rotective mechanical ventilation with low tidal volume (Vt) and low plateau pressure has been shown
to reduce mortality and decrease the length of mechanical ventilation in patients with acute respiratory distress syndrome (ARDS) compared with traditional high Vt
ventilation.1 Prospectively, the ARDS Network database
revealed beneficial effects of decreasing Vt from 12 mL/kg
predicted body weight (PBW) to 6 mL/kg PBW regardless
of plateau pressures.1 The efficacy of protective ventilation
in acute lung injury (ALI) and ARDS has resulted in a
progressive decrease in Vt used by clinicians during surgery in patients with normal lungs. This practice has
developed without evidence-based support. In a review,
Schultz et al.2 recommended the use of Vt 10 mL/kg,
From the Department of Anesthesiology, University of Medicine and
Dentistry of New JerseyNew Jersey Medical School, Newark, New Jersey.
Accepted for publication November 24, 2009.
Supported by Department of Anesthesiology, University of Medicine and
Dentistry of New JerseyNew Jersey Medical School, Newark, NJ.
Disclosure: The authors report no conflicts of interest.
Address correspondence to Ellise Delphin, MD, MPH, UMDNJNew Jersey
Medical School, 185 South Orange Ave., MSB E-538, Newark, NJ 07103.
Address e-mail to delphiel@umdnj.edu.
Copyright 2010 International Anesthesia Research Society
DOI: 10.1213/ANE.0b013e3181cfc416
1652
www.anesthesia-analgesia.org
plateau pressure 15 to 20 cm H2O, and positive endexpiratory pressure (PEEP) 5 cm H2O to ventilate patients
with normal lungs, based on expert opinion and currently
available evidence.
Ventilator-induced lung injury (VILI) has been described after ventilation with high volume and pressure
(barotrauma) and low volume secondary to cyclic opening
and closure of peripheral airways.3,4 Ex vivo models of
normal rodent lungs ventilated with physiologic Vt
caused functional alterations, histologic injury, and release of proinflammatory cytokines.5,6 Subsequent in
vivo studies in normal anesthetized rabbits ventilated at
low Vts revealed histologic injury and increases in
airway resistance.7 Extensive histologic damage with
airway closure results in cytokine release.8 Small-animal
studies have demonstrated increases in cytokines, tumor
necrosis factor (TNF)-, interleukin (IL)-1, IL-6, and
IL-8 with large Vt and long-duration mechanical ventilation.5,6,9,10 Human prospective studies comparing mechanical ventilation strategies have had inconsistent
results.1113 Studies of short-duration mechanical ventilation have found no differences in release of mediators.
Others have demonstrated increased levels of inflammatory mediators and poorer outcomes in patients ventilated with large Vts for longer periods of time.14 17
June 2010 Volume 110 Number 6
METHODS
The study was approved by the New Jersey Medical School
Animal Care and Use Committee. Female Yorkshire pigs
(Animal Biotech Industries, Danboro, PA) weighing approximately 30 kg were acclimatized over a period of 5 to
7 days before procedures. The study strictly abided by the
guidelines of the National Institutes of Health Guide for the
Care and Use of Laboratory Animals.
Animal Preparation
Female pigs were anesthetized with ketamine (20 mg/kg,
IM) and xylazine (2.0 mg/kg, IM) and placed in the supine
position. Each animal was intubated with an endotracheal
tube and end-tidal CO2 was verified. Anesthesia was
maintained with 2 minimal alveolar concentration isoflurane. The femoral artery was cannulated with a 22-gauge
catheter and used for continuous arterial blood pressure
monitoring. The right carotid artery was cannulated with a
20-gauge catheter. This catheter tip was at the junction of
the aortic arch and was verified postmortem. The internal
jugular vein was cannulated with an 8F sheath. A pulmonary artery catheter (Swan-Ganz) was inserted, and pulmonary artery pressures were continuously monitored. These
procedures were completed within 1 hour of intubation
(Fig. 1).
Experimental Protocol
Vital signs including temperature, heart rate, arterial blood
pressure, and oxygen saturation were continuously monitored and recorded every 15 minutes. Heart rate was
maintained between 120 and 140 bpm, mean arterial blood
pressures at 70 to 72 mm Hg, and pulmonary artery
pressures (systolic) at 20 to 23 mm Hg (Table 1). Temperature was maintained at 99 to 103F using an appropriate
warming or cooling apparatus (i.e., forced-air warmer/
cooler) and oxygen saturation at 98% to 100%. Normal
saline (0.9%) was administered as maintenance fluid at a
rate of 4 to 8 mL/kg/h, with all animals receiving similar
amounts of total IV fluids over 8 hours. Hypotension, as
defined by a mean arterial blood pressure 50, was treated
with fluid boluses of 250 mL of normal saline (0.9%). Mean
airway pressure and peak inspiratory pressure (PIP) were
monitored continuously and recorded every 30 minutes.
