Anda di halaman 1dari 16

PREGUNTAS DE SELECTIVIDAD GENTICA PARTE 1

GENTICA (Molecular y Mendeliana)


1. Cmo se denomina el mecanismo que permite la duplicacin de la informacin
gentica? Explquelo detalladamente.
2. Una enfermedad hereditaria provocada por un gen recesivo (d) se manifiesta en
todos los hombres portadores de ese gen, pero no en todas las mujeres portadoras.
Por qu? Indique todos los genotipos posibles de los individuos normales y
enfermos de la poblacin respecto a ese carcter. Razone las respuestas. (la
respuesta se basa en el hecho de que se trata de un carcter ligado al sexo, localizado
en el cromosoma X. Los Genotipos posibles son: X0X0, X0Xd, XdXd, X0Y, XdY)
3. Realice un esquema general de cmo se lleva a cabo la expresin gentica,
describiendo brevemente los procesos implicados en esta expresin y los pasos de
que consta cada uno de ellos.
4. En relacin al esquema responda a las siguientes preguntas:

a. Nombre los procesos sealados con las letras A, B, C y D. Indique la composicin


de las molculas incluidas en los recuadros.
b. Indique una funcin de cada una de las molculas incluidas en los recuadros
(ADN: portador de la informacin gentica, responsable de los caracteres
celulares, etc.; ARN: componente de los ribosomas, transfiere aminocidos,
traduce el mensaje gentico a protenas, portador de la info gentica en virus, etc.;
Protenas: enzimtica, transporte, movimiento, contraccin, soporte mecnico y
estructural, nutricin y reserva, inmunidad, hormonal, etc.). Explique en qu
consiste el proceso. en qu formas biolgicas se ha descrito el proceso A?

5. Explique los conceptos de gen, mutacin, recombinacin y segregacin cromosmica


6. A partir de la tabla siguiente indique el tipo de material hereditario (ADN, ARN,

cadena sencilla o doble) de los diferentes organismos. Razone la respuestas:


Humano: ADN de cadena doble.
Bacteria: ADN de cadena doble.
Virus de la gripe: ARN de cadena sencilla.
Reovirus: ARN de doble cadena
7. Defina los siguientes conceptos: replicacin, transcripcin y traduccin. En qu
parte de las clulas procaritica y eucaritica tienen lugar estos procesos? Describa
cmo se lleva a cabo la transcripcin.
8. (Raz) Redacte un texto en el que se relacionen de forma coherente los siguientes
trminos: aminocidos, poros nucleares, ARN mensajero, ARN transferente,
ribosomas, cdigo gentico, ADN y protenas. (hay que relacionar los trminos
propuestos con el flujo de informacin gentica)
9. (Raz) Cmo se puede explicar que una clula tpica de nuestro cuerpo posea unas
10000 clases diferentes de protenas si el nmero de aminocidos distintos es
solamente 20? Razone la respuesta. (el tipo de protena depende de la secuencia
lineal de aminocidos y la combinacin de 20 aminocidos diferentes puede dar lugar
a muchas secuencias primarias distintas)
10. (Raz) En 1951 Novick y Szilard obtuvieron una estirpe de bacterifago hbrido entre
el fago T2 y el fago T4. Este hbrido tena la cpsida del fago T4 y el ADN del fago T2.
Si este virus hbrido infectara una nueva bacteria, qu cido nucleico y qu cpsida
tendran los nuevos fagos?. Razone la respuesta.
11. En relacin a la figura adjunta, responda a las siguientes preguntas:
a. Cmo se denominan los dos
procesos
biolgicos
representados? Identifique los
distintos elementos de la figura
sealados con nmeros.
b. Identifique los extremos del
elemento 2 (a y b) y los
extremos del elemento 5 (c y d)
Cul es la composicin qumica
de los elementos sealados con
los nmeros 3 y 4?
12. Defina el proceso de Traduccin, indique dnde tiene lugar (ribosomas) y describa
cmo se realiza (descripcin de las 3 etapas: iniciacin, elongacin y terminacin).
13. (Raz) Las mutaciones generalmente son perniciosas para el individuo que las sufre, sin
embargo desde el punto de vista evolutivo son muy importantes. Explique
razonadamente esta aparente contradiccin.
14. Si el cdigo gentico no fuese universal, qu ocurrira al introducir el gen que
codifica la insulina de ratn en una bacteria? Razone la respuesta (Se debe razonar

que no se producira protena (insulina) alguna o que, en caso de producirse, sta no


sera funcional)

