Process Biochemistry 51 (2016) 2433

Contents lists available at ScienceDirect

Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio

Development of inhibitory ssDNA aptamers for the FtsZ cell division

protein from citrus canker phytopathogen
Na-Reum Ha a , Sang-Choon Lee a , Jae-Wook Hyun b , Moon-Young Yoon a,
a
b

Department of Chemistry and Research Institute of Natural Sciences, Hanyang University, Seoul 133-791, Republic of Korea
Citrus Research Station, National Institute of Horticultural and Herbal Science, RDA, Jeju 699-946, Republic of Korea

a r t i c l e

i n f o

Article history:
Received 11 August 2015
Received in revised form 5 November 2015
Accepted 6 November 2015
Available online 28 November 2015
Keywords:
Citrus canker
FtsZ
SELEX
ssDNA aptamer
Antibacterial agent

a b s t r a c t
Citrus canker caused by Xanthomonas axonopodis pv. citri (X. axonopodis) is a plant pathogenic bacterial disease infectious to citrus crops, resulting in reduced fruit quality and premature fruit drop. Many
chemical substances to prevent citrus canker cannot cure the progressive disease caused by drug resistant pathogens. In this study, we identied the lamentous temperature-sensitive Z (FtsZ) protein of X.
axonopodis, a GTPase essential for bacteria cell division, as a new target for anti-citrus canker agent. We
found nine single-stranded DNA aptamers with 44444 nM Kd values against recombinant FtsZ, using
SELEX. Among these aptamers, three FtsZ binding aptamers (FBAs) exhibited potent inhibitory effects
with IC50 values of 12 M similar to berberine, a well-known commercial antibacterial agent. Furthermore, the FBAs also demonstrated high growth inhibitory activity at the cellular level with MIC50 values
in the 100 M range. Consequently, this is the rst report of a biocompatible inhibitory aptamer as a
drug against X. axonopodis FtsZ, and provides a novel strategy for the development of eco-friendly citrus
canker prevention agents, thereby replacing the presently used chemical-based drug in near future.
2015 Elsevier Ltd. All rights reserved.

1. Introduction
Of all the agricultural pests which threaten citrus crops, citrus
canker, one of the most devastating diseases caused by Xanthomonas axonopodis pv. citri (X. axonopodis), is an economically
representative disease of many citrus species such as lime, orange,
lemon, pomelo, etc. [1]. At least 4 distinct types (Asiatic canker,
Cancrosis B, Mexican lime cancrosis, and Citrus bacteriosis) of
citrus canker are currently recognized. Among these types, the
Asiatic canker (Canker A) is the most powerfully destructive to
major citrus cultivars. Severe infection leads to a variety of effects
including defoliation, dieback, severely blemished fruit, reduced
fruit quality and premature fruit drop [2]. To prevent the disease,
many chemical substances have been used and novel products
are being continuously developed. Copper-containing products
offer some protection along with eld-grade antibiotics, especially
streptomycin, used as preventative agents in food crops. Curative

Abbreviations: FtsZ, lamenting temperature sensitive mutantZ; X. axonopodis,

Xanthomonas axonopodis pv. citri; SELEX, systematic evolution of ligands by
exponential enrichment; IC50 , half maximal inhibitory concentration; MIC50 , half
minimum inhibitory concentration.
Corresponding author at: Department of Chemistry and Research institute of
Natural Sciences, Hanyang University, 222 Wangsimni-ro, Seongdong-gu, Seoul
133-791, Republic of Korea. Fax: +82 2 2298 0319.
E-mail address: myyoon@hanyang.ac.kr (M.-Y. Yoon).
http://dx.doi.org/10.1016/j.procbio.2015.11.008
1359-5113/ 2015 Elsevier Ltd. All rights reserved.

applications of chemical-based pesticides reduce bacterial proliferation or spread of the bacterium, however, there is currently no
cure for disease that has already progressed [3]. Furthermore, the
use of chemical-based drugs for the prevention of citrus canker not
only causes resistance to various drugs, it also has harmful effects
on human health. Thus, such measures cannot be permanently
used, and new approaches such as the development of effective
eco-friendly antibiotic drugs that prevent widespread citrus canker
need to be investigated.
FtsZ (Filamenting temperature sensitive mutant Z) assembles
into a highly dynamic ring structure called the Z-ring, and has
GTPase activity. It is the major cytoskeletal protein in the bacterial
cytokinesis mechanism of cell division in prokaryotic bacteria [4],
and is homologous to the eukaryotic cytoskeleton protein (tubulin) [5,6]. The dynamic assembly of FtsZ plays an important role
in the regulation of Z-ring formation [7,8]. The Z-ring leads to the
constriction of membranes, formation of a septum and division of
the cell. Therefore, the use of an FtsZ inhibitor could block Z-ring
formation and eventually inhibit bacterial cell division. For last couple of decades, the FtsZ proteins from various species of bacteria,
such as Bacillus anthracis (B. anthracis), Bacillus subtilis (B. subtilis),
Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and
Mycobacterium tuberculosis (M. tuberculosis), have been studied and
many chemical inhibitors have been developed [912]. Therefore,
it is considered to be a good target for the development of a new
class of antibiotics [1316].

