam, T. Nagy, L. Szabo, A. Cooper, P. J. Simpson, J. H. Lakey, M. P. Williamson,
and H. J. Gilbert. 2001. Role of hydrogen bonding in the interaction between a xylan binding module and
xylan. Biochemistry. 40(19): 5700-5707.
286. Xu, B., I. I. Munoz, J. C. Janson, and J. Sthlberg. 2002. Crystallization and X-ray analysis of
native and selenomethionyl -mannanase Man5A from blue mussel, Mytilus edulis, expressed in Pichia
pastoris. Acta Crystallogr., Sect D: Biol. Crystallogr. 58(Pt 3): 542-545.
287. Xu, B., D. Sellos, and J. C. Janson. 2002. Cloning and expression in Pichia pastoris of a blue mussel
(Mytilus edulis) -mannanase gene. Eur. J. Biochem. 269(6): 1753-1760.
288. Xu, G. Y., E. Ong, N. R. Gilkes, D. G. Kilburn, D. R. Muhandiram, M. Harris-Brandts, J. P.
Carver, L. E. Kay, and T. S. Harvey. 1995. Solution structure of a cellulose-binding domain from
Cellulomonas fimi by nuclear magnetic resonance spectroscopy. Biochemistry. 34(21): 6993-7009.
289. Yage, E., M. Mehak-Zunic, L. Morgan, D. A. Wood, and C. F. Thurston. 1997. Expression of
CEL2 and CEL4, two proteins from Agaricus bisporus with similarity to fungal cellobiohydrolase I and mannanase, respectively, is regulated by the carbon source. Microbiology (Reading, U. K.). 143(Pt 1): 239244.
290. Yamamoto, K., S.-C. Li, and Y.-T. Li. 2000. Microbial glycosidases. Carbohydr. Chem. Biol. 3: 497511.
291. Yamaura, I., and T. Matsumoto. 1993. Purification and some properties of endo-1,4-D-mannanase
from a mud snail, Pomacea insularus (de Ordigny). Biosci. Biotechnol. Biochem. 57(8): 1316-1319.
292. Yamaura, I., Y. Nozaki, T. Matsumoto, and T. Kato. 1996. Purification and some properties of an
endo-1,4--D-mannanase from a marine mollusc, Littorina brevicula. Biosci. Biotechnol. Biochem. 60(4):
674-676.
293. Yoshida, S., Y. Sako, and A. Uchida. 1998. Cloning, sequence analysis, and expression in Escherichia
coli of a gene coding for an enzyme from Bacillus circulans K-1 that degrades guar gum. Biosci. Biotechnol.
Biochem. 62(3): 514-520.
294. Yosida, S., Y. Sako, and A. Uchida. 1997. Purification, properties, and N-terminal amino acid sequences of guar gum-degrading enzyme from Bacillus circulans K-1. Biosci. Biotechnol. Biochem. 61(2):
251-255.
295.Yui, T., K. Ogawa, and A. Sarko. 1992. Packing analysis of carbohydrates and polysaccharides. Part
18. Molecular and crystal structure of konjac glucomannan in the mannan II polymorphic form. Carbohydr.
Res. 229(1): 41-55.
296. Zakaria, M. M., M. Ashiuchi, S. Yamamoto, and T. Yagi. 1998. Optimization for -mannanase production of a psychrophilic bacterium, Flavobacterium sp. Biosci. Biotechnol. Biochem. 62(4): 655-660.
297. kerholm, M., and L. Salmn. 2001. Interactions between wood polymers studied by dynamic FTIR spectroscopy. Polymer. 42(3): 963-969.

68

69

Journal of Biotechnology 75 (1999) 281 289

www.elsevier.com/locate/jbiotec

Hydrolytic properties of a b-mannosidase purified from

Aspergillus niger
Pia Ademark a, Jon Lundqvist a, Per Hagglund a, Maija Tenkanen b,
Nelson Torto c, Folke Tjerneld a, Henrik Stalbrand a,*
a

Department of Biochemistry, Center for Chemistry and Chemical Engineering, Lund Uni6ersity, PO Box 124,
S-221 00 Lund, Sweden
b
VTT Biotechnology and Food Research, PO Box 1500, FIN-02044 VTT, Espoo, Finland
c
Department of Analytical Chemistry, Center for Chemistry and Chemical Engineering, Lund Uni6ersity, PO Box 124,
S-221 00 Lund, Sweden
Received 25 January 1999; received in revised form 1 July 1999; accepted 6 July 1999

Abstract
A b-mannosidase was purified to homogeneity from the culture filtrate of Aspergillus niger. A specific activity of
500 nkat mg 1 and a 53-fold purification was achieved using ammonium sulfate precipitation, anion-exchange
chromatography, and gel filtration. The isolated enzyme has an isoelectric point of 5.0 and appears to be a dimer
composed of two 135-kDa subunits. It is a glycoprotein and contains 17% N-linked carbohydrate by weight. Maximal
activity was observed at pH 2.45.0 and at 70C. The b-mannosidase hydrolyzed b-1,4-linked manno-oligosaccharides of degree of polymerization (DP) 26 and also released mannose from polymeric ivory nut mannan and
galactomannan. The Km and Vmax values for p-nitrophenyl-b-D-mannopyranoside were 0.30 mM and 500 nkat mg 1,
respectively. Hydrolysis of D-galactose substituted manno-oligosaccharides showed that the b-mannosidase was able
to cleave up to, but not beyond, a side group. An internal peptide sequence of 15 amino acids was highly similar to
that of an Aspergillus aculeatus b-mannosidase belonging to family 2 of glycosyl hydrolases. 1999 Elsevier Science
B.V. All rights reserved.
Keywords: Aspergillus niger; b-Mannosidase; Manno-oligosaccharides; Hydrolysis

1. Introduction
b-Mannosidase (b-D-mannoside mannohydrolase, EC 3.2.1.25) catalyzes the successive removal
* Corresponding author. Tel.: +46-46-222-8202; fax: +4646-222-4534.
E-mail
address:
henrik.stalbrand@biokem.lu.se
(H.
Stalbrand)

of D-mannose residues from the nonreducing end

of various b-1,4-linked manno-oligosaccharides. It
is essential for the complete hydrolysis of plant
polysaccharides such as galacto(gluco)mannan
and mannan, and readily converts the mannooligosaccharides produced by b-mannanase (EC
3.2.1.78) to mannose (Reese and Shibata, 1965).
Thus, b-mannosidase is important in the enzy-

0168-1656/99/$ - see front matter 1999 Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 8 - 1 6 5 6 ( 9 9 ) 0 0 1 7 2 - 8

282

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

matic saccharification of hemicellulose to

monomeric sugars for further conversion to
chemicals and fuels. It also cleaves b-1,4-mannosidic linkages in the carbohydrate chains of glycoproteins and is frequently used for structural
studies of these glycans. There is a great interest
in using b-mannosidase and related enzymes in
the synthesis of oligosaccharides for medical and
other purposes (Kobata, 1993). A b-mannosidase from Cellulomonas fimi was recently mutagenized in order to improve the enzyme for
synthetic applications (Stoll, 1998), similarly as
has been done for other glycosidases (McKenzie
et al., 1998). The lysosomal storage disease bmannosidosis, which is caused by insufficient bmannosidase activity, has also attracted
attention to this enzyme (Neufeld, 1991).
Relatively few microbial b-mannosidases have
been purified and characterized (reviewed by Viikari et al., 1993), even though they have been
reported to occur in many microorganisms,
plants, and animal tissues (Dey, 1978). Purification of a b-mannosidase from Aspergillus niger
was first described by Elbein et al. (1977) and
Bouquelet et al. (1978). In the present work
some biochemical properties of a highly purified
b-mannosidase from Aspergillus niger are described. Its activity towards different substrates,
especially side group substituted oligosaccharides
and polymers, was investigated.

2. Materials and methods

2.1. Enzyme source

A. niger ATCC-46890 was obtained from the
QM Culture Collection, Department of Botany,
University of Massachusetts, Amherst, USA.
The fungus was cultivated on galactomannan as
described previously (Ademark et al., 1998) and
the culture fluid was used as the source of bmannosidase.

2.2. Acti6ity assays

b-Mannosidase, a-galactosidase, and b-glucosi-

dase activities were assayed at pH 4.5 with 2

mM p-nitrophenyl-b-D-mannopyranoside (Sigma
N-1268), 4 mM p-nitrophenyl-a-D-galactopyranoside (Sigma N-0877), and 5 mM p-nitrophenyl-b-D-glucopyranoside (Sigma N-7006),
respectively, as described by Ratto and
Poutanen (1988). All enzyme activities were expressed in SI units (katals). A plate assay technique with locust bean gum galactomannan as
substrate and Congo red staining (Stalbrand et
al., 1993) was used to detect b-mannanase
activity.

2.3. Gel electrophoresis

Sodium
dodecylsulfate-polyacrylamide
gel
electrophoresis (SDS-PAGE) under both reducing (with b-mercaptoethanol) and nonreducing
conditions and isoelectric focusing (IEF) were
performed using the PhastSystem (Pharmacia
Biotech, Uppsala, Sweden) in accordance with
the manufacturers instructions. Precast gels
(PhastGel 4-15 and PhastGel IEF 4-6.5) were
obtained from Pharmacia, and proteins were visualized with silver staining. Marker proteins
(Low pI Kit, HMW-SDS and LMW Calibration
Kits) from Pharmacia were run in parallel. Twodimensional gel electrophoresis (IEF followed by
SDS-PAGE) was carried out as described by Yu
et al. (1994).

2.4. Protein assay

Protein concentrations were measured by the
Micro BCA Protein Assay (Pierce, Rockford,
IL), using bovine serum albumin (BSA) as standard. All chromatographic runs were monitored
for protein by absorbance at 280 nm.

2.5. Deglycosylation
The carbohydrate content of the b-mannosidase was estimated by treating it with N-glycosidase F (PNGase F, New England Biolabs,
USA) as described by the manufacturer. The
molecular mass of the N-deglycosylated enzyme
was subsequently determined by SDS-PAGE.

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

2.6. Internal amino acid sequence determination

An internal amino acid sequence determination
was done by Innovagen AB (Lund, Sweden). The
b-mannosidase was digested with endoproteinase
Lys C and the amino acid sequence of one of the
peptide fragments was determined by Edman
degradation, using an ABI 476A instrument (Foster City, CA).

283

ranging from 2.6 to 8 using the same buffer

systems as above. For determination of temperature stability, purified b-mannosidase was incubated (2.5 mg ml 1) at different temperatures for
24 h in citrate-phosphate buffer (50 mM, pH 5.0).
The remaining activity was then measured at standard conditions. Optimal temperature for b-mannosidase activity was determined by assaying at
different temperatures. All samples were analyzed
in duplicate.

2.7. Purification of the b-mannosidase

2.9. Kinetic properties
Solid ammonium sulfate was added to 100 ml
of the culture filtrate under slow stirring to obtain
80% saturation. The precipitate was collected by
centrifugation and then dissolved in 20 ml sodium
acetate buffer, pH 4.5. Three ml of this solution
was desalted and equilibrated with 20 mM ammonium acetate buffer, pH 7.5, by using a Fast
Desalting Column (Pharmacia). The sample was
then directly loaded on a Resource Q 1 ml
anion-exchange column (Pharmacia) equilibrated
with the same buffer. Proteins were eluted with a
linear gradient (060%) of 1 M ammonium acetate, pH 7.5. Fractions of 0.25 ml were collected
and assayed for b-mannosidase, a-galactosidase,
and b-mannanase activities. The eight fractions
most active in b-mannosidase were pooled and
further purified on a HiLoad 16/60 gel filtration
column pre-packed with Superdex 200 pg (Pharmacia). Elution was achieved using 200 mM NaCl
in 100 mM sodium acetate buffer, pH 4.5, at a
flow rate of 0.5 ml min 1. Fractions of 1 ml were
collected and assayed for b-mannosidase and agalactosidase activities. Both ion-exchange chromatography and gel filtration were performed at
room temperature using an FPLC System
(Pharmacia).

2.8. pH and temperature optima and stabilities

The pH stability was investigated by incubating
the purified b-mannosidase (2.5 mg ml 1) at different pH values (pH 2.6 7: 50 mM citrate-phosphate buffer, pH 7.5 8: 50 mM phosphate buffer)
for 24 h at 50C, and then measuring the residual
activity. The pH optimum was determined by
measuring b-mannosidase activity at pH values

The MichaelisMenten constant (Km) and the

maximal reaction velocity (Vmax) for the b-mannosidase were determined by incubating it with
p-nitrophenyl-b-D-mannopyranoside in concentrations ranging from 0.1 to 4 mM. The reactions
were stopped after 5 min, when less than 5% of
the substrate had been degraded, and the release
of p-nitrophenol was measured at standard assay
conditions. All assays were performed in duplicate. The linearity of the reaction was confirmed
by measuring the amount of released p-nitrophenol at three different timepoints: 3, 5, and 7 min.
Values for Km and Vmax were determined from a
LineweaverBurk plot.

2.10. Hydrolysis experiments

The ability of the b-mannosidase to hydrolyze
different oligosaccharides as well as polymeric
mannan and galactomannan was investigated.
Linear b-1,4-linked manno-oligosaccharides of
DP 2 to 6, 61-a-D-galactosylmannotriose
(GalMan3),
63,64-a-D-galactosylmannopentaose
(Gal2Man5) and ivory nut (Phytelephas macrocarpa) mannan were purchased from Megazyme
(Bray, Ireland). 61-a-D-galactosylmannobiose
(GalMan2) and 4-b-D-glucosylmannose (GlcMan)
were prepared as described in Tenkanen et al.
(1997). Locust bean gum galactomannan (a linear
b-1,4-linked mannan backbone substituted with
galactose side groups) was obtained from Sigma
(St. Louis, MO). The substrate concentrations
were 2.5 mg ml 1 in 100 mM sodium acetate
buffer (pH 4.5), and the b-mannosidase dosage
was 2.5 mg ml 1 for locust bean gum hydrolysis

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

284

with a 100 mM sodium hydroxide mobile phase,

using integrated pulsed electrochemical detection
(IPED) (Torto et al., 1995). Mannose and mannooligosaccharides of DP 26 were used for calibration and all samples were analyzed in duplicate
(S.D. 35%). The release of mannose from mannan and galactomannan was calculated as % of
the value obtained by acid hydrolysis (Ademark et
al., 1998). Other hydrolysates were analyzed as
described in Tenkanen et al. (1997), using single
injections.
3. Results and discussion
Fig. 1. Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of the purified b-mannosidase before
(A, 0.4 mg protein) and after (B, 0.4 mg protein) N-deglycosylation, and under nonreducing conditions (C, 0.4 mg protein).
The positions of molecular weight markers are indicated.
Proteins were detected with silver staining.

and 6.7 mg ml 1 for all other experiments. Single

reaction mixtures were incubated at 40C for 48 h
and samples were withdrawn and heated to 100C
before enzyme addition and at various times during hydrolysis. In the case of ivory nut mannan,
the reaction was allowed to continue for 6 days
and an equal amount of fresh enzyme (6.7 mg
ml 1) was added after 48 and 96 h.
A Dionex 500 chromatographic system, controlled by PeakNet software, Dionex (Sunnyvale, CA) was used to separate and detect the
carbohydrates during hydrolysis. Chromatographic separation of hydrolysates from linear
manno-oligosaccharides, mannan, and galactomannan was achieved isocratically by a Carbo
Pac PA 100 pre- and analytical column (Dionex)

3.1. Purification of the b-mannosidase

A b-mannosidase from Aspergillus niger was
purified to homogeneity and its hydrolytic and
other properties were investigated. A single peak
of activity was detected in both anion-exchange
chromatography and gel filtration, indicating that
the fungus under the applied conditions produces
only one form of b-mannosidase. After the final
purification step the b-mannosidase was judged
pure; it appeared as a single band on both SDSPAGE (Fig. 1) and IEF (not shown) after staining
with silver nitrate. No a-galactosidase or b-glucosidase activity could be detected, and the bmannanase plate assay showed no trace of
b-mannanase activity even after an incubation
time of 8 h at 40C (not shown). The high purity
of the preparation was confirmed by two-dimensional gel electrophoresis (not shown). A 53-fold
purification of the b-mannosidase and a total
recovery of 45% were obtained. The purification is
summarized in Table 1.

Table 1
Purification of b-mannosidase from Aspergillus niger culture filtrate
Purification step

Volume (ml)

Activity (nkat)

Protein (mg)

Culture filtrate
(NH4)2SO4 precipitation
Anion exchange
chromatography
Gel filtration

15
3

150
144

16
6.7

Specific activity
(nkat mg1)
9.4
21

Yield (%)

Purification
(-fold)

(100)
96

(1)
2.2

1.5

84

0.50

170

56

18

67

0.134

500

45

53

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

285

Fig. 2. Effect of pH (A) and temperature (B) on b-mannosidase activity ( ) and stability (). The pH- and temperature optima
were determined by measuring the activity at different pH values and temperatures, respectively. The pH- and thermostabilities were
determined by incubating the b-mannosidase (2.5 mg ml 1) for 24 h at different pH values (at 50C) and temperatures (at pH 5.0),
respectively, and then measuring the residual activity. Error bars show the S.D. of the data.

3.2. Properties of the b-mannosidase

The isoelectric point of the purified b-mannosidase was determined to be 5.0 (not shown), which
is close to the previously reported value of 4.7 for
an A. niger b-mannosidase (Bouquelet et al.,
1978). Nonreducing SDS-PAGE gave an estimated molecular mass of 264 kDa (Fig. 1), and
under reducing conditions a single band of 135
kDa was observed (Fig. 1). Analysis by gel filtration showed a molecular mass of 180 kDa. The
results, although not totally in agreement, may
suggest that the b-mannosidase is a dimer composed of two 135-kDa subunits. The deglycosylated b-mannosidase had a molecular mass of 112
kDa (Fig. 1), indicating an N-linked carbohydrate
content of 17% by weight. The molecular mass of
an A. niger b-mannosidase has previously been
reported to be 130 9 5 kDa (Bouquelet et al.,
1978) and 120 kDa (Elbein et al., 1977),
respectively.
Maximal b-mannosidase activity was observed
within the pH range 2.5 5 (Fig. 2A) and at 70C
(Fig. 2B). The enzyme showed highest stability at
pH 46 (Fig. 2A). The temperature stability of
the b-mannosidase is shown in Fig. 2B. About
70% of the original activity remained after incubation at 50C for 24 h.
The amino acid sequence of an internal peptide
fragment was determined to be DAAPSSYS-

YYVGEYE. Comparison of the sequence with

that of a cloned b-mannosidase from A. aculeatus
(Takada et al., 1999) showed a high similarity in a
region close to one of the predicted catalytic
residues; ten out of 15 amino acids were identical.
Consequently, like the A. aculeatus enzyme, the A.
niger b-mannosidase probably also belongs to
family 2 of glycosyl hydrolases (Henrissat and
Bairoch 1993).

3.3. Kinetic properties

The Km and Vmax values for p-nitrophenyl-b-Dmannopyranoside were determined to 0.30 mM
and 500 nkat mg 1, respectively, using the
LineweaverBurk plot (not shown). Earlier investigations on an A. niger b-mannosidase reported
Km values of 0.46 mM (Bouquelet et al., 1978)
and 2 mM (Elbein et al., 1977). For the Aspergillus awamori b-mannosidase, the Km value was
0.80 mM (Neustroev et al., 1991).

3.4. Hydrolysis experiments

The linear manno-oligosaccharides of DP 26
were completely degraded to mannose within 7 h
of incubation with the b-mannosidase (Fig. 3).
The absence of oligosaccharides longer than mannose after hydrolysis shows that the purified enzyme acts in an exo-wise manner. No activity

286

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

could be detected towards xylobiose, cellobiose,

or GlcMan.
The
substituted
manno-oligosaccharides,
GalMan2, GalMan3, and Gal2Man5, were hydrolyzed to a lesser extent than the non-substituted ones, as shown in Table 2. About 43% of
the GalMan2 were degraded to GalMan and mannose when incubated with the b-mannosidase for
48 hours. GalMan3 was completely converted to
mannose and GalMan2, which was further hydrolyzed to GalMan at a slower rate. About 18%
of the Gal2Man5 were split to mannose and
Gal2Man4, which was resistant to further hydrolysis. The hydrolysis pattern of these substrates
clearly shows that the b-mannosidase is able to
cleave up to, but not beyond a mannose residue
carrying a galactosyl substituent. Thus, its mode
of action towards galactomanno-oligosaccharides
seems to be similar to that of a b-mannosidase
from the snail Helix pomatia (McCleary et al.,
1982).
Interestingly, the b-mannosidase was also able
to attack ivory nut mannan and galactomannan.
The amount of released mannose from ivory nut
mannan was equal to 25% after 7 h of incubation
(Fig. 3). After another enzyme addition the degree
of hydrolysis reached a maximum of 53% (not
shown). The ivory nut mannan preparation used

Table 2
Hydrolysis of galactomanno-oligosaccharides by Aspergillus
niger b-mannosidasea
Substrate

GalMan2

GalMan3

Gal2Man5

Degree of
hydrolysis
(%)

43

\99b/17c

18

a
Purified b-mannosidase (6.7 mg ml1) was incubated with
galactomanno-oligosaccharides (2.5 mg ml1) at 40C for 48
h. , completely hydrolyzed linkage;-- -\, partially hydrolyzed linkages; *, the reducing end.
b,c
Hydrolysis of the first/second mannose residue from the
nonreducing end, respectively.

Fig. 3. Time course of hydrolysis of manno-oligosaccharides of

DP 2 6 and ivory nut mannan by Aspergillus niger b-mannosidase. Each substrate (2.5 mg ml 1) was incubated with
the enzyme (2.3 nkat ml 1) at pH 4.5 and 40C for 7 h.
Aliquots were removed at various times and analyzed on a
Dionex 500 chromatographic system. The degree of hydrolysis
is shown in percent. Key: () Man2, () Man3, ( ) Man4,
( ) Man5, () Man6, and (
) ivory nut mannan.

in the hydrolysis experiments was confirmed to be

free of soluble oligosaccharides of at least up to
DP 6 (results not shown).
The amount of released mannose from locust
bean gum galactomannan was 1.4% after 24 h and
1.6% after 40 h of incubation with the b-mannosidase. Since the b-mannosidase removes mannose
residues from the nonreducing end until it reaches
a galactose side group, it is possible to determine
some structural features of the substrate. Locust
bean gum galactomannan has been reported to
have a DP of 1500 (Hui and Neukom, 1964), so
the release of 1.6% of the mannose residues gives

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

that the estimated number of terminal, unsubstituted mannose units at the nonreducing end is, in
average, equal to 24.
The ability of the b-mannosidase to attack ivory
nut mannan and galactomannan is an interesting
property. It obviously has a role in the degradation
of mannan and galacomannan polymers, but a
more detailed kinetic study is needed to fully
understand the mode of action of this enzyme. This
work is currently in progress. Several microbial
b-mannosidases have been shown to hydrolyze
manno-oligosaccharides (Reese and Shibata, 1965;
Hashimoto and Fukumoto, 1969; Wan et al., 1976;
Elbein et al., 1977; Sone and Misaki, 1978; Akino
et al., 1988; Oda and Tonomura, 1996), but few
publications contain information on whether the
enzyme is active on polymeric substrates. An A.
niger b-mannosidase preparation was earlier shown
to release reducing sugars from galactomannan
(Elbein et al., 1977). However, this preparation also
contained a-galactosidase and other activities. A
b-mannosidase from the mushroom Polyporus sulfureus hydrolyzed mannobiose and mannotriose,
but was not able to attack ivory nut mannan (Wan
et al., 1976). Araki and Kitamikado (1982) reported
on an enzyme from Aeromonas sp. that hydrolyzed
codium and coffee mannans and manno-oligosaccharides of DP 3 or more. It released however only
mannobiose, and not mannose, from the substrates
and did not act on p-nitrophenyl-b-D-mannopyranoside or mannobiose. b-Xylosidases from the
fungi Trichoderma reesei (Margolles-Clark et al.,
1996) and Malbranchea pulchella var. sulfurea
(Matsuo et al., 1977) have been reported to release
xylose from polymeric xylan.
The exo-wise mode of action of b-mannosidase
has made it a widely used tool for structural
analysis of complex oligosaccharides. A b-mannosidase preparation from A. niger has been used
together with Mortierella 6inacea a-galactosidase
to determine the structure of galactomannooligosaccharides derived from copra galactomannan (Kusakabe et al., 1990), and an A. niger
b-mannosidase was also used in studies of acetylglucomannan esterase (Tenkanen et al., 1995). The
b-mannosidase purified in the current work was
recently used to determine the structure of oligosaccharides formed during T. reesei b-mannanase

287

treatment of pine kraft pulp (Tenkanen et al.,

1997).
The ability to transglycosylate seems to be common among b-mannosidases of microbial origin
and has been noted in for example Rhizopus ni6eus
(Hashimoto and Fukumoto, 1969) and an alkalophilic Bacillus sp. (Akino et al., 1988). A crude
b-mannosidase preparation from A. niger showed
good transmannosylation capacity and produced
alkyl-b-mannosides when incubated with mannobiose and various alcohols (Holazo et al., 1992;
Itoh and Kamiyama, 1995). No obvious signs of
transglycosylation activity were observed in the
current work, but this needs to be further investigated. Classified b-mannosidases belong to family
1 and 2 of glycosyl hydrolases (Chen et al., 1995;
Bauer et al., 1996; Leipprandt et al., 1996; Alkhayat
et al., 1998; Stoll et al., 1999; Takada et al., 1999).
The enzymes in both these families act by the
retaining mechanism, a prerequisite for the ability
to perform transglycosylation, i.e. synthesis of
oligosaccharides. Cloning and characterization of
the gene encoding the A. niger b-mannosidase is
now in progress, and will provide further information on the family classification and thus the
hydrolytic mechanism of the enzyme.