15. Exponga el concepto de mutacin y explique sus consecuencias (evolutivas y


perjudiciales). Indique la diferencia entre mutaciones espontneas e inducidas y cite
dos ejemplos de agentes mutagnicos (cualquier agente fsico, qumico o biolgico).
16. Observe la figura adjunta y conteste:

a. Cmo se llama el proceso


representado en el esquema?
Identifique los elementos sealados
con las letras A y B, indicando cules
son sus principales semejanzas y
diferencias.
b. Indique la finalidad, dnde se realiza y
describa las etapas del proceso que se
representa. Indique qu significado en
el esquema las anotaciones 5 y 3.
17. Nombre, al menos, tres agentes mutagnicos que conozca. Exponga las consecuencias
biolgicas de las mutaciones.
18. Defina los siguientes conceptos: replicacin, transcripcin y traduccin. En qu parte
de la clula procariota y eucariota tienen lugar estas funciones celulares? Describa
cmo se lleva a cabo la transcripcin.
19. En Drosophila (la mosca del vinagre) los genes que determinan el color del cuerpo y el
tamao de las alas van en el mismo cromosoma. Consideremos una hembra
heterocigota para ambas caractersticas, Qu tipo de gametos podra formar si hay
recombinacin?, Y si no hubiese recombinacin?. Si consideramos una hembra
homocigota para ambos caracteres, Qu tipo de gametos podra formar si hay
recombinacin?, Y si no hubiese recombinacin?
20. Explique las funciones de los distintos ARN que intervienen en la sntesis de protenas.
21. Explique razonadamente cmo se puede comprobar si una enfermedad tiene carcter
hereditario o no. Responda razonadamente a las siguientes preguntas: Las
enfermedades genticas tienen curacin?, las enfermedades genticas tienen
tratamiento, de tal manera que puedan disminuir o incluso eliminarse los sntomas de
la enfermedad?
22. Defina los siguientes conceptos: mutacin espontnea, mutacin inducida y agente
mutagnico. Realice una clasificacin de los agentes mutagnicos, exponiendo los
argumentos utilizados e ilustrando la clasificacin con ejemplos.
23. Clasifique los tipos de bacterias en funcin de la fuente de Carbono y Energa que
utilizan y justifique la respuesta.

24. Por la accin de un mutgeno se produce la sustitucin de una base por otra en una
de las cadenas de un gen que codifica una protena. Sin que se produzca reparacin
tienen lugar sucesivas divisiones celulares. Presentan todas las clulas
descendientes la mutacin? Por qu? (no, al presentarse el ADN mutado slo en una
de las dos clulas hijas) Explique en qu medida puede verse afectada la
funcionalidad de la protena sintetizada en una de las clulas mutantes (desde pasar
desapercibida, en caso de que el nuevo codn codifique para el mismo aminocido,
hasta que se produzca una protena no funcional, inactiva).
25. (Raz) Redacte un texto en el que se relacionen de forma coherente los siguientes
trminos: aminocidos, poros nucleares, ARN, ribosomas y ADN.
26. (Raz) Tienen las mismas consecuencias las mutaciones que se producen en las
clulas somticas que las que se producen en las clulas germinales? Razone la
respuesta. (hay que indicar que las primeras no se transmiten a la descendencia y las
segundas s).
27. Explique qu es la regulacin gnica y por qu es necesaria. Qu son los genes
estructurales y los reguladores?
28. Si se conociese la secuencia de aminocidos de una protena, podra determinarse
exactamente la secuencia de nucletidos del ADN que la codifica? (No, bsicamente
por la degeneracin del cdigo gentico; tambin por la maduracin del ARNm, etc.)
Ha aportado el descubrimiento del cdigo gentico alguna evidencia a favor de la
teora que considera que todos los seres vivos tienen un origen comn? (la
universalidad del cdigo como factor favorable a la teora) Razone ambas respuestas.
29. A la vista de la siguiente imagen, conteste:

a. Indique razonadamente de qu proceso se trata (Transcripcin, por la presencia


de una doble hebra de ADN y una de ARN). en qu lugar de a clula se produce?
(Ncleo eucariota, citosol procaritico y en mitocondrias y cloroplastos) Cmo
afectara a este proceso una elevacin brusca de la T por encima de los 80 C?
(se produce la desnaturalizacin del ADN y de las enzimas)
b. Explique la composicin y estructura de la molcula resultante. cules son las
posibles funciones de esta molcula? (funciones del ARNm, ARN t y ARNr).
30. Explique el concepto de Transcripcin, indique dnde tiene lugar y cmo se realiza. (
en la explicacin no puede faltar: que se produce la copia de una sola hebra de ADN, la
accin de la ARN polimerasa, el papel de las seales de inicio y terminacin)

31. (Raz) La Tercera Ley de Mendel no se cumple en determinados casos, en cules?