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

Aptamers are short single-stranded nucleic acid (DNA or RNA)

molecules which bind to target molecules with high specicity
and binding afnity because of their three-dimensional structure,
characterized by stems, loops, hairpins, or quadruplexes, and can
be screened for by the systematic evolution of ligands by exponential enrichment (SELEX) method [17,18]. The SELEX method is
a widely used against various targets, including small molecules,
proteins, cells, tissues and organisms [19]. As aptamers are quite
small biological molecule in comparison with large molecules such
as proteins, and antibodies, aptamers have various merits including simplicity to be synthesized and modied chemically, being
small in size and having low immunogenic property. Consequently,
aptamers have recently been used in biological applications, particularly as therapeutic agents [20].
In this study, we cloned and puried the FtsZ protein from X.
axonopodis. Through 8 rounds of the SELEX process, we obtained
9 highly specic aptamers and characterized their binding afnity
and specicity. Furthermore, we ultimately selected 3 candidate
aptamers that showed inhibition of FtsZ polymerization activity
within the micromolar range of half maximal inhibitory concentrations (IC50 ) in protein levels using an in-vitro FtsZ polymerization
assay and bacterial growth inhibition within the 100 micromolar
range of half minimum inhibitory concentration (MIC50 ) values in
cellular levels using a surface viable counting assay. We suggest that
the FtsZ protein could be a new target for antimicrobial agents, and
the FtsZ binding aptamers (FBAs) may represent a novel and potent
prevention agent for citrus canker.

25

Protein expression was induced by addition of 0.5 mM isopropyl-d-thiogalactopyranoside (IPTG) and cells were grown at 37 C
for 6 h. In order to purify the FtsZ protein, the induced cells were
harvested by centrifugation at 4,000 rpm for 20 min. The cells were
then re-suspended in 50 ml buffer-A containing 20 mM Tris (pH 7.4)
and 0.4 M NaCl with 1 mM phenylmethylsulfonyl uoride (PMSF)
dissolved in isopropanol, 0.5 mg ml 1 lysozyme, and sonicated. The
induced FtsZ protein was obtained by centrifugation, and loaded
onto a Ni2+ -charged chelating sepharose column for afnity chromatography (Vc (column volume) = 8 ml, Amersham Biosciences,
Piscataway, NJ, USA). A linear gradient from 20500 mM imidazole
in elution buffer was used to elute the FtsZ protein, and fractions
containing protein were concentrated. The nal concentration of
puried FtsZ protein was determined by Bradford assay, following
the manufacturers protocol (Bio-Rad, Hercules, CA, USA).
2.4. Activity test of the puried FtsZ with polymerization assay

2. Materials and methods

The measurement of FtsZ activity was conducted by assembly of

FtsZ in the presence of GTP using a standard polymerization assay.
The FtsZ protein was used in a range of concentrations, 2.3 M
(0.1 mg ml1 ) to 11.1 M (0.5 mg ml1 ), and was incubated in
polymerization buffer containing 50 mM MES (2-(N -morpholino)
ethanesulfonic acid, pH 6.5), 50 mM KCl, and 10 mM MgCl2 ) [22].
The polymerization reaction was initiated by adding 1 mM GTP
into the reaction mixture for 1 h, and the signal was continuously
measured to identify the polymerization of the FtsZ protein at intervals of 20 s at 350 nm by UV-spectrophotometer (Mecasys, Daejeon,
Korea).

2.1. Materials

2.5. In-vitro aptamer screening against FtsZ

X. axonopodis pv.citri was obtained from the Citrus Research Station (Jeju Island, Korea) and grown on Nutrient-Yeast extract Agar
at 30 C. Primers and the template for ssDNA library were synthesized by Bioneer (Daejeon, Korea). pfu polymerase was purchased
from Solgent (Daejeon, Korea), and restriction endonucleases and
DNA ligases from Takara Bio (Shiga, Japan). GTP and berberine were
purchased from Sigma (St. Louis, MO, USA), and nutrients (bactotryptone, yeast extract and bacto-agar) were obtained from BD
Difco Laboratories (Sparks, NV, USA). All chemicals were obtained
from commercial sources and were the highest quality available.

Genomic DNA was isolated from X. axonopodis using a general

alkaline lysis protocol, and served as the template in polymerase chain reactions (PCR). The DNA fragment encoding the
open reading frame (ORF) of the FtsZ gene from X. axonopodis
was amplied by PCR with gene specic primers, (forward: 5 ATATGGATCCATGGCACATTTCGAACTGATTGAAAAAATGGC-3
containing
BamH
I
(bold)
and
reverse:
5 ATATCTCGAGTCAGTCGGCCTGGCGGCGCAGGAA-3
containing
Xho I (bold)), and the amplied PCR product was conrmed on a 1%
agarose gel. Then, the amplied FtsZ gene fragment was inserted
into a pET28a (+) expression vector (Novagen, Madison, WI, USA)
for the production of a recombinant fusion protein that included
hexa-histidine tags at the C-terminal end. The cloned sequence of
the FtsZ-pET28a gene was analyzed by Macrogen (Seoul, Korea)
[21].

In order to prepare the single-stranded DNA (ssDNA)

library containing 30 bases of randomized sequence and two
primers binding sequences for PCR amplication and cloning,
the template for ssDNA library, 5 -ATGCGGATCCCGCGC-(N30 )GCGCAAGCTTCGCGC-3 , was obtained from Bioneer. The template
for ssDNA library was amplied by asymmetric PCR with one of
the primers in excess, specically forward primer in this case (forward primer: 5 -ATGCGGATCCCGCGC-3 with BamH I (bold) site
and reverse primer: 5 -GCGCAAGCTTCGCGC-3 with Hind III site
(bold)). Amplication of ssDNA library was conrmed by 12% native
polyacrylamide gel electrophoresis. Product was obtained using a
crush-and-soak and ethanol precipitation method and the ssDNA
library used for aptamer screening was generated [23].
FtsZ protein dissolved in 50 mM TrisHCl (pH 7.4) was incubated with 1 g ml1 ssDNA library at room temperature. To
remove the unbound aptamers, membrane ltration using Vivaspin
ultraltration spin columns with 30 kDa cut-off (Sartorius Stedim
Biotech GmbH, Goettingen, Germany) was used, and proteinbound aptamers were separated by centrifugation at 14,000 rpm
for 15 min [21]. For the next round, the eluted ssDNA was amplied
by asymmetric PCR, and amplied ssDNA was checked by loading
on a 12% native polyacrylamide gel. ssDNA in the gel was further puried and recovered by the gel elution and crush-and-soak
method, as described above. In order to increase the specicity of
the ssDNA aptamer, negative selection was performed with bovine
serum albumin (BSA) during round 4 of SELEX, and the unbound
ssDNA was collected by centrifugation. A total of 8 rounds of SELEX
were performed under harsh conditions (Table 1).

