Anda di halaman 1dari 20

Peptide nucleic acid (PNA): its medical and

biotechnical applications and promise for the future


ARGHYA RAY AND BENGT NORDEN1
Department of Physical Chemistry, Chalmers University of Technology, S 412 96, Gothenburg,
Sweden
ABSTRACT
Synthetic molecules that can bind with
high sequence specificity to a chosen target in a gene
sequence are of major interest in medicinal and
biotechnological contexts. They show promise for
the development of gene therapeutic agents, diagnostic devices for genetic analysis, and as molecular
tools for nucleic acid manipulations. Peptide nucleic
acid (PNA) is a nucleic acid analog in which the sugar
phosphate backbone of natural nucleic acid has been
replaced by a synthetic peptide backbone usually
formed from N-(2-amino-ethyl)-glycine units, resulting in an achiral and uncharged mimic. It is chemically stable and resistant to hydrolytic (enzymatic)
cleavage and thus not expected to be degraded
inside a living cell. PNA is capable of sequencespecific recognition of DNA and RNA obeying the
Watson-Crick hydrogen bonding scheme, and the
hybrid complexes exhibit extraordinary thermal stability and unique ionic strength effects. It may also
recognize duplex homopurine sequences of DNA to
which it binds by strand invasion, forming a stable
PNA-DNAPNA triplex with a looped-out DNA
strand. Since its discovery, PNA has attracted major
attention at the interface of chemistry and biology
because of its interesting chemical, physical, and
biological properties and its potential to act as an
active component for diagnostic as well as pharmaceutical applications. In vitro studies indicate that
PNA could inhibit both transcription and translation
of genes to which it has been targeted, which holds
promise for its use for antigene and antisense therapy. However, as with other high molecular mass
drugs, the delivery of PNA, involving passage
through the cell membrane, appears to be a general
problem.Ray, A., Norden, B. Peptide nucleic acid
(PNA): its medical and biotechnical applications and
promise for the future. FASEB J. 14, 10411060
(2000)

Key Words: DNA PNA-DNA hybridization antigene antisense gene therapy nucleic acid biosensor

Peptide nucleic acids (PNA) originated from efforts during the 1980s in organic chemist Prof. Ole
Buchardts laboratory in Copenhagen together with
0892-6638/00/0014-1041/$02.25 FASEB

biochemist Peter Nielsen to develop new nucleic


acid sequence-specific reagents. Based on the observation with flow linear dichroism that -helical poly-benzylglutamate (PBG) can form stacked complexes with aromatic chromophores, it was proposed
that PBG with alternating nucleobases and acridine
moieties instead of phenyls might bind sequence
selectively to duplex DNA by combined Hoogsteen
base pair formation and intercalation with the helix
backbone in the major groove. The proposed peptide nucleobase compound was given the ad interim
name peptide nucleic acid, or PNA.
Todays PNAs (Fig. 1) are DNA analogs in which a
2-aminoethyl-glycine linkage generally replaces the
normal phosphodiester backbone (1, 2). A methyl
carbonyl linker connects natural as well as unusual
(in some cases) nucleotide bases to this backbone at
the amino nitrogens. This simple and yet entirely
new synthetic molecule has an interesting and nonprototype chemistry. PNAs are non-ionic, achiral
molecules and are not susceptible to hydrolytic (enzymatic) cleavage. Despite all these variations from
natural nucleic acids, PNA is still capable of sequence-specific binding to DNA as well as RNA
obeying the Watson-Crick hydrogen bonding rules
(3, 4). Its hybrid complexes exhibit extraordinary
thermal stability and display unique ionic strength
properties. Although PNA was earlier considered
primarily a potential drug candidate for gene therapy, today there are three to four major groups of
applications for this novel compound. First, it can be
used as a molecular tool in molecular biology and
biotechnology (59). Second is its role as lead compound for the development of gene-targeted drugs
applying antigene or antisense strategy (10 12).
Third is the use of PNA for diagnostics purposes and
development of biosensors (1316). Fourth, the
study of basic chemistry is related to PNA (1720) for
the improvement of basic architecture, e.g., for
supramolecular constructs and to possibly generate a
subsequent generation of PNA molecules.
1
Correspondence: Department of Physical Chemistry, Chalmers University of Technology, S 412 96, Gothenburg, Sweden.
E-mail: norden@phc.chalmers.se; ray@phc.chalmers.se

1041

Figure 1. Chemical structure of PNA (left) and DNA (right).

