Anda di halaman 1dari 9

Cardiovasc Drugs Ther (2012) 26:457465

DOI 10.1007/s10557-012-6415-z

Allicin Ameliorates Cardiac Hypertrophy and Fibrosis


through Enhancing of Nrf2 Antioxidant Signaling Pathways
Xian-Hui Li & Chun-Yan Li & Zhi-Gang Xiang &
Jian-Jun Hu & Jiang-Ming Lu & Rong-Bo Tian & Wei Jia

Published online: 19 September 2012


# Springer Science+Business Media, LLC 2012

Abstract
Aim To evaluate the protective effects of allicin on Ang IIinduced cardiac hypertrophy.
Methods SpragueDawley male rats were randomized into 3
groups:1)sham group (saline)(n012), 2) Ang II group(n09),
3) allicin group (Ang II + allicin)(n09). They received infusions of either saline or Ang II (250 ng/kg body weight per
min) through mini-osmotic pumps implanted subcutaneously
for 2 weeks and given a diet containing 180 mg/kg/day of
allicin for 8 consecutive weeks. Hemodynamic, morphological, histological, and biochemical changes were evaluated at
corresponding time points.
Results Ang II infusion increased blood pressure, heart
rate and heart weight to body weight ratio, and resulted
in anatomical and functional changes, such as increased
LV mass, posterior wall thickness and LV end-diastolic
diameter, and decreased fractional shortening and EF
compared with sham rats. Nrf2 and HO-1 in the hearts
of rats in the Ang II group were moderately elevated at
both mRNA and protein levels compared to sham group
mice, but NQO1 and-GCS were significantly lower.
GPx activities, levels of GSH and T-AOC in the hearts
of the rats in the Ang II group were also significantly
lower, and the levels of TBARS, reactive oxygen species and protein carbonyl were significant increased.
This work was supported by the grants (no. JSU-CX-2010-38) from
the college students research learning and innovative experiment plan
project of JiShou University and Office of Science and Technology of
Xiangxi autonomous region.
X.-H. Li (*) : C.-Y. Li : Z.-G. Xiang : J.-J. Hu : J.-M. Lu (*) :
R.-B. Tian : W. Jia
Institute of Medicine,College of Medicine, Jishou University,
Jishou, China
e-mail: lxhsurgeon@163.com
e-mail: ljm5928@163.com

Allicin attenuated LV mass, posterior wall thickness


and LV end-diastolic diameter (1.10 0.04 vs. 1.37
0.05, 2.26 0.08 vs. 2.96 0.12, 7.27 0.36 vs. 8.56
0.41, respectively; all P<0.05), and increased fractional
shortening and EF (28.303.21 vs. 25.402.57, 60.27
5.63 vs. 51.304.78, respectively; both P<0.05) in the
Ang II-induced hypertrophic rats compared to the
untreated Ang II rats. Furthermore, allicin treatment
attenuated the accumulation of interstitial collagen and
collagen I/III (P<0.01 vs. the untreated Ang II group),
decreased the levels of reactive oxygen species, protein
carbonyl and TBARS and increased GPx activities. Moreover,
allicin significantly increased mRNA expression and protein
levels of Nrf2, NQO1, and -GCS (P<0.01, P<0.05 vs. the
untreated Ang II group).
Conclusion Allicin could prevent the development of cardiac remodeling and the progression of cardiac hypertrophy
to cardiac dysfunction caused by enhancing the Nrf2 antioxidant signaling pathways.
Key words Allicin . Cardiac hypertrophy . Cardiac fibrosis .
oxidative stress . Nrf2
Abbreviations
ROS
Reactive oxygen species
Nrf2
Transcription factor nuclear factor (erythroidderived 2)-like2
HO-1
Heme Oxygenase 1
SOD
Superoxide dismutase
NQO1
NAD(P)H:- quinine oxidoreductase
GPx
Glutathione peroxidase
-GCS -glutamylcysteine synthetase
GSH
Glutathione
T-AOC Total antioxidant capability
TBARS Thiobarbituric acid reactive substances