2.3. Expression and purication of the FtsZ protein

2.6. Analysis of aptamer sequences and secondary structures

E. coli BL21 (DE3) cells harboring the FtsZ plasmid were grown
in 1.5 L of LuriaBertani (LB) medium containing 100 mg ml1
kanamycin until the optical density (OD600 ) reached 0.7 at 37 C.

To analyze the FtsZ binding aptamers (FBAs) sequence, the

ssDNA library pool obtained from the nal round of SELEX was
amplied by symmetric PCR using 10 M of each primer. The

2.2. Cloning of X. axonopodis FtsZ and plasmid construction

26

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

Table 1
SELEX conditions used in each round.
Round

Protein (g mL1 )

Buffers

1st
2nd
3nd
4th
5th
6th
7th
8th

Tris [mM]

NaCl [mM]

Tween 20 (%)

50
(pH 7.4)

50
100
150
200
250
300
350
400

0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4

amplied double-stranded DNA (dsDNA) was digested with restriction endonucleases (BamH I and Hind III), and inserted into the
pET28a (+) expression vector. The ligation product was conrmed
by electrophoresis on a 1% agarose gel, and the sequence was determined by sequence analysis from Macrogen (Seoul, Korea). The
secondary structures of the ssDNA aptamers were predicted by
using M-fold free software [24,25].
2.7. Estimation of binding afnity and specicity
The apparent binding afnities of FBAs were measured using
an enzyme-linked immunosorbent assay (ELISA) method with 5 biotin-conjugated FBAs (biotin-FBAs) synthesized by Bioneer and
streptavidin-conjugated horseradish peroxidase (HRP) antibody
(BD Biosciences, Franklin Lakes, NJ, USA) [21]. 22 nM (1 g ml1 )
FtsZ protein, dissolved in TBS buffer (20 mM TrisHCl (pH 8.0) and
150 mM NaCl), was immobilized on a 96-well polystyrene plate
(SPL, Kyounggi-do, Korea) for 2 h. The wells were washed 3 times
with TBST (TBS containing 0.05% Tween-20) and then incubated
with 2% bovine serum albumin (BSA) for 1 h to block nonspecic
interactions. After 5 gentle washes, each biotin-FBA was added in a
concentration dependent manner and incubation was carried out
for 2 h. The unbound aptamers were removed through 10 washing steps. Then, streptavidin-conjugated HRP (1:2,000 dilution in
TBST) was added for 1 h, and bound FBAs were detected by addition
of 3, 3 , 5, 5 -tetramethyl benzidine (TMB) solution (R&D Systems,
Minneapolis, MN, USA). After 15 min incubation, the reaction was
terminated by adding 1 M H2 SO4 , and the signal was measured
using a SpectraMax M2 Multi-Mode Microplate Reader (Molecular
Devices, Sunnyvale, CA, USA) at 450 nm. The binding ability of FBAs
to X. axonopodis FtsZ and BSA was measured, and apparent binding
afnities were estimated with the difference of absorbance value
for bound FBA using the Origin Program. The binding specicity of
FBAs towards the target protein was also evaluated by using other
homologous FtsZ protein from B. anthracis and BSA.

10
10
10
5
5
3
3

ssDNA (g mL1 )

Incubation (min)

1
1
0.5
0.5
0.3
0.3
0.2
0.2

60
60
45
45
45
30
30
30

2.9. Surface viable counting assay

X. axonopodis was cultured on Nutrient-Yeast extract (NY) broth
(BD Difco, Sparks, NV, USA) at 30 C until the OD600 reached 0.59. To
determine the number of bacterial cells, 100 L of serial diluted cell
cultures were spread on Nutrient-Yeast extract Agar (NYA) plates
and incubated for 48 h at 30 C. The 103 colony-forming unit (CFU)
ml1 cells were selected for the bacterial cell growth inhibition test.
To evaluate the antibacterial effect of FBAs, a surface viable
counting assay was carried out [27]. A 103 CFU ml1 of X. axonopodis
cells with different concentrations of FBAs were tested for inhibition of cell growth. Samples under each condition were incubated
for 3 h at room temperature and spread on NY Agar plates. The
plates were then incubated for 48 h at 30 C and the inhibition effect
was identied by counting the number of colonies.
2.10. Cytotoxicity assay
Raw 264.7 cells in Dulbeccos Modied Eagle Medium (DMEM)
containing 10% fetal bovine serum (FBS) and 1% antibiotic solution
(penicillin-streptomycin) were counted by hemocytometer, and a
total 1 105 cells were seeded in 96-well plates and incubated with
the condition of 5% CO2 at 37 C overnight. The cells were washed
once with PBS (pH 7.5), after fresh media was added. Next, the
cells were treated with various concentration of aptamers (from
6.25 M to 400 M) and incubated with the condition of 5% CO2 at
37 C for 4 h. To analyze the cell viability, a 1 mg ml1 of the MTT
solution (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium
Bromide) was added on each well and incubated with above mentioned same condition for 4 h. Then, the dimethyl sulfoxide (DMSO)
as a solubilization solution for formazan crystal was treated. 10%
DMSO was used as a negative control. The absorbance was measured at 570 nm by a microtiter plate reader.