Razone la respuesta. (no se cumple cuando los factores mendelianos (los genes) estn
ligados en el mismo cromosoma y en la herencia ligada al sexo).
32. Defina el concepto de gen (fragmento de ADN y unidad gentica funcional) y de
cromosoma (estructura portadora de la informacin gentica, visible en la mitosis,
constituida por ADN y protenas). Cules son los componentes moleculares de los
cromosomas? (ADN y protenas histonas) Explique la estructura de los cromosomas
(enrollamiento y superenrollamiento de la cromatina)
33. (Raz) Al hacer un anlisis de la composicin qumica del ncleo se ha detectado la
presencia de muchas enzimas, aunque en l no existen ribosomas. Da una
explicacin razonada de este hecho (estas enzimas llegan a travs de los poros
nucleares procedentes del citoplasma donde han sido sintetizadas). Para qu son
necesarias estas enzimas? Razone la respuesta (son necesarias para la sntesis de
cidos nucleicos, ADN y ARN, y para su regulacin).
34. Se presenta un fragmento de ADN; la flecha indica el sentido de lectura. Adems se
muestra el cdigo gentico. Conteste las siguientes cuestiones:

a. Indique
la
secuencia
de
bases
del
ARN
mensajero
transcrito
(AUGCCCUCUAGUGGAGUAAUCCACUGGUAA) y la secuencia de aminocidos de la
protena sintetizada (MET-PRO-SER-SER-GLY-VAL-ILE-HIS-TRP (STOP).
b. Cmo se llaman los procesos implicados en el apartado anterior? (Transcripcin y
Traduccin) Si se conociese la secuencia de aminocidos de una protena, se podra
averiguar la secuencia de bases del ADN que la codifica? (No, por varias razones:
cdigo gentico degenerado, eliminacin de intrones)
35. Explique qu se entiende por Cdigo Gentico (relacin entre la secuencia de bases
del ARNm y la secuencia de aminocidos correspondiente). Explique los trminos
codn (grupo de 3 bases que codifica un aminocidos) y anticodn (triplete de bases
del ARNt que se une de forma complementaria a un triplete del ARNm y aporta el

aminocido para el que codifica dicho codn) Qu son los codones sin sentido o de
terminacin? (no corresponden a ningn aminocido) Explique dos caractersticas del
Cdigo Gentico (universalidad y degenerado: explicacin).
36. (Raz) La semejanza que existe entre los hijos y sus padres es explicable por dos de los
siguientes procesos: replicacin, transcripcin, traduccin, reproduccin sexual.
Indique cules. Razone la respuesta. (Replicacin, necesario para la duplicacin del
material gentico en los padres, y la Reproduccin Sexual, que permite que el ADN
replicado pase de una generacin a otra)
37. La figura siguiente representa los resultados del experimento que Meselson y Stahl
realizaron en relacin con la replicacin del ADN. Responda razonadamente las
siguientes cuestiones:

a. Interprete esta experiencia a partir de sus conocimientos sobre la estructura del ADN
y su mecanismo de replicacin (conceptos clave: doble hlice de ADN; hiptesis
semiconservativa de la replicacin).
b. Cul sera el aspecto de un quinto tubo de centrifugacin obtenido a partir del
cultivo sobre medio con N15 tres generaciones despus de su transferencia al medio
con N14? (aparecera una banda estrecha de ADN hbrido (con N15) y otra ms ancha
de ADN ligero (con N14)) Qu aspecto tendra un sexto tubo de centrifugacin
obtenido a partir del cultivo sobre medio con N15 tras 100 generaciones despus de
su transferencia al medio con N14? (aparecera una sola banda de ADN ligero, N14)
38. Explique razonadamente por qu el orden de los nucletidos en el ADN determina
los caracteres de los organismos como son: el tipo de pelo, el color de los ojos, etc.
(El ADN contiene la informacin para sintetizar protenas. Sern stas las que, al actuar
en las reacciones biolgicas, den lugar a la aparicin de los caracteres. La secuencia de
nucletidos en la molcula de ADN determina la secuencia de aminocidos en las
protenas)
39. La difteria est producida por la accin de la toxina de Corynebacterium diphtheriae.
La toxina impide la accin de la translocasa, enzima que favorece el movimiento del
ARN mensajero en el ribosoma. El efecto de esta toxina puede matar a la clula.

Explique razonadamente este hecho. (hay que explicar que la toxina est ocasionando
la detencin de la sntesis proteica)
40. Indique qu es la Replicacin (proceso de duplicacin del ADN, es decir, produccin de
dos molculas de ADN hijas a partir de una molcula de ADN molde) y describa el
proceso (debe incluir: horquillas de replicacin, replicacin bidireccional, replicacin
continua de una hebra y discontinua de la otra, papel fundamental de las enzimas).
Qu significa que la replicacin es semiconservativa? (que cada molcula de ADN
hija presenta una hebra antigua (del ADN molde) y otra de nueva sntesis)
41. Defina el trmino mutacin (alteracin del material gentico) y distinga entre
mutaciones espontneas e inducidas. Comente dos ejemplos en los que se pongan
de manifiesto los efectos perjudiciales de las mutaciones (cncer, enfermedades
genticas, etc.).
42. A la vista de la imagen, responda a las siguientes preguntas:
a.

