Virus Research 122 (2006) 127136

Proteinprotein interactions and nuclear trafficking of coat protein

and C1 protein associated with Bhendi yellow vein mosaic disease
P. Kumar P. a , R. Usha a , A. Zrachya b , Y. Levy b , H. Spanov b , Y. Gafni b,
a

Department of Plant Biotechnology, School of Biotechnology, Madurai Kamaraj University, Madurai 625021, India
Department of Genetics, Agricultural Research Organization, The Volcani Center, P.O. Box 6, Bet Dagan 50250, Israel
Received 11 January 2006; received in revised form 12 July 2006; accepted 12 July 2006
Available online 24 August 2006

Abstract
Bhendi yellow vein mosaic disease (BYVMD) is caused by a complex consisting of a monopartite begomovirus BYVMV and a satellite DNA
component. BYVMV represents a new member of the emerging group of monopartite begomoviruses requiring a satellite component for symptom
induction. Here we report the results of the transient expression of green fluorescent protein (GFP) fused with the C1 and coat protein (CP)
coding regions, in the epidermal cells of Nicotiana benthamiana. GFPCP was found to be targeted into the nucleus whereas GFPC1 was localized
towards the periphery of the cell. The sub-cellular localization of the C1 protein has been compared with that of the CP in yeast cells using a
genetic system for detection of protein nuclear import and export. Expression of C1 ORF in transgenic N. benthamiana under the control of the
Cauliower mosaic virus 35S promoter produced severe developmental abnormalities in the plant, like distorted stem, leaves and stunting of the
plant. We also present the results on the interaction of CP and C1 proteins using yeast two hybrid analysis, suggesting a collaborative role in the
inter- and intracellular dynamics of BYVMD.
2006 Elsevier B.V. All rights reserved.
Keywords: Begomovirus; Bhendi yellow vein mosaic virus; C1; Coat protein; Nuclear localization; Nuclear export

1. Introduction
Bhendi yellow vein mosaic disease (BYVMD) complex
consists of a begomovirus Bhendi yellow vein mosaic virus
(BYVMV) DNA A component and a satellite BYVMD DNA
component (Jose and Usha, 2003). This DNA depends on
BYVMV for its replication and encapsidation. DNA , along
with BYVMV induces typical yellow vein mosaic symptoms in
A. esculentus and severe leaf curl and stunted growth in Nicotiana benthamiana (Jose, 2004). Systemic infection in bipartite
begomoviruses, like Squash leaf curl virus (SLCV), is achieved
by movement protein (MP = BC1) and the nuclear shuttling
protein (NSP = BV1) encoded by the DNA B component of
the genome (Sanderfoot and Lazarowitz, 1995). In contrast,
the monopartite begomoviruses such as BYVMV do not code
for NSP and MP homologs. Therefore, some other proteins
must fulfill some or all of the functions provided by MP and

Corresponding author. Tel.: +972 3 968 3471; fax: +972 3 968 3471.
E-mail address: ygafni@volcani.agri.gov.il (Y. Gafni).

0168-1702/$ see front matter 2006 Elsevier B.V. All rights reserved.
doi:10.1016/j.virusres.2006.07.007

NSP. In the case of monopartite begomoviruses, like TYLCV,

it has been shown that CP is highly karyophilic and it was
suggested to be active in the nuclear import and export of viral
nucleic acids as viral nucleo-proteins across the nuclear pore
complex (Palanichelvam et al., 1998; Kunik et al., 1998; Rhee
et al., 2000; Rojas et al., 2001), thereby fulfilling the role of
BV1. In monopartite begomoviruses, like AYVV, which require
a satellite DNA for typical symptom production, DNA
functions either by facilitating the replication or movement of
the begomovirus, or by suppressing a host defense mechanism
(Saunders et al., 2000). It has also been suggested that the DNA
, in particular the ORF C1 has a major role in symptom induction and accumulation of DNA A to normal levels (Saunders et
al., 2004). It has been shown that CLCuV encodes a functional
C1 transcript, which modulates virus-like symptoms in N.
tabacum (Saeed et al., 2005). It was recently shown for Tomato
yellow leaf curl China virus Y10 isolate (TYLCCNV-Y10), that
the C1 is able to suppress RNA silencing activity (Cui et al.,
2005). Also, the karyophilic nature of this protein is described.
Here, in order to understand the role of CP and C1 of BYVMD
we have analyzed the plant expression of C1 ORF, intracellular

128

P. Kumar P. et al. / Virus Research 122 (2006) 127136

localization of the CP and C1 and the interaction between these

proteins.
2. Materials and methods
2.1. Sequence analysis of CP and C1
To predict the intracellular localization signals in CP and
C1, online software predictions PSORT (http://psort.nibb.
ac.jp/, Nakai and Horton, 1999) and NetNES (http://www.
cbs.dtu.dk/index.shtml, la Cour et al., 2004) were used. Multiple sequence alignments were carried out using the online
servers http://www.ebi.ac.uk/clustalW (Higgins et al., 1994) and
http://www.ch.embnet.org/software/TCoffee.html (Notredame
et al., 2000). Analysis of BYVMDC1 protein (NP 570980)
sequence with various other reported C1 sequences were carried out.

ing sites of pUCGFP to get pUCGFPNLSCP. The expression

cassettes were released from pUCGFPCP and pUCGFPNLSCP
by EcoRI and HindIII digestion and were cloned into the binary
vector pBINGFP (van Engelen et al., 1995) at the corresponding
sites to generate pBINGFPCP and pBINGFPNLSCP, respectively. Similarly the C1 gene of BYVMV was PCR-amplified
using the primers PC1.F and BspC1.R (Table 1) from the
full DNA clone (pBeta1) (Jose and Usha, 2003; Acc. No.
AJ308425). The PCR product was first cloned into pGEM-T
easy vector (Promega) to get pGEMC1. The C1 gene was
then released with Bsp14071 and PstI and cloned in-frame with
the 3 terminus of gfp in pUCGFP to derive pUCGFPC1. The
expression cassette was then cloned into pBINGFP at the EcoRI
and HindIII sites to generate pBINGFPC1. The constructs
pBINGFPCP, pBINGFPNLSCP, pBINGFPC1 and pBINGFP
were individually mobilized into Agrobacterium strain EHA105
(Hood et al., 1993) using freeze-thaw transformation (Chen et
al., 1994).