2.8. In-vitro inhibition assay

3. Results and discussion

The evaluation of the inhibition potency of the screened FBAs

was conducted in the same manner as the FtsZ polymerization
assay. Each FBA was pre-incubated with 11.1 M (0.5 mg ml1 ) FtsZ
protein in polymerization buffer for 30 min, and the reaction was
initiated by adding 1 mM GTP. The turbidity, which corresponds
to the degree of polymerization, was monitored by measuring the
absorbance at 350 nm by UV-spectrophotometer. All data were
plotted using the Origin Program. The IC50 was determined by tting the following equation related with inhibition percentages
based on absorbance for turbidity, where V0 is the reaction rate
without inhibitor, Vf is the rate at saturating inhibition, and [I] is
the inhibitor concentration [26].

3.1. Cloning and purication of X. axonopodis FtsZ protein

V0 Vf IC50
IC50 + [I]

+ Vf

The X. axonopodis FtsZ gene was amplied by PCR with extracted

genomic DNA as a template and the designed primers. Amplication was conrmed on a 1% (w/v) agarose gel. As shown in Fig. 1A,
the length of the amplied gene was approximately 1.2 kbp (exactly
1239 bp). To prepare recombinant protein, the gene was inserted
into the pET 28a (+) expression vector after treatment with restriction endonucleases, transformed into E. coli BL21 (DE3) cells. The
recombinant X. axonopodis FtsZ was expressed, and puried using
Ni2+ -charged sepharose resin by histidine-tag afnity chromatography. The puried FtsZ protein was determined to be soluble,
more than 95% homogeneous and was approximately 45 kDa by
12% SDS-PAGE (Fig. 1B). The puried protein was concentrated up
to 2.5 mg ml1 and used for further studies.

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

27

Fig. 1. Cloning and purication of the X. axonopodis FtsZ protein. (A) PCR product for the FtsZ gene on a 1% (w/v) agarose gel. Lane M, 25/100 bp DNA ladder; lane 1, amplied
FtsZ gene (1239 bp). (B) Puried recombinant FtsZ protein on a 12% SDS-PAGE gel. Lane M, Protein ladder; lane 1, BL21(DE3) lysate before expressed; lane 2, BL21(DE3) lysate
after expressed; lane 3, lysate before binding on column; lane 4, lysate after binding on column; lane 5, puried FtsZ protein (approximately 45 kDa) after concentration of
all of the fractionized solution.

3.2. Characterization of recombinant X. axonopodis FtsZ protein

FtsZ is structurally similar to its homologue in eukaryotes,
tubulin, and forms polymers in the presence of GTP. The activity of puried recombinant FtsZ was measured by the absorbance
value at 350 nm, which means the turbidity of the reaction, and
the polymerization of FtsZ was monitored in a protein concentration dependent manner [22]. Various concentrations of FtsZ
were pre-incubated in polymerization buffer for 10 min, and 1 mM
GTP was added to initiate polymerization. As shown in Fig. 2, the
signal, corresponding to turbidity strength, promptly increased
with increasing protein concentration and the addition of GTP.
In the presence of high concentrations of the FtsZ protein, polymerization progressed more rapidly, and the maximum signal was
detected at 11.1 M (0.5 mg ml1 ) of FtsZ. As the GTP was continually consumed, the absorbance signal was slowly recovered
by depolymerization of FtsZ. In comparison with other bacterial
FtsZ proteins, the polymerization (20 min) and depolymerization
(1 h) of X. axonopodis FtsZ were denitely much slower than those
of E. coli FtsZ (within 30 s for polymerization and 25 min for
depolymerization) [22], and B. anthracis FtsZ (within 10 s for polymerization and polymerization was maintained for a prolonged
period) [26], but faster than M. tuberculosis FtsZ (10 min for polymerization and 5 h for depolymerization) [28]. It is likely that the
relatively slow assembly of X. axonopodis FtsZ was due to lower
GTPase activity. The degree of FtsZ polymerization activity is not
only quite important in bacterial cell growth, but also affects cell
division time. The generation time for X. axonopodis cell growth is
less than 3 h [29], which is explained by the fact that X. axonopodis
has a long cell division time caused by having lower GTPase activity than others, including E. coli (20 min) [30], B. anthracis (50 min)
[31]. However, since X. axonopodis FtsZ has higher GTPase activity than M. tuberculosis FtsZ, X. axonopodis has shorter generation
time than that of M. tuberculosis (1622 h) [32]. This growth rate
corresponds signicantly with the results for FtsZ polymerization
activity. Consequently, FtsZ could be a key factor in regulating cell
growth in X. axonopodis.
3.3. Identication of FtsZ binding aptamer and structural analysis
The puried FtsZ protein and the ssDNA library obtained by
asymmetric PCR were used for aptamer screening, and 8 rounds of
the SELEX process were performed (Fig. 3). To select aptamers with
high afnity and specicity, rounds of SELEX were performed using
the following harsh conditions: increasing salt and detergent concentrations, decreasing binding times, protein and ssDNA library
concentrations (Table 1). In particular, the monovalent cations and

detergent in the binding buffer are known to play a role in reducing

the nonspecic binding of the aptamer to the target. After completing the SELEX process, nine FtsZ binding aptamers (FBAs), each with
a different 30-base sequence, were selected (Table 2).
To understand the binding of an individual aptamer to its target,
we analyzed the secondary structures using the M Fold program
[24,25]. As shown in Fig. 4, all of the predicted structures had a
unique stem-and-loop structure and specic Gibbs free energy (
G) indicating structural stability. Among FBAs, FBA 8 had the lowest
energy value (G = 6.93 kcal mol1 ), whereas FBA 1 had a positive energy value (G = 0.11 kcal mol1 ). Interestingly, each FBA
had its own loop structure formed by the random sequence region
of the aptamer. We anticipate that the specic structures of each
FBA might play a particularly crucial role in binding to the target.