Acknowledgements
We thank Dr Shi-Gui Yu for performing the
two-dimensional electrophoresis, Marjukka Perttula for HPLC analysis of hydrolysates from the
galactomanno-oligosaccharides,
and
Riitta
Isoniemi for performing part of the hydrolysis
experiments. This study was supported by a grant
to FT from the Swedish National Board for Industrial and Technical Development (NUTEK) and a
grant to HS from the Swedish Research Council for
Engineering Sciences (TFR).

References
Ademark, P., Varga, A., Medve, J., Harjunpaa, V., Drakenberg, T., Tjerneld, F., Stalbrand, H., 1998. Softwood hemicellulose-degrading enzymes from Aspergillus niger:
purification and properties of a b-mannanase. J. Biotechnol. 63, 199 210.

288

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

Akino, T., Nakamura, N., Horikoshi, K., 1988. Characterization of b-mannosidase of an Alkalophilic Bacillus sp.
Agric. Biol. Chem. 52, 14591464.
Alkhayat, A.H., Kraemer, S.A., Leipprandt, J.R., Macek,
M., Kleijer, W.J., Friderici, K.H., 1998. Human b-mannosidase cDNA characterization and first identification
of a mutation associated with human b-mannosidosis.
Hum. Mol. Genet. 7, 7583.
Araki, T., Kitamikado, M., 1982. Purification and characterization of a novel exo-b-mannanase from Aeromonas sp.
F-25. J. Biochem. 91, 11811186.
Bauer, M.W., Bylina, E.J., Swanson, R.V., Kelly, R.M.,
1996. Comparison of a b-glucosidase and a b-mannosidase from the hyperthermophilic archaeon Pyrococcus furiosus. Purification, characterization, gene cloning, and
sequence analysis. J. Biol. Chem. 271, 2374923755.
Bouquelet, S., Spik, G., Montreuil, J., 1978. Properties of a
b-D-mannosidase from Aspergillus niger. Biochim. Biophys. Acta 522, 521 530.
Chen, H., Leipprandt, J.R., Traviss, C.E., Sopher, B.L.,
Jones, M.Z., Cavanagh, K.T., Friderici, K.H., 1995.
Molecular cloning and characterization of bovine b-mannosidase. J. Biol. Chem. 270, 38413848.
Dey, P.M., 1978. Biochemistry of plant galactomannans.
Adv. Carbohydr. Chem. Biochem. 35, 341376.
Elbein, A.D., Adya, S., Lee, Y.C., 1977. Purification and
properties of a b-mannosidase from Aspergillus niger. J.
Biol. Chem. 252, 20262031.
Hashimoto, Y., Fukumoto, J., 1969. Studies on the enzyme
treatment of coffee beans. Part II. Purification and properties of b-mannosidase from Rhizopus ni6eus. Nippon
Nogei Kagaku Kaishi 43, 564569.
Henrissat, B., Bairoch, A., 1993. New families in the classification of glycosyl hydrolases based on amino-acid sequence similarities. Biochem. J. 293, 781788.
Holazo, A., Shinoyama, H., Kamiyama, Y., Yasui, T., 1992.
Screening for b-mannosidases with transmannosidation
capacity. Biosci. Biotech. Biochem. 56, 822824.
Hui, P.A., Neukom, H., 1964. Properties of galactomannans.
Tappi 47, 39 42.
Itoh, H., Kamiyama, Y., 1995. Synthesis of alkyl b-mannosides from mannobiose by Aspergillus niger b-mannosidase. J. Ferment. Bioeng. 80, 510512.
Kobata, A., 1993. Glycobiology: an expanding research area
in carbohydrate chemistry. Acc. Chem. Res. 26, 319
324.
Kusakabe, I., Kaneko, R., Takada, N., Zamora, A.F., Fernandez, W.L., Murakami, K., 1990. A simple method for
elucidating structures of galactomanno-oligosaccharides
by sequential actions of b-mannosidase and a-galactosidase. Agric. Biol. Chem. 54, 10811083.
Leipprandt, J.R., Kraemer, S.A., Haithcock, B.E., Chen, H.,
Dyme, J.L., Cavanagh, K.T., Friderici, K.H., Jones,
M.Z., 1996. Caprine b-mannosidase: sequencing and
characterization of the cDNA and identification of the
molecular defect of caprine beta-mannosidosis. Genomics
37, 51 56.

Margolles-Clark, E., Tenkanen, M., Nakari-Setala, T., Penttila, M., 1996. Cloning of genes encoding a-L-arabinofuranosidase and b-xylosidase from Trichoderma reesei by
expression in Saccharomyces cere6isiae. Appl. Environ.
Microbiol. 62, 3840 3846.
Matsuo, M., Yasui, T., Kobayashi, T., 1977. Enzymatic
properties of b-xylosidase from Malbranchea pulchella
var. sulfurea No. 48. Agric. Biol. Chem. 41, 1601 1606.
McCleary, B.V., Taravel, F.R., Cheetham, N.W.H., 1982.
Preparative-scale isolation and characterisation of 61-a-Dgalactosyl-(1 4)-b-D-mannobiose and 62-a-D-galactosyl(1 4)-b-D-mannobiose. Carbohydr. Res. 104, 285 297.
McKenzie, L.F., Wang, Q., Warren, R.A.J., Withers, S.G.,
1998. Glycosynthases: mutant glycosidases for oligosaccharide synthesis. J. Am. Chem. Soc. 120, 5583 5584.
Neufeld, E.F., 1991. Lysosomal storage diseases. Annu. Rev.
Biochem. 60, 257 280.
Neustroev, K.N., Krylov, A.S., Firsov, L.M., Abroskina,
O.L., Khorlin, A.Ya., 1991. Isolation and properties of
b-mannosidase from Aspergillus awamori. Biokhimiya 56,
1406 1412.
Oda, Y., Tonomura, K., 1996. Characterization of b-mannanase and b-mannosidase secreted from the yeast Trichosporon cutaneum JCM 2947. Lett. Appl. Microbiol.
22, 173 178.
Reese, E.T., Shibata, Y., 1965. b-mannanases of fungi. Can.
J. Microbiol. 11, 167 183.
Ratto, M., Poutanen, K., 1988. Production of mannan-degrading enzymes. Biotechnol. Lett. 10, 661 664.
Sone, Y., Misaki, A., 1978. Purification and characterization
of b-D-mannosidase and b-N-acetyl-D-hexosaminidase of
Tremella fuciformis. J. Biochem. 83, 1135 1144.
Stoll, D. (1998) Characterization of the mannan-degrading
system of Cellulomonas fimi, Thesis for Doctor of Philosophy, University of British Columbia, Vancouver.
Stoll, D., Stalbrand, H., Warren, R.A.J., 1999. Mannan-degrading enzymes from Cellulomonas fimi. Appl. Environ.
Microbiol. 65, 2598 2605.
Stalbrand, H., Siika-aho, M., Tenkanen, M., Viikari, L.,
1993. Purification and characterization of two b-mannanases from Trichoderma reesei. J. Biotechnol. 29, 229
242.
Takada, G., Kawaguchi, T., Kaga, T., Sumitani, J.-I., Arai,
M., 1999. Cloning and sequencing of b-mannosidase gene
from Aspergillus aculeatus No. F-50. Biosci. Biotechnol.
Biochem. 63, 206 209.
Tenkanen, M., Thornton, J., Viikari, L., 1995. An acetylglucomannan esterase of Aspergillus oryzae; purification,
characterization and role in the hydrolysis of O-acetylgalactoglucomannan. J. Biotechnol. 42, 197 206.
Tenkanen, M., Makkonen, M., Perttula, M., Viikari, L.,
Teleman, A., 1997. Action of Trichoderma reesei mannanase on galactoglucomannan in pine kraft pulp. J.
Biotechnol. 57, 191 204.
Torto, N., Buttler, T., Gorton, L., Marko-Varga, G.,
Stalbrand, H., Tjerneld, F., 1995. Monitoring of enzymatic hydrolysis of ivory nut mannan using on-line mi-

P. Ademark et al. / Journal of Biotechnology 75 (1999) 281289

crodialysis sampling and anion-exchange chromatography
with integrated pulsed electochemical detection. Anal. Chim.
Acta 313, 15 24.
Viikari, L., Tenkanen, M., Buchert, J., Ratto, M., Bailey, M.,
Siika-aho, M., Linko, M., 1993. Hemicellulases for industrial applications. In: Saddler, J.N. (Ed.), Biotechnology in
Agriculture, No. 9. Bioconversion of Forest and Agricultural Plant Residues. C.A.B. International, Wallingford, pp.

289

131 182.
Wan, C.C., Muldrey, J.E., Li, S.-C., Li, Y.-T., 1976. Mannosidase from the mushroom Polyporus sulfureus. J. Biol. Chem.
251, 4384 4388.
Yu, S.-G., Stefnsson, H., Romanowska, E., Albertsson, P.-A, .,
1994. Two dimensional electrophoresis of thylakoid membrane proteins and its application to microsequencing.
Photosynth. Res. 41, 475 486.

II

81

III

93

IV

101

Journal of Biotechnology 101 (2003) 37 /48

www.elsevier.com/locate/jbiotec

A cellulose-binding module of the Trichoderma reesei

b-mannanase Man5A increases the mannan-hydrolysis of
complex substrates
Per Hagglund a, Torny Eriksson a, Anna Collen a, Wim Nerinckx b,
Marc Claeyssens b, Henrik Stalbrand a,*
a

Department of Biochemistry, Centre for Chemistry and Chemical Engineering, Lund University, PO Box 124, S-221 00 Lund, Sweden
b
Department of Biochemistry/Physiology/Microbiology, Ghent University, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium
Received 11 January 2002; received in revised form 29 August 2002; accepted 3 September 2002

Abstract
Endo-b-1,4-D-mannanases (b-mannanase; EC 3.2.1.78) are endohydrolases that participate in the degradation of
hemicellulose, which is closely associated with cellulose in plant cell walls. The b-mannanase from Trichoderma reesei
(Man5A) is composed of an N-terminal catalytic module and a C-terminal carbohydrate-binding module (CBM). In
order to study the properties of the CBM, a construct encoding a mutant of Man5A lacking the part encoding the CBM
(Man5ADCBM), was expressed in T. reesei under the regulation of the Aspergillus nidulans gpd A promoter. The wildtype enzyme was expressed in the same way and both proteins were purified to electrophoretic homogeneity using ionexchange chromatography. Both enzymes hydrolysed mannopentaose, soluble locust bean gum galactomannan and
insoluble ivory nut mannan with similar rates. With a mannan/cellulose complex, however, the deletion mutant lacking
the CBM showed a significant decrease in hydrolysis. Binding experiments using activity detection of Man5A and
Man5ADCBM suggests that the CBM binds to cellulose but not to mannan. Moreover, the binding of Man5A to
cellulose was compared with that of an endoglucanase (Cel7B) from T. reesei .
# 2002 Elsevier Science B.V. All rights reserved.
Keywords: Carbohydrate-binding module; Hemicellulase; Cellulose; Hemicellulose; Endoglucanase

1. Introduction

Abbreviations: CBM, carbohydrate-binding module; M2,

mannobiose; M3, mannotriose; DNS, 3,5-dinitrosalicylic acid.
* Corresponding author. Tel.:
/46-46-222-8202; fax:
/4646-222-4534.
E-mail
address:
henrik.stalbrand@biokem.lu.se
(H.
Stalbrand).

Endo-b-1,4-D-mannanase (b-mannanase; EC
3.2.1.78) catalyses the random hydrolysis of
manno-glycosidic bonds in both mannans and
heteromannans. These polysaccharides are widespread in nature and are found in several different
forms. Linear b-1,4-mannan polymers are found in

0168-1656/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 8 - 1 6 5 6 ( 0 2 ) 0 0 2 9 0 - 0

38

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

certain plant species such as ivory nut (Phytelephas

macrocarpa ) and date (Phoenix dactylifera ; Meier,
1958). Glucomannans and galactomannans are
present in the endosperm of many plants as
storage polysaccharides (Meier and Reid, 1982).
Acetylated galactoglucomannan is the major hemicellulose in softwood (Sjostrom, 1993). Furthermore, mannan can be found in two crystal forms,
which are referred to as mannan I and mannan II
(Chanzy et al., 1984; Frei and Preston, 1968).
b-Mannanases have several existing and potential applications in, for example, the food and feed,
and the pulp and paper industries (Buchert et al.,
1998; Sachslehner et al., 2000; Viikari et al., 1993).
Previously, the b-mannanase from Trichoderma
reesei (Man5A) has been purified and the corresponding gene has been cloned (Stalbrand et al.,
1993, 1995). The hydrolysis patterns of Man5A on
oligosaccharides and branched mannan-polymers
have been studied (Tenkanen et al., 1997; Harjunpaa et al., 1995), and the degradation of crystalline
mannan has been investigated (Hagglund et al.,
2001). Sequence alignment and hydrophobic cluster analysis have indicated that Man5A is a twomodule enzyme, composed of an N-terminal
catalytic module and a C-terminal putative carbohydrate-binding module (CBM) connected by a
linker region (Stalbrand et al., 1995). The catalytic
module of Man5A belongs to family 5 of glycoside
hydrolases (Henrissat, 1991), and it has the (a/b)8barrel fold characteristic for this enzyme family
(Sabini et al., 2000).
On the basis of sequence alignment, the Man5A
CBM has been classified into family 1 of CBMs
(Tomme et al., 1995). A majority of the modules in
this family are connected to cellulases of fungal
origin, and several have been shown to bind to
cellulose (Linder and Teeri, 1997; Teeri et al.,
1992). The role of the CBMs in cellulolytic
enzymes has been thoroughly investigated and it
has been shown that they often play an important
role in binding to, and increasing the hydrolysis of,
insoluble cellulose substrates (van Tilbeurgh et al.,
1986; Tomme et al., 1988; Gilkes et al., 1988).
Besides Man5A, CBMs have been found in
other b-mannanases (Sunna et al., 2001; Stoll et
al., 2000), and also in other types of hemicellulosedegrading enzymes (Black et al., 1996; Millward-

Sadler et al., 1994). To this date, most studies of

hemicellulase-linked CBMs, and their effect on
hydrolysis have been carried out with xylanases
(Ali et al., 2001; Black et al., 1996, 1997; MillwardSadler et al., 1994; Gill et al., 1999). However,
Biely and Tenkanen (1998) have discussed the
possibility that the presence of a CBM on the T.
reesei b-mannanase is part of the reason for the
superior performance in pulp bleaching experiments for this enzyme compared with some other
b-mannanases (Suurnakki et al., 1996).
The binding of Man5A to cellulose and kraft
fibres, likely mediated by the CBM, has been
shown earlier (Gerber et al., 1999; Ademark et al.,
1998; Tenkanen et al., 1995), but the detailed
binding properties are unknown. In order to
further study the binding properties of Man5A,
also on different mannans, and to investigate the
effect of the CBM on hydrolysis of different
substrates, we have constructed a mutant of
Man5A lacking the CBM (Man5ADCBM). We
have expressed the mutant and the wild-type
enzyme in T. reesei and compared the catalytic
activities and the binding properties of the purified
enzymes. Moreover, the binding of Man5A to
cellulose was compared with that of a T. reesei
endoglucanase (Cel7B) carrying a family 1 CBM.
The results indicate that the C-terminal CBM of
Man5A binds specifically to cellulose. Furthermore, the results of the hydrolysis experiments
indicate that the CBM helps to increase the rate of
hydrolysis of insoluble mannan/cellulose complexes.

2. Materials and methods

2.1. Strains, plasmids and media
T. reesei QM9414 was maintained on potato
dextrose agar slants at 30 8C. Escherichia coli
XL1 blue (Stratagene, La Jolla, CA, USA) was
used as a host for recombinant plasmids. E. coli
cells were cultured in luria broth medium at 37 8C
and ampicillin (100 mg ml1) was added when
appropriate. The plasmids used in this study were
pHSM30 (Stalbrand et al., 1995), pAN52 (Punt et
al., 1990) and pTOC202. pAN52 was kindly

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

provided by Dr Peter Punt at TNJ (Rijswijk, The

Netherlands), and pTOC202 was kindly provided
by Professor Merja Penttila, VTT Biotechnology
(Espoo, Finland).
2.2. DNA techniques
Plasmid DNA preparation, restriction analysis,
and DNA fragment isolation was performed as
described previously (Sambrook et al., 1989).
Mutagenesis was performed by PCR using Pfu
polymerase with the Quikchange site-directed
mutagenesis kit (Stratagene). All PCR runs were
initiated with a denaturation step at 94 8C for 1
min, followed by cycles of denaturation, annealing
and extension. The number of cycles and the
temperatures in the different steps in each cycle
varied in the different runs. All runs were ended
with an extension step for 10 min. All constructs
were sequenced using ABI sequencing instruments
with cycle sequencing methodology at Innovagen
(Lund, Sweden).
2.3. Construction of plasmids
The Sac II site in the man5A sequence (cDNA
encoding T. reesei Man5A) on plasmid pHSM30
was removed by site-directed silent mutagenesis,
using PCR with the primers 5?-CCTCAGCGCTGGCGGCCGTACTGCAGCCTG-3? (primer 1)
and 5?-CAGGCTGCAGTACGGCCGCCAGCGCTGAGG-3? (primer 2). The PCR was run in
16 cycles, each composed of the following steps:
denaturation (94 8C), 30 s; annealing (62 8C), 1
min; extension (70 8C), 14 min. The PCR product
was treated with Dpn I (which cleaves methylated
DNA) in order to remove remaining template
plasmid DNA. The new plasmid was called
pPH001.
The coding sequence of man 5A was amplified
from pPH001 by PCR using the primers 5?-CTCGAGCCGCGGACTGGCATCATGATGATGCTCTCAAAG-3? (primer 3) and 5?-GGGCGCCTCGAGGATCCTCTAGACAAACAGGACTTAAG-3? (primer 4). The PCR was run in 27
cycles, each composed of the following steps:
denaturation (94 8C), 45 s; annealing (61 8C), 1
min; extension (70 8C), 4 min. The coding se-

39

quence of the catalytic module (bases 1/1137 of

man 5A) (man 5ADCBM) was amplified from
pPH001 by PCR using primer 3 and 5?GCCTCGAGGATCCCTAGGGAGGAGGAGTGGTTG-3? (primer 5). The PCR was run
in 27 cycles, each composed of the following steps:
denaturation (94 8C), 45 s; annealing (62 8C), 45
s; extension (72 8C), 3 min. The two amplified
fragments (man 5A and man 5ADCBM) were isolated from an agarose electrophoresis gel using
Jetsorb (Genomed, Research Triangle Park, NC,
USA), subsequent to treatment of the PCR
products with Sac II and Bam HI. pPH002 was
constructed by ligation of Bam HI and Sac II
digested pAN52 with man 5A. pPH003 was constructed by legation of Bam HI and Sac II digested
pAN52 with man 5ADCBM.
2.4. Transformation of T. reesei
Transformation of plasmids into T. reesei was
performed essentially as described by Collen et al.
(2001b), a modification of the method described
by Penttila et al. (1987). pPH002 and pPH003 were
transformed into T. reesei QM9414 together with
pTOC202, carrying the Aspergillus nidulans gene
encoding acetamidase (amdS ). Transformants of
T. reesei were selected by growing on plates
containing KH2PO4 (0.11 M), glucose (0.11 M),
sorbitol (1 M), acetamide (10 mM), CsCl (15 mM),
CaCl2 (4.1 mM), MgSO4 (2.4 mM), CaCl2 (5.4
mM), FeSO4 / 7H2O (0.18 mM), MnSO4 / H2O
(0.095 mM), ZnSO4 / 7H2O (0.049 mM), CoCl2 /
6H2O (0.16 mM), agar noble (18 g l1). Transformants were replated two to three times on a
medium as described above but with sorbitol
omitted and Triton X-100 (0.1% (v/v)) added.
Isolated transformants were tested for b-mannanase activity using the activity assay described
below.
2.5. Determination of specific activity
The activity of Man5A and Man5ADCBM on
soluble galactomannan was determined with the bmannanase assay using the 3,5-dinitrosalicylic acid
(DNS)-method with 0.5% locust bean gum (Sigma,
St. Louis, MO, USA) as substrate (Stalbrand et

40

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

al., 1993). Protein concentrations were determined

by analysis of UV absorbance as described by
Mach et al. (1992). The standard deviations in the
b-mannanase activity measurements and the protein concentration determinations were below 8%.