2.2. Construction of GFP fusion

2.3. Plant agro-inltration and confocal microscopy
A GFP tagging expression cassette comprising the CaMV
35S promoter, GFP coding sequences and the nos terminator
was excised from pBINGFP (van Engelen et al., 1995) with
EcoRI and HindIII and inserted at the corresponding sites of
pUC19 (Yanisch-Perron et al., 1985) to generate pUCGFP. The
CP gene of BYVMV, amplified using the primers BspCP.F and
PCP.R (Table 1) from the full-length clone (pBY1) of BYVMV
(Jose and Usha, 2003; Acc. No. AF241479) was first cloned
into pGEM-T Easy vector (Promega) to get pGEMCP. The CP
of BYVMV has an internal Bsp14071 site at 180 bps away from
the 5 -end. Therefore, the CP region without the 5 180 bps was
released with Bsp14071 and PstI digestions, eluted and cloned
at the 3 -end of gfp in pUCGFP to make pUCGFPNCP. Then
the 5 180 bps from BYVMV CP was released with Bsp14071,
eluted and cloned in to the Bsp14071-digested and dephosphorylated pUCGFPNCP to generate the full-length pUCGFPCP.
The proper orientation of the full-length CP was confirmed by
PCR using the primers BspCP.F and PCP.R (Table 1). To make
the GFPNLSCP fusion construct, the 5 180 bps of CP coding
region released with Bsp14071 was inserted into the correspond-

Leaves of N. benthamiana were infiltrated with Agrobacterium strains containing the above constructs (Llave et al.,
2000). After 48 h of infection the leaves were harvested and
observed under a laser scanning confocal microscope for detecting the fluorescence. The images were acquired by an Olympus IX81/FV500 confocal microscope using an argon laser
(488 nm), a green helium/neon laser (543 nm) and the following objectives: PLAPO60Xoil/NA 1.4 WD 0.15 mm, or
PLAPO60XW/LSM/NA1.00 WD 0.15 mm. Image analysis was
carried out using the MICA software (Cytoview, Israel).
2.3.1. Propidium iodide staining
Leaf samples were stained with propidium iodide (PI) after
fixing with PME buffer (50 mM PIPES pH 6.9, 5 mM EGTA,
2 mM MgSO4 ) containing 3% paraformaldehyde, 0.05% Triton X-100, 0.25% DMSO, 50 M PMSF and incubated for 1
h. After the incubation, leaf samples were washed three times
each for 5 min in phosphate buffered saline (PBS). The leaf samples were then transferred to freshly prepared PI solution (final

Table 1
Primers used for PCR
Primers

Sequence

Location

BspCP.F
PCP.R
PC1.F
BspC1.R
BC1.F
HC1.R
SalCP.F
SalC1.R
EcoC1.R
EcoCP.F
XhoC1.F
XhoCP.R
EcoNC1
XhoCC1

5 -TGT

BYVMD DNA A 280295

BYVMD DNA A 10331050
BYVMD DNA C1 180207
BYVMD DNA C1 602578
BYVMD DNA C1 180207
BYVMD DNA C1 602578
BYVMD DNA A 280295
BYVMD DNA C1 602578
BYVMD DNA C1 602578
BYVMD DNA A 280295
BYVMD DNA C1 180207
BYVMD DNA A 10331050
BYVMD DNA C1 454435
BYVMD DNA C1 362376

ACATGTCGAAGCGAGCTG-3

5 -CTG CAGTCAATTCGTTACAGAGTC 3
5 -CTG CAGTTAAATTATTATCTTATTATCAATAG-3
5 -TGTACATGAAAATATCTATACATTTCATC-3
5 GGATCCTTAAATTATTATCTTATTAT CAATAG-3
5 AAGCTTATGAAAATATCTATACATTTCATC-3
5 -GTCGACCTATGTCGAAGCGAGCTG-3
5 -GTCGACCTATGAAAATAT CTATACATTT C-3
5 -GAATTCATGAAAATAT CTATACATTT C-3
5 -GAATTCATGTCGAAGCGAGCTG-3
5 -CTCGAGAATTATTATCTTATTATCAATAG-3
5 -CTCGAGATTCGTTACAGAGTC 3
5 -GAATTCATG CAG ATC AGT TCA ACA AG-3
5 -CTCGAGAAGTCGAATGGAATG-3

P. Kumar P. et al. / Virus Research 122 (2006) 127136

concentration 1 g/ml) in PBS and incubated for 1 h in dark. PI

solution was decanted, the leaf samples were washed four times,
each for 30 min duration with PBS, dried on Whatmann #1 paper
and mounted on a glass slide with anti-fading agent Elvanol to
observe for fluorescence.
2.4. Yeast-one-hybrid analysis
To study the intracellular localization of CP and C1 in yeast,
vectors pNIA and pNEA of the one-hybrid genetic system for
detection of the nuclear import and export of proteins was used
(Rhee et al., 2000). The CP and C1 coding regions were PCRamplified from pBY1 using primers SalCP.F and PCP.R (Table 1)
and pBeta1 using primers SalC1.R and PC1.F (Table 1),
respectively. The PCR products were cloned into pGEM-T Easy
vector to get pGEMNCP and pGEMNC1, respectively, from
which these genes were released with SalI and PstI and cloned
into the corresponding sites of pNIA. A similar strategy was
used to clone CP and C1 in the pNEA vector. Controls were
pNIA, pNEA and pNEARev where the Rev from HIV is a protein with a well characterized nuclear exporter signal (Fischer et
al., 1995; Ullman et al., 1997; Pollard and Malim, 1998; Rhee
et al., 2000). Standard protocols (Kaiser et al., 1994) were used
to transform Saccharomyces cerevisiae strain L40 (Hollenberg
et al., 1995) in all these experiments. For qualitative analysis
of -galactosidase activity, the colony-lift filter assay on Whatman #3 was used (Breeden and Nasmyth, 1985). Quantitatively
-galactosidase activity was assayed in liquid culture using onitrophenyl -d-galactoside (ONPG) as a substrate (Clontech,
Palo Alto, CA). For quantifying yeast cell growth, cells were
grown in tryptophan dropout minimal medium to OD600 = 0.5.
Serial dilutions of the cultures were prepared and a 10 l sample
of each dilution was spotted onto minimal medium deficient for
both tryptophan and histidine supplemented with 100 mM 3AT.