Qu proceso
se representa en el
esquema?
(Traduccin
o
biosntesis
de
protenas)
Identifique
las
estructuras y las
molculas
que
aparecen en el
dibujo (Ribosoma,
ARNm, ARNt y
aminocidos).

b.

Explique cmo se lleva a cabo el proceso representado (se debe hacer


mencin a todas las molculas de cidos nucleicos que intervienen en el proceso y
a la funcin que desempea cada una).

43. Indique el significado de las siguientes afirmaciones: las dos hebras de una molcula
de ADN son antiparalelas (que una va en sentido 5-3 y la otra al contrario); la
replicacin del ADN es semiconservativa (que las hebras de ADN resultantes tienen
una hebra procedente de la molcula de ADN madre y otra de nueva sntesis); la
replicacin del ADN es bidireccional (que en cada origen de replicacin, la replicacin
se produce en los dos sentidos originando dos horquillas de replicacin, estructuras en
forma de Y, una en cada extremo de la burbuja de replicacin); una de las cadenas del
ADN se replica mediante fragmentos de Okazaki (Durante la replicacin, la sntesis de
una cadena que se copia a partir de la hebra de ADN molde 3-5 se realiza de forma
continua, mientras que la otra, la que se copia a partir de la hebra de ADN molde 5-3,
se sintetiza por medio de pequeos fragmentos llamados de Okazaki; esto es debido a
que la ADN polimerasa slo polimeriza en sentido 5-3). Razone las respuestas.

44. (Raz) La estreptomicina impide que el primer ARN transferente se una al ribosoma
bacteriano. Explique razonadamente su efecto antibitico (el antibitico est
ocasionando la detencin de la sntesis proteica bacteriana).
45. (Raz) El color negro de la piel de una especie de ratn depende del alelo dominante
(B), y el color blanco de su alelo recesivo (b). Si una hembra de color negro tiene
descendientes de piel blanca, cul es el genotipo de la hembra? Qu genotipos y
fenotipos podra tener el macho que se cruz con ella? Razone las respuestas. (la
hembra es heterocigota (Bb) y el macho puede ser heterocigoto u homocigoto
recesivo (bb))
46. Indique la finalidad del proceso de replicacin (duplicacin del material gentico) y en
qu perodo del ciclo celular tiene lugar (fase S de la Interfase). Explique qu es un
cebador (fragmento del ARN que proporciona el extremo 3OH para el inicio de la
polimerizacin del ADN) y un fragmento de Okazaki (fragmentos de ADN por los que
se va replicando la cadena retrasada, a partir de la hebra 5-3 del ADN molde) y por
qu es necesaria su presencia en el proceso de replicacin. Explique brevemente el
proceso de replicacin (debe mencionarse el origen de replicacin, cadenas
adelantada y retrasada, cebador, fragmento de Okazaki, ADN y ARN polimerasas y
Ligasas).
47. En relacin con este esquema, responda a las siguientes preguntas:
a. Cmo se denominan cada uno de
los pasos indicados con flechas en el
esquema y dnde se llevan a cabo
en una clula eucaritica? Escriba
qu codones corresponden a cada
uno de los 5 aminocidos. Si una
mutacin puntual provoca que la
primera base de la molcula 2 pase
a ser una C en vez de una A, qu
cambio se origina en la secuencia de
la molcula 3?
b.

Describa brevemente el proceso de sntesis de la molcula 3 e indique las fases


de las que consta.

48. En los humanos la fibrosis qustica se produce por el alelo recesivo de un gen
autosmico con dos alelos (A: alelo normal; a: alelo de la fibrosis qustica). En una
pareja en la que la mujer es heterocigtica y el varn presenta fibrosis qustica,
indique para este gen los tipos y las proporciones de los vulos de la mujer y
espermatozoides del hombre y los fenotipos y genotipos de la descendencia. Razone
las respuestas. (vulos: 50% A t 50 % a. Espermatozoides: 0 % A y 100 % a.
Descendencia: sanos Aa el 50 % y con fibrosis qustica aa el otro 50 %).
49. Exponga razonadamente si el ADN de una clula de la piel de un individuo contendr
la misma informacin gentica que una clula del hgado. Sintetizan las dos clulas
las mismas protenas? Razone las respuestas.