2.6. Expression and purification

Stable transformants were cultured in 1 l
indented flasks at 30 8C and 160 rpm in a volume
of 100 ml of a medium containing KH2PO4 (0.22
M), K2HPO4 (0.046 M), (NH4)SO4 (0.015 M),
glucose (0.22 M), MgSO4 (5 mM), CaCl2 (5.4
mM), FeSO4 / 7H2O (0.18 mM), MnSO4 / H2O
(0.095 mM), ZnSO4 / 7H2O (0.049 mM), CoCl2 /
6H2O (0.16 mM). The glucose concentration was
monitored regularly by measuring reducing sugars
with DNS (Collen et al., 2001a) and maintained
above 1%. Supernatant from these cultures was
used to screen for b-mannanase activity using the
DNS-method with locust bean gum (0.5%) as
substrate.
Culture filtrates containing Man5A and Man5ADCBM were concentrated approximately ten
times by ultrafiltration using a Stirred Cell System
(Pall Gelman Sciences, Ann Arbor, MI, USA).
The concentrated culture filtrate was equilibrated
in 10 mM Tris /HCl buffer (pH 7.8) and loaded
onto a XK 26/20 column packed with 75 ml
Sepharose HP (Amersham Pharmacia Biotech,
Uppsala, Sweden). A gradient from 0 to 50% 1 M
NaCl (in 10 mM Tris /HCl buffer pH 7.8) was
created over 20 column volumes. Man5A was
purified further on a Mono-P chromatofocusing
column (Amersham Pharmacia Biotech) with 25
mM triethanolamine (pH 8.3) as equilibration
buffer. Elution was carried out with polybuffer
96 (30%) and polybuffer 74 (70%).
Cel7B was purified from a culture filtrate of T.
reesei QM 9414 according to Eriksson et al.
(2001). Cel7BDCBM (amino acid 1/371), constructed as described previously (Collen et al.,
2001b), was expressed under control by the gpd A
promoter from A. nidulans . Cel7BDCBM was
purified by anion-exchange chromatography with
Source Q (Amersham Pharmacia Biotech), using
20 mM Na-acetate (pH 4.5) as buffer A and 1 M

Na-acetate (pH 4.5) as buffer B. Cel7BDCBM was

eluted with a linear gradient of buffer B.
2.7. Gel electrophoresis
SDS-PAGE electrophoresis was performed according to Laemmli (1970) using precast gels
(Nupage 4 /12% bis-Tris), from Novex (San
Diego, CA, USA) and the proteins were stained
with a silver staining kit (SilverExpress ) from
Novex. Affinity gel electrophoresis using gels
including 0.2 mg l 1 locust bean gum galactomannan was performed according to Stoll et al.
(2000).
2.8. Polysaccharides
In this work, polysaccharides isolated from the
endosperm of ivory nut (P. macrocarpa ), were
used. P. macrocarpa contains mostly mannan but
also some cellulose (Chanzy et al., 1984; Timell,
1957; Meier, 1958). A commercially available
(Megazyme, Bray, Ireland) mannan preparation
(more than 99% mannan, see below) isolated from
ivory nut was used, here referred to as ivory nut
mannan. In addition, a preparation isolated from
ivory nut, which is the residue after removal of low
molecular weight mannan with alkali treatment
(1.25 M KOH) according to Aspinall et al. (1953),
was used. Earlier investigations have shown that
such a residue is composed of mainly mannan, but
also contains some cellulose (Chanzy et al., 1984;
Meier, 1958), as was also confirmed here (see
below). In this text, this preparation is referred to
as mannan/cellulose complex.
Acid hydrolysis of ivory nut mannan was
carried out in 0.4 M H2SO4 at 120 8C for 2 h.
Acid hydrolysis of the mannan/cellulose complex
from ivory nut was performed according to
Hagglund (1951). The monosaccharides released
upon acid hydrolysis were analysed using a
Dionex P-500 chromatographic system with
Carbo Pac PA-10 pre- and analytical columns.
Detection was performed with an electrochemical
detector (ED40). Separation was achieved isocratically with 10 mM NaOH as eluent. Mannose,
galactose and glucose (Fluka) were used as standards. The monosaccharide composition analysis

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

of ivory nut mannan yielded more than 99%

mannose residues. The composition of the mannan/cellulose complex sample was determined to
be 81% mannose, 15% glucose and 0.4% galactose
residues. This sample also contained 3% material
which was insoluble under the conditions used.
Ivory nut mannan was also used for crystallisation of mannan I crystals as described previously (Hagglund et al., 2001). Crystals of
mannan II were made from Acetabularia crenulata
mannan as described previously (Hagglund et al.,
2001).
2.9. Hydrolysis experiments
Mannopentaose (Megazyme) was used at a
concentration of 1 mM and the concentration of
ivory nut mannan and the mannan/cellulose complex was 2.5 mg ml 1. In all experiments, equal
amounts of Man5A and Man5ADCBM were
added based on the activity assay towards locust
bean gum. All hydrolysis experiments were carried
out in 50 mM Na-acetate buffer (pH 4.5) at 40 8C
and bovine serum albumin (BSA) (100 mg ml1)
was included.
Samples were withdrawn at different time points
during hydrolysis and heated to 100 8C in 2 min,
followed by centrifugation (20 000 /g , 10 min)
and filtration (0.22 mm filter) to remove insoluble
matter. The released oligosaccharides were analysed using a Dionex P-500 chromatographic
system with Carbo Pac PA-100 pre- and analytical
columns. Detection was performed with an ED40.
Separation was achieved isocratically with 100
mM NaOH as eluent. Enzymatic activity was
calculated on the basis of the amount of mannobiose (M2) and mannotriose (M3) released; the
main products of hydrolysis by the b-mannanase.
M2 and M3 standards were from Megazyme.
2.10. Binding studies
Various amounts (see legend of Figs. 4 and 6) of
Man5A and Man5ADCBM were incubated with
Avicel cellulose (Merck, Darmstadt, Germany; 2
mg ml 1), ivory nut mannan (2.5 mg ml 1),
mannan/cellulose complex (2.5 mg ml1), mannan
I crystals (1 mg ml1), mannan II crystals (1 mg

41

ml1) in 50 mM Na-acetate buffer (pH 4.5) at

4 8C for 1 h under continuous stirring. BSA (100
mg ml 1) was included in all incubations. After
incubation the polysaccharides were removed by
centrifugation (20 000/g, 10 min) and residual
enzyme activity was assayed using the DNSmethod with locust bean gum (0.5%) as substrate
(Stalbrand et al., 1993). The residual activity was
compared with the activity of Man5A and Man5ADCBM incubated under the same conditions, but
without polysaccharides. Binding of Cel7B and
Cel7BDCBM to Avicel cellulose was determined in
the same way, except that 50 mM Na-acetate
buffer (pH 4.8) was used and 0.5% carboxymethylcellulose (ICN Biomedicals, Aurora, OH, USA)
was used as substrate in the assay. The relative
equilibrium association constants (Kr) for binding
of Man5A and Cel7B to Avicel cellulose were
determined as described by Gilkes et al. (1992),
assuming a one-site binding mode. Non-linear
regression analyses were made in Kaleidagraph
3.5.

3. Results
3.1. Expression and purification of Man5A and
Man5ADCBM
The genes encoding the T. reesei b-mannanase
(man5A ) and the region encoding the catalytic
module (man5ADCBM (bases 1 /1137; amino acid
1/352)) were inserted into pAN52 (Fig. 1). In this
plasmid, the transcription of man5A and man5ADCBM is controlled by the constitutive gpd A
promoter from A. nidulans (Punt et al., 1990). The
plasmids carrying man5A and man5ADCBM were
transformed into T. reesei QM9414 and grown in
a glucose-rich medium. Under these conditions,
expression of several other extracellular glycoside
hydrolases, including the endogenous Man5A, is
suppressed (Ilmen et al., 1997).
To confirm the absence of expression of endogenous b-mannanase activity, untransformed T.
reesei QM9414 was cultured under the same
conditions as the transformants and the b-mannanase activity was determined to be lower than 0.01
nkat ml1. In contrast, the activity of the positive

42

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

transformants was between 20 and 30 nkat ml1.

Man5A and Man5ADCBM were expressed in T.
reesei and the enzymes were purified by anionexchange chromatography. The purified enzymes
appeared as single bands of expected mobility on
SDS-PAGE (Fig. 2).
3.2. Catalytic activity of Man5A and
Man5ADCBM on soluble substrates
The hydrolysis of mannopentaose and soluble
locust bean gum galactomannan by Man5A and
Man5ADCBM was compared. The specific activity
on galactomannan was 330 kat mol1 for Man5A
and 340 kat mol1 for Man5ADCBM. Equal
amounts of both enzymes were incubated with
mannopentaose and samples were withdrawn at
several time points for analysis of released oligosaccharides. The results show that Man5A and
Man5ADCBM exhibited similar hydrolytic activity towards mannopentaose (Fig. 3). The rate of
mannopentaose hydrolysis was 10 mol mannopentaose per s mol1 enzyme for Man5A and 12.6
mol mannopentaose per s mol 1 enzyme for
Man5ADCBM determined as the production of
M2 and M3 after 90 min.
3.3. Adsorption of Man5A and Man5ADCBM to
cellulose
Man5A and Man5ADCBM were incubated with
cellulose, and the amount of bound enzyme was
determined, as described in Section 2. As predicted, cellulose binding is observed with Man5A,
but no significant binding is seen with Man5ADCBM (Fig. 4). As a comparison, Cel7B and the
catalytic module of this enzyme (Cel7BDCBM)
were incubated with cellulose in the same way and
the amount of binding to cellulose was analysed
(Fig. 4). In analogy to the b-mannanase, significant binding was seen with the full-length enzyme
only.
In order to quantify the adsorption to cellulose,
the relative binding constants of Man5A and
Cel7B for this polysaccharide were determined as
described by Gilkes et al. (1992), using the
relationship:

[B]

[N0 ]Ka [F ]
1
Ka [F ]

(1)

where [B ] is the amount of enzyme bound, [F ] is

the concentration of free enzyme, [N0] is the
concentration of binding sites and Ka is the
equilibrium association constant. Non-linear regression of the binding data gives values for [N0]
and Ka. Unique solutions for [N0] and Ka can not
be obtained but the relative equilibrium association constant, Kr, (which can be used to compare
the binding of different enzymes to the same
cellulose preparation) can be obtained using the
relationship (Gilkes et al., 1992):
Kr [N0 ]Ka

(2)

Analysis of the binding data in this manner,

assuming a one-site binding mode, gives a slightly
higher Kr for Cel7B in comparison with Man5A
(1.05 and 0.84 l g1, respectively).
3.4. Hydrolysis of ivory nut mannan and a mannan/
cellulose complex
To investigate whether the CBM has an influence on the hydrolysis of insoluble mannan-polymers, Man5A and Man5ADCBM were incubated
with ivory nut mannan and a mannan/cellulose
complex isolated from ivory nut (P. macrocarpa ).
The ivory nut mannan is extracted from ivory nut
with alkali, and contains mannan only (confirmed
by acid hydrolysis which yielded more than 99%
mannose). The mannan/cellulose complex is the
residue when low molecular weight mannan is

Fig. 1. Schematic view of Man5A and Man5ADCBM. The Cterminus (C) and N-terminus (N) of mature Man5A (Stalbrand
et al., 1995) are indicated. Numbers refer to the amino acid
number of the C- and N-terminal amino acids of Man5A and
Man5ADCBM.

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

Fig. 2. SDS-PAGE of purified Man5ADCBM (A), Man5A (B)

and standard proteins (C). Molecular masses (kDa) of standard
proteins (Mark 12, Novex) are indicated. The estimated
molecular weight is 53.6 kDa for Man5A and 43 kDa for
Man5ADCBM.

extracted from ivory nut with alkali as described

by Aspinall et al. (1953). Previous studies have
showed that this material is composed of mostly
high molecular weight mannan with some cellulose
(Ludtke, 1927). This was supported by acid
hydrolysis which yielded 81% mannose residues
and 15% glucose residues.
The amount of released soluble oligosaccharides
after different time points in the enzymatic incubations was determined. No significant difference between Man5A and Man5ADCBM in the
hydrolysis of ivory nut mannan was detected
under the conditions used (Fig. 5a). Ivory nut
mannan was completely hydrolysed even without
the CBM.
However, as seen in Fig. 5b, a much higher
amount of oligosaccharides was released when the
mannan/cellulose complex was incubated with
Man5A, as compared with the amount released
during incubation with Man5ADCBM. The results
also imply that the mannan/cellulose complex is
more resistant to enzymatic degradation than
ivory nut mannan.

43

Fig. 3. Hydrolysis of mannopentaose (1 mM) by Man5A ( )

and Man5ADCBM ( ). 0.15 nkat ml 1 (0.44 nM of Man5ADCBM and 0.46 nM of Man5A) was used. Hydrolysis was
monitored as release of M2 and M3.

3.5. Adsorption to mannan and mannan/cellulose

complexes
The binding of Man5A and Man5ADCBM to
ivory nut mannan and to the mannan/cellulose
complex from ivory nut was investigated. With
ivory nut mannan, no significant binding of
neither Man5A nor Man5ADCBM was observed
under the conditions used (Fig. 6a). With the
mannan/cellulose complex, however, significant
binding was observed with Man5A but not with
Man5ADCBM (Fig. 6b). A separate experiment
was carried out where binding of 2.5 nkat ml1
Man5A (7.6 nM) and Man5ADCBM (7.4 nM) to
ivory nut mannan, mannan/cellulose complex,
Avicel cellulose, and a mixture of ivory nut
mannan and Avicel (85 and 15%, respectively)
was compared. The amount of bound enzyme was
determined by activity measurement of supernatants from the incubation mixtures. No binding of
Man5ADCBM was observed. Man5A bound to
Avicel (54% bound enzyme), the mannan/cellulose
complex (24% bound enzyme) and the mixture of
ivory nut mannan and Avicel (16% bound enzyme). No binding of Man5A to ivory nut mannan
was observed. Affinity gel electrophoresis experiments using 0.2 mg l 1 locust bean gum galactomannan did not show a shift in mobility of

44

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

Fig. 4. Adsorption of Man5A ( ), Man5ADCBM ( ), Cel7B

( ) and Cel7BDCBM ( ) to Avicel cellulose (2 mg ml 1). The
enzyme loading was 2, 1, 0.5, 0.25, 0.125 and 0.0625 mM. The
amount of free enzyme was assessed by measuring residual
enzymatic activity after incubation with Avicel cellulose. The
amount of bound enzyme was calculated by comparing the
amount of free enzyme with the enzymatic activity after
incubation in the absence of Avicel cellulose. Non-linear
regression analysis was used for curve-fitting of the data. The
relative equilibrium association constants (Kr) for Man5A and
Cel7B were calculated to be 0.84 and 1.05 l g 1, respectively
(see further text).

Man5A and Man5ADCBM compared with a gel

without galactomannan (data not shown).
Binding of the enzymes to mannan I and
mannan II, the two crystalline allomorphs of
mannan (Frei and Preston, 1968), was also investigated. Under the conditions used, no binding
to crystalline mannan I from ivory nut and
mannan II from A. crenulata was observed (data
not shown).

Fig. 5. Hydrolysis of insoluble mannan substrates by Man5A

and Man5ADCBM, 15 nkat ml 1 (44 nM of Man5ADCBM
and 46 nM of Man5A) was used in all incubations. Hydrolysis
was monitored as release of mannobiose (M2) and mannotriose
(M3). (a) Hydrolysis of ivory nut mannan by Man5A ( ) and
Man5ADCBM ( ). (b) Hydrolysis of a mannan/cellulose
complex by Man5A ( ) and Man5ADCBM ( ).

4. Discussion
A wide range of CBMs have been found in
many different plant cell-wall degrading enzymes
(Tomme et al., 1995). In previous studies, bmannanases which bind to mannan and cellulose
have been identified (Sunna et al., 2001; Stoll et al.,
2000; Tenkanen et al., 1995). The aim of this study
was to elucidate the binding properties of the
family 1 CBM from Man5A, and to investigate its

possible influence on the hydrolysis of different

substrates.
From the results in this study, where binding of
Man5A and Man5ADCBM was compared (Fig.
4), it can be established that the C-terminal CBM
of Man5A indeed binds to cellulose. These results
are further corroborated by a comparison with a
T. reesei endoglucanase (Cel7B) carrying a family
1 cellulose-binding CBM. Besides Cel7B, several

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

Fig. 6. (a) Adsorption of Man5A ( ) and Man5ADCBM ( ) to

ivory nut mannan (2.5 mg ml 1). The enzyme loading was 0.01,
0.004, 0.0025 and 0.00065 mM. (b) Adsorption of Man5A ( )
and Man5ADCBM ( ) to a mannan/cellulose complex (2.5 mg
ml 1). The enzyme loading was 0.06, 0.03, 0.02, 0.015, 0.01 and
0.0073 mM. The amount of free enzyme was assessed by
measuring residual enzymatic activity after incubation with
polysaccharide. The amount of bound enzyme was calculated
by comparing the amount of free enzyme with the enzymatic
activity after incubation in the absence of polysaccharide. Nonlinear regression analysis was used for curve-fitting of the data.

other T. reesei cellulases, including the cellobiohydrolase Cel7A, also carry family 1 cellulose-binding CBMs. A published analysis of the binding of
Cel7A and Cel7B from T. reesei yielded similar
binding isotherms with bacterial cellulose (Srisod-

45

suk et al., 1997). The similar relative binding

constants for Avicel cellulose observed with
Man5A and Cel7B (0.84 and 1.05 l g1, respectively) are in the same range as what has been
reported previously with other family 1 CBMs
from T. reesei cellobiohydrolases for this type of
cellulose (Linder et al., 1996).
Hydrolysis experiments with soluble galactomannan and mannopentaose indicate that the
CBM does not affect the hydrolysis of soluble
mannan-polymers (Fig. 3). These results are in
accordance with previous reports on cellulolytic
enzymes containing family 1 CBMs, where no
decrease in the hydrolysis of soluble substrates has
been connected to the loss of a CBM (Gilkes et al.,
1988; Tomme et al., 1988). Similar results have
also been shown for a bacterial xylanase carrying
family 2 and family 10 CBMs (Gill et al., 1999).
It is well established that the activity of modular
fungal cellulases toward insoluble substrates is
decreased upon loss of the cellulose binding family
1 CBM (Gilkes et al., 1988; Tomme et al., 1988).
The results of this study indicate that the CBM of
Man5A has no influence on the hydrolysis of
insoluble mannan in the absence of cellulose (Fig.
5a). However, the CBM seems to play an important role in the hydrolysis of mannan/cellulose
complexes, since loss of the CBM resulted in a
dramatic decrease in degradation of the mannan/
cellulose complex (Fig. 5b). An effect of cellulose
binding CBMs on the hydrolysis of a cellulosecontaining substrate has also been reported for
some bacterial xylanases (Ali et al., 2001; Black et
al., 1996, 1997) and an arabinofuranosidase (Black
et al., 1996, 1997), but this is the first time it has
been described for a b-mannanase.
Interestingly, it was also found that Man5A
adsorbed to the mannan/cellulose complex, but
Man5ADCBM did not (Fig. 6b). This observation
correlates the difference in hydrolysis rate of the
mannan/cellulose complex by Man5A and Man5ADCBM to substrate binding. Since the enzymes
did not bind to any of the cellulose-free mannanpolymers tested, it can be concluded that the CBM
probably binds to the cellulose present in the
mannan/cellulose complex. Therefore, it seems
likely that the CBM facilitates hydrolysis of the
mannan/cellulose complex through some interac-

46

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

tion with the cellulose component of the complex.

Since mannan and cellulose are believed to be
kerholm
closely associated in plant cell walls (A
and Salmen, 2001), it is plausible that the binding
of Man5A to cellulose facilitates the degradation
of the mannan/cellulose complex by increasing the
substrate proximity, a mechanism which has been
suggested for some modular xylanases (Black et
al., 1996, 1997; Gill et al., 1999). Another possibility could be that the CBM disrupts the mannan/
cellulose complex, in analogy to the previously
demonstrated cell wall disruptive activity of a
CBM from a bacterial endoglucanase (Din et al.,
1991), thus making the substrate more available
for enzymatic degradation. However, at this stage,
it is not clear exactly how the CBM affects the
degradation of the mannan/cellulose complex.
To conclude, the work presented here suggests
that the C-terminal CBM of Man5A binds to
cellulose but not to mannan. The fact that Man5A
appears to have similar binding properties as the
T. reesei cellulases, further strengthens the view
that the Man5A CBM is indeed a cellulose binding
module. Moreover, it was shown that the presence
of the Man5A CBM increases the hydrolysis rate
of an insoluble mannan/cellulose complex. However, it can not be ruled out that the CBM binds
also to other polysaccharides besides cellulose in
natural complex substrates. Further experiments
will be carried out to investigate more closely how
the CBM facilitates the action of the b-mannanase
in degradation of such substrates.

Acknowledgements
Lars Anderson is thanked for help with affinity
gel electrophoresis. The Swedish Research Council
for Engineering Sciences (TFR), the Swedish
Research Council (VR) and Carl Tryggers Research Foundation are gratefully thanked for
grants to Henrik Stalbrand.

References
Ademark, P., Varga, A., Medve, J., Harjunpaa, V., Drakenberg, T., Tjerneld, F., Stalbrand, H., 1998. Softwood

hemicellulose-degrading enzymes from Aspergillus niger :

purification and properties of a b-mannanase. J. Biotechnol.
63, 199 /210.
kerholm, M., Salmen, L., 2001. Interactions between wood
.A
polymers studied by dynamic FT-IR spectroscopy. Polymer
42, 963 /969.
Ali, M.K., Hayashi, H., Karita, S., Goto, M., Kimura, T.,
Sakka, K., Ohmiya, K., 2001. Importance of the
carbohydrate-binding module of Clostridium stercorarium
Xyn10B to xylan hydrolysis. Biosci. Biotechnol. Biochem.
65, 41 /47.
Aspinall, G.O., Hirst, E.L., Percival, E.G.V., Williamson, I.R.,
1953. The mannans of ivory nut (Phytelephas macrocarpa ).
Part I, the methylation of mannan A and mannan B. J.
Chem. Soc., 3184 /3188.
Biely, P., Tenkanen, M., 1998. Enzymology of hemicellulose
degradation. In: Harman, G.E., Kubicek, C.P. (Eds.),
Trichoderma Gliocladium, vol. 2. Taylor & Francis, London, pp. 25 /47.
Black, G.W., Rixon, J.E., Clarke, J.H., Hazlewood, G.P.,
Theodorou, M.K., Morris, P., Gilbert, H.J., 1996. Evidence
that linker sequences and cellulose-binding domains enhance the activity of hemicellulases against complex substrates. Biochem. J. 319, 515 /520.
Black, G.W., Rixon, J.E., Clarke, J.H., Hazlewood, G.P.,
Ferreira, L.M., Bolam, D.N., Gilbert, H.J., 1997. Cellulose
binding domains and linker sequences potentiate the activity
of hemicellulases against complex substrates. J. Biotechnol.
57, 59 /69.
Buchert, J., Oksanen, T., Pere, J., Siika-Aho, M., Suurnakki,
A., Viikari, L., 1998. Applications of Trichoderma reesei
enzymes in the pulp and paper industry. In: Harman, G.E.,
Kubicek, C.P. (Eds.), Trichoderma Gliocladium, vol. 2.
Taylor & Francis, London, pp. 343 /363.
Chanzy, H.D., Grosrenaud, A., Vuong, R., Mackie, W., 1984.
The crystalline polymorphism of mannan in plant cell walls
and after recrystallization. Planta 161, 320 /329.
Collen, A., Ward, M., Tjerneld, F., Stalbrand, H., 2001a.
Genetically engineered peptide fusions for improved protein
partitioning in aqueous two-phase systems. Effect of fusion
localization on endoglucanase I of Trichoderma reesei . J.
Chromatogr. A 910, 275 /284.
Collen, A., Ward, M., Tjerneld, F., Stalbrand, H., 2001b.
Genetic engineering of the Trichoderma reesei endoglucanase I (Cel7B) for enhanced partitioning in aqueous twophase systems containing thermoseparating ethylene oxidepropylene oxide copolymers. J. Biotechnol. 87, 179 /191.
Din, N., Gilkes, N.R., Tekant, B., Miller, R.C., Warren, A.J.,
Kilburn, D.G., 1991. Non-hydrolytic disruption of cellulose
fibers by the binding domain of a bacterial cellulase.
Biotechnology 9, 1096 /1099.
Eriksson, T., Karlsson, J., Tjerneld, F., 2001. A model
explaining declining rate in hydrolysis of lignocellulose
substrates with cellobiohydrolase I (Cel7A) and endoglucanase I (Cel7B) of Trichoderma reesei . Appl. Biochem.
Biotechnol. 101, 41 /60.

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

Frei, E., Preston, R.D., 1968. Noncellulosic structural polysaccharides in algal cell walls. III. Mannan in siphoneous
green algae. Proc. R. Soc. London, Ser. B 169, 127 /145.
Gerber, P.J., Heitmann, J.A., Joyce, T.W., Buchert, J., Siikaaho, M., 1999. Adsorption of hemicellulases onto bleached
kraft fibers. J. Biotechnol. 67, 67 /75.
Gilkes, N.R., Warren, R.A., Miller, R.C., Jr, Kilburn, D.G.,
1988. Precise excision of the cellulose binding domains from
two Cellulomonas fimi cellulases by a homologous protease
and the effect on catalysis. J. Biol. Chem. 263, 10401 /
10407.
Gilkes, N.R., Jervis, E., Henrissat, B., Tekant, B., Miller, R.C.,
Jr, Warren, R.A., Kilburn, D.G., 1992. The adsorption of a
bacterial cellulase and its two isolated domains to crystalline
cellulose. J. Biol. Chem. 267, 6743 /6749.
Gill, J., Rixon, J.E., Bolam, D.N., McQueen-Mason, S.,
Simpson, P.J., Williamson, M.P., Hazlewood, G.P., Gilbert,
H.J., 1999. The type II and X cellulose-binding domains of
Pseudomonas xylanase A potentiate catalytic activity
against complex substrates by a common mechanism.
Biochem. J. 342, 473 /480.
Harjunpaa, V., Teleman, A., Siika-aho, M., Drakenberg, T.,
1995. Kinetic and stereochemical studies of mannooligosaccharide hydrolysis catalysed by b-mannanases from Trichoderma reesei . Eur. J. Biochem. 234,
278 /283.
Henrissat, B., 1991. A classification of glycosyl hydrolases
based on amino acid sequence similarities. Biochem. J. 280,
309 /316.
Hagglund, E., 1951. Chemistry of Wood. Academic Press, New
York.
Hagglund, P., Sabini, E., Boisset, C., Wilson, K., Chanzy, H.,
Stalbrand, H., 2001. Degradation of mannan I and II
crystals by fungal endo-b-1,4-mannanases and a b-1,4mannosidase studied with transmission electron microscopy. Biomacromolecules 2, 694 /699.
Ilmen, M., Saloheimo, A., Onnela, M.L., Penttila, M.E., 1997.
Regulation of cellulase gene expression in the filamentous
fungus Trichoderma reesei . Appl. Environ. Microbiol. 63,
1298 /1306.
Laemmli, U.K., 1970. Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature 227,
680 /685.
Linder, M., Teeri, T.T., 1997. The roles and function of
cellulose-binding domains. J. Biotechnol. 57, 15 /28.
Linder, M., Salovuori, I., Ruohonen, L., Teeri, T.T., 1996.
Characterization of a double cellulose-binding domain.
Synergistic high affinity binding to crystalline cellulose. J.
Biol. Chem. 271, 21268 /21272.
Ludtke, M., 1927. Zur Kenntnins der pflanzlichen Zellmem ber die Kohlenhydrate des Steinnusamens. Ann.
bran. U
Chem. 456, 201 /224.
Mach, H., Middaugh, C.R., Lewis, R.V., 1992. Statistical
determination of the average values of the extinction
coefficients of tryptophan and tyrosine in native proteins.
Anal. Biochem. 200, 74 /80.