458

Introduction
Cardiac hypertrophy is a common pathological feature in
the natural course of some major cardiovascular diseases,
including hypertension. Furthermore, cardiac hypertrophy is
strongly associated with an increased risk of heart failure
and sudden cardiac death [1, 2]., indicating the importance
of preventing cardiac hypertrophy.
There is increasing evidence that Ang II-induced formation
of reactive oxygen species (ROS) causes oxidative stress
leading to cardiac hypertrophy and heart failure [35]. However, some large clinical trials using ROS scavengers of antioxidant vitamins suggest that non-selective scavenging of
ROS is ineffective or even harmful [6, 7]. Up-regulation of
antioxidant enzymes, including haeme oxygenase-1, inhibits
Ang II-induced oxidative stress and cardiac hypertrophy, suggesting an important role of endogenous antioxidant defences
in the control of Ang II-mediated redox signalling in the heart
[8]. Thus, it is likely that myocardial antioxidant systems
scavenge excess ROS in the heart, thereby suppressing Ang
II-induced myocardial oxidative stress and subsequent maladaptive cardiac remodelling and dysfunction.
The transcription factor nuclear factor (erythroid-derived
2)-like2 (Nrf2) regulates the expression of these key antioxidants as well as numerous reactive oxygen species
(ROS) detoxifying enzymes that protect the cell against
free radical-induced damage [9]. In response to oxidative
stress, Nrf2 induces the basal and inducible expression of a
series of antioxidant genes and other cytoprotective phase II
detoxifying enzymes, such as HO-1, superoxide dismutase
(SOD), glutathione peroxidase (GPx), glutathione-Stransferases, NAD(P)H:- quinine oxidoreductase (NQO1),
-glutamylcysteine synthetase (-GCS) [10, 11]. Moreover,
recent studies have revealed that Nrf2 plays a role in Ang IIinduced oxidative stress and the subsequent hypertrophic
remodelling of the heart [12]. As a result, Nrf2 has been
identified as a promising therapeutic target against Ang IImediated cardiac hypertrophy and heart failure [13, 14].
The organosulfur compounds, allicin and L-sulforaphane,
can activate Nrf2, because each of these compounds has an
electrophilic center which can serve as an attack site for nucleophiles, such as specific protein sulfhydryl groups present on
Keap1 [15, 16]. Recently, some studies have reported that
allicin could protect against coronary endothelial dysfunction
and cardiac hypertrophy and fibrosis [17]. However, the role of
allicin in cardiac hypertrophy and related molecular mechanisms
still remains unknown. In the present study, we investigated the
effects of allicin on cardiac hypertrophy induced by Ang II.
Animals and experimental design
The experiments were carried out in adult male
SpragueDawley rats (Sino-British Sippr/BK,Shanghai,

Cardiovasc Drugs Ther (2012) 26:457465

China). They were kept in polyacrylic cages and maintained under standard housing conditions (room temperature 2224C) with a 12 h light/dark cycle. All
experimental animals were overseen and approved by
the Animal Care and Welfare Committee of Jishou
University before and during the experiments. After
acclimatization for 1 week on standard rat chow, male
rats (200 to 250 g) received infusions of either saline
or Ang II (250 ng/kg body weight per min) through
mini-osmotic pumps implanted subcutaneously for
2 weeks.
The rats were randomized into three groups as follows:1)sham group (saline)(n012), 2) Ang II group(n09),
3) allicin group (Ang II + allicin)(n09). The sham group and
Ang II group were fed a standard rat chow (60 % carbohydrate, 20 % protein, 10 % vitamin and mineral mix, 5 % fat
and 5 % cellulose), while the allicin group received a diet
containing 180 mg/kg/day of allicin in addition to standard
chow at the 4th week after the surgery for 8 consecutive
weeks [15]. The experimental design and process are shown
in Fig. 1.
Echocardiographic and haemodynamic analysis
At the 12th week,blood pressures were measured in conditioned, unanaesthetized mice using the tail-cuff method
(RM-6240 system, Chengdu Sci-Tec, China). Echocardiography was performed on anaesthetized mice, using a GE
Vivid 4 ultrasound machine (GE Medical Systems, Waukesha, WI, USA) equipped with a 13 MHz phase array linear
transducer, as previously described [18].
Heart/body weight ratio
After the foregoing in vivo hemodynamic measurements
and lung perfusion with ice-cold 0.9 % Nacl solution, animals were sacrificed and the heart-lung organs rapidly dissected, blotted and weighed. Then, the heart/body weight
(HW/BW) ratio was calculated in each group.
Histomorphology
Hearts were cannulated via the left ventricular apex,
cleared by perfusion with saline solution, fixed by perfusion with 4 % paraformaldehyde, and embedded in
paraffin. Paraffin sections were prepared at 5-m thickness and stored at room temperature until staining.
Interstitial fibrosis was determined using picrosirius red
staining and the perivascular fibrosis was determined
using Massons trichrome staining. Myocardial fibrosis
in the tissue sections was quantitatively analyzed by
morphometry in picrosiriusred staining sections with
Image J software (NIH, 1.61)

