Anda di halaman 1dari 5

FTC Faculdade de Tecnologia e Cincias

Curso: Bacharelado em Nutrio


Docente: Jussara Silveira

Disciplina: Biologia Geral e Histologia


Semestre: I

ATVIDADE PRTICA
Duplicao, Transcrio e Traduo do DNA
1. Analise o esquema ao lado que caracteriza a estrutura do DNA. Os algarismos 1, 2 e 3 representam,
respectivamente:
a) base nitrogenada, desoxirribose e fosfato.
b) base nitrogenada, fosfato e desoxirribose.
c) fosfato, desoxirribose e base nitrogenada.
d) fosfato, base nitrogenada e desoxirribose.
e) desoxirribose, fosfato e base nitrogenada.
2. O esquema seguinte representa duas cadeias de cidos nucleicos. Aps observ-lo, analise as afirmativas
e assinale a correta.

a) I e II correspondem a duas molculas de RNA.


b) I corresponde a uma cadeia de ADN e II a uma cadeia de RNA.
c) I e II correspondem a duas cadeias de uma molcula de ADN.
d) I e II correspondem a duas cadeias de uma molcula de RNA.
e) I corresponde a uma cadeia de RNA e II a uma cadeia de ADN.
3. A respeito dos cidos nuclicos (DNA e RNA) podemos afirmar que:
a) a pentose do DNA a ribose.
b) a uracila a base nitrogenada exclusiva do DNA.
c) gene um segmento de RNA capaz de produzir protena.
d) durante a transcrio, os dois segmentos do DNA permanecem ativos.
e) a duplicao do DNA dita semiconservativa porque cada novo DNA conserva metade do DNA antigo.
4. Analise as proposies abaixo sobre o cido nuclico chamado de DNA:
I. A troca de uma nica base na molcula de DNA leva, obrigatoriamente, substituio de um aminocido na cadeia
polipeptdica correspondente.
II. A duplicao do DNA ocorre de maneira semiconservativa.
III. A DNA polimerase uma enzima especial que est diretamente envolvida na duplicao da molcula de DNA.
Das proposies acima, esto corretas
a) II, apenas.
b) I e II, apenas.

c) I e III, apenas.
d) II e III, apenas.

e) I, II e III.

5. (UFPE_Modificada) Aps observar a imagem ao lado, analise as proposies a seguir:


I. Em 1, o DNA est acoplado a uma cadeia de RNA, dando incio ao processo de
sntese de protenas.
II. Em 2, a dupla cadeia de nucleotdeos do DNA apresenta uma regio de
separao, com rompimento de pontes de hidrognio.
III. A RNA polimerase a enzima responsvel pela replicao do RNA.
IV. Em 3, exemplificada a formao de uma molcula de RNAm, contendo
informaes transcritas a partir do DNA.
V. Uma molcula de DNA com a seqncia de bases GCGTATTAT produzir um
RNAm com a seqncia de bases: CGCCAUAAUA.
Das proposies acima, esto corretas
a) I, II e III, apenas.
b) II, IV e V, apenas.

c) III, IV e V, apenas.
d) I, II, IV e V, apenas.

e) I, II, III, IV e V.

6. (UFSM-RS_Modificada) Os seres vivos possuem macromolculas chamadas de cidos nucleicos que


coordenam as todas atividades metablicas existentes, bem como a transmisso das caractersticas
genticas. Baseando-se em seu conhecimento sobre esses cidos, numere a 2. coluna de acordo com a 1.
Coluna 1
1 DNA
2 RNA

(
(
(
(
(
(

Coluna 2
) Dupla hlice
) Ribose
) Fita nica ou simples
) Desoxirribose
) Bases nitrogenadas: adenina, guanina, citosina, timina.
) Bases nitrogenadas: adenina, guanina, citosina, uracila.

