ly
platforms) are in the developmental phase (for Received for publication: 17 November 2009.
research purposes only) and although they
on
Revision received: 1 March 2010.
have a higher throughput capacity and elegant Accepted for publication: 3 March 2010.
design, their overall assay cost represents a
Abstract heavy burden for national health care screen- This work is licensed under a Creative Commons
e
Attribution 3.0 License (by-nc 3.0).
ing programs.9-15 Of additional concern is that
This paper describes the technical and ana-
lytical performance of a novel set of hybridiza-
tion probes for the four GARDASIL® vaccine-
us
most of the world’s population does not have
access to the equipment required to perform
current HPV typing procedures.16 Encouraging
©Copyright I. Brukner et al., 2010
Licensee PAGEPress, Italy
Journal of Nucleic Acids Investigation 2010; 1:e3
al
relevant HPV types (6, 11, 16 and 18). These efforts have been made by PATH-QIAGEN to doi:10.4081/jnai.2010.e3
probes are obtained through in vitro selection introduce screening assays to developing
ci
from a pool of random oligonucleotides, rather countries.17 However, a robust typing assay still
In this work we hypostatize that: (a) select-
er
than the traditional “rational design” approach does not exist. At the heart of this problem is a
typically used as the initial step in assay devel- ed probes19 do have robust performance (toler-
dominant technological and scientific hurdle
ate 8-10°C operative range) and preserve ana-
m
opment. The type-specific segment of the HPV imposed by the current limited understanding
genome was amplified using a GP5+/6+ PCR lytical sensitivity of 1,000 genome equivalents
of the specificity of nucleic acid interactions.
of HPV in the context of 10,000 (or less) of
om
selected hybridization probes was demonstrat- vitro selection procedures to generate oligonu-
ed by monitoring the preservation of the speci- (either 6, or 11, or 16, or 18) and did not show
cleotide probes with type-specific resolution.
any cross-hybridization with any of the
on
ficity and sensitivity of the typing assay over all Hybridization probes, empirically obtained
39 HPV types, using a different spectrum of remainder 38 HPV types, for which counter-
through selection, are used to build a novel
HPV (genome equivalent: 103-109) and human selection was performed.
hybridization assay that is applicable to a num-
N
DNA concentrations (10-100 ng) as well as ber of different platforms. The assay uses well-
temperature and buffer composition varia- described GP5+/6+ HPV PCR21,22 with minor
tions. To the Authors’ knowledge, this is a modifications.19 After amplicon conversion to
unique hybridization-based multiplex typing the single stranded form, hybridization with
Materials and Methods
assay. It performs at ambient temperatures, type-specific probes is performed. Assay per-
does not require the strict temperature control formance is further analytically tested under Oligonucleotides
of hybridization conditions, and is functional varying conditions: a different HPV copy num- The oligonucleotides were synthesized by
with a number of different non-denaturing ber within the context of human DNA and a Integrated DNA Technologies (Coralville, Iowa,
buffers, thereby offering downstream compati- range of temperatures under which robust USA). Targets were 139-148 nucleotide-long,
bility with a variety of detection methods. hybridization and washing may typically be type-specific segments (GP5+ strands) of
Studies aimed at demonstrating clinical per- performed. To the Authors’ knowledge, this is a GP5+/6+ amplicons, located between positions
formance are needed to validate the applicabil- unique hybridization-based multiplex typing 6624 and 6765 of the HPV16 sequence (acces-
ity of this strategy. assay that does not require temperature-con- sion number K02718). The 5’ block TTC-
trolled hybridization conditions. Due to the GACAGGAGGCTCACAACAGGC and 3’ block
inherent features of selected probes, the TGGGAGACAAGAATA AACGCTCAA were used
hybridization assay is operative within differ- to “block” the anchoring segments of the
Introduction ent (non-denaturing) buffers. That feature probes. The forward GP5+ primer has been pre-
might provide downstream compatibility with viously described20 and a mixture of 4 oligonu-
The HPV vaccination era calls for new stan- a number of different detection techniques. cleotides was used as a reverse GP6+ primer:
GAAAAATAAACTGTAAATCATATTC,
GAAAAATAAACTGTAAATCATACTC,
GAAAAATAAACTGTAAATCAAATTC and
GAAAAATAAACTGTAAATCAAACTC.19 The uni-
versal HPV probe (UP) sequence was:
GAAAAATAAACTGTAAATCATATTCCTCCACAT-
GTCTTATATATTCCTTAAA. All type-specific
probes were obtained using an in vitro selec-
tion procedure (Figure 1). The selected probes
used in this assay were: i) for HPV 6: 5’GCCT-
GTTGTGAGCCTCCTGTCGAAGGAAGATGTAG-
GTAGGGATCGA TTGAGCGTTTATTCTTGTCTC-
CCA3’; ii) for HPV11: 5’GCCTGTTGTGAGCCTC-
CTGTCGAATTAGTGTATGTAGCATGCGACA
TTGAGCGTTTATTCTTGTCTCCCA3’; iii) for
HPV16: 5’GCCTGTTGTGAGCCTCCTGTCGAA
GATCGGGAAGTAGATATGGCGC TTGAGCGTT-
TATTCTTGTCTCCCA3’; iv) for HPV 18: 5’GC-
CTGTTGTGAGCCTCCTGTCGAA GAGACAGGTA- Figure 1. Iterative hybridizations. Methodology used for the selection of probes (modi-
GAAGGGCCCAGG TTGAGCGTTTATTCTTGTCT fied from18). The technique involves five forward hybridizations (steps 1-3) to generate
CCCA3’. pools of probes with significant affinity, but not necessarily specificity, for the target.