47

Meier, H., 1958. On the structure of cell walls and cell wall
mannans from ivory nuts and from dates. Biochim.
Biophys. Acta 28, 229 /240.
Meier, H., Reid, J.S.G., 1982. Reserve polysaccharides other
than starch in higher plants. Encyl. Plant Physiol. New Ser.
13A, 418 /471.
Millward-Sadler, S.J., Poole, D.M., Henrissat, B., Hazlewood,
G.P., Clarke, J.H., Gilbert, H.J., 1994. Evidence for a
general role for high-affinity non-catalytic cellulose binding
domains in microbial plant cell wall hydrolases. Mol.
Microbiol. 11, 375 /382.
Penttila, M., Nevalainen, H., Ratto, M., Salminen, E.,
Knowles, J., 1987. A versatile transformation system for
the cellulolytic filamentous fungus Trichoderma reesei . Gene
61, 155 /164.
Punt, P.J., Dingemanse, M.A., Kuyvenhoven, A., Soede, R.D.,
Pouwels, P.H., van den Hondel, C.A., 1990. Functional
elements in the promoter region of the Aspergillus nidulans
gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 93, 101 /109.
Sabini, E., Schubert, H., Murshudov, G., Wilson, K.S., SiikaAho, M., Penttila, M., 2000. The three-dimensional structure of a Trichoderma reesei b-mannanase from glycoside
hydrolase family 5. Acta Crystallogr. D Biol. Crystallogr.
56, 3 /13.
Sachslehner, A., Foidl, G., Foidl, N., Gubitz, G., Haltrich, D.,
2000. Hydrolysis of isolated coffee mannan and coffee
extract by mannanases of Sclerotium rolfsii . J. Biotechnol.
80, 127 /134.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Plainview, NY.
Sjostrom, E., 1993. Wood Chemistry, Fundamentals and
Applications. Academic Press, San Diego.
Srisodsuk, M., Lehtio, J., Linder, M., Margolles-Clark, E.,
Reinikainen, T., Teeri, T.T., 1997. Trichoderma reesei
cellobiohydrolase I with an endoglucanase cellulose-binding
domain: action on bacterial microcrystalline cellulose. J.
Biotechnol. 57, 49 /57.
Stoll, D., Boraston, A., Stalbrand, H., McLean, B.W., Kilburn,
D.G., Warren, R.A., 2000. Mannanase Man26A from
Cellulomonas fimi has a mannan-binding module. FEMS
Microbiol. Lett. 183, 265 /269.
Stalbrand, H., Siika-aho, M., Tenkanen, M., Viikari, L., 1993.
Purification and characterization of two b-mannanases from
Trichoderma reesei . J. Biotechnol. 29, 229 /242.
Stalbrand, H., Saloheimo, A., Vehmaanpera, J., Henrissat, B.,
Penttila, M., 1995. Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei b-mannanase gene
containing a cellulose binding domain. Appl. Environ.
Microbiol. 61, 1090 /1097.
Sunna, A., Gibbs, M.D., Bergquist, P.L., 2001. Identification of
novel b-mannan- and b-glucan-binding modules: evidence
for a superfamily of carbohydrate-binding modules. Biochem. J. 356, 791 /798.
Suurnakki, A., Clark, T., Allison, R., Buchert, J., Viikari, L.,
1996. Mannanase aided bleaching of soft-wood Kraft pulp.

48

P. Hagglund et al. / Journal of Biotechnology 101 (2003) 37 /48

In: Messner, K., Srebotnik, E. (Eds.), Biotechnology in Pulp

and Paper Industry */Advances in Applied and Fundamental Research. WUA Universitatsverlag, Vienna, pp. 69 /
74.
Teeri, T., Reinikainen, T., Ruohonen, L., Jones, T.A.,
Knowles, J.K.C., 1992. Domain function in Trichoderma
reesei cellobiohydrolases. J. Biotechnol. 24, 169 /176.
Tenkanen, M., Buchert, J., Viikari, L., 1995. Binding of
hemicellulases on isolated polysaccharide substrates. Enzyme Microb. Technol. 17, 499 /505.
Tenkanen, M., Makkonen, M., Perttula, M., Viikari, L.,
Teleman, A., 1997. Action of Trichoderma reesei mannanase on galactoglucomannan in pine Kraft pulp. J. Biotechnol. 57, 191 /204.
Timell, T.E., 1957. Vegetable ivory as a source of a mannan
polysaccharide. Can. J. Chem. 35, 333 /338.
Tomme, P., Van Tilbeurgh, H., Pettersson, G., Van Damme, J.,
Vandekerckhove, J., Knowles, J., Teeri, T., Claeyssens, M.,

1988. Studies of the cellulolytic system of Trichoderma

reesei QM 9414. Analysis of domain function in two
cellobiohydrolases by limited proteolysis. Eur. J. Biochem.
170, 575 /581.
Tomme, P., Warren, R.A.J., Miller, R.C.J., Kilburn, D.G.,
Gilkes, N.R., 1995. Cellulose-binding domains: classification and properties. In: Saddler, J.M., Penner, M. (Eds.),
Enzymatic Degradation of Insoluble Polysaccharides.
American Chemical Society, Washington, DC, pp. 142 /163.
van Tilbeurgh, H., Tomme, P., Claeyssens, M., Bhikhabhai, R.,
Pettersson, G., 1986. Limited proteolysis of the cellobiohydrolase I from Trichoderma reesei . FEBS 204, 223 /227.
Viikari, L., Tenkanen, M., Buchert, J., Ratto, M., Bailey, M.,
Siika-aho, M., Linko, M., 1993. Hemicellulases for industrial applications. In: Saddler, J.N. (Ed.), Bioconversion of
Forest and Agricultural Plant Residues, vol. 9. CAB
International, Wallingford, UK, pp. 131 /182.

121

Journal of Biotechnology 92 (2002) 267 277

www.elsevier.com/locate/jbiotec

endo-b-1,4-Mannanases from blue mussel, Mytilus edulis:

purification, characterization, and mode of action
Bingze Xu a, Per Hagglund b, Henrik Stalbrand b, Jan-Christer Janson a,*
a

Center for Surface Biotechnology, Biomedical Center, Uppsala Uni6ersity, Box 577, SE-751 23 Uppsala, Sweden
b
Department of Biochemistry, Center for Chemistry and Chemical Engineering, Lund Uni6ersity, Box 124,
SE-221 00 Lund, Sweden
Received 29 January 2001; received in revised form 28 June 2001; accepted 6 July 2001

Abstract
Two variants of an endo-b-1,4-mannanase from the digestive tract of blue mussel, Mytilus edulis, were purified by
a combination of immobilized metal ion affinity chromatography, size exclusion chromatography in the absence and
presence of guanidine hydrochloride and ion exchange chromatography. The purified enzymes were characterized
with regard to enzymatic properties, molecular weight, isoelectric point, amino acid composition and N-terminal
sequence. They are monomeric proteins with molecular masses of 39 216 and 39 265 Da, respectively, as measured by
MALDI-TOF mass spectrometry. The isoelectric points of both enzymes were estimated to be around 7.8, however
slightly different, by isoelectric focusing in polyacrylamide gel. The enzymes are stable from pH 4.0 to 9.0 and have
their maximum activities at a pH about 5.2. The optimum temperature of both enzymes is around 50 55 C. Their
stability decreases rapidly when going from 40 to 50 C. The N-terminal sequences (12 residues) were identical for
the two variants. They can be completely renatured after denaturation in 6 M guanidine hydrochloride. The enzymes
readily degrade the galactomannans from locust bean gum and ivory nut mannan but show no cross-specificity for
xylan and carboxymethyl cellulose. There is no binding ability observed towards cellulose and mannan. 2002
Elsevier Science B.V. All rights reserved.
Keywords: Mytilus edulis; Blue mussel; Purification; b-Mannanase

1. Introduction

Note: The novel N-terminal amino-acid sequence data

published here has been submitted to the SWISS-PROT
protein sequence database and is available under accession
number P82801.
* Corresponding author. Tel.: + 46-18-471-4011; fax: + 4618-555-016.
E-mail address: jan-christer.janson@ytbioteknik.uu.se (J.-C.
Janson).

endo-b-1,4-Mannanases (b-mannanase, EC
3.2.1.78) cleave randomly within the b-1,4-mannan main chain of galactomannan, glucomannan,
galactoglucomannan and mannan (Matheson and
McCleary, 1985; McCleary and Matheson, 1986).
They are very important for the enzymatic digestion of hemicelluloses, one of the most abundant
group of polymers in nature. b-Mannanases hy-

0168-1656/02/$ - see front matter 2002 Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 8 - 1 6 5 6 ( 0 1 ) 0 0 3 6 7 - 4

268

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

drolyze mannan yielding mannotriose and mannobiose (Sta lbrand et al., 1993). b-Mannanases
are used in the food and pharmaceutical industry
(Christgau et al., 1994a; McCleary, 1990), as well
as in the paper industry (Paice and Jurasek, 1984).
b-Mannanases are primarily produced by bacteria and hemicellulolytic fungi (Sta lbrand et al.,
1993; Gu bitz et al., 1996; Tamaru et al., 1995;
Duffaud et al., 1997; Christgau et al., 1994b).
b-Mannanases are classified in family 5 and family 26 of glycosyl hydrolases according to the
classification by Henrissat and Bairoch (1993). A
few b-mannanases have been purified and characterized from higher organisms, such as mollusca
(Yamaura and Matsumoto, 1993; Yamaura et al.,
1996; McCleary, 1988). However, no report has
been found in the literature on b-mannanases
isolated from blue mussel, Mytilus edulis. Some of
these organisms may perhaps digest mannan from
sea-weed (Yamaura et al., 1996). The mussel digestive enzymes are secreted from a crystalline
style which projects from a style-sac, a primitive
form of pancreas, into the lumen of the stomach
(Purchon, 1977). We isolated crystalline styles
from both fresh and frozen blue mussel and found
high b-mannanase activity in the extracts from
these. The preliminary purification and characterization studies were performed with these extracts
as starting material. However, for large scale
preparations, dissected whole digestive glands
were used as starting material.
This work describes for the first time the purification and characterization of b-mannanases from
blue mussel. No mollusc b-mannanase gene sequence has yet been published. However, the Nterminal sequence data obtained in this work
enabled comparison with those published for bmannanases from two other molluscs.

2. Materials and methods

2.1. Materials
M. edulis used as raw material in this work
originate from waters off the Swedish west coast.
Larger quantities of frozen mussel were bought
directly from a whole seller, Lysekils Fryshus AB,

Lysekil, Sweden. STREAMLINE Chelating, Superdex 75 prep grade (60/600 prepacked

column), Mono S HR 10/10 and HR 5/5, Superdex 200 prep grade (16/60 prepacked
column), ExcelGel SDS gradient gel (818),
PhaseGel IEF 3 9 gel, Low Molecular Weight
Calibration Kit (LMW) and Broad pI Calibration
Kit were obtained from Amersham Pharmacia
Biotech (Uppsala, Sweden). CarboPac PA-100
Guard and Analytical columns were obtained
from Dionex. 3,5-Dinitrosalicylic acid (DNS) and
locust bean gum were from Sigma Chemical Co.
(St. Louis, MO, USA). Linear b-1,4-linked
manno-oligosaccharides and ivory nut mannan
were purchased from Megazyme. Coomassie Brilliant Blue (R-250) was from Bio-Rad Laboratories. All other chemicals were standard analytical
grade commercial products. FPLC System, Multiphor II Electrophoresis System and PhastSystem were obtained from Amersham Pharmacia
Biotech (Uppsala, Sweden). For the HPLC-analysis the following equipment from Dionex (Sunnyvale, CA) were used: AS 50 chromatography
Compartment, ED 40 Electrochemical Detector,
GP 50 Gradient Pump and AS 50 Autosampler.

2.2. Purification procedure

In Table 1 are summarized all the steps involved in the purification procedure. All purification steps were carried out at room temperature
unless otherwise stated.

2.2.1. Enzyme extraction

In a typical purification process, 1.42 kg hepatopancreas (digestive glands) were excised from
28.7 kg of whole frozen mussel. Phenylmethylsulfonylfluoride (PMSF), dissolved in 5 ml ethanol,
was added to a concentration of 1 mM followed
by homogenisation in a meat blender cooled on
ice. Twenty millimoles of ice cold phosphate
buffer pH 7.0 was added to a total volume of 3.2
l followed by extraction by stirring for 30 min.
Insoluble materials were removed by centrifugation at 10 000 g for 30 min. The supernatant
was collected including residues of a difficult-toremove top layer of floating lipid material. Finally, NaCl was added to a concentration of 1 M,

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

this material served as a starting material for

purification.

2.2.2. Batch adsorption to STREAMLINE

Chelating (Zn 2 + ) and column elution
The presence of small amounts of lipid particles
in the crude extract supernatant after the centrifugation prevented the use of column adsorption
and this was why batch adsorption was used as
the first purification step. Thus 300 ml (sedimented volume) STREAMLINE Chelating, saturated with Zn2 + ions and rinsed with distilled
water, was added to the crude blue mussel extract
containing 1 M NaCl in 20 mM sodium phosphate buffer pH 7.0. After low speed propeller
blade stirring for 2 h, the adsorbent particles were
allowed to sediment and the supernatant containing non-adsorbed material and floating lipid particles were decanted. After washing three times with
500 ml, 20 mM sodium phosphate buffer pH 7.0
containing 1 M NaCl, the adsorbent particles
containing the target proteins were packed into a
XK 50/30 column (Amersham Pharmacia Biotech). After further washing with the same buffer
until the absorbance at A280 had reached the
base line, the less strongly bound proteins were
eluted with equilibration buffer containing 50 mM
imidazole at a flow rate of 150 cm h 1. The target
protein was eluted with equilibration buffer containing 50 mM EDTA at a flow rate of 50 cm
h 1.

269

2.2.3. Size exclusion chromatography

The fractions containing b-mannanase activity
were pooled (about 80 ml), further concentrated
to 20 ml using an Amicon Ultrafilter PM10 and
loaded to the 60 600 mm Superdex 75 pg
column equilibrated in 20 mM Naphosphate
buffer pH 7.0 containing 0.2 M NaCl. The flowrate was 30 cm h 1.
2.2.4. Ion exchange chromatography
The b-mannanase active fractions were pooled
(about 120 ml) and changed into 20 mM sodium
acetate buffer pH 5.5 by gel filtration on Sephadex G-25. The sample was then applied to a
Mono S (HR10/10) column equilibrated in the
same buffer at a flow-rate of 300 cm h 1. Elution
was performed by applying a 20-column volumes
0 400 mM NaCl-gradient in the same buffer at a
flow-rate of 150 cm h 1. Two b-mannanase active
peaks called ManA and ManB, respectively, appeared at about 200250 mM NaCl.
2.2.5. Size exclusion chromatography in 6 M
Gu HCl
SDS-PAGE analysis of the material in the
ManA and ManB peaks from the IEC on Mono
S revealed several trace contaminants, not observed in native-PAGE. In addition, MALDITOF analysis data were difficult to interpret due
to a multitude of signals. This is why material
from the two b-mannanase active peaks were

Table 1
Purification of b-mannanases from M. edulis
Step

Total protein
(mg)

Total activity
(units)

Specific activity (U mg1)

Purification (fold) Yield (%)

Crude extract
IMAC eluate
UF concentrate
SEC eluate
IEC eluate (ManA)
IEC eluate (ManB)
IEC (ManA, after
GuHCl)
IEC (ManB, after
GuHCl)

32 275
331
248
7.2
0.89
1.15
0.78

n.d.a
204
159
100
43.6
38.1
38.8

n.c.b
0.62
0.64
13.9
49.0
33.1
49.7

n.c.
1.03
22.4
79.0
53.4
80.2

n.c.
77.9
49.2
21.4
18.7
19.0

32.4

52.3

16.0

a
b

1.01

32.7

n.d., not determined due to high carbohydrate (reducing group) content of the extract.
n.c., not calculated. The total yield of ManA+ManB is 19.0+16.0= 35%.

270

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

subjected to further purification by size exclusion

chromatography under denaturing conditions. To
this end a HiLoad 16/60 Superdex 200 pg column
was equilibrated in 50 mM phosphate buffer containing 6 M guanidinehydrochloride (Gu HCl)
at pH 6.4. A 2-ml sample was applied and eluted
at a flow-rate of 1 ml min 1.

2.2.6. Final ion exchange chromatography

The main peak fractions collected from the
Superdex 200 pg experiment in 6 M Gu HCl of
both ManA and ManB were pooled (10 ml) and
the Gu HCl was removed by gel filtration on a
Sephadex G-25 column equilibrated in 20 mM
sodium acetate buffer pH 5.5. Finally the b-mannanases were rerun on a Mono S HR 5/5 column
under the same condition as described above.
2.3. Analytical methods
2.3.1. Polyacrylamide gel electrophoresis analysis
SDS-PAGE on reduced and alkylated samples
was performed using Multiphor II Electrophoresis
System for purity check, protein composition
analysis and for the estimation of molecular mass.
Isoelectric focusing (IEF) and native-PAGE were
carried out using the Phast System. The isoelectric points of ManA and ManB were estimated
using PhastGel IEF 3 9.
2.3.2. Mass spectrometry and N-terminal
sequence analysis
Samples from the second Mono S purification
step of both ManA and ManB were analyzed by
MALDI-MS (Kratos Kompact MALDI IV,
Kratos, UK) and subjected to N-terminal sequence analysis by Dr A, ke Engstro m at the Department of Medical Chemistry, Uppsala
Biomedical Center, Uppsala, Sweden, using a-cyano-4-hydroxycinnaminic acid as matrix.
2.3.3. Amino acid composition analysis
Amino acid composition analysis was performed at the amino acid analysis laboratory at
Uppsala Biomedical Center. An LKB Alpha-Plus
amino acid analyzer was used following standard
hydrolysis procedures and applying the standard
protein hydrolysate system with ninhydrin
detection.

2.3.4. Determination of enzyme acti6ity

The b-mannanase activity was routinely determined by adapting the dinitrosalicylic acid (DNS)
method for reducing sugar analysis according to
Sta lbrand et al. (1993). As substrate was used
locust bean gum (LBG), the main component of
which is galactomannan with a backbone chain of
b-1,4-linked mannosyl substituted with a-1,6linked galactosyl side-groups. Enzyme assay was
carried out by mixing 50 ml of appropriately diluted enzyme samples with 450 ml of 50 mM
sodium citrate buffer, pH 5.5 containing 0.5%
LBG. The mixture was incubated at 40 C for 20
min and the reaction was stopped by the addition
of 1 ml DNS reagent. After 5 min in a boiling
water bath and quick cooling to room temperature, the degree of enzymatic hydrolysis of the
LBG was determined spectrophotometrically by
measuring the absorbance at 540 nm. The reducing sugars released were then determined against a
standard curve obtained with mannose. One unit
of b-mannanase activity is defined as the amount
of enzyme that gives rise to reducing end groups
corresponding to 1 mg mannose under the current
experimental conditions.
Xylanase activity was assayed as described by
Bailey et al. (1992) using 1.0% (w/v) birchwood
xylan (Sigma X-0502) and oat spelts xylan (Sigma
X-0627) as substrates in 50 mM sodium citrate
buffer, pH 5.3. Amylase activity was assayed as
described by Bernfeld (1955) using 1.0% (w/v)
soluble starch (Sigma S-9765) as substrate in 50
mM sodium acetate buffer. Endoglucanase activity was assayed as described by Wood and Bhat
(1988) using 1.0% (w/v) carboxymethyl cellulose
(CMC, medium viscosity, Fluka) as substrate in
50 mM sodium acetate buffer, pH 5.5. b-Galactosidase and b-mannosidase activities were assayed as described by Ra tto and Poutanen (1988)
using 4.0 mM p-nitrophenyl-b-D-galactopyranoside (Sigma N-0877) as substrate in 50 mM
sodium citrate buffer, pH 4.5 and 2.0 mM 4-nitrophenyl-b-D-mannopyranoside (Sigma N-1268) as
substrate in 50 mM sodium citrate buffer, pH 5.5.
The amount of p-nitrophenol released in the mixture was determined by measuring absorbance at
405 nm.

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

2.3.5. Determination of protein concentration

Protein was determined using the Bio-Rad
Protein Assay according to the method of Bradford (1976), using bovine serum albumin (BSA) as
a reference standard. All chromatographic runs
were monitored for protein by absorbance at 280
nm.
2.3.6. Determination of pH and temperature
optima
The optimum pH was determined by incubating
aliquots of the enzymes (3.5 pmol in 50 ml) with
450 ml of 0.5% substrate (LBG) at 40 C at
different pH values (pH 36: 50 mM sodium
citrate buffer, pH 6.5 7.0: 50 mM phosphate
buffer, pH 7.29.0: 50 mM TrisHCl, pH 9.0
10: 50 mM glycine NaOH buffer). The reactions
were stopped after 20 min by adding DNS reagent
and the activities were assayed for as described
above. The same procedure was used to determine
the optimum temperature by incubating the enzymes with substrate at different temperatures (at
optimum pH) for 20 min and the activities were
assayed for as described above.
2.3.7. Determination of pH and temperature
stability
The pH stability was determined by incubating
the enzyme solutions (in the presence of 0.1%
BSA) at different pH values at room temperature
for 24 h. The activity was measured as described
above. The temperature stability measurements
were performed by incubating the enzyme solutions in the presence of 0.1% BSA at 10, 20, 30,
40, 50 and 60 C and samples were withdrawn
after different time intervals and immediately
cooled in an ice bath. The activities were assayed
for as described above.
2.3.8. Determination of kinetic properties
The MichaelisMenten constant (Km) and the
maximum reaction velocity (Vmax) for ManA was
determined by incubating the enzyme at a concentration of 7.5 pmol with substrate concentrations
ranging from 0.25 to 10 mg ml 1 LBG in 50 mM
citrate buffer, pH 5.5 at 40 C for 10 min. The
released oligosaccharides were measured by the
DNS method under the standard conditions.
Woolf plot was used to determine parameters.

271

2.3.9. Determination of substrate specificity:

mannopentaose and mannan hydrolysis
The b-mannanase substrate specificity was studied using mannopentaose as substrate. An aliquot
of ManA (3.5 pmol, 0.03 nkat) was incubated
with 1 mM mannopentoase at 40 C in 50 mM
sodium citrate buffer, pH 5.5 containing 0.1%
BSA. Samples were withdrawn after different time
intervals and immediately put in a boiling water
bath for 2 min to stop the reaction. The denatured proteins were removed by centrifugation at
14 000 g for 10 min. The supernatants containing the reaction products were analysed by HPLC
on CarboPac PA-100 analytical column using 100
mM NaOH as the mobile phase at a flow-rate of
1 ml min 1. A Dionex 500 chromatographic system, controlled by PeakNet software (Dionex)
was used to separate and detect the oligosaccharides. Mannose, mannobiose, mannotriose, mannotetraose and mannopentaose at concentrations
1, 5, 10, 20 and 40 mg ml 1 were used as
standards.
In a separate experiment, purified ManA (3.5
pmol) was added to 2.5 mg ml 1 suspensions of
ivory nut mannan in 50 mM sodium citrate
buffer, pH 5.5 containing 0.1% BSA. The ivory
nut mannan used here is an insoluble linear polymer of b-1,4-linked mannosyl residues. The degree
of polymerisation has been reported to be in the
order of 20 (Meier, 1958). The hydrolysis was
carried out at 40 C for 24 h during which period
the ivory nut mannan was only partially dissolved. After centrifugation the contents of the
supernatant were analysed by HPLC as described
above.