129

control. Human lamin C is a well-characterized non-interacting

partner in the yeast-two-hybrid analysis (Bartel et al., 1993).
As a positive control for -galactosidase activity, pNEA in L40
was used (Rhee et al., 2000). For -galactosidase activity, the
same protocols as for the one-hybrid assay were used. Quantitatively -galactosidase activity was assayed in liquid culture
using ONPG as a substrate (Clontech, Palo Alto, CA). To quantify yeast cell growth, cells were grown in tryptophan, histidine
and uracil dropout minimal medium to OD600 = 0.5. Serial dilutions of the cultures were prepared and a 10 l sample of each
dilution was spotted onto selective dropout medium plates lacking tryptophan, histidine, uracil and leucine.
2.6. C1 transgenic plants
For the plant-expression of ORF C1, it was PCR amplified
from pBeta1, using the primers BC1.F and HC1.R (Table 1).
The PCR product was first cloned into pXcmkn12 (Cha et
al., 1993) to obtain pXcmC1. The C1 ORF, released using
BamHI and HindIII digestions, was cloned into the binary vector
pGA643 (An et al., 1988) at the BglII and HindIII sites to derive
the sense construct pGAC1S. For the antisense construct,
the C1 ORF was released using BamHI and cloned into the
BgIII site of pGA643 to obtain pGAC1AS.The sense and anti
sense constructs were confirmed by PCR using the 35S primer
and the gene specific primer combinations. The pGAC1S and
pGAC1AS constructs were separately mobilized into Agrobacterium strain LBA4404 by triparental mating (Ditta et al., 1980).
N. benthamiana leaf discs were transformed with the constructs as described (Radian-Sade et al., 2000). Transgenic plants
were selected on MS medium supplemented with 300 g of
kanamycin and 250 g of cefotoxime per milliliter and grown
at 2527 C under artificial light (150 E s1 m2 ) with a 16-h
photoperiod. Transgenic plants were transferred to potting soil
and were maintained in the plant growth chamber.

2.5. Yeast-two-hybrid analysis

2.7. Northern blot analysis of RNA from transgenic plants
To analyze the interaction of CP and C1, yeast-two-hybrid
system (Ausubel et al., 1995) was used. The CP and C1 coding
regions were PCR-amplified from pBY1 using primers EcoCP.F
and XhoCP.R and from pBeta1 using primers EcoC1.R and
Xho C1.F (Table 1). Deletion mutants of C1, namely NC1,
coding for 51140 amino acids from the N terminal end and
CC1, coding for 180 amino acids from the N terminal end
were made using the primers EcoNC1.R & XhoC1.F and
EcoC1.R & XhoCC1.F, respectively (Table 1). The PCR
products were first cloned into pGEM-T Easy vector to get pGEMYCP, pGEMYC1, pGEMYNC1and pGEMYCC1,
respectively. These genes were then released with EcoRI and
XhoI digestions and cloned into the corresponding sites of yeasttwo-hybrid DNA binding vector pEG202 and activation domain
vector pJG4-5. For analyzing the interaction with a plant protein,
tomato -karyopherin cDNA in pJG4-5 was used [pLeKAP1]
(Kunik et al., 1999, Acc. No. AF017252). To identify the false
positives human lamin C released from pGBKT7-Lam (Clontech, Palo Alto, CA) by EcoRI and BamHI digestions and cloned
into the corresponding sites of pEG202 was used as a negative

Transgenic plants were selected by PCR and Southern

hybridization. RNA was isolated from all the transgenic lines
using plant RNA reagent (Invitrogen, Carlsbad, CA, U.S.A.).
Samples of RNA (20 g) were electrophoresed in a 1.5%
formaldehyde agarose gel and were blotted onto nylon membrane (Biobond N+ plus, Sigma, U.S.A.). Blotted RNA was
hybridized overnight at 42 C (Sambrook and Russell, 2001)
with 32 P dCTP-labeled full-length DNA C1 probes.
3. Results
3.1. PSORT and NetNES analysis
Analysis of BYVMV capsid protein sequence using the
online software prediction PSORT (http://psort.nibb.ac.jp),
revealed a strong bipartite nuclear localization signal (NLS),
1 msKRaadivistpasKvRRRlnfg24 at its N terminus. This bipartite signal is conserved among the begomovirus coat proteins
and is similar to that in TYLCV (Kunik et al., 1998). The

130

P. Kumar P. et al. / Virus Research 122 (2006) 127136

Table 2
Comparison of known leucine-rich nuclear export signals and BYVMDC1

nuclear localization of the Y10 C1 of TYLCCNV as predicted by the NLS (45 PALAKKK51 ) using PSORT analysis
was confirmed experimentally by Cui et al. (2005). However,
a similar PSORT analysis of BYVMD C1 did not show
any NLS in the sequence. Interestingly PSORT analysis of
a number of C1 sequences revealed that there are at least
two distinct types of C1 proteins, those with a NLS and
those with a NES sequence. The C1 proteins associated with
Tomato yellow leaf curl virusChina (TYLCCNV, CAI96493,
Tomato leaf curl virusChina (ToLCCNV, CAG28792),
Tomato leaf curl virusPune (ToLCNDV, AAV98446), Mungbean yellow mosaic India virus (MYMIV, AAZ78309), and
Papaya leaf curl virus (PaLCuCNV, NP 821073) have a
monopartite NLS. The NLS sequence shows minor variation
between C1 proteins. It is 45 PALAKKK51 in TYLCCNV,
45 PALVKKK51 in MYMIV, PaLCuCNV and ToLCNDV and
45 PAMIKRR51 in ToLCCNV. Online prediction using, NetNES
(http://www.cbs.dtu.dk/index.shtml) revealed the presence of a
nuclear export signal (NES), 105 LEEDIIHMVDI115 towards
the carboxy terminus of BYVMDC1. A Similar sequence has
been found to be present in the C1 proteins from Okra leaf
curl virus (OLCuV, CAC87055), Cotton leaf curl virus (CLCuV,
ABA40413, CAC44025, AAX21514, AAX21495), Malvastrum
yellow vein virus (MYVV, CAH10920, CAI96762) and Ageratum yellow vein virus (AYVV, CAD89717, CAD65761 and
CAC87053). The NES of C1 associated with BYVMD has
been found to share some similarity with already characterized
NES of HIV Rev (Fischer et al., 1995; Pollard and Malim, 1998
and Rhee et al., 2000), inhibitor of protein kinase A (PKI) (Wen
et al., 1995), transcription factor III A (Fridell et al., 1996; Ward
and Lazarowitz, 1999) and BV1 of SLCV (Ward and Lazarowitz,
1999). Table 2 shows the comparison of predicted NES of C1
associated with BYVMD with other characterized NESs. Multiple alignments of these sequences clearly show the distribution
of NLS and NES among C1 proteins (data not shown). The
variation in the distribution of NLS and NES sequences among
C1 correlate with that of the diversity and geographical distribution of DNA already reported (Briddon et al., 2003; Bull et
al., 2004)