ly
Specificity is then achieved during subtractive hybridization steps (steps 4-6) where only
probes having a differential diagnostic performance are retained. Iterative hybridizations,
DNA extraction
on
cloning, sequencing and testing of the performance of selected probes can all be fully
Human DNA used for spiking experiments automated. Intended and non-intended targets, probes and complexes between them are
was extracted from blood (QIAamp DNA tubes, shown in the legend (see below). Note that the intended targets are attached to the solid
support, while non-intended targets are free in solution and present only in subtractive
Qiagen, Mississauga, Ont., Canada), while the
e
hybridization steps.
concentration was measured using NanoDrop
(NanoDrop ND-1000, Wilmington, Del., USA)
and DNA integrity was validated on 0.7%
agarose gel.
Membrane us
Streptavidine-coated Promega membrane
peratures (22±2°C). To analyze the effect of
temperature variation, hybridization was also
al
(SAM, Biotin Capture Membrane, Medison, carried out at fixed temperatures (Figure 3).
Wisc., USA) was used in the following manner. The membrane was washed with hybridization
ci
HPV universal probe (UP) was spotted on the Shelton, Conn., USA) for 10-30 min and read
cation, which was present in the original pro- by Cyclone software (OptiQuant, version 4.00,
membrane and dried at ambient temperature
tocol,20 especially in the cases where the copy for 5 min. The membrane was washed in H2O Packard Instrument Co., Boston, Mass., USA).
number of HPV targets was below 1,000 HPV
-c
Scientific) for 1-12 h at 55°C. The membrane The performance of a new generation of
Conversion of PCR product to sin- was either stored at room temperature (for as HPV-type specific hybridization probes is pre-
gle-stranded (ss) DNA and labeling long as four days) or immediately used for sented. They were obtained using in vitro
The rest of the PCR mix (40 mL) was digest- hybridization assay. selection as opposed to rational and computer-
ed for 15 min at 37°C with Exonuclease I (New assisted in silico design and optimization. A
England Biolabs Ltd., Pickering, Ont., Canada) Labeling set of such probes for 39 HPV types has been
to remove excess primers following enzyme previously obtained.19 Briefly, selection from
Labeling (SA, specific activity of 105-106
inactivation (20 min, 85°C). Lambda exonucle- the random pool of probes was composed of 5
cpm/pmol) of 2-20 pmol of single-stranded PCR
ase (New England Biolabs Ltd., Pickering, preparative hybridization steps (Figure 1,
product and/or an oligonucleotide was per-
Canada) was used (15 min, 37°C) to remove a Steps 1 to 3) using the intended type-specific
formed using 5 mL of [g-32P] ATP (6000
GP6+ PCR strand, followed by an enzyme inac- HPV target, followed by 3 subtractive hybridiza-
Ci/mmol) and 1 mL of T4 polynucleotide
tivation step (20 min, 85°C). The sample was tion steps (Figure 1, Steps 4 to 6). During sub-
kinase, following the manufacturer’s recom-
passed through a Sephadex G-25 (GE tractive steps, the remaining 38 non-intended
mendations (Invitrogen, Burlington, Ont.,
Healthcare Life Science, Baie d'Urfé, Quebec, targets were added into the hybridization mix.