3.4. Characterization of screened aptamers: binding afnity and

specicity
Binding afnity of aptamer was measured by ELISA using biotinlabelled FBAs. As described in Table 2 and Fig. 5, the binding
afnities (Kd ) of FBAs were calculated to be in the concentration of
44444 nM range. Among the FBAs, FBA 2 and FBA 6 exhibited lower
binding afnities (44.5 nM and 80.6 nM, respectively) than the others we characterized. FBA 1 and FBA 9 showed relatively higher
binding afnities (283 nM and 444 nM, respectively). Although the
all FBAs had similar structures, their binding afnities are different. Interestingly, in cases of FBA 5 and FBA 7, both aptamers had
very close structures, however FBA 5 had an approximately 3-fold
increased relative binding afnity. This suggests that the binding of
aptamers to the target molecule were affected by structure as well
as sequence.
The target specicity test was performed with a biotinylated
FBAs against B. anthracis FtsZ and BSA. The B. anthracis FtsZ shares
50% sequence identity with X. axonopodis FtsZ, as determined by
the NCBI blast program (Fig. S3). B. anthracis FtsZ was puried via
E. coli expression system and identied the polymerization activity as the same conditions as X. axonopodis FtsZ (Figs. S1 and S2).
Among FBAs, FBA 1, 4, 57, and 9 were exhibited similar binding property between X. axonopodis FtsZ and B. anthracis FtsZ. In
contrast, FBA 2, 3, and 8 were only showed a high binding ability
specically against X. axonopodis FtsZ. Moreover, in case of BSA, all
FBAs exhibited a high binding specicity against X. axonopodis FtsZ
(Fig. 6). Consequently, according to the binding afnity and specicity, the FBA 2 and 8 showed an outstanding binding capability
against FtsZ protein.

28

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

Fig. 2. In-vitro polymerization assay of the X. axonopodis FtsZ protein. Polymerization occurred immediately upon addition of 1 mM GTP. Various concentrations of X.
axonopodis FtsZ were incubated in a polymerization reaction buffer, and then the absorbance at 350 nm was monitored.

Fig. 3. Overall schematic of the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method, including the binding, elution, and amplication steps, for the
selection of aptamer against FtsZ protein.
Table 2
FBAs screened and their binding afnities.
No.

Occurrencesa

Aptamer sequences

Binding afnityb (Kd , nM)

FBA 1
FBA 2
FBA 3
FBA 4
FBA 5
FBA 6
FBA 7
FBA 8
FBA 9

2
6
4
2
3
2
2
6
3

GGAGTCGTAGGGTTGTGCGTTGTCTCTGTC
GCACAGCAGGGGGCCACCCGCACGTGGTCG
CGACGTGAGGAAGGCGCGCTGGTTTGCACC
GCACGAAGTGACGCGCCTCCTTGTGTGTCG
CACGCAACGAGTGGCGCGCCTTGTTTCGGC
CGACGTCAGAGAGGCGCGCTACTGCGTACC
GCCGAAACAAGGCGCGCCACTCGTTGCGTG
GCAGTGAGGGGCACGCACCCGTGGCGGGTG
GCACACCGGAGGGGGGCTGCACTGGCCGTG

283 10.6
44.5 32.6
186 10.0
276 32.3
277 22.9
80.6 13.8
99.1 6.57
176 21.0
444 6.34

After eight rounds of SELEX, a total of 30 ssDNA aptamers were selected, and their sequences were determined. Among them, nine unique sequences were identied.
Binding afnities were determined as described in the Section 2. FtsZ was immobilized in individual wells of a polystyrene plate, and ssDNA aptamer was added. After
extensive washing, the amount of bound ssDNA aptamer was estimated using a streptavidin-conjugated antibody which specically recognizes the biotin label on each
ssDNA aptamer. The dissociation constant (Kd ) was obtained from binding saturation curve tting from three independent experiments.
b

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

29

Fig. 4. Predicted secondary structures of the FBAs. All FBAs have a stem-loop structure consisting of a 30-mer of nucleic acid. The structural forming energy of each FBA was
as follows; FBA 1 (G = 0.11 kcal mol1 ), FBA 2 (G = 4.44 kcal mol1 ), FBA 3 (G = 1.61 kcal mol1 ), FBA 4 (G = 3.03 kcal mol1 ), FBA 5 (G = 2.69 kcal mol1 ), FBA 6
(G = 3.50 kcal mol1 ), FBA 7 (G = 2.66 kcal mol1 ), FBA 8 (G = 6.93 kcal mol1 ), and FBA 9 (G = 3.91 kcal mol1 ).

Fig. 5. Binding afnities of FBAs toward the X. axonopodis FtsZ protein. The Kd value for each FBA was determined using the ELISA method. All assays were performed in
triplicate.

30

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

Fig. 6. Determination of the binding specicity of FBAs (500 nM) against X. axonopodis FtsZ by ELISA. B. anthracis FtsZ and BSA were used as negative controls and the
experiments were performed in triplicate.