3.2. Intracellular localization of GFP

When expressed alone GFP was distributed uniformly in the
cells (Fig. 1A).
The GFPCP and GFPNLSCP fusion proteins were specifically localized to the cell nucleus (Fig. 1BD). In contrast,
the GFPC1 fusion protein was localized to the cell cytoplasm
(Fig. 1E and F). PI counter-staining was restricted to the nucleus
(Fig. 1D2, F2 and F3) and was found to co-localize with that of
GFPNLSCP fluorescence (Fig. 1D3).
3.3. Intracellular localization in yeast
Based upon the activation of the reporter gene galactosidase in the presence of pNIACP it can be concluded
that the CP is targeted into the nucleus (Fig. 3a-5). This was further confirmed by a quantitative -galactosidase assay (Fig. 2).
Furthermore, the cells harboring the CP in pNIA grew on
histidine-deficient medium (Fig. 3b-5), further confirming the
nuclear import of CP, however no nuclear export activity was
detected for CP as both the reporter gene activities (Fig. 3a3 and b-3) were similar to that of pNEA (Fig. 3a-1 and b-1).
The expression of C1 in pNIA did not show any nuclear
affinity (Fig. 3a-6) as compared to pNIA (Fig. 3a-7). However, the C1 in pNEA showed reduced -galactosidase activity (Fig. 3a-4) and HIS3 gene expression (Fig. 3b-4), which
was comparable to that of pNEA Rev (Fig. 3a-2 and b-2)
indicating the possible presence of a putative NES sequence
in C1.
3.4. Yeast-two-hybrid results
The yeast-two-hybrid data showed that both CP and C1
interact homotypically, with each other and also with tomato
karyopherin , and. The mutant NC1 was found to interact
with itself, with wild type C1 and also with tomato karyopherin
, whereas the CC1 was found to interact only with the CP.
This was revealed qualitatively by the -galactosidase activity
(Figs. 4a, 5a and b) and leucine prototrophy (Figs. 4b and 5c)

P. Kumar P. et al. / Virus Research 122 (2006) 127136

131

Fig. 1. Sub-cellular localization of GFP alone and GFP fusion proteins during transient expression in N. benthamiana. The fluorescence was visualized using confocal
microscopy. GFP fluorescence (green channel), bright field channel, and channel overlays of green channel either with red (auto fluorescence of plant tissue or PI
fluorescence) channel or with bright field channels are shown. Expression of GFP alone (Panel A1A4), GFPCP (Panel B1B4), GFPNLSCP (Panel C1C4) &
(Panel D1D4) and GFPC1 (Panel E1E4) & (Panel F1F4). Figures in Panel D and Panel F are stained with propidium iodide. Panels D2 and F2 show PI stained
nuclei. The co-localization of GFP and PI fluorescence is shown in panel D3 (channel overlay of PI fluorescence with GFP fluorescence), whereas the panel F3 did
not show any co-localization of PI with GFP. GFPC1 is localized only in the cytoplasm.

132

P. Kumar P. et al. / Virus Research 122 (2006) 127136

Fig. 2. Quantitative -galactosidase assay. pNEA (1), pNEARev (2), pNEACP

(3), pNEAC1 (4), pNIACP (5), pEGCP-pJGCP (6), pEGCP-pJGLeKAP1
(7), pEGC1-pJGC1 (8), pEGC1-pJGLeKAP1 (9), pEGCP-pJGC1
(10) pEGNC1-pJGNC1 (11), pEGNC1-pJGC1 (12), pEGNC1pJGLeKAP1 (13) and pEGCC1-pJGCP (14). Standard errors are shown
based on three independent experiments.

and was further confirmed by quantitative -galactosidase assay

(Fig. 2).
3.5. C1 transgenic plants
Expression of C1 ORF in transgenic N. benthamiana produced severe developmental abnormalities in the plant, like
distorted stem and leaf and stunting of the plant (Fig. 6a). These
symptoms were very much like those produced in N. benthamiana upon agroinfection with the infectious clones of DNA A
and DNA (Jose, 2004). The expression of the C1 ORF in
the antisense orientation did not produce any symptoms and the
plants looked normal. Northern analysis showed that variation
in the symptom severity among the transgenic plants correlated
with the quantity of mRNA (Fig. 6b). For instance the plant with
the maximum quantity of mRNA of C1 (Fig. 6b lane 3) showed
the most severe symptom.
4. Discussion
The nuclear import activity of the BYVMV CP has been
revealed by GFP localization, one-hybrid analysis and twohybrid interaction of CP with the nuclear transporter protein
tomato karyopherin (pLeKAP1). Such an activity is analogous to that of the CP of monopartite begomoviruses, like
Tomato yellow leaf curl virus TYLCV (Kunik et al., 1998;
Gafni and Epel, 2002) and the NSP of bipartite begomoviruses
(Sanderfoot and Lazarowitz, 1995; Zhang et al., 2001; Rojas
et al., 2001). It may be speculated that the CP of BYVMV is
responsible for targeting the viral DNA into the nucleus as viral
nucleoprotein complex through the nuclear pore complex. If the
BYVMVCP had a NES then we should have observed much
less fluorescence in GFPCP compared to GFPNLSCP. However, nuclear export activity was not identified for BYVMV CP,
as the expression and localization of GFPCP and GFPNLSCP
were similar (Fig. 1B and C). Moreover the pNEACP showed
activity similar to that of pNEA (Fig. 3a and b) further confirming the absence of NES in CP. Predictions using online sequence
analysis softwares PSORT and NetNES also ruled out the presence of any known NES in BYVMV CP.
The observation that GFPC1 was confined to the cell periphery and also showed nuclear exporting in the one-hybrid system