Canada).
Canada) for buffer exchange reaction compat- The selected probes were cloned, sequenced,
ibility with a downstream T4 polynucleotide chemically synthesized and tested for their
Hybridization specificity.19 Here, the focus was on 4 vaccine-
kinase (Invitrogen, Burlington, Ont., Canada) Hybridization was carried out in the
labeling step. relevant HPV-types. The assay format, includ-
hybridization buffer for 1-12 h, at ambient tem- ing the 4 corresponding probes, was dictated
ly
even in an extremely high concentration of
HPV amplicons, indicates high specificity of
on
the selected probes.
Second, the sensitivity of the assay was test-
ed using PCR amplified targets in the context
e
of 10 and 100 ng of human DNA (Figure 2)
approximating clinical samples in the range of
103-104 human genome equivalents. While esti-
mating assay sensitivity, we used terminology
us
al
of minimal numbers of required genome
equivalents per reaction mix. This term would
ci
human DNA (Figure 2A-C). For example, sam- ical samples: mixed infections produced high- range” primer sets. The roots of both problems,
ples having 10:1 and 1:1 ratios between HPV ly disconcordant typing results among a variety stemmed from an insufficient knowledge of
and human genome equivalents produced of assays.8 sequence-dependent interactions among
-c
clear patterns (Figure 2 A and B). However, a To evaluate the robustness of the assay, nucleic acids. The second technical problem
1:10 ratio between HPV and human genome hybridization was carried out at different tem- caused significant non-concordance among
on
copies produced noise in the hybridization pat- peratures in the range of 20-35°C (Figure 3). different typing assays, when reporting double
terns (Figure 2C). The 100 copies of HPV in The hybridization buffer was changed from the or multiple HPV infections, “probably due to
the context of 1,000 human genome equiva- one previously used19 for the selection of HPV the differences in the affinities of the primer
N
lents were not amplified well enough to be typing probes (10 mM Tris-HCl, pH 7.5, 10 mM sets for the different HPV types”.8 Therefore,
detected. These results reflect the present lim- MgCl2 and 50 mM NaCl) to the one described clinical validations of a range of primer
its of assay sensitivity, which are related to the in the Methods section in order to better fit the designs14 and improved amplification proce-
present limits of PCR sensitivity. membrane-based hybridization requirements. dures or pre-PCR sample enrichments12 are
Clinical samples, which were previously necessary.
genotyped by RFLP analysis using the MY The 4 selected probes (6,11,16 and 18) were
09/MY 11 primer set, were analyzed (Figure 2 tested against 39 different HPV types under
D). RFLP vs. hybridization assay produced the Discussion defined conditions (presented as hypotheses
same typing data when single infections were (a); see above). Only intended target
considered. When multiple infections were HPV typing using multiplex hybridization sequences showed hybridization signal, while
simulated (equimolar quantities of 2-4 tar- assays is facing two distinct technical issues. the rest of non-intended targets did not show
gets), the PCR amplified oligonucleotide tar- The first one concerns cross-hybridization any detectable cross-hybridization. The signal
gets produced type-specific signals of uneven among non-intended targets. As shown by the had a minimum 10 times stronger P32 number
intensity (data not shown). However, when present evaluation of the sensitivity, specifici- of counts per minutes than background, over
hybridization was carried out without interme- ty and robustness of our HPV typing assay to the same membrane surface. The visual pres-
diate PCR amplification, the hybridization pat- detect 4 GARDASIL®-relevant HPV types (6, 11, entation of autoradiography of membranes
terns were proportional to the concentration of 16 and 18), this issue was successfully (Figures 2 and 3) illustrates typical signal-
input multiple target templates (again equi- resolved. The second technical issue is more noise ratio. Non-intended targets (all 38) did
molar quantities of 2-4 targets). A similar general: an amplification bias caused by the not show any cross-hybridization with 4 select-
ly
mercial HPV typing assays where small varia- analysis of HPV DNA viral load in HPV16, Oncol 2008;9:929-36.
tions of 1-2ºC lead to cross-hybridization or HPV18 and HPV33 E6/E7 mRNA positive
on
18. Brukner I, El-Ramahi R, Gorska-Flipot I, et al.
loss of sensitivity.23,24 specimens. J Virol Methods 2009;155:61-6. An in vitro selection scheme for oligonu-
The assay performance was well tolerated 5. van Ham MA, Bakkers JM, Harbers GK, et al. cleotide probes to discriminate between
using 2 different hybridization buffers. This Comparison of two commercial assays for
e
closely related DNA sequences. Nucleic Acids
inherent feature of selected probes is impor- detection of human papillomavirus (HPV) in Res 2007;35:e66.