Arterial blood gas samples were obtained hourly. Preand postpulmonary blood samples were obtained from the
pulmonary artery and aortic catheters, respectively, hourly
for 8 hours after intubation.
At the completion of 8 hours of mechanical ventilation,
a bronchoalveolar lavage (BAL) was performed. All animals were then humanely euthanized. Tissue samples from
the right upper lobes (RULs) and right lower lobes (RLLs)
of the lung were harvested and stored at 80C under
sterile conditions. Samples of each tissue were immediately
fixed for histologic analysis.
Ventilation Protocol
Animals were randomized into 3 groups and their lungs
ventilated with volume control using a Drager Narkomed 4
ventilator (Drager). Group H-Vt/3 (n 6) was ventilated
with a Vt of 15 mL/kg and 3 cm H2O PEEP. Group L-Vt/3
(n 6) was ventilated with a Vt of 6 mL/kg and 3 cm H2O
PEEP. Group L-Vt/10 (n 6) was ventilated with a Vt of
6 mL/kg and 10 cm H2O PEEP. Respiratory rate was
adjusted to maintain Paco2 at 35 to 50 mm Hg and pH at
7.35 to 7.5. The inspiratory/expiratory ratio was 1:2. The
fraction of inspired oxygen (Fio2) was maintained at 50%
throughout the procedure for all animals. Arterial blood
gas samples were taken hourly to verify adequate oxygenation, ventilation, and acid-base status.
Bronchoalveolar Lavage
BAL was performed after the completion of 8 hours of
mechanical ventilation before euthanization. Twenty milliliters of sterile normal saline was used for the lavage. The
volume of return was recorded and the samples were
centrifuged for 15 minutes at 2500g. The supernatant was
aliquoted and stored at 80C until the time of assays. BAL
protein concentration was determined using a refractometer (TS400, Reichert, Depew, NY).
Cytokine Measurements
Ten milliliters of serum from each sample was collected in
15-mL nonpyrogenic, sterile falcon tubes prelung (pulmonary artery) and postlung (aortic arch). Each sample was
centrifuged at 2500g for 15 minutes at 4C to remove
cellular components, and the supernatant was aliquoted
and immediately stored at 80C until the time of assays.
BAL and plasma concentrations of TNF-, IL-1, IL-6,
IL-8, IL-10, and IL-12 were measured using commercially
available enzyme-linked immunosorbent assay kits (R&D
Systems, Minneapolis, MN) that contained respective standards for production of standard curves and controls. All
enzyme-linked immunosorbent assays were performed by
www.anesthesia-analgesia.org
1653
72 4.5
111 4.2
L-VT/3
L-VT/10
70 3.7
113 3.3
69 4.5
109 6.4
7.5 0.007*
32.5 0.5
247 9.2
35 1.8*
15 mL/kg
3
7.44 0.007
33.3 0.6
222 7.5
47 1.8
6 mL/kg
3
7.39 0.03
34.4 0.7
251 10.7
50 2.0
6 mL/kg
10
9.3 0.3
26.4 0.87
12 0.5
6.9 0.4
17.7 1.28
34 0.5
14.7 0.7
23.6 0.70
30 1.1
After 1 h.
* P 0.02 compared with other groups.
P 0.002 compared with other groups.
P 0.005 compared with L-VT/3.
P 0.001 compared with other groups.
a single researcher following the guidelines from the manufacturer and were analyzed at 450 nm using SOFTmax PRO
4.3 LS software (Molecular Devices, Sunnyvale, CA). Background absorbency of blank wells was subtracted from
standards and unknown samples before determining concentrations. The detection limits for these kits were 3.7 pg/mL for
TNF-, 10 pg/mL for IL-1, and IL-6, 4.6 pg/mL for IL-8, 3.5
pg/mL for IL-10, and 9 pg/mL for IL-12.
RLL lung tissues previously stored at 80C were homogenized, and total RNA was extracted using the TRIzol Isolation
Kit (Invitrogen Life Technologies, Carlsbad, CA) according to
the manufacturers protocol. Purified RNA 200 ng was reverse
transcribed, generating cDNA by using the manufacturers
protocol for the Retroscript Detection Kit (Ambion, Austin,
TX). Amplification and detection of specific products were
performed using the ABI PRISM 7700 Sequence Detection
System with the cycle profile according to the protocol for the
ABsolute SYBR Green ROX Mix Kit (ABgene, Rockford, IL).