Cardiovasc Drugs Ther (2012) 26:457465

459

Fig. 1 Time schedules of


saline, Ang II and allicin
administration

Assays of antioxidant capacity and determination


of oxidative damage markers

nanomoles per mg protein, using a standard curve as a reference with a known quantity of malondialdehyde.

Determination of GPx

ROS assay

For the determination of GPx activity, the homogenate supernatant mixed with GSH and hydrogen peroxide was
incubated at 37 C for 3 min, followed by the addition of
10 % trichloro acetic acid. After centrifugation, the supernatant was collected and mixed with disodium hydrogen
phosphate and 5,5,-dithiobis(2-nitro-benzoic acid). The absorbance at 412 nm was recorded for the calculation of GPx
activity. The unit of GPx activity was expressed as micromoles GSH oxidation per min per mg protein [15].

ROS was measured as described previously, based on


the oxidation of 2,7-dichlorodihydrofluorescein diacetate to 2,7-dichlorofluorescein (DCF) [19]. Briefly, the
reaction mixture containing Lockes buffer, homogenate
and 5 mM 2,7-dichlorodihydrofluorescein diacetate was
incubated for 45 min at room temperature, and then
measured using a spectrofluorimeter with excitation at
484 nm and emission at 530 nm. Background fluorescence was corrected by the inclusion of parallel blanks.
ROS formation was quantified from a DCF standard
curve and the data were expressed as pmol DCF formed/
min/mg protein

Determination of glutathione (GSH), total antioxidant


capability (T-AOC) and thiobarbituric acid reactive
substances (TBARS)

Determination of protein carbonyl content


GSH,T-AOC and TBARS was assayed with commercial kits
(Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
The GSH concentration was calculated using a GSH standard
curve. The TBARS concentration was expressed as TBARS in
Table 1 Experimental primers
of corresponding genes for real
time-PCR

Protein carbonyls were quantified by monitoring the


absorbance 370 nm in a quartz 96 well plate using a
spectrophotometer, and calculated using an extinction

Primers

Gene access #

Sequences

Product Length(bp)

NQO-1

NM_017000.3

196

HO-1

NM_012580.2

-GCS

J05181.1

Nrf2

NM_031789.1

Col11

NM_053304.1

Col31

NM_032085.1

GAPDH

NM_017008.3

Forward: TGGAAGGGTGGAAGAAGCGTC
Reverse: TCTGGTTGTCGGCTGGAATGG
Forward: ACAGAAGAGGCTAAGACCG
Reverse: CAGGCACTCCTTCCATT
Forward: ACGGTCAGGTCATCACTATC
Reverse: TCAAGGTAGGAGTTCAGAATG
Forward: CCATTTACGGAGACCCAC
Reverse: TGAGCGGCAACTTTATTC
Forward: TTCCTGCCTCAGCCACCTCA
Reverse: GAACCTTCGCTTCCATACTCG
Forward: ATGGTGGCTTTCAGTTCAG
Reverse: CAATGTCATAGGGTGCGATA
Forward: CCCCCAATGTATCCGTTGTG
Reverse: TAGCCCAGGATGCCCTTTAGT

441
203
197
431
351
188

460

Cardiovasc Drugs Ther (2012) 26:457465

Table 2 Effects of allicin on Ang II-induced cardiac hypertrophy rats


Parameters

BW(g)
BP systolic (mmHg)
BP diastolic (mmHg)
BP MAP (mmHg)
HR (b.p.m.)
HW/BW

Sham (n012) Ang II(n09)

384.19.45
1128.42
77.37.42
90.78.62
29914.8
4.510.11

359.212.34
16810.26**
12211.39**
14410.28**
32115.6**
5.970.24**

Ang II + allicin
(n010)
379.510.61
12311.67#
86.612.37#
98.711.89#
30617.6#
5.320.32#