tant, considering different buffer require-
ments of enzyme-driven colorimetric reactions
that could eventually be applied here to detect
us
cervical scrape specimens: validation of the
Roche AMPLICOR HPV test as a means to
screen for HPV genotypes associated with a
19. Brukner I, El-Ramahi R, Sawicki J, et al.
Hybridization assay performed at ambient
temperature for typing high-risk human
al
a specific hybridization event. higher risk of cervical disorders. J Clin
papillomaviruses. J Clin Virol 2007;39:113-8.
The attractive use of this type of assay in Microbiol 2005;43:2662-7.
ci
cation (Biohelix, US) combined with chro- al. Evaluation of the SPF10-INNO LiPA
ic oligonucleotide probes for high-resolution
matographic hybridization detection human papillomavirus (HPV) genotyping
DNA typing. Nat Protoc 2007;2:2807-14.
m
(ChemBio Diagnostics), offering a hands off, test and the Roche linear array HPV genotyp-
21. de Roda Husman AM, Walboomers JM, van
instruments off, simple, multiplex, point-of- ing test. J Clin Microbiol 2006;44: 3122-9.
den Brule AJ, et al. The use of general
om
care diagnostic test. 7. Quint WG, Pagliusi SR, Lelie N, et al. Results
primers GP5 and GP6 elongated at their 3'
It is clear that the current form of the assay of the first world health organization interna-
would need to address a combination of add ends with adjacent highly conserved
tional collaborative study of detection of
sequences improves human papillomavirus
-c
tional optimization factors to achieve required human papillomavirus DNA. J Clin Microbiol
sensitivity, while switching from P32 to colori- 2006;44:571-9. detection by PCR. J Gen Virol 1995;76:1057-
on
value was introduced in 1990 by Tuerk, Gold, prevalence. J Clin Microbiol 2008;46:1606-13. PCR-enzyme immunoassay method for rapid
Ellington and Szostak.25,26 The demonstrated 9. Dalstein V, Merlin S, Bali C, et al. Analytical detection of 14 high-risk and 6 low-risk
robustness of hybridization probes under vari- evaluation of the PapilloCheck test, a new human papillomavirus genotypes in cervical
ous “environmental conditions” represents an commercial DNA chip for detection and scrapings. J Clin Microbiol 1997;35:791-5.
unexpected result. It seems that selection-cap- genotyping of human papillomavirus. J Virol 23. Steinau M, Swan DC, Unger ER. Type-specif-
tured molecular determinants in probe-target Methods 2009;156:77-83. ic reproducibility of the Roche linear array
complexes are only those that are consistently 10. Jiang HL, Zhu HH, Zhou LF, et al Genotyping HPV genotyping test. J Clin Virol 2008;42:412-
preserved under imposed conditions of selec- of human papillomavirus in cervical lesions 4.
tion. This feature is very useful and should by L1 consensus PCR and the Luminex xMAP 24. Stevens MP, Garland SM, Tabrizi SN. Human
encourage the development of a fast and auto- system. J Med Microbiol 2006;55:715-20. papillomavirus genotyping using a modified
matic generation of diagnostic probes. 11. Klaassen CH, Prinsen CF, de Valk HA, et al. linear array detection protocol. J Virol
Based on the overall results, it can be con- DNA microarray format for detection and Methods 2006;135:124-6.
cluded that the in vitro selection of hybridiza- subtyping of human papillomavirus. J Clin 25. Ellington AD, Szostak JW. In vitro selection of
tion probes is a valuable technological choice Microbiol 2004;42:2152-60. RNA molecules that bind specific ligands.
for engineering multiplex robust point-of-care 12. Nazarenko I, Kobayashi L, Giles J, et al. A Nature 1990;346;818-22.
diagnostic assays. Further studies aimed at novel method of HPV genotyping using 26. Tuerk C and Gold, L. Systematic evolution of
avoiding amplification bias are needed to illus- Hybrid Capture sample preparation method ligands by exponential enrichment: RNA lig-
trate the universal clinical applicability of combined with GP5+/6+ PCR and multiplex ands to bacteriophage T4 DNA polymerase.
these types of molecular detection assay. detection on Luminex XMAP. J Virol Methods Science 1990;249: 505-10.