Fig. 3. One hybrid results: (a) -galactosidase assay, (b) histidine prototrophy on
minimal medium deficient for both tryptophan and histidine supplemented with
100 mM 3AT. (a) pNEA (1), pNEARev (2), pNEACP (3), pNEAC1 (4), pNIACP (5), pNIAC1 (6), and pNIA (7). (b) pNEA (1), pNEARev (2), pNEACP
(3), pNEAC1 (4), pNIACP (5).

suggests that C1 may have a nuclear export or peripheral localization function. Reports show the NES is not conserved motif
but it follow a consensus L X2-3 (F, I, L, V, M) X2-3 (L, I) X
(L, I) (Sekimoto et al., 2005). Sequence analysis revealed that
C1 has a stretch of Leu and Ile-rich region towards its C terminus: 105 LEEDIIHMVDI115 (Table 2). Possibly, this region
may be responsible for the nuclear export or cytoplasmic localization activity of C1, which needs to be further confirmed by
mutational analysis. The two-hybrid protein interaction stud-

P. Kumar P. et al. / Virus Research 122 (2006) 127136

133

Fig. 4. Two hybrid results: (a) -galctosidase assay, (b) leucine prototrophy on minimal medium deficient for, tryptophan, histidine, uracil and
leucine. (a) pEGCP-pJGCP (1), pEGCP-pJGLeKAP1 (2), pEGC1-pJGC1
(3), pEGC1-pJGLeKAP1 (4), pEGCP-pJGC1 (5), pEGLam-pJGCP (6),
pEGLam-pJGC1 (7), pEGLam-pJGLeKAP1 (8). (b) pEGCP-pJGCP (1),
pEGCP-pJGLeKAP1 (2), pEGC1-pJGC1 (3), pEGC1-pJGLeKAP1 (4),
pEGCP-pJGC1 (5).

ies showed that C1 interacts with itself, also with CP and the
tomato protein karyopherin . Since CP and C1 have nuclear
import and export functions, respectively, the interaction of CP
with C1 might be involved in the nuclear transport of the
virus analogous to the cooperative interaction of NSP and MP
of bipartite begomoviruses (Sanderfoot and Lazarowitz, 1995;
Gafni and Epel, 2002). Yeast-two-hybrid analysis of the mutant
C1 protein showed that the domain of C1 interacting with
CP is at the N terminal half whereas the domain(s) of C1
interacting with itself and karyopherin are at the C terminal
half. Karyopherins are soluble transport receptors that interact
with basic NLS sequences and help in nuclear import (Gorlich
and Kutay, 1999). The interaction of C1 with karyopherin ,
despite lacking nuclear localization needs to be explored further
to understand its significance. It may be speculated that karyopherin , which is a recycled protein, after carrying its cargo and
emptying it into the nucleus, is brought out of the nucleus by its

Fig. 5. Two hybrid results of mutant C1: (a and b) -galactosidase assay, (c)
leucine prototrophy on minimal medium deficient for, tryptophan, histidine,
uracil and leucine. (a) pEGNC1-pJGNC1 (1), pEGNC1-pJGC1
(2), pEGNC1-pJGLeKAP (3), pEGNC1-pJGCC1 (4) pEGNC1pJGCP (5) pEG Lamin C-pJGNC1 (6). (b) pEGCC1-pJGCP
(1), pEGCC1-pJGC1 (2), pEGCC1-pJGLeKAP (3), pEGCC1pJGNC1 (4), pEGCC1-pJGCC1 (5), pEG Lamin C-pJGCC1 (6).
(c) Lane pEGNC1-pJGNC1 (1), pEGNC1-pJGC1 (2), pEGNC1pJGLeKAP1 (3), pEGCC1-pJGCP (4).

134

P. Kumar P. et al. / Virus Research 122 (2006) 127136

Fig. 6. (a) N. benthamiana plants showing abnormal phenotype upon expressing the C1 gene in sense orientation. Plants expressing C1 in sense orientation (ad),
C1 in antisense orientation (e), non-transformed plants (f). (b) Northern analysis of transgenic N. benthamiana plants. Lane 1: non-transformed plant, lanes 25:
C1 sense plants, lane 6 and 7: C1 antisense plants.

interaction with C1. In healthy plants and in plants infected by

monopartite begomoviruses like some of the isolates of TYLCV
(which lack DNA and hence C1), plant exportins analogous to cellular apoptosis susceptibility (CAS)-like protein(s),
might be performing the job of bringing karyopherin out of
the nucleus (Kutay et al., 1997). Recently, it has become evident that importin s seem to have activities in the assembly
of macromolecular structures, which is distinct from its housekeeping functions (Goldfarb et al., 2004), which may explain its
interaction with C1 in yet another context. Studies on the roles
of importin s in mitosis, spindle assembly and nuclear envelope
biogenesis point more directly to activities which are independent of the housekeeping roles of importin . Genetic analyses
of yeast importin mutants identified several alleles that confer defects in chromosome, nuclear segregation, altered mitotic
spindle structure and deficits in the ubiquitin-mediated protein
degradation pathway (Yano et al., 1994; Kussel and Frasch,
1995; Loeb et al., 1995).
It has been previously demonstrated that the DNA together
with DNA A was required for the induction of typical symptoms
in the natural host okra (Jose and Usha, 2003). When expressed
in plants, C1 produced virus-like symptoms (Saunders et
al., 2004; Cui et al., 2004, 2005; Saeed et al., 2005). The
present work reporting abnormal phenotype of N. benthamiana plants transgenic for C1 in the sense but not in the anti
sense orientation is similar to the observation for the expression of the C1 associated with Ageratum yellow vein disease
(AYVD) (Saunders et al., 2004), Tomato yellow leaf curl disease
(TYLCCNDY10) (Cui et al., 2004), and Cotton leaf curl disease (CLCuD) (Saeed et al., 2005). Many of the characterized
plant viral movement proteins are shown to be pathogenicity
determinants. The expression of movement protein of bipartite begomoviruses (Pascal et al., 1993; Ingham et al., 1995;
Duan et al., 1997; Hou et al., 2000) in transgenic plants induced
viral disease-like symptoms. The cell-to-cell movement of the
monopartite begomovirus TYLCV has been proposed to be