BW body weight; BP blood pressure; MAP mean artery pressure; HR


heart rate; b.p.m beat per minute; HW/BW heart weight/body weight
ratio. Data were expressed as mean SEM. **p<0.01,Ang II vs.
Sham;#p<0.05,Ang II + allicin vs. Ang II

coefficient of 21.0 mM/cm for aliphatic hydrazones to


calculate the amount of protein carbonyls in terms of
nmol/mg protein.
Fig. 2 Echocardiographic
measures in Ang II-induced
cardiac hypertrophy rats at 12th
weeks after allicin treatment. A:
diastolic thickness of interventricular septum (IVSd); B: left
ventricular (LV) end-diastolic
diameter (LVEDd); C: diastolic
thickness of LV posterior wall
(LVPWd); D: fractional shortening (FS); E ejection fraction
(EF); and F LV mass. All data
are represented as meanS.E.M
for six to seven rats each group.
*P<0.05, **P<0.01 vs. sham;
#P<0.05, ##P<0.01 vs. Ang II

Quantitative real-time PCR


For real time-PCR, total RNA was extracted from frozen,
pulverized mouse heart tissues using TRIzol (Invitrogen),
and was converted to cDNA using primers with the Advantage RT-for-PCR kit (BD Biosciences). We quantified PCR
amplifications using SYBR Green PCR Master Mix
(Solarbio) and normalized results against GAPDH gene
expression. Experimental primers of corresponding genes
are listed in Table 1.
Western blot analysis
The heart samples were homogenized in RIPA buffer containing 150 mM NaF, 2 mM sodium orthovanadate and protease
inhibitors (protease inhibitor mixture; Roche). The homogenates were then centrifuged, the supernatants were collected
and total protein concentrationwas determined according to

Cardiovasc Drugs Ther (2012) 26:457465

the MicroBCA procedure (Pierce, IL, USA), using bovine


serum albumin as standard. Protein samples (30 g) were
loaded and blotted. Primary antibodies against rabbit anti Nrf2, mouse anti- NQO-1 (Cell Signalling Technology, Inc.,
Beverly, MA, USA) and rabbit anti --GCS (Wuhan Boster,
China) were used. The proteins were detected using horseradish peroxidase-conjugated anti-rabbit, or anti-mouse secondary antibodies. The optical density values of bands were
measured with NeuroJ software and were normalized using
anti--tubulin (Cell Signalling Technology, Inc., Beverly,
MA, USA) as an internal control (optical densitydetected protein/
optical densityinternal control).

461

comparisons. Differences were considered significant at a


level of P<0.05.

Results
Allicin ameliorates Ang II-induced cardiac hypertrophy

Data are shown as mean + SEM. Results were compared by


ANOVA, followed by the Bonferroni test for multiple

To assess effectiveness of dietary allicin in Ang II-induced


cardiac hypertrophy, we analysed the myocardial hypertrophic responses elicited by saline or Ang II infusion in all
groups. Ang II infusion increased blood pressure, heart rate
(HR) and heart weight to body weight ratio (HW/BW)
(Table 2). Echocardiographic data revealed that Ang II
infusion resulted in anatomical and functional changes that
were consistent with cardiac hypertrophy, such as increased
LV mass, posterior wall thickness and LV end-diastolic

Fig. 3 Effects of allicin on myocardial fibrosis and collagen content in


cardiac tissue of Ang II-induced cardiac hypertrophy rats. A: representative figure of perivascular fibrosis (Massons trichrome staining,
Scale bar050 m); B: representative figure of interstitial fibrosis

(picrosirius red staining, Scale bar050 m); C: statistic results of


myocardial fibrosis; D: collagen I/III content in cardiac tissue. Data
are expressed as meanSEM, n06. **P<0.01 vs. sham; ##P<0.01 vs.
Ang II

Statistical analysis

462

Cardiovasc Drugs Ther (2012) 26:457465

diameter, and decreased fractional shortening and EF


compared with sham rats. Allicin in the diet significantly attenuated the LV mass, posterior wall thickness and
LV end-diastolic diameter (1.10 0.04 vs. 1.37 0.05,
2.26 0.08 vs. 2.96 0.12, 7.27 0.36 vs. 8.56 0.41,
respectively; all P<0.05), and increased fractional shortening and EF(28.30 3.21 vs. 25.40 2.57,60.27 5.63
vs. 51.304.78, respectively; all P <0.05) in Ang IIinduced hypertrophic rats (Fig. 2).