50. Explique el concepto de gen y de genoma. Qu es el cdigo gentico? Explique qu


significa que el cdigo gentico es universal y degenerado.
51. Podran los 20 aminocidos estar codificados por un cdigo gentico constituido por
dipletes de las cuatro bases nitrogenadas? Razone la respuesta. No, porque slo se
podran formar 16 dipletes diferentes y hacen falta al menos 20 para poder codificar
los 20 aminocidos diferentes presentes en las protenas.
52. Explique brevemente el proceso de replicacin. Indique la finalidad de este proceso y
el significado de la afirmacin: la replicacin del ADN es semiconservativa.
53. Suponga que en un fragmento de ADN que codifica un polipptido se produce una
mutacin que cambia un par de bases por otro. Debido a ello, cuando la clula
sintetice de nuevo el polipptido pueden ocurrir cualquiera de los cuatro hechos
siguientes:
1. Que se codifique el mismo aminocido. (se debe al hecho de que el cdigo gentico
es degenerado)
2. Que se sustituya un aminocido por otro distinto. (se debe a una mutacin que ha
cambiado un codn a otro que codifica para otro aminocido)
3. Que el nuevo polipptido sintetizado sea ms corto. (la mutacin produce un
codn de parada que impide que se sintetice el polipptido en su totalidad)
4. Que el nuevo polipptido sintetizado sea ms largo. (la mutacin ha modificado al
codn de terminacin convirtindolo en otro que s que codifica un aminocido y
permite la sntesis de un polipptido ms grande)
Basndose en sus conocimientos del cdigo gentico, explique cmo se producira
cada uno de estos resultados

54. En relacin a la figura adjunta, conteste a las siguientes cuestiones:


a. Qu
representan
los
esquemas 1 y 2? La primera (1)
y la segunda (2) ley de Mendel
(alternativamente un cruce
entre homocigticos y un cruce
entre heterocigticos) Indique
que representan la letras A
(Alelo dominante) y a (alelo
recesivo) y los pares de letras
AA (homocigoto dominante), Aa
(heterocigoto) y aa (homocigoto recesivo)
b. Explique los distintos porcentajes que aparecen en los esquemas 1 y 2 (los
individuos AA y aa slo producen un tipo de gameto y los Aa producen dos en
igual cantidad; el cruce entre dos homocigticos da lugar, exclusivamente, a
heterocigticos y el cruce entre dos heterocigticos produce los tres genotipos

posibles en las proporciones 1:2:1). Represente el cruce Aa x aa utilizando un


esquema similar a los de la figura, incluyendo los valores de los porcentajes.
55. Defina qu es un cruzamiento prueba (Cruzamiento entre un individuo de fenotipo
dominante y un individuo homocigtico recesivo a fin de poder averiguar el genotipo
del primero) y realice un esquema del mismo utilizando smbolos gentico. Defina
herencia intermedia (Los dos alelos implicados en un carcter se expresan con la
misma intensidad, de forma que los hbridos manifiestan un fenotipo intermedio
diferente al de los homocigotos de ambos alelos) y realice un esquema de la misma
usando smbolos genticos. Utilice para la realizacin de los esquemas los smbolos A
y a.
56. En relacin a la figura adjunta sobre el flujo de la informacin gentica, responda a
las siguientes preguntas:

a. Nombre cada uno de los procesos biolgicos que se indican con las letras a, b, c y d.
Relacione cada uno de estos procesos con: ARN polimerasa dependiente de ADN,
ribosomas, ADN polimerasa, anticodn, transcriptasa inversa, aminocidos, ARN
transferente y cebadores de ARN.
b. Exponga la funcin de cada uno de estos procesos.
57. (Raz) a) Si un polipptido tiene 450 aminocidos, indique cuntos ribonucletidos
tendr el fragmento del ARN mensajero que codifica esos aminocidos (450 x 3 =
1350 ribonucletidos). b) Indique cules sern los anticodones de los ARN
transferentes correspondientes a la molcula de ARNm 5'-GUU-UUC-GCA-UGG-3'
(CAA, AAG, CGU, ACC). c) Indique la secuencia de ADN que sirvi de molde para este
mismo ARN mensajero (3-CAAAAGCGTACC-5).
58. Explique cul es la finalidad de la replicacin y de la transcripcin. Explique la
traduccin. Dibuje el inicio de la traduccin.
59. (Raz) a) Complete la tabla que aparece a continuacin que corresponde a las cadenas
complementarias de un fragmento de ADN.Utilice las letras: P para el cido fosfrico,
D para la pentosa (2' desoxirribosa), A para adenina, C para citosina, G para guanina
y T para timina. Indique, en cada caso, el nmero de puentes de hidrgeno que se
establecen entre las dos bases nitrogenadas.

b) Al analizar las proporciones de bases nitrogenadas de un fragmento


monocatenario de ADN humano los resultados fueron los siguientes: 27% de A, 35%
de G, 25% de C y 13% de T. Indique cules sern las proporciones de bases de la
cadena complementaria. (13% de A, 25% de G, 35% de C y 27 % de T)
60. En relacin a la figura adjunta, conteste a las
preguntas:
a. Nombre el tipo de molcula de que se trata.
Cmo se denominan sus monmeros y cul es
su composicin. Considerando la molcula en
sentido longitudinal, las notaciones 3' y 5' se
sitan en posiciones opuestas. Explique el
significado de este hecho.
b. Cmo se denomina el proceso por el cual esta
molcula se duplica? Explquelo brevemente.