mediated by the C4 protein (Rojas et al., 2001). It has been

shown that C4 induces the disease symptoms in transgenic plants
(Jupin et al., 1994; Krake et al., 1998; Rigden et al., 1994) and
localizes to the host cell periphery and interacts with plasmodesmata (Rojas et al., 2001). Similarly the expression of the 30 kDa
movement protein associated with Tobacco mosaic virus (Lucas
et al., 1993, 1996) or the 17 kDa movement protein of Potato
leaf roll virus (Herbers et al., 1997) induced abnormal phenotypes in the transgenic plants. The virus-like symptoms induced
by the MP of bipartite begomoviruses is assumed to be associated with the interference of MP with normal macromolecular
intercellular trafficking (Lucas, 1995; Hou et al., 2000; Gafni
and Epel, 2002). It is now well established that viral MPs are
multifunctional agents involved in many facets of viral infection,
including the formation of viral nucleo protein complex, mediating the cell-to-cell and long-distance trafficking of the viral
genome, viral RNA translation, and suppression of gene silencing (Harrison and Robinson, 2005; Kasschau and Carrington,
1998; Lucas, 2006). The functional role of C1 of BYVMD
in modulating the symptoms is presently unclear. It has been
shown that some of the gene products of RNA viruses that
induce symptoms in transgenic plants, such as the P0 protein
of poleroviruses and P19 protein of tombusviruses, also act as
suppressors of post-transcriptional gene silencing (Pfeffer et al.,
2002; Silhavy et al., 2002; van der Wilk et al., 1997). The role of
BYVMDC1 as a suppressor of posttranscriptional gene silencing is currently being explored. Preliminary evidence suggests
that the BYVMDC1 protein may have such a function.
There were significant differences in the levels of the mRNA
of C1 gene among the plants transformed with C1. The level
of expression was proportional to symptom severity. The present
data of C1 showing symptoms in the transgenic plants together
with the protein interaction and localization data suggest that
C1 might be playing some role in the movement. This needs
to be further validated by further experiments. It may thus be
concluded that functions of the NSP and MP of bipartite bego-

P. Kumar P. et al. / Virus Research 122 (2006) 127136

moviruses could be performed by the CP and C1 proteins,

respectively, of the monopartite begomovirus BYVMV, which
is associated with a DNA .
Acknowledgements
This work was supported by funding from CSIR, UGC (Centre for potential in the subject of genomic sciences), DST and
DBT of India and the MASHAV of Israel. The instrument facilities provided by DST-FIST and DBT are acknowledged. Senior
research fellowship (CSIR) and MASHAV fellowship to P.P.K.
are gratefully acknowledged. We thank Dr. V. Citovsky for
the yeast one-hybrid vectors. We thank Mr. Eddy Blasov for
technical assistance in confocal microscopy. We thank Prof. K.
Veluthambi for pGA643 and LBA4404. We are grateful to Ms. K.
Vydehi, Mr. P. Gopal and Dr. B. Sinilal for helpful discussions.
References
An, G., Ebert, P., Mitra, A., Ita, S., 1988. Binary vectors. In: Gelvin, S.B.,
Schilperoort, R.A. (Eds.), Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht/Boston/London, pp. 119 (Section A, Chapter
3).
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith,
J.A., Struhl, K., 1995. Current Protocols in Molecular Biology, vol. 1. John
Wiley & Sons Inc (Chapter 5).
Bartel, P.L., Chien, C.T., Sternglanz, R., Fields, S., 1993. Elimination of false
positives that arise in using the two-hybrid system. BioTechniques 14,
920924.
Breeden, L., Nasmyth, K., 1985. Regulation of the yeast HO gene. In: Cold
Spring Harbor Symposium on Quantitative Biology, vol. 50, pp. 643650.
Briddon, R.W., Bull, S.E., Amin, I., Idris, A.M., Mansoor, S., Bedford, I.D.,
Dhawan, P., Rishi, N., Siwatch, S.S., Abdel-Salam, A.M., Brown, J.K., Zafar,
Y., Markham, P.G., 2003. Diversity of DNA a satellite molecule associated
with some monopartite begomoviruses. Virology 312, 106121.
Bull, S.E., Tsai, W.S., Briddon, R.W., Markham, P.G., Stanley, J., Green, S.K.,
2004. Diversity of begomovirus DNA satellites of Non-malvaceous plants
in east and south east Asia. Arch. Virol. 149, 11931200.
Cha, J., Bishai, W., Chandrasegaran, S., 1993. New vectors for direct cloning of
PCR products. Gene 136, 369370.
Chen, H., Nelson, R.S., Sherwood, J.L., 1994. Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and
drug selection. BioTechniques 16 (4), 664668, 670.
Cui, X., Tao, X., Xie, Y., Fauquet, C.M., Zhou, X., 2004. A DNA associated
with tomato yellow leaf curl China virus is required for symptom induction.
J. Virol. 78 (24), 1396613974.
Cui, X., Li, G., Wang, D., Hu, D., Zhou, X., 2005. A begomovirus DNA-encoded
protein binds DNA, functions as a suppressor of rna silencing, and targets
the cell nucleus. J. Virol. 79 (16), 1076410775.
Ditta, G., Stanfield, S., Corbin, D., Helinski, D.R., 1980. Broad host range
cloning system for Gram-negative bacteria: construction of a genome bank
of Rhizobium meliloti. Proc. Natl. Acad. Sci. U.S.A. 77, 73477351.
Duan, Y.P., Powell, C.M., Purcifull, D.E., Broglio, P., Hiebert, E., 1997. Phenotypic variation in transgenic tobacco expressing mutated geminivirus
movement/pathogenicity (BC1) proteins. Mol. Plant-Microb. Interact. 10,
10651074.
Fischer, U., Huber, J., Boelens, W.C., Mattaj, I.W., Luhrmann, R., 1995. The
HIV-1 Rev activation domain is a nuclear export signal that accesses an
export pathway used by specific cellular RNAs. Cell 82, 475483.
Fridell, R.A., Fischer, U., Luhrmann, R., Meyer, B.E., Meinkoth, J.L., Malim,
M.H., Cullen, B.R., 1996. Amphibian transcription factor IIIA proteins contain a sequence element functionally equivalent to the nuclear export signal
of human immunodeficiency virus type 1 Rev. Proc. Natl. Acad. Sci. U.S.A.
93, 29362940.