hypertrophy, a significant accumulation of interstitial


collagen was observed by quantitative image analysis
in the 12th week after Ang II infusion, compared with
the sham group (P<0.01, Fig. 3c). Furthermore, Ang II
infusion increased collagen I/III mRNA expression,
compared with the sham group (P<0.01, Fig. 3d). However, allicin treatment attenuated the accumulation of
interstitial collagen and collagen I/III mRNA expression
(P<0.01 vs the Ang II group, Fig. 3cd).

Allicin inhibits myocardial fibrosis induced by AngII

Allicin blocks oxidative damage through decreasing


the levels of reactive oxygen species, protein carbonyl
and TBARS and increasing GPx activities

As shown in Fig. 3, the Ang II group showed severely


increased perivascular fibrosis (Massons trichrome
staining, Fig. 3a) and interstitial fibrosis (picrosirius
red staining, Fig. 3b). Concomitantly with myocardial
Fig. 4 Effects of allicin on the
activities of antioxidant
enzymes (GPx), the levels of
GSH, T-AOC, ROS, contents of
TBARS and carbonyl proteins
in heart of Ang II-induced
cardiac hypertrophy rats. Bars
represent the mean SEM of 5
observations. (a, b, c, d, e, f)
Comparison of the activities of
GPx, GSH, T-AOC, ROS
TBARS and carbonyl proteins
levels. **P<0.01 vs. sham;
#P<0.05, ##P<0.01 vs. Ang II

As shown in Fig. 4, GPx activities, levels of GSH and TAOC in the hearts of the Ang II group were significantly

Cardiovasc Drugs Ther (2012) 26:457465

463

Fig. 5 Effect of treatment of


allicin on mRNA expression of
Nrf2 and Nrf2 downstream
targets NQO1,HO-1 and-GCS
in cardiac tissue of Ang IIinduced cardiac hypertrophy
rats. Data are expressed as
meanSEM, n04. *P<0.05,
**P<0.01 vs. sham; #P<0.05,
##P<0.01 vs. Ang II

lower, and the levels of TBARS, reactive oxygen species


and protein carbonyl were significantly increased compared
Fig. 6 Effect of treatment of
allicin on protein levels of Nrf2
and Nrf2 downstream targets
NQO1,HO-1 and-GCS in cardiac tissue of Ang II-induced
cardiac hypertrophy rats. (A)
Representative immunoblot for
Nrf2, NQO1, HO-1,-GCS and
GAPDH in all groups. (B) Relative density analysis of the
Nrf2, NQO1,HO-1 and -GCS
protein bands. The relative
density is expressed as the ratio
(Nrf2, NQO1,HO-1 and-GCS/
GAPDH). Data are expressed as
meanSEM (n 04), *P<0.05,
**P<0.01 vs. sham; #P<0.05,
##P<0.01 vs. Ang II

to the sham group (P<0.01), but attenuated by allicin treatment (P<0.01 vs. the Ang II group).

464

Allicin-induced activation of the Nrf2 pathway confers


protection against heart oxidative damage
NQO1 and-GCS in the hearts of the Ang II group rats were
significantly lower (P<0.01 vs. the sham group). Nrf2 and
HO-1 in the hearts of the Ang II group rats were moderately
elevated at both mRNA and protein levels compared to the
sham group rats. Treatment with allicin significantly increased the protein levels and mRNA expression of Nrf2,
NQO1, and -GCS (P<0.01, P<0.05vs. the Ang II group,
Figs. 5 and 6).