2.3.10. Determination of cellulose and mannan

binding ability
Binding of the b-mannanases to mannan and
cellulose was investigated by incubating the enzymes with the polysaccharides at 4 C for 1 h
after which the samples were centrifugated and
the residual enzymatic activity in the supernatant
was analysed. Here 3.5 pmol ManA and ManB
were mixed with 1% suspension of Avicel PH 101
and Ivory nut mannan, respectively, in 50 mM
sodium citrate buffer at pH 5.2.

272

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

3. Results

3.1. Purification of the i-mannanases

SEC on the Superdex 75 pg 60/600 column of
the b-mannanase active peak from the IMAC step
gave a 22-fold purification. The enzyme eluted as
a narrow, symmetric peak. Due to the relatively
high pI (approximate 7.8) of the b-mannanases,
the pooled active fractions from the SEC step
were further purified on a Mono S HR10/10
column at pH 5.5. Two active, well separated
b-mannanase peaks, ManA and ManB, were
eluted, with purification factors 3.5 and 2.3,
respectively.
The results of the purification procedure are
summarized in Table 1. An approximately 1300fold purification was achieved for ManA with an
overall yield of 20%. For ManB, a 900-fold purification was achieved with a yield of 16%. The
purities of the final products were analysed by
SDS-PAGE and IEF using the silver staining
method. Typical chromatograms of each step are
shown in Fig. 1.

3.2. Properties of the i-mannanases

In Fig. 2 is shown the result of the SDS-PAGE
analysis of samples from the different steps of the
purification process. The positions of the single
bands representing the pure b-mannanases after
the final IEC step indicate a single polypeptide
chain with a molecular weight around 39 000 Da.
MALDI-TOF measurements resulted in molecular weights 39 702 Da for ManA and 39 265 Da
for ManB, respectively (data not shown). IEF
analysis gave an estimated isoelectric point for
ManA of 7.8 (Fig. 3). A slightly higher isoelectric
point was observed for ManB. SDS-PAGE did
not reveal any impurities, even at high sample
loading and using the silver staining method.
As shown in Table 1, there is a significant
difference in specific activity of the purified bmannanase variants. Thus for ManA a value of
49.7 U mg 1 and for ManB a value of 32.4 U
mg 1 was obtained, respectively.
Amino acid composition analysis of the purified
enzymes showed no significant difference between

the two varieties (data not shown). The b-mannanases are rich in histidine. The N-terminal sequence of ManA is: R-L-S-V-S-G-T-N-L-N-Y-NG-H-H-I-F-L-S-G-A-N-Q-A-W-V-N-Y-A-R-DF-G-H-N-Q-. The first 12 amino acid sequences at
the N-terminal were analysed for ManB and
found to be identical to that of ManA.
The N-terminal sequence alignment of the M.
edulis b-mannanase with that of b-mannanases
from other higher organisms, P. insularus and the
marine mollusc, L. bre6icula, shows significant
sequence similarity (Fig. 4). Thus, a conserved
region of ten amino acids could be registered.
The effect of pH on the activity of both b-mannanases was investigated (data not shown). Maximum activity was obtained at pH 5.2 with a
comparatively rapid decrease on both acid and
alkaline sides. More than 80% of the activity was
found in the range pH 4.06.5. The enzymes are
stable from pH 4 to 9.5 (data not shown). The
optimum temperature of the b-mannanase activity
was studied at optimum pH (data not shown).
Both ManA and ManB showed maximum activity
at about 50 C. At 60 C the activity was reduced to 50% of maximum. In a separate temperature stability study in the presence of 0.1% BSA
we found that the enzymes are unstable at higher
temperatures. At 60 C the enzymes lost their
activity within 1 min. At 50 C the half-life of
both ManA and ManB was 20 min. Both enzymes
lost their activity completely after 60 min (data
not shown). However, the enzymes are stable for
several hours at 30 and 40 C.

3.3. Kinetic properties

The Km and Vmax values for ManA and LBG
were determined to be 3.95 mg ml 1 and 176.8
nkat mg 1, respectively, using the Woolf plot
(not shown).

3.4. Enzymatic hydrolysis

The purified ManA and ManB were tested for
other enzymatic activities. No xylanase, amylase,
cellulase, b-galactosidase and b-mannosidase activities were detected using an incubation time of

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

273

Fig. 1. Chromatograms of each step in the M. edulis b-mannanase purification process. Details of each experiment are described in
Section 2. (A) IMAC on STREAMLINE Chelating. Arrows indicate where the buffer changes were made. (A) Equilibration buffer
containing 50 mM imidazole, (B) Equilibration buffer containing 50 mM EDTA. (B) SEC on Superdex 75. (C) IEC on Mono S HR
10/10. (D) SEC on Superdex 200 under denaturing conditions. (E) IEC on Mono S HR 5/5. The solid lines in all chromatograms
represent the UV absorbance at 280 nm and in (A) and (B) the dashed lines represent the b-mannanase activity. For (D) and (E)
similar curves were obtained for ManB.

4 h. No binding to cellulose or mannan could be

observed (data not shown).
The purified ManA and ManB show the same
pattern of hydrolysis, thus they do not hydrolyse

mannobiose and mannotriose (data not shown).

ManA cleaves mannopentaose mainly to mannobiose and mannotriose and mannotetraose (Fig.
5). Mannotetraose can be hydrolyzed to mannose

274

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

and mannotriose plus little mannobiose, but the

hydrolysis rate is very low in comparison with the
hydrolysis of mannopentaose. After 24 h incubation, 73% of the mannotetraose still remains intact. The main products of hydrolysis of ivory nut
mannan are similar to the hydrolysis pattern of
mannopentaose. The results of the hydrolysis experiments indicate that the enzymes are endo-bmannanases in conformity with data from studies
of b-mannanases from other organisms.

4. Discussion
Due to the relatively high viscosity and turbidity of the crude extracts from the blue mussel
digestive glands, we choose the large particle diameter (average dp 200 mm) STREAMLINE
Chelating, saturated with zinc ions, as an IMAC
absorbent for the initial capture step in stirred
batch adsorption mode. The strong binding of the
b-mannanases and the high sedimentation rate of
this adsorbent made the washing procedure both

Fig. 2. SDS-PAGE of samples from the different purification

steps. Lanes 1 and 9: LMW calibration kit proteins; lane 2:
crude extract; lane 3: b-mannanase fraction after IMAC; lane
4: b-mannanase fraction after SEC; lanes 5 and 6: ManA and
ManB after the first IEC step; lanes 7 and 8: ManA and ManB
after the second IEC step. Each lane contains 0.5 mg protein.
The gel was stained with silver nitrate. The positions of the
Mw-standard proteins are marked at the side.

Fig. 3. Isoelectric focusing analysis in polyacrylamide gel of

b-mannanases from the last IEC step. Lane 1: ManA; lane 2:
ManB. 0.2 mg protein was loaded to the gel. The sample lanes
are surrounded by lanes containing the pI calibration kit
proteins (pH 3 10).

easier and faster. The use of the STREAMLINE

Chelating in expanded bed mode turned out to be
less feasible due to clogging of the net in the
column bottom end piece.
Purity analysis of the material in the peaks
from the IEC step using native-PAGE showed
only one strong band even when using the silver
staining method. However, SDS-PAGE analysis
revealed several low-molecular weight bands in
addition to the b-mannanase band. Our interpretation is that there are complex forming proteins
present in the sample that causes this phenomenon. The problem was finally solved using
SEC on Superdex 200 16/60 pg in the presence of
6 M Gu HCl to remove the contaminating
proteins. It seems as if the denaturing condition
dissociates the b-mannanase protein complexes.
Fortunately, the b-mannanases can be easily renatured by removing the GuHCl by SEC on Sephadex G-25 without significant loss of activity.
The remaining contaminants were then removed
by a rerun on Mono S HR 5/5 column after

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

275

Fig. 4. N-terminal sequence alignment of b-mannanases from M. edulis, P. insularus (Yamaura and Matsumoto, 1993) and L.
bre6icula (Yamaura et al., 1996). Conserved sequences are boxed. Common residues are marked light grey.

which step the enzymes showed only one band in

SDS-PAGE.
MALDI-TOF analysis of the purified b-mannanases showed a mass difference of 43.7 Da. The
N-terminal sequences were found to be identical
and no C-terminal sequence analysis was performed. At this stage of the investigation it is not
possible to present a reasonable hypothesis as to
the origin of the mass difference. More analysis
will have to be made, such as tryptic peptide
mapping and sequence analysis of isolated diverging peptides.
Frequently, microbial b-mannanases appear extracellularly in multiple forms. It has been indicated that several b-mannanase isoforms of T.
reesei are expressed by the man1 gene (Sta lbrand
et al., 1995; Sta lbrand, 1995). However, for the
anaerobic fungus Pyromyces three homologous
b-mannanase encoding genes have been isolated
(Millward-Sadler et al., 1996). In the present case,
it is possible that the two b-mannanases are modifications of a common gene product, but it needs
to be investigated further.
b-Mannanases may be one domain proteins
(Christgau et al., 1994b) or may contain additional domains naturally fused to the catalytic
domain. For example the T. reesei and the Cellulomonas fimi b-mannanases carry additional
polysaccharide binding domains (Sta lbrand et al.,
1995; Stoll et al., 1999, 2000). The T. reesei bmannanase binds to cellulose, mediated through a
cellulose binding domain (CBD) (Sta lbrand et al.,
1995; Ademark et al., 1998; Tenkanen et al.,
1994). The M. edulis enzymes apparently do not
contain a CBD since they do not bind to cellulose.
The obtained apparent molecular mass of approx.
39 kDa for the M. edulis b-mannanases corre-

spond well to the molecular masses of b-mannanase catalytic domains of family 5 and family
26. Furthermore, the hitherto unclassified b-mannanases from the other mollusca P. insularus, L.
bre6icula, and H. pomatia have similar molecular
masses, i.e. 3742 kDa (Yamaura and Matsumoto, 1993; Yamaura et al., 1996; McCleary,
1988).
The M. edulis b-mannanases appear to be related to those of P. insulans and L. bre6icula, since
their N-terminal sequences showed partial identity. However, neither of these partial sequences
have been found to be identical or similar to those
of other b-mannanases. This is why family assignment is not yet possible.

Fig. 5. Diagram of the time course of hydrolysis of mannopentaose. M1 M5 indicate mannose, mannobiose, mannotriose,
mannotetraose and mannopentaose, respectively. 3.5 pmol
purified ManA was incubated with 1 mM mannopentoase in
50 mM Na citrate buffer, pH 5.5 containing 0.1% BSA, at
40 C. Samples were withdrawn after different time intervals
and immediately boiled for 2 min to stop the reaction. The
denatured proteins were removed by centrifugation at 14 000
rpm for 10 min. The supernatants containing the reaction
products were analysed by HPLC. The data presented are
from integrated peaks.

276

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

As for other mollusc b-mannanases, the M.

edulis enzymes have a high content of basic amino
acids, and consequently relatively high isoelectric
points, about 7.8. In contrast, many bacterial as
well as fungal b-mannanases have got acidic pIs
(Viikari et al., 1993). The P. insularus and L.
bre6icula b-mannanases are inhibited by Ag+
ions, whereas the M. edulis enzymes are not.
The Km values for locust bean gum galactomannan of 3.95 mg ml 1 for the M. edulis ManA is
considerably higher than the values reported for
the H. pomatia enzyme (0.3 mg ml 1) and also
high compared to some previously reported bacterial and fungal b-mannanases (0.0015 1.1 mg
ml 1) (McCleary, 1988; Stoll et al., 1999; ArisanAtac et al., 1993).
The acidic pH optimum (5.2) for the M. edulis
enzymes is similar to, or higher than, those of
fungal b-mannanases that usually lie between 3.0
and 5.5 (Sta lbrand et al., 1993; Christgau et al.,
1994b; Ademark et al., 1998; Viikari et al., 1993).
However, it is lower than those of bacterial bmannanases which have optima close to neutral
pH (Viikari et al., 1993). The M. edulis enzymes
display a relatively low thermostability in comparison to many b-mannanases from non-thermophilic microorganisms that are stable within an
interval of several pH units for several hours at
50 C (Sta lbrand et al., 1993; Ademark et al.,
1998). The b-mannanase of P. insularus was unstable at a temperature as low as 8 C when
incubated for 16 h at around pH 5 (McCleary,
1988).
As for many b-mannanases, including the T.
reesei and A. niger enzymes (Sta lbrand et al.,
1993; Ademark et al., 1998; Harjunpa a et al.,
1995, 1999; Torto et al., 1995, 1996), the major
products from hydrolysis of mannopentaose and
ivory nut mannan by the M. edulis ManA are
mannobiose and mannotriose. An accumulation
of mannotetraose also after 24 h incubation with
ivory nut mannan was observed for the M. edulis
enzyme. Such accumulation has also been observed, at similar enzyme loadings, when the T.
reesei and A. niger enzymes were incubated with
ivory nut mannan (Torto et al., 1995, 1996). The
release of significant amounts of mannotetraose
combined with the fact that only trace quantities

of mannose can be detected, indicates that the M.

edulis b-mannanases are capable of performing
transglycosylation reactions. This is in accordance
with the fact that classified b-mannanases belong
to family 5 and family 26 of glycoside hydrolases,
both having the retaining mechanism. Transglycosylation has been shown for several b-mannanases, including those from A. niger and T.
reesei (Ademark et al., 1998; Harjunpa a et al.,
1995, 1999). The overall pattern of hydrolysis by
the M. edulis b-mannanases appears to be similar
to that of these enzymes. However, a more detailed kinetic study need to be carried out in order
to detect possible differences in the subsite substrate binding requirements.

Acknowledgements
We are most grateful to the R&D Management
of Amersham Pharmacia Biotech in Uppsala for
their financial support of the adjunct professorship of J.-C. J. that made this work possible. H.S.
thanks the Swedish Research Council for Engineering Sciences (TFR) for financial support.

References
Ademark, P., Varga, A., Medve, J., Harjunpa a , V., Drakenberg, T., Tjerneld, F., Sta lbrand, H., 1998. Soft-wood
hemicellulose-degrading enzymes from Aspergillus niger:
purification and properties of a b-mannanase. J. Biotechnol. 63, 199 210.
Arisan-Atac, I., Hodits, R., Kristufek, D., Kubicek, C.P.,
1993. Purification and characterization of a b-mannanase
of Trichoderma reesei C-30. Appl. Microbiol. Biotechnol.
39, 58 62.
Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory
testing of methods for assay of xylanase activity. J. Biotechnol. 23, 257 270.
Bernfeld, P., 1955. Amylases, a- and b-. Methods Enzymol. 1,
149 158.
Bradford, M.M., 1976. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing
the principle of protein dye binding. Anal. Biochem. 72,
248 254.
Christgau, S., Andersen, L.N., Kauppinen, S., Heldt-Hansen,
H.P., Dalboege, H., 1994. Purified enzyme exhibiting mannanase activity; application in oil, paper, pulp, fruit and
vegetable juice industry and in carrageenan extraction,
Patent Novo-Nordisk, 9425576, 10 November 1994.

B. Xu et al. / Journal of Biotechnology 92 (2002) 267277

Christgau, S., Kauppinen, S., Vind, J., Kofod, L.V., Dalbge,
H., 1994b. Expression cloning, purification and characterization of a b-1,4-mannanase from Aspergillus aculeatus.
Biochem. Mol. Biol. Int. 33, 917 925.
Duffaud, G.D., McCutchen, C.M., Leduc, P., Parker, K.N.,
Kelly, R.M., 1997. Purification and characterization of
extremely thermostable b-mannanase, b-mannosidase, and
b-galactosidase from the hyperthermophilic eubacterium
Thermotoga meapolitana 5068. Appl. Environ. Microbiol.
63, 169 177.
Gu bitz, G.M., Hayn, M., Urbanz, G., Steiner, W., 1996.
Purification and properties of an acidic b-mannanase from
Sclerotium rolfsii. J. Biotechnol. 45, 165 172.
Harjunpa a , V., Teleman, A., Siika-aho, M., Drakenberg, T.,
1995. Kinetic and stereochemical studies of mannooligosaccharide hydrolysis catalysed by b-mannanase from
Trichoderma reesei. Eur. J. Biochem. 234, 278 283.
Harjunpa a , V., Helin, J., Koivula, A., Siika-Aho, M., Drakenberg, T., 1999. A comparative study of two retaining
enzymes of Trichoderma reesei: transglycosylation of
oligosaccharides catalysed by the cellobiohydrolase I,
Cel7A, and the b-mannanase, Man5A. FEBS Lett. 443,
149 153.
Henrissat, B., Bairoch, A., 1993. New families in the classification of glycosyl hydrolases based on amino-acid sequence
similarities. Biochem. J. 293, 781 788.
Matheson, N.K., McCleary, B.V., 1985. In: Aspinall, G.O.
(Ed.), The Polysaccharides, vol. 3. Academic Press, New
York, p. 1.
McCleary, B.V., Matheson, N.K., 1986. Enzymic analysis of
polysaccharide structure. In: Tipson, R.S., Horton, D.
(Eds.), Adv. Carbohydr. Chem. Biochem. Academic Press,
UK, pp. 147 276.
McCleary, B.V., 1988. b-D-Mannanase. Methods Enzymol.
160, 596 614.
McCleary, B.V., 1990. Comparion of endolytic hydrolases that
depolymerize 1,4-b-D-mannan, 1,5-b-L-arabinan and 1,4-bD-galaktan. ACS Symp. Ser. 460, 437 449.
Meier, H., 1958. On the structure of cell walls and cell wall
mannans from ivory nuts and from dates. Biochem. Biophys. Acta 28, 229 240.
Millward-Sadler, S.J., Hall, J., Black, G.W., Hazlewood, G.P.,
Gilbert, H.J., 1996. Evidence that the Piromyces gene
family encoding endo-1,4-mannanases arose through gene
duplication. FEMS Microbiol. Lett. 141, 183 188.
Paice, M.G., Jurasek, L., 1984. Removing hemicellulose from
pulps by specific enzymatic hydrolysis. J. Wood Chem.
Technol. 4, 187 198.
Purchon, R.D., 1977. The Biology of the Mollusca, second ed.
Pergamon, Oxford.
Ra tto , M., Poutanen, K., 1988. Production of mannan-degrading enzymes. Biotechnol. Lett. 10, 661 664.

277

Sta lbrand, S., Siika-aho, M., Tenkanen, M., Viikari, L., 1993.
Purification and characterization of two b-mannanases
from Trichoderma reesei. J. Biotechnol. 29, 229 242.
Sta lbrand, H., Saloheimo, A., Vehmaanpera , J., Henrissat, B.,
Penttila , M., 1995. Cloning and expression in Saccharomyces cere6isiae of a Trichoderma reesei b-mannanase
gene containing a cellulose binding domain. Appl. Environ. Microbiol. 61, 1090 1097.
Sta lbrand, H., 1995. Hemicellulose-degrading enzymes from
fungi. Characterization of b-mannanase and the man1 gene
of Trichoderma reesei. Department of Biochemistry, Lund
University, Lund, Sweden Ph.D. thesis.
Stoll, D., Sta lbrand, H., Warren, R.A.J., 1999. Mannan-degrading enzymes from Cellulomonas fimi. Appl. Environ.
Microbiol. 65, 2598 2605.
Stoll, D., Boraston, A., Sta lbrand, H., McClean, B.W., Kilburn, D.G., Warren, R.A.J., 2000. Mannanase Man 26A
from Cellulomonas fimi has a mannan binding module.
FEMS Microbiol. Lett. 183, 265 269.
Tamaru, Y., Araki, T., Amagoi, H., Mori, H., Morishita, T.,
1995. Purification and characterization of an extracellular
b-1,4-mannanase from a marine bacterium, Vibrio sp.
Strain MA-138. Appl. Environ. Microbiol. 61, 4454 4458.
Tenkanen, M., Buchert, J., Viikari, L., 1994. Binding of
hemicellulases on isolated polysaccharide substrates. Enzyme Microb. Technol. 17, 499 505.
Torto, N., Buttler, T., Gorton, L., Marko-Varga, G.,
Sta lbrand, H., Tjerneld, F., 1995. Monitoring of enzymatic
hydrolysis of ivory nut mannan using on-line microdialysis
sampling and anion-exchange chromatography with integrated pulsed electrochemical detection. Anal. Chem. Acta
313, 15 24.
Torto, N., Marko-Varga, G., Gorton, L., Sta lbrand, H., Tjerneld, F., 1996. On-line quantitation of enzymatic mannan
hydrolysates in small-volume bioreactors by microdialysis
sampling and column liquid chromatography-integrated
pulsed electrochemical detection. J. Chromatogr. 725, 165
175.
Viikari, L., Tenkanen, M., Buchert, J., Ra tto , M., Bailey, M.,
Siika-aho, M., Linko, M., 1993. Hemicellulases for industrial applications. In: Saddler, J.N. (Ed.), Bioconversion of
Forest and Agricultural Plant Residues. CAB International, Wallingford, pp. 131 182.
Wood, T.M., Bhat, K.M., 1988. Methods for measuring cellulase activities. Methods Enzymol. 160, 87 112.
Yamaura, I., Matsumoto, T., 1993. Purification and some
properties of endo-1,4-b-D-mannanase from a mud snail,
Pomacea insularus (de Ordigny). Biosci. Biotech. Biochem.
57, 1316 1319.
Yamaura, I., Nozaki, Y., Matsumoto, T., Kato, T., 1996.
Purification and some properties of an endo-1,4-b-D-mannanase from a marine mollusc, Littorina bre6icula. Biosci.
Biotech. Biochem. 60, 674 676.

VI

135

Degradation of glucomannan and O-acetylgalactoglucomannan by mannoside- and

glucoside-hydrolases
Jon Lundqvist1, Per Hgglund1*, Torny Eriksson1, Per Persson2, Dominik Stoll3,
Matti Siika-aho4, Lo Gorton2 and Henrik Stlbrand1

Department of Biochemistry, Center for Chemistry and Chemical Engineering, Lund University,
P.O. Box 124, S-221 00, Lund, Sweden

Department of Analytical chemistry, Center for Chemistry and Chemical Engineering, Lund University,
P.O. Box 124, S-221 00, Lund, Sweden
3

Department of Microbiology and Immunology, The University of British Columbia, Vancouver,

British Columbia, Canada
4
VTT Biotechnology, P.O. Box 1500, Espoo FIN-02044, Finland

*Corresponding author: Department of Biochemistry, Centre for Chemistry and Chemical Engineering,
University of Lund, Lund, P.O. Box 124, S-221 00, Lund, Sweden.
Tel: +46 46 222 9854 Fax: +46 222 4534. e-mail:per.hagglund@biokem.lu.se

Abstract
The plant cell wall is a tissue with cellulose, hemicellulose and lignin, tightly associated through
various interactions. Cellulases are therefore likely to be affected by the presence of the
hemicellulose components, and in the same way hemicellulases are probably affected by cellulose.
In this study we have analysed the degradation of mannan-based hemicelluloses (glucomannan
and O-acetyl-galactoglucomannan) by hemicellulases and cellulases. The products were analysed
by reducing sugar analysis, size-exclusion chromatography and HPLC analysis. As expected, the
-mannanases used in this study degraded the mannans to oligosaccharides. More surprisingly,
the endoglucanase Cel7B from Trichoderma reesei also displayed activity against both
glucomannan and O-acetyl-galactoglucomannan. Endoglucanase Cel45A from T. reesei was active
against glucomannan. Furthermore, -mannosidase from Aspergillus niger released mannose
from both glucomannan and O-acetyl-galactoglucomannan. Mass spectrometry analysis revealed
that acetylated mannose can also be released by this -mannosidase.