3.5. In-vitro inhibition analysis

In order to identify potent inhibitory aptamers against X.
axonopodis FtsZ, we analyzed the inhibition effect of individual FBAs on FtsZ polymerization. This was done by monitoring
the degree of turbidity in the presence of FBAs via UV/vis spectrophotometer. Among FBAs, 3 different aptamers, FBA 2, 8, and
9, showed inhibitory effects with low micromolar IC50 values
(2.84 M, 1.25 M and 1.64 M, respectively) (Fig. 7A). To compare the inhibition potency of FBAs, we used berberine well-known
chemical inhibitor of E. coli FtsZ [33] as a positive control. We calculated an IC50 value for berberine with approximately 3.84 M,
which also had a strong inhibitory effect on X. axonopodis FtsZ. In
addition, when we treated the 30 mer randomly scrambled aptamer
(Sc-apt) as a negative control, there is no effect on FtsZ polymerization activity (Fig. 7A). Furthermore, in order to identify the
inhibitory specicity, two groups of FBAs, the inhibitory FBAs (FBA
2, 8, 9) against X. axonopodis FtsZ and FBA 5, 7 which was considerably bound to B. anthracis FtsZ, were tested. As shown in Fig. 7B, the
FBAs are not given any inuence on B. anthracis FtsZ polymerization
activity as treated up to 30 M. The FBA 2, 8, and 9 exhibited considerably great inhibition ability in X. axonopodis FtsZ polymerization
and not in B. anthracis FtsZ. An oligo-nucleic acid based aptamer
can discriminate to their targets on the basis of subtle structural
differences such as presence or absence of a functional group and
enantiomer of the target [34]. Furthermore, a protein targets with a
high structural complexity allow aptamer binding by various interactions such as stacking interaction, electrostatic interaction, and
hydrogen bonding [35]. Therefore, aptamers can bind to variable
region of target. Even though two species of FtsZ protein have 50%
sequence identity between their sequences, these inhibitory FBAs
might interact with some particular domain of X. axonopodis FtsZ
and act as an inhibitor for the FtsZ polymerization. Although FBA
5 and FBA 7 bind both species of FtsZ similarly, these FBAs could
not show any inhibition effect against X. axonopodis and B. anthracis
FtsZ. It means that the interaction between FBAs and target protein

was unrelated with polymerization activity, and the FBA binding

site and FtsZ GTPase activity region is also different. Consequently,
the FBA 2, 8, and 9 exhibited high levels of in-vitro inhibition activity. Specically, FBA 8 showed the best inhibition potency with high
binding afnity and specicity against X. axonopodis FtsZ.
3.6. Inhibition potency of FBAs at the cellular level
To verify the cellular inhibition effects of candidate FBAs, we
carried out a surface viable counting assay with 103 CFU ml1
of cells on a NYA plate. As shown in Fig. S4, the assay was conducted with 100 M berberine as a positive control, random 30
mer of Sc-apt as a negative control and with various concentrations of inhibitory FBAs (FBA 2, 8, and 9). In the case of berberine,
a high level of inhibition of bacterial cell growth was seen (Fig.
S4). Although the inhibitory FBAs exhibited inhibitory properties
at higher concentrations than berberine, they were shown to be
potent inhibitors of bacterial cell growth in a concentration dependent manner. As the concentrations of FBAs increased, the number
of colonies dramatically decreased (Fig. S4). As a result, the MIC50
values for each inhibitory FBA were estimated to be 121.84 M for
FBA 2, 111.68 M for FBA 8, and 117.49 M for FBA 9 (Fig. 8A and
B) corresponding with the previous IC50 values for the FBAs. This
result indicates that the antibacterial effect was strong in the presence of the FBAs, as efcient binding of each FBA to the FtsZ protein
blocked polymerization. In contrast, random Sc-apt (N30 ) could not
show any inhibition effect in bacterial cell growth. It means that
the inhibitory FBAs targeted specically to FtsZ and have a growth
inhibition function of X. axonopodis. Furthermore, cell cytotoxicity
assay was carried out to conrm that the growth inhibition of X.
axonopodis is not caused by the toxic effect of FBAs on the bacterial
cells. Cytotoxicity test was performed using murine macrophage
cell line Raw 264.7. The inhibitory FBAs are not given any toxic
effect on murine macrophage cell line as treated up to 400 M
(Fig. S5). It indicates that these candidate FBAs are not inuence

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

31

Fig. 7. In-vitro inhibition analysis of X. axonopodis FtsZ polymerization by FBAs. (A) Determination of the IC50 values for the candidate FBAs (FBA 2, 8, and 9), berberine. FBA
8 showed the lowest IC50 value which means it had a stronger inhibitory effect on FtsZ polymerization than berberine did. Random Sc-apt had no inuence on X. axonopodis
FtsZ polymerization. (B) Inhibition analysis of B. anthracis FtsZ polymerization by FBAs (30 M). FBAs had no effect on B. anthracis FtsZ polymerization.

on mammalian cells that does not have FtsZ inside the cell, and
only FtsZ targeted inhibitory aptamers cause the growth inhibition
of X. axonopodis that express the FtsZ inside the cell. Therefore, FBAs

may serve as efcient regulators of polymerization for FtsZ activity,

Z-ring formation and even the bacterial cell growth. In the respect
of FBAs characteristics, the FBA 8 exhibited the highest specicity

Fig. 8. Evaluation of the antibacterial ability of candidate FBAs at cellular level using the surface viable counting method. (A) Histogram of bacteria viability after treatment
with FBAs, berberine, and Sc-apt. (B) Determination of MIC50 values for each candidate FBA.