As an internal control, glyceraldehyde-3-phosphate dehydrogenase primers were used for RNA template normalization.
Fluorescent signals were normalized to an internal reference,
and the threshold cycle (Ct) was set within the exponential
phase of the polymerase chain reaction (PCR). The target PCR
Ct values were normalized by subtracting the glyceraldehyde-3phosphate dehydrogenase Ct value (Ct). The relative
expression level between treatments was then calculated
using the following equation: relative gene expression
2(Ct sample Ct control). Each sample was tested in
triplicate. The primers (5-3) used for each cytokine were
([S]-sense and [AS]-antisense):
TNF-: [S] GCAACCTGGGACATCTGGAATG/[AS]
GGTGAAATCTTCTCAAGGAATGTTCTG
IL-1: [S] CCCTACCCTCTCTAGCCAGTCTAC/[AS]
TGTTGTCACCATTGTTAGCCATCAC
IL-6:
[S]
ATGAACTCCCTCTCCACAAGCG/[AS]
GCATCACCTTTGGCATCTTCTTCC
1654
www.anesthesia-analgesia.org
IL-8:
[S]
GGACCAGAGCCAGGAAGAGAC/[AS]
GGGTGGAAAGGTGTGGAATGC
IL-10: [S] TTTCTTTCAAACGAAGGACCAGATG/[AS]
GCAACCCAGGTAACCCTTAAAGTC
IL-12: [S] CTGAAGTCTCTCCTAACCTTAAAGTC/[AS]
CCCAGTTCCTAACCCATACCC
Histology
The lungs harvested from the pigs were immediately fixed
in 10% buffered formalin. Samples from the most dorsal
portion of the RLL and the most ventral portion of the RUL
were selected and fixed. After fixation, the tissue samples
were dehydrated and embedded in paraffin blocks. The
sections were cut to 4-m thickness and stained with
hematoxylin and eosin (H&E). A surgical pathologist,
blinded to the study variables, evaluated each sample
histologically to determine a lung injury score. Our definition of lung injury score was a quantitative measurement to
determine the extent of lung inflammation and damage in
each animal and to stratify the level of injury by the totals.
Five random fields were analyzed using light microscopy
at 100 magnification. Each lung section was analyzed
using a histologic grading scale based on the work of
Claridge et al.18 This histologic grading scale scored inflammation (0 3), interstitial edema (0 3), congestion (0 3),
atelectasis (0 3), alveolar integrity (0 3), acute inflammation (0 3), and interstitial thickening (0 3). The total lung
injury score ranged from 0 to 21, 0 representing minimal to
no damage and 21 the worst damage possible.
Statistical Analysis
All data were statistically analyzed using SPSS version 15.0
(SPSS, Chicago, IL). The 3 groups were compared using
1-way analysis of variance with appropriate use of post hoc
analysis to isolate significant between-group differences.
Results were expressed as mean sem. P values 0.05
were considered significant.
RESULTS
Effects of Different Ventilator Strategies on
Hemodynamics and Gas Exchange
All hemodynamic variables were similar within all 3
groups and maintained within the ranges noted in the
Methods section. All animals requiring fluid boluses responded appropriately and no other intervention was
necessary to maintain hemodynamic variables.
pH was between 7.35 and 7.5 during the protocol in all
animals. There was a significant difference in pH between
the high- and low-Vt strategies. Group H-Vt/3 had significantly higher pH (7.5 0.008) than group L-Vt/3 (7.44
0.008) and group L-Vt/10 (7.39 0.03) (Table 1).
Paco2 was between 33 and 55 mm Hg in all groups.
Group H-Vt/3 maintained significantly lower Paco2 from
hour 1 through hour 8. Both low-Vt strategies had significantly higher Paco2 than H-Vt/3 after 1 hour of mechanical ventilation (Fig. 2A). Partial pressure of arterial oxygen
(Pao2) was similar in all 3 groups (Fig. 2B).
Respiratory rate was significantly different between the
high- and low-Vt strategies because it was adjusted to
maintain a Paco2 55 mm Hg in all groups. There were no
differences in respiratory rate between the 2 low-Vt strategy groups.
Figure 2. Effects of different ventilation strategies on PaCO2 and
PaO2. A, PaCO2 over 8 hours of mechanical ventilation. *P 0.05,
group H-VT/3 versus groups L-VT/3 and L-VT/10. #P 0.001, group
L-VT/3 versus group L-VT/10 at hour 1. B, PaO2 over 8 hours of
mechanical ventilation.