Discussion
In the present study, we evaluated the potential therapeutic
effects and pharmacological characteristics of allicin on Ang
II-induced cardiac hypertrophy and explored the potential
mechanisms involved. We demonstrated that allicin could
prevent, even partially reverse cardiac pathological hypertrophy by decreasing the elevated blood pressure, and improving cardiac function and cardiomyocyte pathological
changes. Others have shown that allicin may prevent the
progression of hypertrophy to cardiac failure induced by
pressure overload [17]. Furthermore, in our study allicin
decreased the HW/BW ratio and attenuated the accumulation of interstitial collagen and collagen I/III mRNA expression. These cardioprotective effects of allicin were mediated
by the activation of the Nrf 2-mediated antioxidant response
and reduction of oxidative damage, which led to the inhibition of hypertrophy, inflammation and fibrosis, thus ultimately preventing cardiac dysfunction. These findings
support the notion that allicin may be a promising candidate
for therapies against cardiac hypertrophy and subsequent
progression to heart failure.
Accumulating evidence indicates that Nrf2 is a critical
regulator for maintaining structural and functional integrity
of the heart in the setting of sustained Ang II stimulation
[11, 20, 21]. Some studies have shown that Nrf2 knockout
exaggerated Ang II-induced cardiac hypertrophy by further
increasing oxidative stress in the heart, and the Nrf2 pathway serves as a novel negative feedback mechanism in Ang
II-induced cardiac hypertrophy [12]. Thus, targeting Nrf2
may be a useful therapeutic strategy against Ang IImediated cardiac hypertrophy and heart failure. In our study,
we found that Nrf2 and HO-1 in the hearts of the Ang II
group rats were moderately elevated at both the mRNA and
protein levels compared to the sham group mice, but that
NQO1 and-GCS levels were significantly lower. GPx activities, levels of GSH and T-AOC in the hearts of Ang II
group rats were also significantly lower, and the levels of
TBARS, reactive oxygen species and protein carbonyl were
significantly increased. The exact mechanisms of the Ang

Cardiovasc Drugs Ther (2012) 26:457465

II-mediated Nrf2 activation in the heart have not been fully


clarified in the present study. However, there are several
hypotheses about the mechanisms of the Ang II-mediated
Nrf2 activation in the cardiovascular system [12]. Firstly,
Ang II-induced oxidative stress directs modification of cysteine residues of Keap1 thereby decreasing the Keap1mediated ubiquinitation and degradation of Nrf2 and results
in enhanced Nrf2 activity. Secondly, Ang II-induced oxidative stress results in the modulation of cysteine residues in
Nrf2 per se that regulates its nuclear translocation. Thirdly,
Ang II-activated kinases phosphorylates Nrf2, thereby increasing its nuclear translocation. These results demonstrate
that increased Nrf2 activity in the myocardium is secondary to
the Ang II-induced oxidative stress and serves as a negative
regulator of Ang II-induced oxidative stress in cardiomyocytes. Allicin may markedly increase the protein levels and
mRNA expression of Nrf2, NQO1, and -GCS and alleviate
progression to cardiac hypertrophy. Consistent with our
finding that Ang II-induced hypertrophic signalling is
inhibited by the forced activation of Nrf2, recent studies
have documented that sulphoraphane and triterpenoid 2cyano-3, 12-dioxooleana-1, 9 (11)-dien-28-oic acid (CDDO)imidazolide (two established Nrf2 activators) protect the heart
from ischaemic injury in rats and cigarette-smoke-induced
cardiac dysfunction in mice, respectively [22, 23].
In conclusion, our findings suggest that allicin may prevent the development of cardiac remodeling and progression
of cardiac hypertrophy to cardiac dysfunction. Therefore,
allicin could be recommended as a possible candidate for the
prevention and therapy of cardiac hypertrophy. However,
further studies are needed to elucidate the exact mechanism
of allicin in treating cardiac hypertrophy.

References
1. Maulik SK, Kumar S. Oxidative stress and cardiac hypertrophy: a
review. Toxicol Mech Methods. 2012;22:35966.
2. Delmar M, Makita N. Cardiac connexins, mutations and arrhythmias. Curr Opin Cardiol. 2012;27:23641.
3. Takimoto E, Kass DA. Role of oxidative stress in cardiac hypertrophy and remodeling. Hypertension. 2007;49:2418.
4. Schluter KD, Wenzel S. Angiotensin II: a hormone involved in and
contributing to pro-hypertrophic cardiac networks and target of
anti-hypertrophic cross-talks. Pharmacol Ther. 2008;119:31125.
5. Das DK, Maulik N, Engelman RM. Redox regulation of angiotensin II signaling in the heart. J Cell Mol Med. 2004;8:14452.
6. Miller ER, Pastor-Barriuso R, Dalal D, Riemersma RA, Appel LJ,
Guallar E. Meta-analysis: high-dosage vitamin E supplementation
may increase all-cause mortality. Ann Intern Med. 2005;142:3746.
7. Lonn E, Bosch J, Yusuf S, Sheridan P, Pogue J, Arnold JM,
et al. Effects of long-term vitamin E supplementation on
cardiovascular events and cancer: a randomized controlled trial.
JAMA. 2005;293:133847.
8. Widder JD, Fraccarollo D, Galuppo P, Hansen JM, Jones DP, Ertl G,
et al. Attenuation of angiotensin II-induced vascular dysfunction and

Cardiovasc Drugs Ther (2012) 26:457465

9.