32

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

and inhibition potency, and may be an attractive candidate as a

citrus canker prevention agent on FtsZ inhibition.
Although the FBAs had lower in-vitro IC50 values than berberine at the protein level, berberine showed more potent bacterial
growth inhibition at the cellular level. Because the FtsZ protein is
localized throughout the cytoplasm in bacteria, thus an inhibitor
targeted to FtsZ would need to penetrate the bacterial cell membrane. However, inhibitory FBAs of high molecular weights (MW)
and hydrophilicities have a difcult time passing through the bacterial cell membrane. Typically, molecules less than 500 Da can
penetrate the membrane more easily than larger molecules [36].
Herein, the average MW of the FBAs used was approximately
9.0 kDa (20-fold larger than berberine (407.84 Da)). This explains
why the FBAs, which had lower efciency in cell penetration,
showed less bacterial cell growth inhibition than berberine did.
An electrical repulsive force also exists between the hydrophilic
properties of oligonucleic acids and gram negative bacterial cell
membranes [37], thus FBAs could not penetrate into cell membranes easily. According to Lipinskis rule, antibacterial compounds
should have specic physicochemical properties such as MW,
lipophilicity, and hydrogen bond donors and acceptors [36,37].
Actually, the membrane penetration mechanism of aptamer is not
clearly understood. As comparing to the small chemical inhibitor,
berberine, which have advantages such as small size and membrane permeability, the inhibitory FBAs have a weak point in this
aspect [38]. However, the FBAs identied by this study showed
signicantly specic inhibition against X. axonopodis FtsZ. This
remarkable target specicity of FBAs could be superiority above
non-selectivity of berberine [26,33]. Therefore, the FBAs could be
provided signicant basis for development of eco-friendly and target specic anti-citrus canker agent. Further studies will be needed
to validate a target identication and improve the inhibitory effect
of FBAs of the cellular level by modication of candidate aptamer
such as optimum structure by size control and enhancement of
hydrophobicity by attaching a chemicals.
4. Conclusion
In this study, we identied and evaluated a potent ssDNA
aptamers as a potential X. axonopodis FtsZ inhibitors. Specically,
we cloned gene encoding the FtsZ into a pET 28a (+) expression vector and puried the recombinant FtsZ protein using Ni2+ -charged
afnity chromatography. Using a SELEX process, 9 aptamers with
high afnity and specicity were identied and characterized. The
binding afnity of these FBAs toward FtsZ was measured to be in the
44444 nanomolar range of Kd value. Among these aptamers, FBA
2, 8, and 9 showed strong inhibitory effects on FtsZ polymerization
with IC50 values of 1 to 2 M, and on bacterial growth inhibition,
with MIC50 values of 100 M. In addition, these candidate aptamers
did not show any cytotoxicity against murine macrophage cells.
In conclusion, we suggest that the FtsZ protein may play a significant key role in the development of a novel antibacterial agents.
The inhibitory FBAs, especially FBA 8, could be viable alternative
for the existing chemical-based antibacterial agents as eco-friendly
prevention agents for citrus canker. However, the internalization of
inhibitory aptamer has yet not clearly understood. Further study
would be required for identication of target, evaluation of the
FBAs as anti-citrus canker agent via a plant-based inhibition test,
and modication of the FBAs structure to improve their inhibitory
effects.
Acknowledgements
This work was supported by the Cooperative Research Program
grants for Agriculture Science & Technology Development (Project