A sequncia correta de cima para baixo :


a) 1 2 1 2 2 1
c) 1 1 2 2 2 1
b) 2 1 1 2 2 2
d) 2 1 2 1 1 2

e) 1 2 2 1 1 2

7. (UFU-MG) Na medicina moderna, drogas conhecidas como anti-sense tm sido utilizadas com sucesso no
bloqueio da expresso de genes indesejveis. Essas drogas so, na realidade, seqncias de nucleotdeos de
RNA que tm complementaridade de bases com o RNAm. Esses nucleotdeos (anti-sense), ligam-se ao RNAm,
no citoplasma, impedindo a expresso gnica. Baseando-se na afirmativa anterior, marque a seqncia
correta da droga anti-sense, para o seguimento gnico hipottico: ATATGCAGCAGTATG
a) AUAUGCAGCAGUAUG
b) ATATGCAGCAGTATG

c) TATACGTCGTCATAC
d) UAUACGUCGUCAUAC

e) TATACGUGCUCATAC

8. Considere as seguintes etapas da sntese de protenas:


I. Produo do RNA mensageiro a partir do DNA nuclear.
II. Ligao do RNA mensageiro aos ribossomos, formando os polirribossomos.
III. Produo de protenas a partir da ligao dos cdons de RNA mensageiro aos anticdons correspondentes.
As etapas I e III so denominadas, respectivamente:
a) traduo e fixao.
c) traduo e replicao.
b) autoduplicao e traduo.
d) transcrio e traduo.

e) traduo e transcrio.

9. Foi demonstrado experimentalmente que a maioria das sequncias altamente repetitivas de DNA de
cromossomos eucariotos no so transcritas. O que isto indica a respeito da funo deste tipo de DNA?

10. O jonal Folha de So Paulo (23/09/2002) notificou que um cientista espanhol afirmou ter encontrado
protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstruir o DNA desses animais.
a) Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma seqncia de DNA,
obtm-se uma protena.

b) A partir de uma protena, possvel percorrer o caminho inverso e chegar seqncia de DNA que a gerou?
Justifique.

11. Se uma partcula viral contivesse uma dupla fita de DNA com 2000 mil pares de bases, quantos
nucleotdeos estariam presentes? Quantas espirais completas ocorriam? Qual seria o comprimento da
configurao do DNA do vrus?

12. Num organismo diplide um pesquisador verificou que uma molcula de DNA continha 22% de GUANINA.
Com base nesta informao, possvel determinar qual o percentual de cada uma das outras bases? Se sim,
que percentagem? Se no, por qu?

13. Um vrus, cujo material consiste de uma fita de RNA, tem aproximadamente 22% de seus RNA
nucleotdeos consistindo de URACIL. Qual a frequncia de ADENINA?

14. O DNA da bactria Bacillus hipoteticus tem um contedo de T + C de 46%. Qual o contedo de cada uma
das quatro bases?

15. No sorgo, um determinado alelo apresenta a seguinte seqncia de bases:


Exon 1
Intron 1
Exon 2
Intron 2
Exon 3
5 ATG AAT GAT CAC CGA ACG CCC AGA ATT CCA GGC TAA AGC TGC TAG C3
3 TAC TTA CTA GTC GCT TGC GGG TCT TAA GGT CCG ATT TCG ACG ATC G5
A fita sense dessa molcula tem a timina como primeira base na posio 3, a partir desse pergunta-se:
a) Qual a seqncia de bases do RNAm precursor?

b) Qual a seqncia de bases do RNAm maduro?

c) Qual o nmero e a seqncia de aminocidos que formaro esta protena?

16. Considere o seguinte segmento de fita de DNA: 3' AAAGAACGATGATTTCGGATT 5'


a) Qual a sequncia de bases do RNAm correspondente?

b) Quantos tRNAs sero utilizados na sntese?

c) Quais os anti-cdons dos tRNAs acima considerados?

d) Quantos aminocidos podero ser codificados?

e) Qual a sequncia de aminocidos codificados?

f) Considere que esta sequncia sofra splicing e que os introns ocorram a cada 2 cdons no hnRNA, quais seriam as
respostas para as perguntas acima?
fa)

fb)

fc)

fd)

fe)

17. Suponha a seguinte fita de DNA: 5 A T G C C G A C G T A T C A G T A A 3


3 T A C G G C T G C A T A G T C A T T 5. Responda:
a) Qual a fita de RNAm maduro?

b) Qual a seqncia de aminocidos?

c) Se a 6 base da fita na direo 3-5 fosse substituda por T, o que ocorreria com a protena?

d) Se a 8 da mesma fita citada no item anterior fosse substituda por T o que ocorreria?

e) se for adicionado erradamente durante a replicao do DNA, o par AT, entre o quinto e o sexto par de bases, qual
seria a seqncia de aminocidos na protena?

Fonte <http://disciplinex.files.wordpress.com/2008/10/codigo.gif>.