10.

11.

12.

13.

14.

15.

hypertension by overexpression of Thioredoxin 2. Hypertension.


2009;54:33844.
Chen SY. Analysis of nrf2-mediated transcriptional induction of
antioxidant response in early embryos. Methods Mol Biol.
2012;889:27790.
Li J, Ichikawa T, Villacorta L, Janicki JS, Brower GL,
Yamamoto M, et al. Nrf2 protects against maladaptive cardiac responses to hemodynamic stress. Arterioscler Thromb Vasc Biol.
2009;29:184350.
Ichikawa T, Li J, Meyer CJ, Janicki JS, Hannink M, Cui T.
Dihydro-CDDO-trifluoroethyl amide (dh404), a novel Nrf2 activator, suppresses oxidative stress in cardiomyocytes. PLoS One.
2009;4:e8391.
Li J, Zhang C, Xing Y, Janicki JS, Yamamoto M, Wang XL, et al.
Up-regulation of p27(kip1) contributes to Nrf2-mediated protection against angiotensin II-induced cardiac hypertrophy.
Cardiovasc Res. 2011;90:31524.
Hybertson BM, Gao B, Bose SK, McCord JM. Oxidative stress in
health and disease: the therapeutic potential of Nrf2 activation.
Mol Aspects Med. 2011;32:23446.
Alfieri A, Srivastava S, Siow RC, Modo M, Fraser PA, Mann GE.
Targeting the Nrf2-Keap1 antioxidant defence pathway for neurovascular protection in stroke. J Physiol. 2011;589:412536.
Li XH, Li CY, Lu JM, Tian RB, Wei J. Allicin ameliorates
cognitive deficits ageing-induced learning and memory deficits
through enhancing of Nrf2 antioxidant signaling pathways.
Neurosci Lett. 2012;514:4650.

465
16. Leonardo CC, Dore S. Dietary flavonoids are neuroprotective
through Nrf2-coordinated induction of endogenous cytoprotective
proteins. Nutr Neurosci. 2011;14:22636.
17. Liu C, Cao F, Tang QZ, Yan L, Dong YG, Zhu LH, et al. Allicin
protects against cardiac hypertrophy and fibrosis via attenuating
reactive oxygen species-dependent signaling pathways. J Nutr
Biochem. 2010;21:123850.
18. Gul R, Park JH, Kim SY, Jang KY, Chae JK, Ko JK, et al.
Inhibition of ADP-ribosyl cyclase attenuates angiotensin IIinduced cardiac hypertrophy. Cardiovasc Res. 2009;81:58291.
19. Lu J, Wu DM, Zheng ZH, Zheng YL, Hu B, Zhang ZF. Troxerutin
protects against high cholesterol-induced cognitive deficits in
mice. Brain. 2011;134(Pt 3):78397.
20. Porter KE, Turner NA. Cardiac fibroblasts: at the heart of myocardial remodeling. Pharmacol Ther. 2009;123:25578.
21. Li J, Ichikawa T, Jin Y, Hofseth LJ, Nagarkatti P, Nagarkatti M, et
al. An essential role of Nrf2 in American ginseng-mediated antioxidative actions in cardiomyocytes. J Ethnopharmacol.
2010;130:22230.
22. Piao CS, Gao S, Lee GH, Kim DS, Park BH, Chae SW, et al.
Sulforaphane protects ischemic injury of hearts through antioxidant pathway and mitochondrial K(ATP) channels. Pharmacol Res.
2010;61:3428.
23. Sussan TE, Rangasamy T, Blake DJ, Malhotra D, El-Haddad H, Bedja
D, et al. Targeting Nrf2 with the triterpenoid CDDO-imidazolide
attenuates cigarette smoke-induced emphysema and cardiac dysfunction in mice. Proc Natl Acad Sci U S A. 2009;106:2505.