137

Introduction
Mannans and heteromannans are among the most abundant biopolymers on earth. Linear b-(14)D- mannans are found in the seed endosperms of numerous plants (Meier, 1958; Wolfrom et al.,
1961), and also in the cell walls of some green algae (Frei & Preston, 1968; Ikiri & Miwa, 1960).
Galactomannans, which are composed of a linear mannan chain with some a-(16)-linked
galactosyl side-groups, are found mainly in the seeds of leguminous plants (Reid, 1985). The
most abundant mannan-based polysaccharides, in terms of biomass, are the O-acetylgalactoglucomannans (O-acetyl-GGM) and glucomannans, which are found as hemicelluloses in
softwoods and hardwoods, respectively (Timell, 1967). Besides in wood, glucomannan are also
found as reserve polysaccharides in the root and tubers of some annual plants (Meier & Reid,
1982). Glucomannan is built up by a linear chain of b-(14)-linked mannose and glucose units,
which may be acetylated. O-acetyl-GGM is built up by a glucomannan main chain with a-(16)linked galactosyl branches (Figure 1). Acetyl groups may be attached at the C-2 and C-3 positions of some mannose residues (Lindberg et al., 1973; Timell, 1967).
The complete degradation of the complex mannan-based hemicelluloses require the presence of
several hemicellulose-degrading enzymes. Endo--1,4-D-mannanase (-mannanase; EC 3.2.1.78)
is the major endo-hydrolase involved in mannan hydrolysis, degrading glucomannans and
galactoglucomannans into smaller soluble oligosaccharides. These oligosaccharides can subsequently be further degraded by several exo-hydrolases, namely -mannosidase (EC 3.2.1.25), glucosidase (EC 3.2.1.21) and -galactosidase (EC 3.2.1.22). -Mannosidase and -glucosidase
attack the main chain of oligosaccharides from its non-reducing ends and release mannose and
glucose residues, respectively. -Galactosidase release galactosyl side-groups, apparently with a
preference for either oligomeric or polymeric substrates depending on the enzyme source (Ademark
et al., 2001a; Ademark et al., 2001b). Acetyl groups may be removed by acetyl (mannan) esterase
(Tenkanen et al., 1995).
-Mannanases have been purified from a wide range of microbes (Ademark et al., 1998; Stoll et
al., 1999; Stlbrand et al., 1993; Sunna et al., 2000) and also from some higher organisms (Xu et
al., 2002). Based on sequence similarities, all -mannanases characterised this far have been
assigned to family 5 and 26 of glycoside hydrolases, according to the classification of Henrissat
et al. (1991). -Mannosidases have also been found in a wide range of organisms, and most mannosidases analysed have been classified in family 2 (Ademark et al., 2001a). Families 2, 5
and 26 are all included in the GH-A clan, which share the (/)8 barrel structural fold (Jenkins et
al., 1995). Included in the GH-A clan is also family 1, which includes some -glucosidases. Galctosidases are found in family 4, 27 and 36.
The degradation patterns of the -mannanases from Trichoderma reesei and Aspergillus niger on
different heteromannans have been studied previously (McCleary & Matheson, 1983; Puls &
Schuseil, 1993; Rtt et al., 1993; Tenkanen et al., 1997). These studies have provided some
information about the sub-site specificity of these enzymes, but the influence of acetyl groups on
the hydrolysis has not been examined in detail. We and others have previously shown that at least
some -mannosidases can degrade mannan polymers (Ademark et al., 1999; Kulminskaya et al.,
1999), and we have also shown that the -mannosidase Man2A from Aspergillus niger (previously called Mnd2A) degrade even highly crystalline polymeric mannan (Hgglund et al., 2001).
138

However, only sparse information is available on the degradation of glucomannan by mannosidase (Gbitz et al., 1996; Hirata et al., 1998). We and others have previously reported
that some endoglucanases depolymerise glucomannan (Chhabra et al., 2002; Karlsson, 2000).
The rationality behind glucomannan degradation by endoglucanases is unclear and the detailed
degradation patterns have not yet been investigated.
Previously we have detected activity toward O-acetyl-GGM by -mannanase and -galactosidase (Lundqvist et al., 2002b), but otherwise little information is published on the degradation of
this polysaccharide. In this study, we have analysed the degradation of glucomannan and Oacetyl-GGM by a series of different mannan-degrading enzymes and endoglucanases (Table 1).
We have used an isolated fraction of O-acetyl-GGM from spruce (Lundqvist et al., 2002b) and a
glucomannan from Amorphophallus konjac (so called konjac glucomannan (KM)) as substrates
for these enzymes and we have studied the products after prolonged degradation. In the native
state KM has a molecular weight of 1000000 (Nishinari et al., 1992). Native O-acetyl-GGM has
a degree of polymerisation between 100-150 (Timell, 1967).
The results of this study indicate that the T. reesei endoglucanase Cel7B, can depolymerise Oacetyl-GGM to a limited extent. Furthermore, we present results which show that Man2A can
release acetylated mannose residues from the non-reducing end of O-acetyl-GGM.

Materials and methods

Substrates
Konjac glucomannan (KM) from the tubers of Amorphophallus konjac plants was purchased
from Megazyme (Bray, Ireland). O-acetyl-galactoglucomannan (O-acetyl-GGM) from spruce was
previously isolated in our group (Lundqvist et al., 2002b). The O-acetyl-GGM was isolated from
a filtrate obtained by heat fractionation of spruce and has a molecular weight of 2600. It is most
likely a fragment of the native polysaccharide and displayed a monomer composition similar to
low galactosyl-substituted O-acetyl-GGM (Lundqvist et al., 2002b). O-acetyl-GGM and KM
were solubilised in the appropriate buffer before the enzymatic treatment.

Enzymes
The catalytic module (amino acid 1-352) of the Trichoderma reesei -mannanase Man5A (Stlbrand
et al., 1995), was expressed in T. reesei under control by the gpdA promoter from Aspergillus
nidulans and purified as described earlier (Hgglund et al., 2002). The catalytic module (amino
acid 1-371) of the T. reesei endoglucanase Cel7B (Penttil et al., 1986), was expressed in T. reesei
under control of the gpdA promoter from A. nidulans, as described previously (Colln et al.,
2001). Cel7B was purified by anion-exchange chromatography with Source Q (Amersham
Pharmacia Biotech), using 20 mM Na-acetate (pH 4.5) as buffer A and 1 M Na-Acetate (pH 4.5)
as buffer B. Cel7B was eluted with a linear gradient of buffer B. Man2A from A. niger was
overexpressed in a multi-copy strain of A. niger as described by Ademark et al (Ademark et al.,
2001a), and purified as described previously (Ademark et al., 1999). The A. niger -galactosidase Agal II was purified according to Ademark (Ademark et al., 2001b).

139

The catalytic module (amino acid 1-182, including signal peptide) of Cel45A (Saloheimo et al.,
1994) from T. reesei was purified from the culture filtrate of a T. reesei strain constructed for
expression of the protein in glucose-containg medium, as described by earlier (Nakari-Setla &
Penttil, 1995). The culture filtrate was adjusted to pH 6.0 and applied to a column with DEAE
Sepharose FF. The protein was eluted with a NaCl gradient from 0 - 0.2 M. The fractions containing Cel45A were pooled and the buffer was adjusted to 0.02 M sodium acetate (pH 5.0) and 0.5 M
(NH4)2SO4. The pooled fractions were applied to a column with Phenyl Sepharose FF. For elution
a gradient of decreasing concentration of sodium acetate and (NH4)2SO4 was used where Cel45A
was eluted with 1 mM sodium acetate. The pooled fractions with Cel45A were adjusted to pH 3.0
with 5 mM acetic acid/sodium acetate and applied to a SP Sepharose FF column. Cel45A was
eluted with a NaCl gradient from 0 - 0.5 M.
The catalytic module (amino acid 1-464) of Cellulomonas fimi Man26A (Stoll et al., 1999) was
expressed from a pET vector in Escherichia coli BL21 and purified essentially as described
previously (Stoll et al., 1999). Cells were ruptured in a French pressure cell and equilibrated in a
binding buffer (5 mM imidazole, 500 mM NaCl, 20 mM Tris-HCl, pH 7.9). The equilibrated
sample was applied on a 5 ml column packed with His Bind Resin (Novagen, Madison, WI,
USA) at a flow rate of 1 ml/min and eluted by an stepwise increase in imidazole concentration
from 5 mM to 500 mM. A commercial preparation of A. niger -glucosidase (-Gluc) was used
(Megazyme). All purified enzymes appeared as single bands on SDS-PAGE (Laemmli, 1970)
after silver staining.

Enzyme activity assays

The -mannosidase/-glucosidase activity ratio in the Man2A and -Gluc preparations were assayed essentially as described previously (Rtt & Poutanen, 1988) at pH 4.5 using 2 mM pnitrophenyl--D-glucopyranoside (Sigma, St Louis, MO, USA) and 2 mM p-nitrophenyl--Dmannopyranoside (Sigma).

Dot-blot analysis
All steps were performed at room temperature. Drops of 4 l containing either Man5A or Cel7B
were placed on a Biotrace NT blotting nitrocellulose membrane (Pall Gelman Sciences, Ann
Arbor, MI, USA) and allowed to dry for 15 min. The membrane was placed in blocking solution
(TBS buffer (20 mM Tris, 137 mM NaCl, pH7.6), 0.1 % Tween and 1.5 % Bovine serum albumin
(BSA)) for one hour with gentle shaking. The membrane was washed twice for 5 min in washing
buffer (TBS, 0.1 % Tween). New TBS buffer including polyclonal antibodies (diluted 1/1000)
against Man5Araised in rabbit, was added and the mebrane was incubated for 1 h.
After two washes as described above, new TBS buffer containing secondary goat anti-rabbit
antibodies (Bio-Rad (Hecules, CA, USA)) diluted 1/1500 was added, and the membrane was
incubated for 1 h. After two washes in Tris buffer (0.1 M Tris, 0.5 mM MgCl2, pH9.5), Tris buffer
containing Nitroblue tetrazolium chloride (300 g/ml) and AP Color Development Reagent (150
g/ml) (Bio-Rad, Hercules, CA, USA) solutions was added, and the mixture was incubated until
spots were clearly visible (approximately 60 minutes). The incubation was ended, by immersing
the membrane in distilled water for 10 min.

140

Enzymatic hydrolysis of konjac glucomannan and galactoglucomannan

All enzymatic incubations were carried out at 40 C in 50 mM ammonium acetate buffer, pH 4.8,
except Man26A which was incubated in 50 mM ammonium acetate buffer, pH 6.2. In all enzymatic
incubations BSA (100 g/ml) was included and in all incubations the enzyme concentration was
0.1 M. Man5A, Man26A, Cel7B and Cel45A were incubated with KM (5 mg/ml) for 72 h and
Man2A and -glucosidase were incubated with KM (5 mg/ml) for 92 h. Man2A, Man5A, Cel7B,
Agal II and -Gluc were incubated with 10 mg/ml O-acetyl-GGM for 92 h.
In order to ensure that all incubations were hydrolysed to completion, samples were withdrawn at
different time points and subjected to reducing sugar analysis, as described below. The difference
in amount of reducing sugars in the two last time points, which were separated by 24 h, did not
exceed 12 % in any incubation. All enzymatic reactions were terminated by boiling the samples
for 2 minutes.

Reducing sugar analysis

Samples from the enzymatic incubations were withdrawn and analysed for reducing sugars using
3,5-dinitrosalicylic acid (DNS), according to Sumner and Somers (1949), using a mannose (Fluka
Chemie AG, Buchs, Switzerland ) standard curve. Corrections were made for reducing sugars
present in parallel control incubations of polysaccharides without enzyme.

Size exclusion chromatography

The end products formed after hydrolysis of KM and O-acetyl-GGM by the -mannanases and
endoglucanases were separated using an FPLC-system (Pharmacia Biotech, Uppsala, Sweden)
with refractive index (RI)- (Erma-inc, Tokyo, Japan) and ultra violet (UV)- (Pharmacia Biotech,
280nm) detectors. Two size exclusion chromatography (SEC) systems were set up; SEC1 for
determination the molecular weight distribution (MWD) of polysaccharides of and SEC2 for
analysis of oligosaccharides with degree of polymerization (DP) from 1-7.
SEC1: The separations (Molecular weight-range of 1000-40000) were performed using gel filtration media from Pharmacia Biotech . In this SEC system three columns were connected in series,
(i) a precolumn Superdex 75 (HR 5/5), (ii) a Superdex 75 (HR 10/30), and (iii) a Superdex 200
(HR 10/30) column, (Pharmacia Biotech). The MWD was determined using O-acetyl-GGM isolated previously as standards (Lundqvist et al., 2002a). The molecular weight of these GGM
standards were determined previously by matrix assisted laser desorption/ionisation mass
spectrometry (Lundqvist et al., 2002a). A sample volume of 500 l was loaded on the columns
and water was used as mobile phase at a flow rate of 0.5 ml/min in room temperature. Acetone
was used to determine the total volume of the columns (47 ml).
SEC2: The oligosaccharide analysis (DP 1-9, molecular weight 100-1500) was performed using
Bio-Gel P-2 Gel, Fine, gel filtration media from Bio-Rad Laboratories. The media was packed in
a Pharmacia column (HR 30/95) with a total volume of 670 ml. Manno-oligosaccharides (DP1-5)
from Megazyme were used as calibration standards. A sample volume of 500 l was loaded on
the column and water was used as mobile phase at a flow rate of 0.3 ml/min in room temperature.
Standards were manno-oligosaccharides of DP 1-6 (Megazyme)

141

HPLC-analysis
For the determination of released monosaccharides after hydrolysis of the oligo- and
polysaccharides, High Performance Anionic Exchange Chromatography with Pulsed Amperometric
Detection (HPAEC-PAD) (DIONEX, Sunnyvale Ca, USA) was used. The HPAEC-PAD consisted of an AS50 autosampler, a GP40 gradient pump and Carbo Pac Pa10 guard and analytical
column and an ED40 electrochemical detector. The flow rate using water elution was 1 ml/min
and the injection volume was 10 l. A post-column pump (DIONEX) with 200 mM NaOH as
eluent was used to enable detection of the sugars. D-mannose, D-xylose, D-glucose, D-galactose,
L-arabinose (Fluka Chemie) was used as standards for the analysis.

MS-analysis
The mass spectrometry analysis of hexoses and acetylated hexoses was performed on an EsquireLC ion-trap mass spectrometer equipped with an API-electrospray interface operated in positive
ionisation mode (Bruker Daltonics, Bremen, Germany). The mass spectrometer was set to scan in
the mass-to-charge ratio (m/z) range of 50-310. Nitrogen was used as a drying gas and was pumped
into the interface at a rate of 3 L/min and at a temperature of 350C. Nitrogen was also used as
nebuliser gas and was kept at 10 psi. The nitrogen gas was supplied by a nitrogen generator from
Whatman Inc. (Haverhill, MA, USA). The following voltages were used: HV capillary 4000 V,
HV end plate offset -500 V, capillary exit offset 65 V, skimmer 1 35 V and skimmer 2 8 V. The
sample was continuously injected into the interface by a syringe pump (Cole Parmer 74900 series, Cole Parmer Instrument Company, Vernon Hills, IL, USA). A 250 l syringe (Hamilton,
Reno, NV, USA) was used for infusion and the injection speed was 90 l/h. Five parts of the
sample was mixed with one part of a sodium acetate solution (3.8 mg/ml) prior to injection.

Results
In this study, konjac glucomannan (KM) and O-acetyl-galactoglucomannan (O-acetyl-GGM) have
been hydrolysed by several hemicellulases and cellulases (Table 1) Two endoglucanases (Cel7B
and Cel45A), two -mannanases (Man5A and Man26A) and a -mannosidase (Man2A). Degradation patterns, reducing ends and released monosaccharides have been established by size exclusion chromatography (SEC), reducing sugar assay, high performance anionic exchange chromatography (HPAEC) and mass spectrometry (MS). Two SEC systems were used; SEC1 for the
analysis of products in the molecular weight-range of 1000-40000 (DP 6-250) and SEC2 for the
analysis of products in the molecular weight-range of 100-1500 (DP 1-9)
The properties of the substrates used have been determined previously (Lundqvist et al., 2002b;
Nishinari et al., 1992). KM has a mannose:glucose ratio of 1.6:1 and an molecular weight of
1000000. It has a degree of acetylation (DSAc) of 0.07. The O-acetyl-GGM fraction used was
isolated as described previously (Lundqvist et al., 2002b). It is an isolated fragment of O-acetylGGM hemcellulose isolated from steam fractionated spruce. This preparation has a
galactosyl:glucosyl:mannosyl ratio of 0.1:1:4 with a DSAc of 0.28 and a molecular weight of
2600. A schematic picture of O-acetyl-GGM is shown in Figure 1. The KM and O-acetyl-GGM
used solubilised in the appropriate buffer before incubation with the enzymes.

142

Hydrolysis of KM
KM (5 mg/ml) was hydrolyzed by Cel7B, Cel45A, and Man5A from Trichoderma reesei and
Man26A from Cellulomonas fimi to completion. Reducing ends and mono- and oligosaccharides
obtained after hydrolysis were analysed. The reducing end concentrations estimated after degradation with Cel7B, Cel45A, Man5A and Man26A on KM were 2.7, 1.7, 2.5 and 2.2 mg/ml,
respectively. The elution profile from SEC2 of the oligosaccharides formed after KM hydrolysis
by the different enzymes are shown in Figure 2. The distribution of the products formed after
hydrolysis of KM by all the enzymes was between DP 1-6, except for Cel45A where it was
essentially DP 6 and higher (Figure 2B). Man5A and Man26A had the highest content of DP 2
and 3 with minor production (< 10%) of DP 1 and 3-7 (Figure 2A). The hydrolysis with Cel7B
formed an even distribution of DP 1-7 with the highest production of DP 3 (Figure 2B). Cel45A
did not degrade KM in the same extent as the other enzymes.
A hydrolysis of KM (5 mg/ml) with Man2A and -Gluc was also performed and the amount of
liberated reducing sugar was analysed. A release of 1.2 g/ml (Man2A) and 1.6 g/ml (-Gluc)
was detected when the enzymes were incubated individually. When Man2A and -Gluc were
used in combination a release of 19 g/ml reducing sugars was observed.

Hydrolysis of GGM
An hydrolysis of O-acetyl-GGM (10 mg/ml) with Cel7B, Man5A and Man2A was performed
with the objective to investigate the products formed after prolonged hydrolysis. The depolymerised
O-acetyl-GGM was analysed with SEC1 and SEC2. The resulting elution curves for Cel7B and
Man5A are displayed in Figure 3 (SEC1) and Figure 4 (SEC2). For Cel7B, a moderate but significant shift of the chromatogram elution profile toward smaller apparent molecular weight is seen.
This is an indication of depolymerising activity of Cel7B on O-acetyl-GGM. As seen in the SEC2
chromatogram only small amounts of oligosaccharides of DP 5 or lower could be detected in the
sample hydrolysed by Cel7B. The reducing end concentrations after hydrolysis with Cel7B was
2.1 mg/ml. Man5A degrades O-acetyl-GGM to a higher extent with a reducing sugar concentration of 4.3 mg/ml. This is also seen in the SEC1 elution profile for the products formed after
treatment with Man5A which display a major peak of an approximate molecular weight of 1200
(Figure 3). The elution profile established by SEC 2 showed that the products formed after treatment with Man5A were between DP 2-6 (Figure 4).
O-acetyl-GGM was also hydrolysed by Man5A in combination with Man2A, and by Man2A in
combination with Agal II, and -Gluc. The concentration of reducing ends after hydrolysis using
Man5A in combination with Man2A was slightly higher than for Man5A alone (Table 2). The
hydrolysis by Man5A in combination with Man2A also results in a new peak at molecular weight
<500 in the chromatogram of SEC1, compared with incubation of Man5A alone (Figure 3). This
peak correspond to monomeric products. The combined action of Man2A, Agal II and -Gluc did
not result in a complete degradation of O-acetyl-GGM into monosaccharides (Table 2). In the
incubation with Man2A and -Gluc, Agal II released about 47 % of the galactosyl groups attached to the O-acetyl-GGM. The release of mannose was slightly enhanced compared to the
action with Man2A alone.

143

Dot-blot analysis of Cel7B

The preparation of T. reesei Cel7B used in this study appeared as single bands on SDS-PAGE and
isoelectric focusing gels (data not shown). In order to ensure that the depolymerisation of Oacetyl-GGM with the Cel7B preparation was a true endoglucanase activity and not due to a
contamination of -mannanase, the purity of the Cel7B preparation was further assessed. A dotblot analysis with antibodies directed against Man5A, the only known -mannanase from T.
reesei (Stlbrand et al., 1995), was performed (Figure 5). No visible antibody labeling of the
Cel7B sample was seen, even if a 10 000 fold more Cel7B (on a molar basis) was applied in
correlation to the amount of Man5A which gave a clearly visible spot.

The acetyl-groups attached to the mannosyl units

O-acetyl-GGM (10 mg/ml) was incubated with Man2A for 92 h. A control incubation of Man2A
without O-acetyl-GGM was also included. After the incubations electrospray ionization mass
spectrometry (ESI-MS) analyses was performed on the samples. The analytes were detected as
their sodium adducts with one positive charge, i.e. hexaose with a molar mass of 180 was detected at m/z 203 and the acetylated hexaose was detected at m/z 245. As seen in the MS spectrum
of the hydrolyzed sample (Figure 6A), a peak at m/z 245 was detected, indicating that Man2A has
released acetylated mannose from O-acetyl-GGM. No significant peak at m/z 245 was detected
in a sample of O-acetyl-GGM incubated without enzyme (Figure 6B).

Discussion
The lignified plant cell wall is a complex mixture of cellulose, hemicellulose, lignin and minor
amounts of pectic substances. Although the detailed organisation of these components in the cell
wall is not fully understood, several reports have indicated a close association between mannan
and cellulose (kerholm & Salmn, 2001). In this study, we have investigated the activity of a
number of mannan- and cellulose-degrading enzymes on glucomannan isolated from
Amorphophallus konjac (KM) and O-acetyl-GGM isolated from spruce.
It has been indicated earlier that several endoglucanases from T. reesei have the ability to
depolymerise konjac glucomannan (Karlsson, 2000). However, the distribution of released
oligosaccharides has not been analysed. Our results indicate a difference in product distribution
between Cel7B and Cel45A. Degradation of KM by Man5A and Man26A yielded similar oligosaccharide distributions, indicating that these enzymes might have similar subsite binding properties in glucomannan hydrolysis.
It has previously been demonstrated that Man2A can release mannose from mannan and
galactomannan (Ademark et al., 1999; Hgglund et al., 2001). In this study we also found that
Man2A was capable of liberating sugar from glucomannan. Furthermore the amount of released
sugars was increased more than ten times when Man2A was incubated with glucomannan in the
presence of -glucosidase, which may be explained by the following: -mannosidase hydrolyse
the polymeric main-chain until a non-reducing glucose monomer is exposed, which can be hydrolysed by the -glucosidase. In the same way the -glucosidase can subsequently release

144

glucose residues. The activity of the Man2A on glucomannan indicates that a stretch of mannose
units without interspersed glucose units are present at the non-reducing end of the polymer.
Glucomannan degradation has been reported previously for -mannosidases from Sclerotium
rolfsii, Bacillus subtilis and apple-snails (Gbitz et al., 1996; Hirata et al., 1998).
The action of Man5A and Cel7B from Trichoderma reesei on O-acetyl-GGM showed some interesting features. After hydrolysis with Man5A, the oligosaccharides formed were between DP 2-5.
The extent of galactose units attached to the isolated O-acetyl-GGM was low (mannosyl:galactosyl
ratio 4:0.1) and would probably not interfere in a higher extent on the action with Man5A. Tenkanen
and co-workers have previously investigated the action of Man5A from Trichoderma reesei on
non-acetylated galactoglucomannan (Tenkanen et al., 1997). They showed a degradation pattern
of DP 2-4 with major extent of 2 and 3. Puls and Schuseil (Puls & Schuseil, 1993), hydrolyzed
acetylated GGM from spruce with a -mannanase from Aspergillus niger, and observed possible
steric hindrance by acetyl groups. They showed a higher extent of sugar liberation with the mannanase using deacetylated GGM compared to acetylated GGM. These results indicate that
the pattern of distribution of acetyl groups influence the action of some -mannanases. More
studies have to be made in order to investigate if acetyl-groups are sterical hinders for the action
of Trichoderma reesei Man5A. Further experiments will be conducted in order to analyse the
possible hindrance by acetyl substituents on Man5A.
The hydrolysis of O-acetyl-GGM by Man2A has not been analysed previously. The release of
acetylated mannose by Man2A established by EIS-MS was an interesting discovery and has not
been found for any -mannosidase before. The exact positions of the acetyl groups were not
determined and further studies will be carried out to in order to determined if the acetyl substituents
are attached at the C-2 and/or C-3 positions on the released acetylmannose residues. Thus, the
family 2 -mannosidase studied appear to be able to recognise acetylated mannose residues.
However, at least one -mannanase (Puls & Schuseil, 1993) was clearly restricted by acetyl
substituents. This is an interesting reflection, since all known -mannanases are classified in
family 5 and 26, and thus belong to the same (/a)8-barrel clan (GH-A) of glycoside hydrolases as
Man2A. Further studies will be conducted to reveal differences or similarities in the influence of
acetyl substituents in clan GH-A mannoside-hydrolases.
Cel5A is the only endoglucanase from Trichoderma reesei that previously has been reported to
show -mannanase activity (Macarrn et al., 1996). Interestingly, we found that Cel7B had activity against O-acetyl-GGM. Two peaks were formed after SEC 1 with slightly lower molecular
weight than before hydrolysis. However, further investigations have to be made regarding the
GGM activity to establish if Cel7B has -mannanase activity or if it has the ability to catalyze the
cleavage of bonds between 1 and +1 subsite having mannosyl or glucosyl units placed at the -1
subsite. Furthermore, it would be interesting to explore the possible effect of substituents on
endoglucanase hydrolysis of O-acetyl-GGM.