61. Defina los siguientes conceptos: gen, alelo, homocigoto y herencia intermedia.
Explique la segunda ley de Mendel utilizando un ejemplo. En qu consiste el
cruzamiento prueba?
Gen: fragmento de ADN y unidad gentica funcional
Alelo: cada una de las formas alternativas que puede presentar un gen
Homocigoto: individuo en el que los dos alelos de un gen son iguales.
Herencia intermedia: cuando los hbridos de la primera generacin filial muestran
caracteres intermedios entre los dos progenitores
Explicacin de la 2 Ley de Mendel con cruce de hbridos
Cruzamiento prueba: cruce entre un individuo de fenotipo dominante y un individuo
homocigtico recesivo a fin de poder averiguar el genotipo del primero
62. (Raz) Qu caracterstica tiene el cdigo gentico que permite que un gen de un
organismo pueda expresarse en otro? Razone la respuesta. (carcter universal)
63. (Raz) Indique las proporciones de los distintos genotipos en la descendencia del
siguiente cruzamiento AaBb x AaBb. Razone la respuesta.

AABB: 1/16; AABb: 2/16; AAbb: 1/16; AaBB: 2/16; aaBB: 1/16; AaBb: 4/16; aaBb: 2/16;
Aabb: 2/16; aabb: 1/16
64. En relacin a la figura adjunta, responda a las siguientes
preguntas:
a. Qu tipo de molcula representa? (ARNt) Explique su
composicin indicando el tipo de enlace que se
produce entre sus componente (nucletidos unidos
por enlaces fosfodister). Cumple esta molcula la
relacin [purinas]/[pirimidinas]=1? (No, dado que no
es una molcula bicatenaria)
b. Explique su funcin indicando el nombre y la
implicacin en la misma de las regiones sealadas con
los nmeros 1 y 2. (Transporte de aminocidos al
ribosoma para la sntesis proteica. N1: Brazo Aceptor
del aminocido correspondiente al Anticodn. N 2:
Anticodn, reconocimiento y unin al triplete de
nucleticos del ARNm o codn)
65. A un vulo de una hembra A, se le elimina su ncleo y se le introduce el ncleo de
una clula somtica de un individuo B, y posteriormente se implanta en el tero de
una hembra C. Si los individuos A, B y C son de la misma especie, a quin se
parecern las caractersticas genticas del individuo resultante? Razone la respuesta
(se parecern al B pues proceden del material gentico de este individuo).
66. Explique qu se entiende por cdigo gentico (Relacin entre secuencia de bases
(ARN mensajero) y secuencia de aminocidos (protenas)) . Defina los trminos codn
(grupo de tres bases (tripletes) del ARN mensajero que codifica un aminocido) y
anticodn (triplete de bases del ARN transferente). Qu son los codones sin sentido
o de terminacin? (Codones que no corresponden a ningn aminocido) Describa dos
caractersticas del cdigo gentico (universal y degenerado).
67. En cierta especie animal, el pelo gris (G) es dominante sobre el pelo blanco (g) y el
pelo rizado (R) sobre el liso (r). Se cruza un individuo de pelo gris y rizado, que tiene
un padre de pelo blanco y una madre de pelo liso, con otro de pelo blanco y liso.
a) Pueden tener hijos de pelo gris y liso? (s) En caso afirmativo, en qu
porcentaje? (25% de los descendientes ser Ggrr (pelo gris y liso)
b) Pueden tener hijos de pelo blanco y rizado? (s) En caso afirmativo, en qu
porcentaje? (el 25% de los descendientes sern ggRr) Razone las respuestas.
68. Cite y defina los dos procesos que tienen lugar en la expresin de la informacin
gentica (transcripcin, sntesis de una cadena de ARN que tiene la secuencia
complementaria de una cadena de ADN que acta como molde, y traduccin, sntesis
de una cadena polipeptdica a partir de una secuencia de ARNm). Indique si alguno de
estos procesos podra darse en sentido inverso (transcripcin inversa) y en qu tipo
de microorganismos se produce (retrovirus o virus de ARN). Explique la funcin de los
distintos tipos de ARN en la expresin gnica (ARNr forma parte de los ribosomas;