135

Gafni, Y., Epel, B.L., 2002. The role of host and viral proteins in intra- and intercellular trafficking of geminiviruses. Physiol. Mol. Plant Path. 60, 231241.
Goldfarb, D.S., Corbett, A.H., Mason, D.A., Harreman, M.T., Adam, S.A., 2004.
Importin : a multipurpose nuclear-transport receptor. Trends Cell Biol. 14
(9), 505514.
Gorlich, D., Kutay, U., 1999. Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15, 607660.
Harrison, B.D., Robinson, D.J., 2005. Another quarter century of great progress
in understanding the biological properties of plant viruses. Ann. Appl. Biol.
146, 1537.
Herbers, K., Tacke, E., Hazirezaei, M., Krause, K.P., Melzer, M., Rohde, W.,
Sonnewald, U., 1997. Expression of a luteoviral movement protein in transgenic plants leads to carbohydrate accumulation and reduced photosynthetic
capacity in source leaves. Plant J. 12, 10451056.
Higgins, D., Thompson, J., Gibson, T., Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673
4680.
Hollenberg, S.M., Sternglanz, R., Cheng, P.F., Weintraub, H., 1995. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a
two hybrid system. Mol. Cell. Biol. 15, 38133822.
Hood, E.E., Gelvin, S.B., Melchers, L.S., Hoekema, A., 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2,
208218.
Hou, Y.-M., Sanders, R., Ursin, V.M., Gilbertson, R.L., 2000. Transgenic
plants expressing geminivirus movement proteins: abnormal phenotypes and
delayed infection by Tomato mottle virus in transgenic tomatoes expressing the Bean dwarf mosaic virus BV1 or BC1 proteins. Mol. Plant-Microb.
Interact. 13, 297308.
Ingham, D.J., Pascal, E., Lazarovitz, S.G., 1995. Both bipartite geminivirus
movement proteins define viral host range, but only BL1 determines viral
pathogenicity. Virology 207, 191204.
Jose, J., Usha, R., 2003. Bhendi yellow vein mosaic disease in India is caused by
association of a DNA satellite with a begomovirus. Virology 305, 310317.
Jose, J., 2004. Molecular Characterization of Bhendi yellow vein mosaic virus,
Ph.D. Thesis, Madurai Kamaraj University, Madurai.
Jupin, I., De Kouchkovsky, F., Jouanneau, F., Gronenborn, B., 1994. Movement
of tomato yellow leaf curl geminivirus (TYLCV): involvement of the protein
encoded by ORF C4. Virology 204, 8290.
Kaiser, C., Michaelis, S., Mitchell, A., 1994. Methods in Yeast Genetics. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Krake, L.R., Rezaian, M.A., Dry, I.B., 1998. Expression of the tomato leaf curl
geminivirus C4 gene produces viruslike symptoms in transgenic plants. Mol.
Plant-Microb. Interact. 11, 413417.
Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V., Gafni, Y., 1998. Nuclear
import of the Capsid protein of Tomato yellow leaf curl virus (TYLCV) in
plant and insect cells. Plant J. 13 (3), 393399.
Kunik, T., Mizrachy, L., Citovsky, V., Gafni, Y., 1999. Characterization of tomato
karyopherin a that interacts with the Tomato yellow leaf curl virus (TYLCV)
capsid protein. J. Exp. Bot. 50, 731732.
Kasschau, K.D., Carrington, J.C., 1998. A counterdefensive strategy of plant
viruses: suppression of posttranscriptional gene silencing. Cell 95, 461470.
Kussel, P., Frasch, M., 1995. Yeast Srp1, a nuclear protein related to Drosophila
and mouse pendulin, is required for normal migration, division, and integrity
of nuclei during mitosis. Mol. Gen. Genet. 248, 351363.
Kutay, U., Bischoff, F.R., Kostka, S., Kraft, R., Gorlich, D., 1997. Export of
importin from the nucleus is mediated by a specific nuclear transport
factor. Cell 90, 10611071.
la Cour, T., Kiemer, L., Mlgaard, A., Gupta, R., Skriver, K., Brunak, S., 2004.
Analysis and prediction of leucine-rich nuclear export signals. Protein Eng.
Des. Sel. 17 (6), 527536.
Llave, C., Kaschau, K.D., Carrington, J.C., 2000. Virus encoded suppressor of
post transcriptional gene silencing targets a maintenance step in the silencing
pathway. Proc. Natl. Acad. Sci. U.S.A. 97, 1340113406.
Loeb, J.D.J., Schlenstedt, G., Pellman, D., Kornitzer, D., Silver, P.A., Fink, G.R.,
1995. The yeast nuclear import receptor is required for mitosis. Proc. Natl.
Acad. Sci. U.S.A. 92, 76477651.