145

References
Ademark, P., de Vries, R. P., Hgglund, P., Stlbrand, H. & Visser, J. (2001a). Cloning and characterization of Aspergillus niger genes encoding an -galactosidase and a -mannosidase
involved in galactomannan degradation. Eur. J. Biochem 268(10), 2982-2990.
Ademark, P., Larsson, M., Tjerneld, F. & Stlbrand, H. (2001b). Multiple -galactosidase from
Aspergillus niger: purification, characterization, and substrate specificities. Enzyme
Microb. Technol. 29, 441-448.
Ademark, P., Lundqvist, J., Hgglund, P., Tenkanen, M., Torto, N., Tjerneld, F. & Stlbrand, H.
(1999). Hydrolytic properties of a -mannosidase purified from Aspergillus niger. J.
Biotechnol. 75(2-3), 281-289.
Ademark, P., Varga, A., Medve, J., Harjunp, V., Drakenberg, T., Tjerneld, F. & Stlbrand, H.
(1998). Softwood hemicellulose-degrading enzymes from Aspergillus niger: purification
and properties of a -mannanase. J. Biotechnol. 63(3), 199-210.
Chhabra, S. R., Shockley, K. R., Ward, D. E. & Kelly, R. M. (2002). Regulation of endo-acting
glycosyl hydrolases in the hyperthermophilic bacterium Thermotoga maritima grown
on glucan- and mannan-based polysaccharides. Appl. Environ. Microbiol 68(2), 545554.
Colln, A., Ward, M., Tjerneld, F. & Stlbrand, H. (2001). Genetic engineering of the Trichoderma reesei endoglucanase I (Cel7B) for enhanced partitioning in aqueous two-phase
systems containing thermoseparating ethylene oxidepropylene oxide copolymers. J.
Biotechnol 87(2), 179-191.
Frei, E. & Preston, R. D. (1968). Noncellulosic structural polysaccharides in algal cell walls. III.
Mannan in siphoneous green algae. Proc. R. Soc. London, Ser. B 169(1015), 127-145.
Gbitz, G. M., Hayn, M., Sommerauer, M. & Steiner, W. (1996). Mannan-Degrading Enzymes
from Sclerotium rolfsii: Characterisation and synergism of two Endo -Mannanases and
a -Mannosidase. Bioresour. Technol. 58, 127-135.
Henrissat, B. (1991). A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 280(Pt 2), 309-316.
Hirata, K., Aso, Y. & Ishiguro, M. (1998). Purification and some properties of -mannosidase, N-acetylglucosaminidase, and -galactosidase from apple snails (Pomacea canaliculata).
J. Fac. Agric., Kyushu Univ. 42(3-4), 463-472.
Hgglund, P., Eriksson, T., Colln, A., Nerinckx, W., Claeyssens, M. & Stlbrand, H. (2002). A
cellulose-binding module of the Trichoderma reesei b-mannanase Man5A increases the
mannan-hydrolysis of complex substrates. Submitted.
Hgglund, P., Sabini, E., Boisset, C., Wilson, K., Chanzy, H. & Stlbrand, H. (2001). Degradation
of mannan I and II crystals by fungal endo--1,4-mannanases and a -1,4-mannosidase
studied with transmission electron microscopy. Biomacromolecules 2(3), 694-699.
Ikiri, Y. & Miwa, T. (1960). Chemical Nature of the cell wall of the green algae, Codium,
Acetabularia and Halicoryne. Nature 185, 178-179.
Jenkins, J., Lo Leggio, L., Harris, G. & Pickersgill, R. (1995). -glucosidase, -galactosidase,
family A cellulases, family F xylanases and two barley glycanases form a superfamily of
enzymes with 8-fold / architecture and with two conserved glutamates near the carboxyterminal ends of -strands four and seven. FEBS Lett 362(3), 281-285.
Karlsson, J. (2000). Fungal Cellulases: Study of hydrolytic properties of endoglucanases from
Trichoderma reesei and Humicola insolens. Doctoral thesis, Lund University.

146

Kulminskaya, A. A., Eneiskaya, E. V., Isaeva-Ivanova, L. S., Savelev, A. N., Sidorenko, I. A.,
Shabalin, K., A., Golubev, A. M. & Neustroev, K. N. (1999). Enzymatic activity and galactomannan binding property of -mannosidase from Trichoderma reesei. Enzyme
Microb.Technol. 25, 372-377.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227(259), 680-685.
Lindberg, B., Rosell, K.-G. & Svensson, S. (1973). Position of the O-acetyl groups in pine
glucomannan. Svensk Papperstidning 76, 383-384.
Lundqvist, J., Jacobs, A., Palm, M., Zacchi, G., Dahlman, O. & Stlbrand, H. (2002a).
Characterization of galactoglucomannan extracted from spruce (Picea abies) by heat
fractionation at different conditions. Submitted.
Lundqvist, J., Teleman, A., Junel, L., Zaachi, G., Dahlman, O., Tjerneld, F. & Stlbrand, H. (2002b).
Isolation and characterization of galactoglucomannan from Spruce (Picea abies).
Carbohydr. Polym. 48(1), 29-39.
Macarrn, R., Acebal, C., Castilln, M. P. & Claeyssens, M. (1996). Mannanase activity of
Endoglucanase III from Trichoderma reesei QM9414. Biotechnol. Lett. 18(5), 599-602.
McCleary, B. V. & Matheson, N. K. (1983). Action Patterns and Substrate-Binding Requirements
of -D-Mannanase with Mannosaccharides and Mannan-type Polysaccharides.
Carbohydr. Res. 119, 191-219.
Meier, H. (1958). On the structure of cell walls and cell wall mannans from ivory nuts and from
dates. Biochim. Biophys. Acta 28, 229-240.
Meier, H. & Reid, J. S. G. (1982). Reserve Polysaccharides Other Than Starch in Higher Plants.
In Encyclopaedia of Plant Physiology New Ser. (Loewus, F. A. & Tanner, W., eds.), Vol.
13A, pp. 418-471. Springer Verlag, Berlin.
Nakari-Setla, T. & Penttil, M. (1995). Production of Trichoderma reesei cellulases on glucosecontaining media. Applied and Environmental Microbiology 61(10), 3650-3655.
Nishinari, K., Williams, P. A. & Phillips, G. O. (1992). Review of the physico-chemical characteristics and properties of konjac mannan. Food Hydrocolloids 6(2), 199-222.
Penttil, M., Lehtovaara, P., Nevalainen, H., Bhikhabhai, R. & Knowles, J. (1986). Homology
between cellulase genes of Trichoderma reesei: complete nucleotide sequence of the
endoglucanase I gene. Gene 45, 253-263.
Puls, J. & Schuseil, J. (1993). Chemistry of hemicelluloses: relationship between hemicellulose
structure and enzymes required for hydrolysis. In Hemicellulose and Hemicellulases
(Coughlan, M. P. & Hazlewood, G. P., eds.), Vol. 4, pp. 1-27. Portland Press Res. Monogr.,
London.
Reid, J. S. G. (1985). Galactomannans. In Biochemistry of Storage Carbohydrates in Green Plants
(Dey, P. M. & Dixon, R. A., eds.), pp. 265-288. Academic Press, London.
Rtt, M. & Poutanen, K. (1988). Production of Mannan-Degrading Enzymes. Biotechnol. Lett.
10(9), 661-664.
Rtt, M., Siika-aho, J., Buchert, J., Valkeajrvi, A. & Viikari, L. (1993). Enzymatic hydrolysis of
isolated and fibre-bound galactoglucomannans from pine-wood and pine kraft pulp.
Applied Microbiology and biotechnology 40, 449-454.
Saloheimo, A., Henrissat, B., Hoffrn, A. M., Teleman, O. & Penttil, M. (1994). A novel, small
endoglucanase gene, egl5, from Trichoderma reesei isolated by expression in yeast.
Mol. Microbiol. 13(2), 219-28.
Siika-aho, M., Karlsson, J., Nakari-Setl, T., Saloheimo, A., Teleman, A., Tjerneld, F. & Pentitil,
M. (2002). EG V (Cel45) of Trichoderma reesei expression of the core protein, purification and characterization. Submitted..
147

Stoll, D., Stlbrand, H. & Warren, R. A. (1999). Mannan-degrading enzymes from Cellulomonas
fimi. Appl. Environ. Microbiol. 65(6), 2598-2605.
Stlbrand, H., Saloheimo, A., Vehmaanpera, J., Henrissat, B. & Penttil, M. (1995). Cloning and
expression in Saccharomyces cerevisiae of a Trichoderma reesei -mannanase gene
containing a cellulose binding domain. Appl. Environ. Microbiol. 61(3), 1090-1097.
Stlbrand, H., Siika-aho, M., Tenkanen, M. & Viikari, L. (1993). Purification and characterization
of two -mannanases from Trichoderma reesei. J. Biotechnol. 29, 229-242.
Sunna, A., Gibbs, M. D., Chin, C. W., Nelson, P. J. & Bergquist, P. L. (2000). A gene encoding a
novel multidomain -1,4-mannanase from Caldibacillus cellulovorans and action of the
recombinant enzyme on kraft pulp. Appl. Environ. Microbiol. 66(2), 664-670.
Tenkanen, M., Makkonen, M., Perttula, M., Viikari, L. & Teleman, A. (1997). Action of
Trichoderma reesei mannanase on galactoglucomannan in pine kraft pulp. J. Biotechnol.
57(1-3), 191-204.
Tenkanen, M., Thornton, J. & Viikari, L. (1995). An acetylglucomannan esterase of Aspergillus
oryzae; purification, characterization and role in the hydrolysis of O-acetylgalactoglucomannan. J. Biotechnol. 42(3), 197-206.
Timell, T. E. (1967). Recent Progress in the chemistry of Wood Hemicellulose. Wood Sci. Technol.
1, 45-70.
Wolfrom, M. L., Layer, M. L. & Patin, D. L. (1961). Carbohydrates of the coffee bean. II. Isolation and characterization of a mannan. J. Org. Chem. 26, 4533-4535.
Xu, B., Hgglund, P., Stlbrand, H. & Janson, J. C. (2002). endo--1,4-Mannanases from blue
mussel, Mytilus edulis: purification, characterization, and mode of action. J. Biotechnol.
92(3), 267-277.
kerholm, M. & Salmn, L. (2001). Interactions between wood polymers studied by dynamic
FT-IR spectroscopy. Polymer 42(3), 963-969.

148

Table 1. Enzymes used in this study.

Name

Activity

E.C number

Mr *

References

Man5Aa

Endo-1,4--mannanase

3.2.1.78

45 000

(Hgglund et al., 2002;

Stlbrand et al., 1995)

Man26Ab

Endo-1,4--mannanase

3.2.1.78

48 000

(Stoll et al., 1999)

Man2A

Exo-1,4--mannosidase

3.2.1.25

135 000

(Ademark et al., 2001a;

Ademark et al., 1999)

Cel7Bc

Endo-1,4--glucanase

3.2.1.4

46 000

(Colln et al., 2001;

Penttil et al., 1986)

Cel45Ad

Endo-1,4--glucanase

3.2.1.4

22 000

(Saloheimo et al., 1994;

Siika-aho et al., 2002)

Agal II

Exo--1,6-galactosidase

3.2.1.22

64 000

-Gluc

Exo-1,4--glucosidase

3.2.1.21

118 000

(Ademark et al., 2001b)

Megazyme$

* Mr values from SDS-PAGE, i.e. monomer molecular weight

$
Commercial preparation purchased from Megazyme
a
Catalytic module of Man5A, residues 1-352
b
Catalytic module of Man26, residues 1-464
c
Catalytic module of Cel7B, residues 1-371
d
Catalytic module of Cel45A, residues 1-182

Table 2. Released reducing sugars after enzymatic hydrolysis of O-acetyl-GGM (10 mg/ml).

Enzymes

Reducing sugars (mg/ml)

Man5A+Man2A

4.92

Man2A

1.41

Man2A+-Gluc+Agal II

2.14

Man5A

4.30

Cel7B

2.11

149

Figure 1. A schematic picture of O-acetyl-galactoglucomannan, built up by a main chain of -(14)-linked

mannose (MAN) and glucose (GLC) residues, with -(16)-linked galactose (GAL) residues attached to
some MAN residues. Some MAN residues are acetylated at C-2 (2 Ac) or C-3 (3 Ac).

150

Figure 2. SEC2 elution profiles of the products formed after enzymatic hydrolysis of KM. (A) KM treated
with Man5A (dotted line) and Man26A (hatched line) (B) KM treated with Cel45A (dotted line) and Cel7B
(hatched line). In both A and B the nonhydrolysed KM (solid line) is also shown. RI was used for the
detection of the products formed. The applied sample volume was 500l. The arrows mark the elution
volumes of manno-oligosaccharides (DP 1-6). V0 was estimated to 170 ml.

151

Figure 3. SEC1 elution profile of products formed after hydrolysis of O-acetyl-GGM with Man5A (dotted
line), Cel7B (hatched line), and Man5A combination with Man2A (dash dotted line). The nonhydrolyzed Oacetyl-GGM (solid line) with a molecular weight of 2600 is also shown. RI was used for the detection of the
products formed. The applied sample volume was 500l. The arrows mark the elution volumes from fractions (7 (3900) and 9 (1700)) of galactoglucomannan analysed with MALDI-MS (Lundqvist et al (2002)).
Monomeric sugars eluted at 39-40 ml.

Figure 4. SEC2 elution profile of the products formed after hydrolysis of O-acetyl-GGM with Man5A
(dotted line) and Cel7B (hatched line). The nonhydrolysed O-acetyl-GGM (dotted line (small dots)) with an
molecular weight of 2600 is also shown. RI was used for the detection of the products formed. The applied
sample volume was 500 l. The arrows mark the elution volumes of manno-oligosaccharides (DP 1-6). V0
was estimated to 170 ml.

152

Figure 5. Dot-blot analysis of Cel7B and Man5A using anti-Man5A polyclonal antibodies as described in
materials and methods. Drops of 4 l of Cel7B at concentrations of 368 M (A), 5.89 M (B) and 0.59 M
(C) were applied. Drops of 4 l of Man5A at concentrations of 0.345 M (D), 0.035 M (E), 0.003 M (F).

Figure 6. (A) ESI-MS spectrum of sample of O-acetyl-GGM incubated with Man2A for 92 h. (B) Spectrum
of O-acetyl-GGM incubated in the same manner in the absence of Man2A . The analytes were detected as
their sodium adducts with one positive charge, i.e. hexaose (Hex) with a molar mass of 180 was detected at
m/z 203 and the acetylated hexaose (Hex-Ac) was detected at m/z 245.

153

154

VII
155

156

The Active Site Cleft of Trichoderma reesei

-Mannanase Man5A: Analysis of Mutants
of the Catalytic Glutamates and Arginine
171 Positioned in the +2 Subsite
Per Hgglund, Lars Anderson and Henrik Stlbrand

Department of Biochemistry, Center for Chemistry and Chemical Engineering,

Lund University, PO Box 124, S-221 00, Lund, Sweden

Abstract
The -mannanase (Man5A) from the filamentous fungus Trichoderma reesei is a
modular enzyme composed of a catalytic module and a carbohydrate-binding
module. The N-terminal catalytic module is classified into family 5 of glycoside
hydrolases and the previously solved structure of this module revealed that it
shares the overall (/)8 fold which is conserved in this family. Furthermore, the
two catalytic glutamates (Glu169 and Glu276) were also found in their conserved
positions. In addition, an arginine residue (Arg171), which is conserved in several other -mannanases, is positioned in the +2 subsite. In order to study the
function of Arg171, mutants of this residue were constructed and expressed in
Pichia pastoris. Mutants of the catalytic glutamates were also designed and expressed in the same way. The hydrolytic properties of the mutants were studied.
The results show that a mutant of Arg171 (R171K) display retained activity on
polymeric galactomannan but reduced activity on oligosaccharides. Moreover,
this mutant appears to have a more alkaline activity pH-optimum than the wildtype enzyme. The mutants of the catalytic glutamates were essentially inactive,
with the exception of one of the acid/base mutants (E169Q) for which a 25-fold
decrease in kcat was observed.
Abbreviations: Locust bean gum (LBG); 3,5-dinitrosalicylic acid (DNS)

157

Introduction
Polysaccharides with -(14)-linked mannose residues are common in nature. They are found
in a variety of terrestrial plants and also in some algae (Frei & Preston, 1968; Meier, 1958; Timell,
1967). O-acetyl-galactoglucomannan hemicellulose found in woody tissues from gymnosperms
is one of the most abundant polysaccharides on earth. Galactomannans and glucomannans in the
seeds and tubers of plants function mainly as storage polysaccharides (Meier & Reid, 1982).
Endo-1,4--D-mannanase (E.C. 3.2.1.78; -mannanase) is the major depolymerising mannandegrading enzyme: it catalyses the random hydrolysis of -D-1,4-mannopyranosyl linkages within
the main chain of different mannans. A majority of the characterised -mannanases are produced
by bacteria and fungi (Ademark et al., 1998; Stoll et al., 1999; Stlbrand et al., 1995), but mannanases have also been isolated from plants, algae and mollusks (Bewley et al., 1997; Loos
& Meindl, 1985; Xu et al., 2002). The -mannanases characterised this far, have been annotated
to family 5 and 26 of glycoside hydrolases in the classification according to Henrissat et al.
(Henrissat, 1991; Henrissat & Bairoch, 1996). Enzymes from both of these families share the (/
)8 barrel fold and the structurally conserved catalytic residues found in clan GH-A of glycosyl
hydrolases (Henrissat et al., 1995; Jenkins et al., 1995).
The filamentous fungus Trichoderma reesei produces a -mannanase (Man5A) (Stlbrand et al.,
1995; Stlbrand et al., 1993). The corresponding gene has been cloned and the N-terminal catalytic
module is classified in family 5 of glycoside hydrolases (Stlbrand et al., 1995). The C-terminal
module belong to family I of carbohydrate-binding modules (CBMs) according to the classification
of Tomme et al. (Tomme et al., 1995). The CBM binds to cellulose and has been shown to affect
the hydrolysis of complex substrates by Man5A (Hgglund et al., 2002). The structure of the
catalytic module of Man5A (Man5ACBM) has been solved by X-ray crystallography (Sabini et
al., 2000). Man5ACBM share the same overall fold conserved in other family 5 enzymes.
At least seven conserved residues in family 5 are also conserved in the Man5A structure.
Included among these are the two residues predicted to be the catalytic residues: the acid/base
(Glu169) and the nucleophile (Glu276). The influence of several of the residues conserved in
family 5 on hydrolysis has been investigated earlier (Belaich et al., 1992; Navas & Beguin, 1992;
Py et al., 1991). In particular, the importance of the catalytic residues has been experimentally
demonstrated previously for several family 5 endo- and exoglucanases using mutational analysis
and covalently trapped inhibitors (Macarron et al., 1993; Mackenzie et al., 1997; Wang et al.,
1993). Interestingly, despite the conserved amino acids and similar structural folds in family 5,
several specificities are included in this family. Beside -mannanases, family 5 also include for
example endo- and exoglucanases.
The structure of Man5ACBM in complex with mannobiose reveals some interesting features
(Sabini et al., 2000). In this complex, the mannobiose molecule is bound in the +1 and +2 subsites
of Man5A through several interactions with the enzyme. Specifically, it was indicated that Arg
171 is important for substrate binding since it is positioned within hydrogen bond distance from
the axial C2 hydroxyl of the +2 mannose residue (Figure 1). Since mannose and glucose only
differ in the position of the C2 hydroxyl group it is possible that the interaction with this group is
important for determining the enzymes substrate specificity between mannan and cellulose.
158

Interestingly, sequence alignment of family 5 -mannanases reveals that this arginine residue
appears to be conserved in several eukaryotic -mannanases (Figure 2).
Previous kinetic analyses of manno-oligosaccharide degradation with Man5A suggest that the +2
subsite may be important for hydrolysis, at least in the case of substrates with a degree of
polymerization of 4 or more (Harjunp et al., 1995). Furthermore, product analysis suggests that
the +2 subsite also may participate in aglycone binding in transglycosylation reactions (Harjunp
et al., 1999).

In order to investigate the specificity in the active site of Man5A, we have constructed mutants of
the catalytic acid/base (Glu169) and nucleophile (Glu276). We have also mutated Arg171 positioned
in +2 subsite. In accordance with the prediction, we found a pronounced reduction in activity for
the mutants of the catalytic residues. However, one of the Arg171 mutants (R171K) showed
retained activity on polymeric, soluble galactomannan, but reduced activity on mannopentaose.
Furthermore, our results indicate a shift toward a more alkaline activity pH optimum for R171K,
in comparison with the wild-type enzyme.

Materials and Methods

Plasmids and strains
The plasmid pHSM30 (Stlbrand et al., 1995) was maintained in Escherichia coli XL1 blue
(Stratagene, La Jolla, CA, USA). All other plasmids were maintained in E. coli TOP10F
(Invitrogen, San Diego, CA, USA). All E. coli cells were cultured in luria broth medium at 37 C
and Ampicillin (100 g/ml) or Zeocin (25 g/ml) was added when appropriate. The Pichia
pastoris strain KM71H was purchased from Invitrogen and maintained on YPD plates (1 % Yeast
Extract, 2 % Peptone, 2 % Dextrose) according to the manufacturers recommendations.

Construction of mutants
Mutagenesis was performed by PCR using Pfu polymerase with the Quikchange site-directed
mutagenesis kit (Stratagene). Molecular biology techniques, including DNA isolation and preparation, agarose gel electrophoresis, restriction enzyme analysis, and DNA fragment isolation were
performed as described previously (Sambrook et al., 1989). The sequence encoding Man5A was
digested from pHSM30 using XhoI and EcoRI and ligated into pPICZA which has been cut with
the same enzymes. The resulting plasmid, pPICZAMan5A, was used as a template for site-directed mutagenesis using Primer 1 and Primer 2 (Table 1), yielding a plasmid
(pPICZAMan5ACBM) containing a truncated version of man5A, coding for the catalytic module only (man5ACBM; bases 1-1113 of man5A)). This plasmid was used as a template for all
the following site directed mutagenesis using the primers 3-16 (Table 1). All PCR runs were
initiated with a denaturation step at 95 C for two minutes, followed by 17 cycles of denaturation
(95 C, 30 seconds), annealing (62C, 1 minute) and extension (72C, 10 minutes). The PCR
products were treated with Dpn I, to remove template plasmid and transformed into Escherichia
coli as described previously (Sambrook et al., 1989). The sequences of all mutants were analysed
at the BM-unit, Lund University.

159

Pichia pastoris transformation

The constructed plasmids were purified using the JETstar Plasmid Midiprep (Genomed, Research
Triangle Park, NC, USA), linearised using Sac I and subsequently purified by phenol extraction
and ethanol precipitation as described previously (Sambrook et al., 1989). P. pastoris cells, were
electroporated with 5-10 g of linearised plasmid according to the suppliers recommendations
(Invitrogen). P. pastoris transformants were transferred to YPD plates containing sorbitol (1 M)
and Zeocin (100 g/ml). The plates were incubated for 3 days at 30C. Positive transformants
were subsequently replated several times. Isolated transformants were screened for -mannananse
expression using the -mannanase activity plate assay and dot-blot analysis described below.

Expression in Pichia pastoris

Positive transformants were inoculated in YPD media (50 ml in 1 l indented flasks) and cultured
for 48 h (30 C, 200 rpm). After harvesting by centrifugation (5000 rpm; 10 min) the cells were
resuspended in buffered minimal media (1.34 % yeast nitrogen base, 4x10-5 % biotin, 0.5 %
methanol, 100 mM potassium phosphate buffer, pH 6) and cultured in a volume of 200 ml in a 2
l indented flask (30 C, 250 rpm) for 4 days. Methanol was added every day to a final concentration of 0.5 % to compensate for loss because of evaporation and consumption. After 4 days, cells
were pelleted by centrifugation and the supernatants were collected and stored for purification.