ARNt transporta los aminocidos de forma especfica; ARNm contiene el mensaje


gentico).
69. (Raz) Indique si las afirmaciones siguientes son ciertas o falsas, razonando la
respuesta:
a) Si en un ARNm se introduce un uracilo en la posicin donde debera colocarse una
citosina se produce una mutacin. Falsa: puesto que un cambio en el ARNm no es una
mutacin, las mutaciones se producen por cambios en el ADN
b) En eucariotas el ARNm puede ser traducido nada ms sintetizarse. Falsa: en
eucariotas la sntesis de ARNm y su maduracin se produce dentro del ncleo por lo
que debe salir de l para ser traducido en el citoplasma
c) En una horquilla de replicacin las dos hebras del ADN se replican en sentido
53. Verdadera: las ADN polimerasas sintetizan en sentido 53. Por ello, una de
las hebras se sintetiza de manera continua (la hebra adelantada), mientras que la otra
(la retrasada) lo hace de manera fragmentada (fragmentos de Okazaki)
d) Si dos genes tienen secuencias de tripletes diferentes codificarn siempre cadenas
peptdicas diferentes. Falsa: no siempre puede afirmarse tal cosa ya que el cdigo
gentico es degenerado, es decir varios tripletes diferentes pueden codificar el mismo
aminocido.
70. (Raz) Explique razonadamente por qu el orden de los nucletidos en el ADN
determina los caracteres del fenotipo de los organismos. La secuencia de nucletidos
en la molcula de ADN determina la secuencia de aminocidos en las protenas y por
tanto el fenotipo del organismo.
71. Defina el trmino mutacin (alteracin del material gentico) y distinga entre
mutaciones espontneas (Las mutaciones espontneas se producen de forma natural
en los individuos) e inducidas (Las mutaciones inducidas se producen como
consecuencia de la exposicin a agentes mutagnicos qumicos o fsicos). Comente dos
ejemplos en los que se pongan de manifiesto los efectos perjudiciales de las
mutaciones (Efectos perjudiciales: cncer, enfermedades genticas, etc.).
72. (Raz) En la especie humana, el color de ojos es un carcter autosmico donde el alelo
del color marrn A domina sobre el azul a. Un hombre de ojos marrones, cuya
madre tiene ojos azules, tiene dos descendientes con una mujer de ojos azules.
Cules son los genotipos del hombre y de la mujer? (el hombre tiene que ser
heterocigoto Aa para dicho carcter porque ha heredado el alelo recesivo de su
madre de ojos azules, homocigota recesiva aa; la mujer es homocigota recesiva aa
por tener los ojos azules) y los de los descendientes? (heterocigotos Aa u
homocigotos recesivos aa) cul es la probabilidad de que esta pareja tenga
descendientes con los ojos azules? (50%) Y la probabilidad de tener descendientes
con ojos marrones? (50 %) Razone la respuesta.
73. En humanos la presencia de una fisura en el iris est regulada por un gen recesivo
ligado al sexo (Xf). De un matrimonio entre dos personas normales naci una hija
con el carcter mencionado. El marido solicita el divorcio alegando infidelidad de la

esposa. Explique el modo de herencia del carcter indicando los genotipos del
matrimonio y a qu conclusin debe llegar el juez en relacin a la posible infidelidad
de la esposa teniendo en cuenta el nacimiento de la hija que presenta la fisura.
(Genotipo de la mujer (XFXf) y del marido (XFY). Para que la mujer pueda tener una
hija con fisura en el iris debe haberle sido infiel a su marido con un individuo que
tambin presentase fisura (excepto frecuencia de mutacin del gameto masculino)
74. (Raz) Una pareja de fenotipo normal para la pigmentacin tiene un hijo albino.
Explique el modo de herencia del albinismo e indique los genotipos de los padres y
del hijo (el albinismo es un carcter autosmico recesivo ya que si no fuese as la
pareja no podra tener un hijo albino, y los genotipos de ambos padres son Aa, siendo
el hijo aa). Qu proporcin de hijos no albinos se puede esperar en la descendencia?
(75%)Y de hijos albinos? (25%)Razone las respuestas.
75. Segn el sistema AB0 de grupos sanguneos humanos, los individuos con sangre del
grupo AB presentan en la superficie de sus eritrocitos antgenos de tipo A y
antgenos de tipo B, mientras que los individuos con sangre del grupo 0 no presentan
estos antgeno, por qu en el caso de transfusiones sanguneas a los individuos con
sangre AB se les considera receptores universales y a los de tipo 0 donantes
universales? Razone la respuesta. (un individuo con sangre del grupo AB, que tiene
antgenos del tipo A y B, no produce anticuerpos para estos antgenos y, por tanto,
puede recibir sangre de donantes de cualquier grupo sanguneo. Los individuos con
sangre del grupo 0 no tienen los antgenos A ni B y, por tanto, pueden donar a
cualquier receptor porque no le introducen antgenos extraos)
76. La informacin gentica de los retrovirus, que est en forma de ARN, puede
insertarse en el ADN de la clula husped. D una explicacin razonada a este hecho.
(la respuesta se basar en que mediante la transcriptasa inversa se hace una copia de
la cadena de ARN en ADN y esta ltima se puede integrar en el genoma de la clula
hospedadora)
77. (Raz) El color de la flor de un tipo de violetas est determinado por un gen con dos
alelos con herencia intermedia. El alelo R determina el color rojo y el r el color
blanco. Las plantas heterocigticas tienen flores rosas. En los cruzamientos Rr X RR;
rr X Rr; Rr X Rr indique qu gametos se formarn en cada parental y cul ser el
fenotipo de las flores en la siguiente generacin.
Rr X RR: gametos del individuos Rr (R y r) y del individuo RR (R)
rr X Rr: gametos del individuo rr (r) y del individuo Rr (R y r)
Rr X Rr: gametos de los dos individuos (R y r)
Descendencia del primer cruce: flores rojas y rosas.
Descendencia del segundo cruce: flores blancas y rosas
Descendencia del tercer cruce: flores rojas, rosas y blancas
78. Considere una clula en la que una determinada molcula de ADN de cadena doble
presenta una proporcin de Adenina del 30%. Cul ser en dicha molcula la
proporcin de: T (30%), G (20%), C (20%), bases pricas (50%) y bases pirimidnicas