136

P. Kumar P. et al. / Virus Research 122 (2006) 127136

Lucas, W.J., 1995. Plasmodesmata: intercellular channels for macromolecular

transport in plants. Curr. Opin. Cell Biol. 7, 673680.
Lucas, W.J., 2006. Plant viral movement proteins: agents for cell-to-cell trafficking of viral genomes. Virology 344, 169184.
Lucas, W.J., Balachandran, S., Park, J., Wolf, S., 1996. Plasmodesmal companion cell-mesophyll communication in the control over carbon metabolism
and phloem transport: insight gained from viral movement proteins. J. Exp.
Bot. 47, 11191128.
Lucas, W.J., Olesinski, A., Hull, R.J., Haudenshield, J.S., Deom, C.M., Beachy,
R.N., Wolf, S., 1993. Influence of the tobacco mosaic virus 30 kDa protein
on carbon metabolism and photosynthate partitioning in transgenic tobacco
plants. Planta 190, 8896.
Nakai, K., Horton, P., 1999. PSORT: a program for detecting the sorting signals
of proteins and predicting their sub-cellular localization. Trends Biochem.
Sci. 24 (1), 3435.
Notredame, C., Higgins, D., Heringa, J., 2000. T-coffee: a novel method for
multiple sequence alignments. J. Mol. Biol. 302, 205217.
Palanichelvam, K., Kunik, T., Citovsky, V., Gafni, Y., 1998. The capsid protein
of Tomato yellow leaf curl virus binds cooperatively to single stranded DNA.
J. Gen. Virol. 79, 28292833.
Pascal, E., Goodlove, P.E., Wu, L.C., Lazarowitz, S.G., 1993. Transgenic tobacco
plants expressing the geminivirus BL1 protein exhibit symptoms of viral
disease. Plant Cell 5, 795807.
Pfeffer, S., Dunoyer, P., Heim, F., Richards, K.E., Jonard, G., Ziegler-Graff, V.,
2002. P0 of Beet western yellows virus is a suppressor of posttranscriptional
gene silencing. J. Virol. 76, 68156824.
Pollard, V.W., Malim, M.H., 1998. The HIV-1 Rev protein. Ann. Rev. Microb.
52, 491532.
Radian-Sade, S., Perl, A., Edelbaum, O., Kuznetsova, L., Gafny, R., Sela1, I.,
Edna, T., 2000. Transgenic Nicotiana benthamiana and grapevine plants
transformed with grapevine virus A (GVA) sequences. Phytoparasitica 28
(1), 18.
Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C., Citovsky, V., 2000. A genetic system
for detection of protein nuclear import and export. Nat. Biotech. 18, 433437.
Rigden, J.E., Krake, L.R., Rezaian, M.A., Dry, I.B., 1994. ORF C4 of tomato
leaf curl geminivirus is a determinant of symptom severity. Virology 204,
847850.
Rojas, M.R., Jiang, H., Salati, R., Xoconostle-Casares, B., Sudarshana, M.R.,
Lucas, W.J., Gilbertson, R.L., 2001. Functional analysis of proteins involved
in movement of the monopartite Begomovirus. Tomato yellow leaf curl virus.
Virology 291, 110125.
Saeed, M., Behjatnia, S.A.A., Mansoor, S., Zafar, Y., Hasnain, S., Rezaian,
M.A., 2005. A single complementary-sense transcript of a geminiviral DNA
satellite is determinant of pathogenicity. Mol. Plant-Microb. Interact. 18
(1), 714.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual,

third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
USA.
Sanderfoot, A.A., Lazarowitz, S.G., 1995. Cooperation in viral movement: the
geminivirus BL1 movement protein interacts with BR1 and redirects it from
the nucleus to the cell periphery. Plant Cell 7, 11851194.
Saunders, K., Bedford, I.D., Briddon, R.W., Markham, P.G., Wong, S.M., Stanley, J., 2000. A unique virus complex causes ageratum yellow vein disease.
Proc. Natl. Acad. Sci. U.S.A. 97, 68906895.
Saunders, K., Norman, A., Gucciardo, S., Stanley, J., 2004. The DNA beta
satellite component associated with ageratum yellow vein disease encodes
an essential pathogenicity protein (C1). Virology 324 (1), 3747.
Sekimoto, J., Katahira, J., Yoneda, Y., 2005. Nuclear import and export signals.
In: Tzfira, T., Citovsky, V. (Eds.), Nuclear Import and Export in Plants and
Animals. Kluwer Academic/Plenum Publishers, N.Y., U.S.A. (Chapter 4).
Silhavy, D., Molnar, A., Lucioli, A., Szittya, G., Hornyik, C., Tavazza, M.,
Burgyan, J., 2002. A viral protein suppresses RNA silencing and binds
silencing-generated, 21- to 25-nucleotide double-stranded RNAs. EMBO
J. 21, 30703080.
Ullman, K.S., Powers, M.A., Forbes, D.J., 1997. Nuclear export receptors: from
importin to exportin. Cell 90, 967970.
van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.-P., Pereira, A., Stiekema,
W.J., 1995. pBINPLUS: an improved plant tranformation vector based on
pBIN 19. Transgenic Res. 4, 288290.
van der Wilk, F., Houterman, P., Molthoff, J., Hans, F., Dekker, B., van den
Heuvel, J., Huttinga, H., Goldbach, R., 1997. Expression of the potato leafroll
virus ORF0 induces viral-disease-like symptoms in transgenic potato plants.
Mol. Plant-Microb. Interact. 10, 153159.
Ward, B.M., Lazarowitz, S.G., 1999. Nuclear export in plants: use of geminivirus movement proteins for a cell-based export assay. Plant Cell 11, 1267
1276.
Wen, W., Meinkoth, J.L., Tsien, R.Y., Taylor, S.S., 1995. Identification of
a signal for rapid export of proteins from the nucleus. Cell 82, 463
473.
Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning
vectors and host strains: nucleotide sequences of the M13mp18 and pUC19
vectors. Gene 33, 103119.
Yano, R., Oakes, M.L., Tabb, M.M., Nomura, M., 1994. Yeast Srp1p has homology to armadillo/plakoglobin/beta-catenin and participates in apparently
multiple nuclear functions including the maintenance of the nucleolar structure. Proc. Natl. Acad. Sci. U.S.A. 91, 68806884.
Zhang, S.C., Wege, C., Jeske, H., 2001. Movement proteins (BC1 and BV1) of
Abutilon mosaic geminivirus are co-transported in and between cells of sink
but not of source leaves as detected by green fluorescent protein tagging.
Virology 290, 249260.