Enzyme purification
The supernatants were concentrated using a ultrafiltration device with a membrane of 10 kDa
cut-off. The. The concentrated samples were equilibrated in 10 mM Tris pH:7.8 using a PD-10
column (Amersham Pharmacia Biotech, Uppsala, Sweden). Chromatography purification was
performed on a FPLC System (Amersham Pharmacia Biotech). Equilibrated samples were applied to a 6 ml Resource Q anion exchange column (Amersham Pharmacia Biotech). The proteins
were eluted in a NaCl gradient (0-0.5 M) over 20 column volumes and fractions of 2 ml were
collected. The flow was 1.0 ml/min. The proteins were further purified on a HiLoad 16/60 gel
filtration column (Pharmacia). The eluent was 200 mM NaCl in 100 mM Na-Acetate buffer, pH
4.5 and the flow rate was 0.5 ml/min. Fractions of 2 ml were collected. All purified enzymes
appeared as single bands on SDS-PAGE after silver staining (Laemmli, 1970). The concentrations of purified proteins were determined by measuring absorbance at 280 nm, according to the
method of Mach (Mach et al., 1992).

Dot-blot analysis
All steps were performed at room temperature. Drops of 10 l were placed on a Biotrace NT
blotting nitrocellulose membrane (Pall Gelman Sciences, Ann Arbor, MI, USA) and allowed to
dry for 15 min. The membrane was placed in blocking solution (TBS buffer (20 mM Tris, 137
mM NaCl, pH7.6), 0.1 % tween and 1.5 % bovine serum albumin (BSA)) for one hour with
gentle shaking. The membrane was washed twice for 5 min with changes of fresh washing buffer
(TBS, 0.1 % tween). New TBS buffer including polyclonal antibodies (diluted 1/1000) against
Man5ACBM raised in rabbit, was added and the mebrane was incubated for 1 h. After two
washes as described above, new TBS buffer containing secondary goat anti-rabbit antibodies
(Bio-Rad, Hercules, CA, USA) diluted 1/1500 was added, and the membrane was incubated for 1
h. After two washes in Tris buffer (0.1 M Tris, 0.5 mM MgCl2, pH9.5), new Tris buffer containing
Nitroblue tetrazolium chloride (300 g/ml) and AP Color Development Reagent (150 g/ml)
(Bio-Rad) solutions was added, and the mixture was incubated until spots were clearly visible.
The incubation was ended, by immersing the membrane in distilled water for 10 min.

160

-mannanase activity plate assay

Transformants were screened for -mannanase activity by a -mannanase plate assay, in analogy
to a previously described method (Stlbrand, 1995). The P. pastoris cells were grown on buffered
minimal media plates (1.34 % yeast nitrogen base, 4x10-5 % biotin, 0.5 % methanol, 100 mM
potassium phosphate buffer, pH 6). These plates also contained 0.1 % locust bean gum
galactomannan (LBG) (Sigma) as substrate. Transformants were also grown on plates containing
glycerol instead of methanol as a non-induced control. The plates were incubated in 30 C for 2
days. 100 l methanol was added to the lid of the inverted plate every day to compensate for loss
because of evaporation and consumption. After two days, the cells were removed from the plated
by several washes in distilled water. A 10 l drop of previously purified -mannanase solution
was placed on the plate as a positive control and the plates were incubated in 42C for 30 min.
After this incubation, the plates were coloured with Congo Red (Sigma) overnight and destained
with 1 M NaCl for 3 hours.

-Mannanase activity assay

Screening of -mannanase activity in purified fractions was performed using the previously described DNS-stopping method with 0.5% LBG as substrate, in 50 mM Na-acetate buffer pH 4.5
(Stlbrand et al., 1993). The reaction was stopped by adding 3,5-dinitrosalicylic acid (DNS). The
reducing ends of the sugars were detected by boiling for 10 min. The absorbance is measured at
540 nm and the activity calculated from a mannose standard curve.

pH optimum of LBG hydrolysis

Man5ACBM and R171K (28 nM) were incubated in 0.5 % LBG solutions at 40 C, in 50 mM
buffers at different pH (Na-Citrate pH 3.5; Na-Acetate pH 4.5; Na-Citrate pH 5.3; Na-Citrate pH
6.0). Prior to the LBG incubations the enzyme stock solutions were diluted in the buffer of appropriate pH and pre-incubated for 30 min. The release of reducing sugars after the LBG incubations
was determined as in the -mannanase activity assay described above using DNS.

Mannopentaose hydrolysis
Man5ACBM and R171K (0.45 nM) were incubated with mannopentaose at 40 C in 50 mM
Na-Acetate pH 4.5. BSA (100 g/ml) was included. Oligosaccharides released after different
time points in the mannopentaose hydrolysis were analysed using high performance anionic exchange chromatography with pulsed amperometric detection (HPAEC-PAD) with a Dionex CX
500 System (Dionex, Sunnyvale CA, USA). The system included an AS50 autosampler, a GP40
gradient pump and an ED40 electrochemical detector. A Carbo Pac Pa100 guard and analytical
column was used for separation and the oligosaccharides were eluted with an isocratic eluent of
100 mM NaOH. The flow rate was 1 ml/min and the injection volume was 10 l.
Mannooligosaccharides of degree of polymerisation of 1-6 (Megazyme, Bray, Ireland) were used
as standards. Mannobiose and mannotriose were the main products released.

Determination of kinetic parameters

Kinetic parameters for LBG hydrolysis were determined by incubating the enzymes in LBG
solutions of different concentrations (ranging from 0.03 to 0.5 %). The hydrolysis velocity was
plotted as a function of substrate concentration and values of KM and kcat were obtained from nonlinear regression analysis using Kaleidagraph 3.51 (Synergy Software).

161

Results and discussion

Expression of Man5A in Pichia pastoris
The catalytic module of the Trichoderma reesei -mannanase (Man5ACBM; amino acid 1346) (Stlbrand et al., 1995), and a number of constructed mutants, were (listed in Table 1),
where expressed in the methylotrophic yeast, P. pastoris under control of the alcohol oxidase
promoter. The level of expression of Man5ACBM in P. pastoris was approximately 40 nkat/ml,
estimated from activity measurements. This level is slightly higher than the expression levels of
30 nkat/ml obtained from T. reesei cultures when Man5ACBM was expressed under the control
of the Aspergillus nidulans gpdA promoter (Hgglund et al., 2002). Kinetic analysis with LBG as
the substrate showed that the value of kcat of the purified Man5ACBM (241 s-1) expressed in P.
pastoris was similar to T. reesei expressed Man5ACBM (285 s-1) (Table 2). Furthermore, the
kcat/KM ratios were similar (Table 2).

Activity of mutants of the catalytic residues

The catalytic activities of a number of mutants of the catalytic residues (Glu169 and Glu276), of
Man5ACBM were analysed. The activity of the mutants was assessed either by the -mannanase
plate assay or by the -mannanase activity assay described in materials and methods. In accordance
with the prediction of the catalytic residues, the activities of the mutants were greatly reduced or
abolished. With the nucleophile mutants (E276Q, E276A and E276S), no activity was detected
(Table 2). In addition, no activity was detected with the alanine mutant of the acid/base mutants
(E169A). However, activity was detected for the E169Q mutant, but it was apparently largely
reduced (Table 2). Kinetic analysis of the hydrolysis of LBG by E169Q revealed that the reduced
activity was mainly due to an approximately 25-fold decrease in kcat (Table 2). KM was essentially
unchanged. Previous mutational analyses of other family 5 enzymes have also shown a dramatic
decrease in activity of mutants of the catalytic residues (Navas & Beguin, 1992; Py et al., 1991).
As in the present case, a greater activity reduction for an acid/base alanine mutant in comparison
with a glutamine mutant was also seen with the Clostridium thermocellum endoglucanase CelC
(Navas & Beguin, 1992). Moreover, as in the present case, the Km of the glutamine mutant was
similar to the wild-type.

Comparison of the R171K mutant and the wild-type enzyme

Two mutants of Arg171 were created (R171K and R171A) and transformed into P. pastoris. With
the R171A mutant, P. pastoris transformants were obtained, but no -mannanase activity was detected
(Table 2). Furthermore, a negative dot-blot analysis using anti-Man5ACBM antibodies, indicated
abolished expression and/or secretion. In contrast, the R171K mutant showed activity on the plate
assay, and was thus subjected to further analysis. Kinetic analysis showed that the activity of this
mutant on LBG was essentially retained, in comparison with the wild-type (Table 2).
Since it was found that the R171K mutant was active, the hydrolytic properties of this mutant on
LBG were further studied. Thus, the activity pH optimum profile of this mutant was investigated
and compared with the wild-type. As seen in the activity pH optima plots shown in Figure 3, a
more alkaline pH optimum was obtained with the R171K mutant in comparison with the wildtype enzyme. This is a very interesting observation in terms of applications of fungal -mannanases.
Many applications in the pulp and paper industry demand enzymes with more alkaline pH optima
than most of the fungal wild-type enzymes have (Buchert et al., 1998).
162

In the current case, the increase in activity pH optimum is difficult to explain solely by enzyme/
substrate interactions in the +2 subsite. Several previous reports have shown that charged/polar
amino acid residues in the close vicinity of the catalytic residues can influence the enzymes pH
optima (Becker et al., 2001). Besides mannobiose, Arg171 is hydrogen bonded to Glu205 which
lies closer to the catalytic residues (Figure 1) (Sabini et al., 2000).
In order to evaluate the activity of the R171K mutant also on oligomeric substrates, mannopentaose
was hydrolysed by the wild-type and R171K and samples withdrawn at different time-points
were analysed. In contrast to the hydrolysis of polymeric substrate LBG, a significant decrease in
activity was observed for the R171K mutant in mannopentaose hydrolysis in comparison with the
wild-type enzyme (Figure 4). It may be possible that this decrease in activity results from a
reduced substrate affinity in the +2 subsite, possibly as a result of the lost hydrogen bond between
Arg171 and the C-2 hydroxyl of mannose. Previous kinetic analyses of mannopentaose hydrolysis
with Man5A indicate an involvement of the +2 subsite (Harjunp et al., 1995). Continued kinetic
analysis of mannopentaose degradation by R171K will further establish the role of R171K in
substrate binding and its influence on hydrolysis.

Acknowledgement
Magnus Nilsson is thanked for performing part of the mutagenesis. The Swedish Research Council (VR), the Swedish Research Council for Engineering Sciences (TFR) and Carl Trygger Foundation (CTS) are thanked for research grants to Henrik Stlbrand.

References
Ademark, P., Varga, A., Medve, J., Harjunp, V., Drakenberg, T., Tjerneld, F. & Stlbrand, H.
(1998). Softwood hemicellulose-degrading enzymes from Aspergillus niger: purification
and properties of a -mannanase. J. Biotechnol. 63(3), 199-210.
Becker, D., Braet, C., Brumer III, H., Claeyssens, M., Divne, C., Fagerstrom, B. R., Harris, M.,
Jones, T. A., Kleywegt, G. J., Koivula, A., Mahdi, S., Piens, K., Sinnott, M. L., Sthlberg, J.,
Teeri, T. T., Underwood, M. & Wohlfahrt, G. (2001). Engineering of a glycosidase Family
7 cellobiohydrolase to more alkaline pH optimum: the pH behaviour of Trichoderma reesei
Cel7A and its E223S/ A224H/L225V/T226A/D262G mutant. Biochem. J 356(Pt 1), 19-30.
Belaich, A., Fierobe, H. P., Baty, D., Busetta, B., Bagnara-Tardif, C., Gaudin, C. & Belaich, J. P.
(1992). The catalytic domain of endoglucanase A from Clostridium cellulolyticum: effects
of arginine 79 and histidine 122 mutations on catalysis. J Bacteriol 174(14), 4677-82.
Bewley, J. D., Burton, R. A., Morohashi, Y. & Fincher, G. B. (1997). Molecular cloning of a
cDNA encoding a (1->4)--mannan endohydrolase from the seeds of germinated tomato
(Lycopersicon esculentum). Planta 203(4), 454-459.
Buchert, J., Oksanen, T., Pere, J., Siika-Aho, M., Suurnakki, A. & Viikari, L. (1998). Applications
of Trichoderma reesei enzymes in the pulp and paper industry. In Trichoderma Gliocladium
(Harman, G. E. & Kubicek, C. P., eds.), Vol. 2, pp. 343-363. Taylor and Francis Ltd., London.
Frei, E. & Preston, R. D. (1968). Noncellulosic structural polysaccharides in algal cell walls. III.
Mannan in siphoneous green algae. Proc. R. Soc. London, Ser. B 169(1015), 127-145.

163

Harjunp, V., Helin, J., Koivula, A., Siika-aho, M. & Drakenberg, T. (1999). A comparative
study of two retaining enzymes of Trichoderma reesei: transglycosylation of oligosaccharides
catalysed by the cellobiohydrolase I, Cel7A, and the -mannanase, Man5A. FEBS Lett
443(2), 149-153.
Harjunp, V., Teleman, A., Siika-aho, M. & Drakenberg, T. (1995). Kinetic and stereochemical
studies of manno-oligosaccharide hydrolysis catalysed by -mannanases from Trichoderma
reesei. Eur. J. Biochem. 234, 278-283.
Henrissat, B. (1991). A classification of glycosyl hydrolases based on amino acid sequence
similarities. Biochem. J. 280(Pt 2), 309-316.
Henrissat, B. & Bairoch, A. (1996). Updating the sequence-based classification of glycosyl
hydrolases. Biochem. J 316(Pt 2), 695-696.
Henrissat, B., Callebaut, I., Fabrega, S., Lehn, P., Mornon, J. P. & Davies, G. (1995). Conserved
catalytic machinery and the prediction of a common fold for several families of glycosyl
hydrolases. Proc. Natl. Acad. Sci. U. S. A 92, 7090-7094.
Hgglund, P., Eriksson, T., Colln, A., Nerinckx, W., Claeyssens, M. & Stlbrand, H. (2002). A
cellulose-binding module of the Trichoderma reesei b-mannanase Man5A increases the
mannan-hydrolysis of complex substrates. Submitted.
Jenkins, J., Lo Leggio, L., Harris, G. & Pickersgill, R. (1995). -glucosidase, -galactosidase,
family A cellulases, family F xylanases and two barley glycanases form a superfamily of
enzymes with 8-fold / architecture and with two conserved glutamates near the carboxyterminal ends of -strands four and seven. FEBS Lett 362(3), 281-285.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227(259), 680-685.
Loos, E. & Meindl, D. (1985). Cell-wall-bound lytic activity in Chlorella fusca: function and
characterization of an endo-mannanase. Planta 166(4), 557-562.
Macarron, R., van Beeumen, J., Henrissat, B., de la Mata, I. & Claeyssens, M. (1993). Identification
of an essential glutamate residue in the active site of endoglucanase III from Trichoderma
reesei. FEBS Lett 316(2), 137-40.
Mach, H., Middaugh, C. R. & Lewis, R. V. (1992). Statistical determination of the average values
of the extinction coefficients of tryptophan and tyrosine in native proteins. Anal. Biochem.
200(1), 74-80.
Mackenzie, L. F., Brooke, G. S., Cutfield, J. F., Sullivan, P. A. & Withers, S. G. (1997). Identification of Glu-330 as the catalytic nucleophile of Candida albicans exo--(1,3)-glucanase.
J. Biol. Chem 272(6), 3161-3167.
Meier, H. (1958). On the structure of cell walls and cell wall mannans from ivory nuts and from
dates. Biochim. Biophys. Acta 28, 229-240.
Meier, H. & Reid, J. S. G. (1982). Reserve Polysaccharides Other Than Starch in Higher Plants.
In Encyclopaedia of Plant Physiology New Ser. (Loewus, F. A. & Tanner, W., eds.), Vol.
13A, pp. 418-471. Springer Verlag, Berlin.
Navas, J. & Beguin, P. (1992). Site-directed mutagenesis of conserved residues of Clostridium
thermocellum endoglucanase CelC. Biochem. Biophys. Res. Commun. 189(2), 807-812.
Py, B., Bortoli-German, I., Haiech, J., Chippaux, M. & Barras, F. (1991). Cellulase EGZ of Erwinia
chrysanthemi: structural organization and importance of His98 and Glu133 residues for
catalysis. Protein Eng 4(3), 325-333.
Sabini, E., Schubert, H., Murshudov, G., Wilson, K. S., Siika-Aho, M. & Penttil, M. (2000). The
three-dimensional structure of a Trichoderma reesei -mannanase from glycoside hydrolase family 5. Acta Crystallogr., Sect. D: Biol. Crystallogr. 56(Pt 1), 3-13.

164

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular cloning: a laboratory manual. 2nd
edit, Cold Spring Harbor Laboratory Press, Plainview, N.Y.
Stoll, D., Stlbrand, H. & Warren, R. A. (1999). Mannan-degrading enzymes from Cellulomonas
fimi. Appl. Environ. Microbiol. 65(6), 2598-2605.
Stlbrand, H., Saloheimo, A., Vehmaanpera, J., Henrissat, B. & Penttil, M. (1995). Cloning and
expression in Saccharomyces cerevisiae of a Trichoderma reesei -mannanase gene
containing a cellulose binding domain. Appl. Environ. Microbiol. 61(3), 1090-1097.
Stlbrand, H., Siika-aho, M., Tenkanen, M. & Viikari, L. (1993). Purification and characterization
of two -mannanases from Trichoderma reesei. J. Biotechnol. 29, 229-242.
Timell, T. E. (1967). Recent Progress in the chemistry of Wood Hemicellulose. Wood Sci. Technol.
1, 45-70.
Tomme, P., Warren, R. A. J., Miller, R. C. J., Kilburn, D. G. & Gilkes, N. R. (1995). CelluloseBinding Domains: Classification and Properties. In Enzymatic Degradation of Insoluble
Polysaccharides (Saddler, J. M. & Penner, M., eds.), pp. 142-163. American Chemical Society, Washington, DC.
Wang, Q., Tull, D., Meinke, A., Gilkes, N. R., Warren, R. A., Aebersold, R. & Withers, S. G.
(1993). Glu280 is the nucleophile in the active site of Clostridium thermocellum CelC, a
family A endo--1,4-glucanase. J. Biol. Chem 268(19), 14096-14102.
Xu, B., Hgglund, P., Stlbrand, H. & Janson, J. C. (2002). endo--1,4-Mannanases from blue
mussel, Mytilus edulis: purification, characterization, and mode of action. J. Biotechnol.
92(3), 267-277.

165

Table 1. A list of the primers used for the construction of the Man5A mutants. pPICZAMan5A
was used as a template sequence for the construction of the STOP mutant (Man5ACBM).
pPICZAMan5ACBM was used as template sequence for all other mutations. The mutated
nucleotides are showed in bold on the sense strand and are underlined in the sense strand and in
the template. The names of the plasmids formed after mutagenesis are shown.
Mutation

Primer

STOP
Primer 1
(Man5ACBM) Primer 2
Template
R171K
Primer 3
Primer 4
Template
R171A
Primer 5
Primer 6
Template
E276A
Primer 7
Primer 8
Template
E276Q
Primer 9
Primer 10
Template
E276S
Primer 11
Primer 12
Template
E169Q
Primer 13
Primer 14
Template
E169A
Primer 15
Primer 16
Template

Sequence (5' to 3')*

Plasmid

GCTATTAACGGCGGCTAGCCCACTCCTC
GAGGAGTGGGCTAGCCGCCGTTAATAGC
GCTATTAACGGCGGTACAACCACTCCTC
GCTGGGCAACGAGCCTAAGTGCAACGGCTGCAGTACTG
CAGTACTGCAGCCGTTGCACTTAGGCTCGTTGCCCAGC
GCTGGGCAACGAGCCTCGCTGCAACGGGTGCAGTACTG
GCTGGGCAACGAGCCTGCATGCAACGGCTGCAGTACTG
CAGTACTGCAGCCGTTGCATGCAGGCTCGTTGCCCAGC
GCTGGGCAACGAGCCTCGCTGCAACGGGTGCAGTACTG
GCAAACCTTGCGTGTTTGAAGCTTACGGCGCCCAGCAAAACC
GGTTTTGCTGGGCGCCGTAAGCTTCAAACACGCAAGGTTTGC
GCAAACCTTGCGTGTTTGAAGAATACGGCGCACAGCAAAACC
GCAAACCTTGCGTGTTTGAACAGTACGGCGCCCAGCAAAACC
GGTTTTGCTGGGCGCCGTACTGTTCAAACACGCAAGGTTTGC
GCAAACCTTGCGTGTTTGAAGAATACGGCGCACAGCAAAACC
GCAAACCTTGCGTGTTTGAAAGCTACGGCGCCCAGCAAAACC
GGTTTTGCTGGGCGCCGTAGCTTTCAAACACGCAAGGTTTGC
GCAAACCTTGCGTGTTTGAAGAATACGGCGCACAGCAAAACC
GAGCTGGGCAACCAGCCAAGGTGCAACGGGTGCAGTACTGATG
CATCAGTACTGCACCCGTTGCACCTTGGCTGGTTGCCCAGCTC
GAGCTGGGCAACGAGCCTCGCTGCAACGGGTGCAGTACTGATG
GAGCTGGGCAACGCGCCAAGGTGCAACGGGTGCAGTAC
GTACTGCACCCGTTGCACCTTGGCGCGTTGCCCAGCTC
GAGCTGGGCAACGAGCCTCGCTGCAACGGGTGCAGTAC

pPICZAMan5ACBM

166

pPICZAR171K
pPICZAR171A
pPICZAE276A
pPICZAE276Q
pPICZAE276S
pPICZAE169Q
pPICZAE169A

Table 2. Activities of wild-type catalytic module (Man5ACBM) and mutants expressed in P.

pastoris and T. reesei. Proteins produced in T. reesei were expressed under the control of the
Aspergillus nidulans gpdA promoter (Hgglund et al., 2002). Activities and kinetic constants
(apparent KM and kcat values) were determined using locust bean gum galactomannan (LBG) as
substrate and the DNS-reagent for detection of reducing sugars produced.

Protein

Expression

Activity1

KM (g/l)

kcat (s-1)

kcat/KM [(g/l-1 (s-1)]

E276A

P. pastoris

-2

E276Q

P. pastoris

-2

E276S

P. pastoris

-2

E169A

P. pastoris

E169Q

P. pastoris

(+)

0.62

9.42

15.1

E169A

T. reesei

E169Q

T. reesei

(+)

N.D.$

N.D.$

N.D.$

R171K

P. pastoris

1.304

262

202

R171A*

P. pastoris

Man5ACBM P. pastoris

0.59

241

406

Man5ACBM T. reesei

0.70

285

405

No expression detected with dot-blot analysis

Not determined

: No activity detected
+ : Retained activity

(+): Reduced activity

2

Determined by the -mannananase activity plate assay, described in materials and methods
167

Figure 1. Close up of the active site of Man5A in complex with mannobiose, showing the residues selected
for mutagenesis in this study. Possible hydrogen bonds are indicated by dotted lines. This figure was generated in POV-Ray using data from the solved structure of Man5ACBM (PDB code: 1QNR) (Sabini et al.,
2000)

Figure 2. Sequence alignment of family 5 -mannanases, showing the regions around Arg171 (boxed) and
Glu169 (boxed) in Man5A. The -mannanases are from: Trichoderma reesei (Man5A), Swiss-Prot: Q99036;
Aspergillus aculeatus, Swiss-Prot: Q00012; Agaricus bisporus, Swiss-Prot: Q92401; Geobacillus
stearothermophilus, GenPept: AAC71692.1; Orpinomyces sp. PC-2, GenPept: AAL01213.1; Lycopersicon
esculentum, Swiss-Prot: O48540; Mytilus edulis, GenPept: CAC81056.1. (*) = conserved residues, (:) =
similar residue.

168

Figure 3. pH activity profiles for the wild-type enzyme ( ) and R171K ( ). The enzymes (28 nM) were
incubated with LBG at 40 C in Na-Acetate pH 4.5 as described in materials and methods and the hydrolysis
rate was calculated (in kat/mol). The symbols represent the average value of three separate incubations.
Error bars display the standard deviations.

Figure 4. Hydrolysis of mannopentaose (1 mM) by the wild-type enzyme ( ) and R171K ( ). The enzymes
(0.45 nM) were incubated with mannopentaose at 40 C in Na-Acetate pH 4.5 and samples were withdrawn
at different time-points. The main products, mannobiose (M2) and mannotriose (M3), were quantified. The
symbols represent the average value of two separate incubations. Error bars display the standard deviations.

169