Figure 3. Effects of different ventilator strategies on airway mechanics. A, Average mean airway pressure mean SEM over 8 hours of
mechanical ventilation. *P 0.002, group H-VT/3 versus group L-VT/3 after hour 3. **P 0.001, group L-VT/10 versus other groups. B,
Average peak inspiratory pressures mean SEM over 8 hours of mechanical ventilation. *P 0.005, group H-VT/3 versus group L-VT/3. **P
0.005, group L-VT/3 versus other groups. ***P 0.01, group L-VT/10 versus group H-VT/3 after hour 6.
www.anesthesia-analgesia.org
1655
Figure 4. Effects of 8 hours of mechanical ventilation on bronchoalveolar lavage (BAL). A, Significant cytokine levels in BAL mean SEM.
*P 0.001, group L-VT/10 versus other groups. B, BAL protein
concentration mean SEM. *P 0.001, group H-VT/3 versus other
groups. **P 0.001, group L-VT/3 versus other groups. ***P
0.001, group L-VT/10 versus other groups. C, mRNA of right lower
lobe lung tissue mean SEM. *P 0.05, group L-VT/10 versus other
groups.
1656
www.anesthesia-analgesia.org
DISCUSSION
demonstrated the unique findings depicted with each representative histologic slide. The RUL was similar histologically, revealing a range of inflammatory cell migration,
vascular congestion, and alveolar and perivascular edema
www.anesthesia-analgesia.org
1657
1658
www.anesthesia-analgesia.org
Differences in chest wall anatomy between pigs and humans may cause differences in the injury caused by mechanical ventilation. The study was performed on a small
number of young swine. Their lungs may react differently
than those of older animals or humans ventilated similarly.
Because of the ventilator used, we were unable to measure
plateau pressure, auto-PEEP, or pressure volume loops.
Our inability to measure end-inspiratory pressure limits
the ability to determine whether the results were caused by
PEEP or by tidal overdistention due to high-end pressure.
Future studies should be done to correlate the relationship
between high PEEP ventilation and plateau pressures. We
performed a single BAL at the end of 8 hours of mechanical
ventilation rather than at multiple time points during the
protocol. We were unable to distinguish whether each
cytokine increased at different time points or constantly
throughout ventilation. The BAL samples were taken before euthanasia to eliminate any effects from the physiologic changes caused by euthanasia in the samples (i.e.,
decreased cardiac output and hypoxia). Finally, our 3
ventilation strategies used a PEEP of either 3 or 10 cm H2O.
Additional research is needed to determine the effects of
PEEP within this range (i.e., PEEP of 5 or 8 cm H2O). It
would be valuable to determine a level of PEEP above
which lung injury occurs.
CONCLUSIONS
We demonstrated that mechanical ventilation with high PEEP
associated with high mean airway pressures resulted in
increased pulmonary inflammation. Low PEEP resulted in
lower levels of inflammatory markers. High Vt (15 mL/kg
PBW), low PEEP (3 cm H2O), and low mean airway pressure
resulted in less pulmonary inflammation and parenchymal
damage in normal, noninjured animal lungs compared with
other low-Vt mechanical ventilation strategies. These findings
support the use of larger Vts and PEEP 10 cm H2O to
ventilate patients with normal lungs. Pulmonary physiology
is dramatically different between ARDS and noninjured
lungs. We have demonstrated that ventilation strategies used
in patients with ARDS may not be appropriate for patients
with noninjured lungs. We believe that the question of which
ventilatory strategy will protect normal human lungs remains unanswered. Large human clinical trials with outcome
analysis remain necessary to elucidate the best strategy for
ventilation of uninjured lungs to improve postoperative recuperation and morbidity.
REFERENCES
1. Amato MBP, Barbas CSV, Medeiros DM, Magaldi RB, Schettino GP, Lorenzi-Filho G, Kairalla RA, Deheinzelin D, Munoz
C, Oliveira R, Takagaki TY, Carvalho CRC. Effect of protectiveventilation strategy on mortality in the acute respiratory
distress syndrome. N Engl J Med 1998;338:34754
2. Schultz MJ, Haitsma JJ, Slutsky AS, Gajic O. What tidal
volumes should be used in patients without acute lung injury?
Anesthesiology 2007;106:1226 31
3. Dreyfuss D, Saumon G. Ventilator-induced lung injury: lessons
from experimental studies. Am J Respir Crit Care Med
1998;157:294 323
4. DAngelo E, Pecchiari M, Della Valle P, Koutsoukou A, MilicEmili J. Effects of mechanical ventilation at low lung volume
on respiratory mechanics and nitric oxide exhalation in normal
rabbits. J Appl Physiol 2005;99:433 44
www.anesthesia-analgesia.org
1659
1660
www.anesthesia-analgesia.org