No. PJ008264) funded by the Rural Development Administration,

Republic of Korea and by Agricultural Biotechnology Development
Program, Ministry of Agriculture, Food and Rural Affairs, Republic
of Korea (314013-3).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.procbio.2015.11.
008.
References
[1] L.M. Rodriguez-R, A. Grajales, M.L. Arrieta-Ortiz, C. Salazar, S. Restrepo, A.
Bernal, Genomes-based phylogeny of the genus Xanthomonas, BMC
Microbiol. 12 (2012) 43.
[2] J. Boch, U. Bonas, Xanthomonas AvrBs3 family-type III. Effectors: discovery
and function, Annu. Rev. Phytopathol. 48 (2010) 419436.
[3] S.D. Ellis, M.J. Boehm, D. Coplin, in: K.L. Smith (Ed.), Bacterial Diseases of
Plants, The Ohio State University, 2008, 2015, pp. 14.
[4] H.P. Erickson, D.E. Anderson, M. Osawa, FtsZ in bacterial cytokinesis:
cytoskeleton and force generator all in one, Microbiol. Mol. Biol. Rev. 74
(2010) 504528.
[5] S. Kapoor, D. Panda, Targeting FtsZ for antibacterial therapy: a promising
avenue, Expert Opin. Ther. Targets 13 (2009) 10371051.
[6] E. Harry, L. Monahan, L. Thompson, Bacterial cell division: the mechanism and
its precison, Int. Rev. Cytol. 253 (2006) 2794.
[7] J. Lutkenhaus, The regulation of bacterial cell division: a time and place for it,
Curr. Opin. Microbiol. 1 (1998) 210215.
[8] J. Lutkenhaus, Assembly dynamics of the bacterial MinCDE system and spatial
regulation of the Z ring, Annu. Rev. Biochem. 76 (2007) 539562.
[9] C. Schaffner-Barbero, M. Martin-Fontecha, P. Chacon, J.M. Andreu, Targeting
the assembly of bacterial cell division protein FtsZ with smll molecules, ACS
Chem. Biol. 7 (2012) 269277.
[10] D. Awasthi, K. Kumar, I. Ojima, Therapeutic potential of FtsZ inhibition: a
patent perspective, Expert Opin. Ther. Pat. 21 (2011) 657679.
[11] D.J. Haydon, N.R. Stokes, R. Ure, G. Galbraith, J.M. Bennett, D.R. Brown, P.J.
Baker, V.V. Barynin, D.W. Rice, S.E. Sedelnikova, J.R. Heal, J.M. Sheridan, S.T.
Aiwale, P.K. Chauhan, A. Srivastava, A. Taneja, I. Collins, J. Errington, L.G.
Czaplewski, An Inhibitor of FtsZ with potent and selective anti-staphylococcal
activity, Science 321 (2008) 16731675.
[12] B. Vulevic, J.J. Correia, Thermodynamic and structural analysis of microtubule
assembly: the role of GTP hydrolysis, Biophys. J. 72 (1997) 13571375.
[13] W. Vollmer, The prokaryotic cytoskeleton: a putative target for inhibitors and
antibiotics? Appl. Microbiol. Biotechnol. 73 (2006) 3747.
[14] Q. Huang, P.J. Tonge, R.A. Slayden, T. Kirikae, I. Ojima, FtsZ: a novel target for
tuberculosis drug discovery, Curr. Top. Med. Chem. 7 (2007) 527543.
[15] R.L. Lock, E.J. Harry, Cell-division inhibitors: new insights for future
antibiotics, Nat. Rev. Drug Discov. 7 (2008) 324338.
[16] X. Li, S. Ma, Advances in the discovery of novel antimicrobials targeting the
assembly of bacterial cell division protein FstZ, Eur. J. Med. Chem. 95 (2015)
115.
[17] T. Hermann, D.J. Patel, Adaptive recognition by nucleic acid aptamers, Science
287 (2000) 820825.
[18] R. Stoltenburg, C. Reinemann, B. Strehlitz, SELEX-A (r) evolutionary method to
generate high-afnity nucleic acid ligands, Biomol. Eng. 24 (2007) 381403.
[19] R. Stoltenburg, C. Reinemann, B. Strehlitz, FulMag-SELEX as an advantageous
method for DNA aptamer selection, Anal. Bioanal. Chem. 383 (2005) 8391.
[20] S.K. Kim, B.C. Shin, T.A. Ott, W. Cha, I.J. La, M.Y. Yoon, SELEX. Combinatorial
library methodology and applications, Biochip J. 2 (2008) 97102.
[21] J.S. Choi, S.G. Kim, M. Lahousse, H.Y. Park, H.C. Park, B. Jeong, J. Kim, S.K. Kim,
M.Y. Yoon, Screening and characterization of high-afnity ssDNA aptamers
against anthrax protective antigen, J. Biomol. Screen 16 (2011) 266271.
[22] A. Mukherjee, J. Lutkenhaus, Analysis of FtsZ assembly by light scattering and
determination of the role of divalent metal cations, J. Bacteriol. 181 (1999)
823832.
[23] M. Citartan, T.H. Tang, S.C. Tan, C.H. Hoe, R. Saini, J. Tominaga, S. Gopinath,
Asymmetric PCR for good quality ssDNA generation towards DNA aptamer
production, Songklanakarin J. Sci. Technol. 34 (2012) 125131.
[24] M. Zuker, On nding all suboptimal foldings of an RNA molecule, Science 244
(1989) 4852.
[25] M. Zuker, Mfold web serber for nucleic acid folding and hybridization
prediction, Nucleic Acids Res. 31 (2003) 34063415.
[26] H.C. Park, V. Gedi, J.H. Cho, J.W. Hyun, K.J. Lee, J. Kang, B. So, M.Y. Yoon,
Characterization and in vitro inhibition studies of Bacillus anthracis FtsZ: a
potential antibacterial target, Appl. Biochem. Biotechnol. 172 (2014)
32633270.
[27] O.S. Kolovskaya, A.G. Savitskaya, T.N. Zamay, I.T. Reshetneva, G.S. Zamay, E.N.
Erkaev, X. Wang, M. Wehbe, A.B. Salmina, O.V. Perianova, O.A. Zubkova, E.A.
Spivak, V.S. Mezko, Y.E. Glazyrin, N.M. Titova, M.V. Berezovski, A.S. Zamay,
Development of bacteriostatic DNA aptamers for Salmonella, J. Med. Chem. 56
(2013) 15641572.

N.-R. Ha et al. / Process Biochemistry 51 (2016) 2433

[28] E.L. White, L.J. Ross, R.C. Reynolds, L.E. Seitz, G.D. Moore, D.W. Borhani, Slow
polymerization of Mycobacterium tuberculosis FstZ, J. Bacteriol. 182 (2000)
40284034.
[29] M.A. Jackson, J.S. Frymier, B.J. Wilkinson, P. Zorner, S. Evans, Growth
requirements for production of stable cells of the bioherbicidal bacterium
Xanthomonas campestris, J. Ind. Microbiol. Biotechnol. 21 (1998) 237241.
[30] G. Sezonov, D. Joseleau-Petit, R. DAri, E. coli physiology in Luria-Bertani Broth,
J. Bacteriol. 189 (2007) 87468749.
[31] K.D. Passalacqua, N.H. Bergman, J.Y. Lee, D.H. Sherman, P.C. Hanna, The global
transcriptional responses of Bacillus anthracis Sterne (34F2 ) and sodA1
mutant to paraquat reveal metal ion homeostasis imbalances during
endogenous superoxide stress, J. Bacteriol. 189 (2007) 39964013.
[32] T.R. Rustad, K.J. Minch, W. Brabant, J.K. Winkler, D.J. Reiss, N.S. Baliga, D.R.
Sherman, Global analysis of mRNA stability in Mycobacterium tuberculosis,
Nucleic Acids Res. 41 (2013) 509517.

33

[33] P.N. Domadia, A. Bhunia, J. Sivaraman, S. Swarup, D. Dasgupta, Berberine

targets assembly of E. coli cell division protein FtsZ, Biochemistry 47 (2008)
32253234.
[34] S.D. Jayasena, Aptamers an emerging class of molecules that rival antibodies
in diagnostics, Clin. Chem. 45 (1999) 16281650.
[35] B. Strehlitz, N. Nikolaus, R. Stoltenburg, Protein detection with aptamer
biosensors, Sensors 8 (2008) 42964307.
[36] K. Lewis, Platforms for antibiotic discovery, Nat. Rev. Drug Discov. 12 (2013)
371387.
[37] R. OShea, H.E. Moser, Physicochemical properties of antibacterial compounds:
implications for drug discovery, J. Med. Chem. 51 (2008) 28712878.
[38] L. Sun, Peptide-based drug development, Modern Chem. Appl. 1 (2013)
12.