(50%)? Indique si todas las molculas de ADN de dicha clula presentan los mismos
porcentajes de A, T, G, C, bases pricas y pirimidnicas? La secuencia ser diferente y
variarn los porcentajes de cada base, pero no variarn los porcentajes de bases
pricas y pirimidnicas que sern del 50 % cada una) Razone la respuesta.
79. Ni Lus ni Mara tienen distrofia muscular de Duchenne (enfermedad ligada al sexo),
pero su hijo primognito s. Indique si el alelo responsable es dominante o recesivo
(es recesivo porque la madre no presenta la enfermedad) y los genotipos de los
padres y del hijo (madre- XAXa, padre- XAY e hijo- XaY). Si tienen otro hijo varn, cul
es la probabilidad de que padezca esta enfermedad? (la probabilidad de que otro hijo
varn tenga la enfermedad es del 50 %) Y si es una hija? (0%) Razone la respuesta.
80. Un investigador encuentra que entre los ratones de su laboratorio se ha producido
una mutacin espontnea en un macho. Tras cruzarlo con una hembra normal,
comprueba que en la descendencia ningn macho presenta la mutacin, pero en
cambio s la presentan todas las hembras. Indique qu tipo de mutacin ha podido
producirse (una mutacin dominante en el cromosoma X). Qu porcentaje de
individuos mutantes cabra esperar en la descendencia si se cruza una hembra
mutante (del cruce anterior) con un macho normal? Razone las respuestas.

Porcentajes: 50 % de machos mutantes y 50 % de hembras mutantes.

MICROBIOLOGA
1. Nombre las fases fundamentales del ciclo ltico de un virus. Descrbelas de forma
breve y seale la diferencia de un ciclo viral lisognico.
2. Defina un virus y describa el Ciclo Ltico de un bacterifago.
3. Defina el concepto de biotecnologa y describa una aplicacin de la misma en la a
que intervengan bacterias.
4. A la vista de la imagen que representa el virus del VIH, conteste a las preguntas:
a. Indique la naturaleza
molecular
de
los
elementos indicados con
los nmeros (1: bicapa
liipdica; 2: protenas de
cubierta; 3: protena de
la cpsida). Indique qu
tipo de cido nucleico
contiene
este
virus
(ARN), qu tipo de
clulas
pueden
ser

infectadas por este virus (linfocitos T4 provocando su destruccin y


desactivando la respuesta inmune tanto celular como humoral) y las
consecuencias de ello (desactivacin de la respuesta inmune tanto celular como
humoral).
b. Explique el ciclo del virus del VIH. (El ciclo comienza con la interaccin del
retrovirus con una glucoprotena de membrana de la clula hospedadora, lo que
provoca la fusin de la membrana del virus y de la clula con la consiguiente del
retrovirus al interior celular; tras la prdida de la cubierta proteica se inicia la
retrotranscripcin del ARN vrico gracias a la retrotranscriptasa, que sintetiza un
ADN bicatenario que se integra en el cromosoma de la clula hospedadora. El
siguiente paso es la expresin del ADN viral que conduce a la formacin de ARN
vricos, que se traducen para originar las protenas estructurales y enzimticas
del virus; tras el ensamblaje de los viriones stos pueden liberarse para reiniciar
un nuevo ciclo infectando nuevas clulas diana).