This review will focus on different mechanistic


aspects in order to understand the physicochemical
and biological properties of PNA and PNAnucleic
acid complexes. We will discuss its mode of action in
relation to potential use as an antigene or antisense
agent and related developments for gene therapeutic application, detection systems for genetic analysis,
and novel tools for nucleic acid manipulation. Finally, the cellular delivery of peptide nucleic acids
will be discussed in light of recent progress in this
area.
Chemical properties and related methodology
This section will discuss, in brief, the synthesis and
purification of peptide nucleic acids. Then the physicochemical properties of PNAs, as characterized
from different biophysical measurements, will be
discussed.
Synthesis and purification
The backbone of PNA carries 2-aminoethyl glycine
linkages in place of the regular phosphodiester
backbone of DNA (1, 2), and the nucleotide bases
are connected to this backbone at the amino
nitrogens through a methylene carbonyl linker
(Fig. 1). Being achiral, peptide nucleic acids can
be synthesized without need of any stereoselective
pathway. PNA oligomers can be prepared following standard solid-phase synthesis protocols for
peptides (21, 22) using, for example, a (methylbenzhydryl)amine polystyrene resin as the solid
support (2327). The scheme for protecting the
amino groups of PNA monomers is based on either
Boc or Fmoc chemistry (2325). The postsynthetic
modification of PNA uses coupling of a desired
group to an introduced lysine or cysteine residue
in the PNA (23, 27). Amino acids can be coupled
during solid-phase synthesis or compounds containing a carboxylic acid group can be attached to
1042

Vol. 14

June 2000

the exposed amino-terminal amine group to modify PNA oligomers. A bis-PNA is prepared in a
continuous synthesis process by connecting two
PNA segments via a flexible linker composed of
multiple units of either 8-amino-3,6-dioxaoctanoic
acid or 6-aminohexanoic acid (28). It has been
found that changing cytosine to pseudoisocytosine
in the Hoogsteen strand abolishes the pH dependence of a DNAPNA-DNA triplex without affecting the stability of the triplex (28).
A subsequent generation of PNAs might contain
an unusual modification of the backbone or a
chimeric architecture. The latter is commonly
known as a PNA/DNA chimera, where a PNA
oligomer is fused to a DNA oligomer to give rise to
new architecture. The synthesis of PNAs with
modified backbones is carried out in a similar way.
PNA hetero-oligomers comprising normal aminoethylglycine and aminoproline building blocks
are prepared using Boc strategy (for details, see ref
29). Two principal strategies have been adopted to
facilitate the synthesis of PNA/DNA chimeras:
block condensation of presynthesized PNA and
DNA oligomers in solution, and stepwise, online
solid-phase synthesis with suitably protected monomeric building blocks. The second strategy has
been successful for the synthesis of chimera. Development of special protecting group strategies is
also going on. Koch et al. (30) have reported the
synthesis of a PNA pentadecamer carrying a heptapeptide attached to the NH2 terminus via a
tris(8-amino-3,6,-dioxaoctanoic acid) using Boc
peptide synthesis. The method made use of traditional PNA synthesis with Boc-benzyloxycarbonyl
strategy. The presence of the peptide does not
significantly affect the structure of the PNADNA
duplex. Betts et al. (31) have reported the synthesis of a PNA-peptide-PNA chimera where two pyrimidine PNA nanomers have been linked by a
his-gly-ser-ser-gly-his peptide. This construct is capable of forming a stable triple-helical complex
with an oligopurine complex (31).
Postsynthesis procedures involve cleaving PNA oligomers from the solid support by treatment with either
anhydrous hydrogenfluoride or trifluoromethanesulfonic acid, followed by high-performance liquid chromatography (HPLC) purification (23, 28, 32, 33). The
crude PNA products can also be cleaved from the solid
matrix by treatment with trifluoroacetic acid and mcresol (4:1) mixture. Then PNA is precipitated by
ice-cold diethyl ether and dissolved in 0.1% trifluoroacetic acid solution (23, 32, 33). Further purification
and subsequent characterization are done using reverse-phase HPLC, followed by matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF)
mass spectrometry (23, 28, 32, 33).

The FASEB Journal

RAY AND NORDEN

Physicochemical properties
Since peptide nucleic acids and DNA have no functional groups in common except for the nucleobases, the chemical stability of PNA differs significantly from its DNA counterpart. Unlike DNA, which
depurinates on treatment with strong acids, peptide
nucleic acids are fairly acid stable. However, some
chemical instability can derive from the free amino
functionality at the NH2 terminus, where a slow
N-acyl transfer of the nucleobase acetic acid or a
cleavage of the amino-terminal PNA unit by ring
closure can take place, particularly under basic conditions (34). PNAs are charge-neutral compounds
and hence have poor water solubility compared to
DNA. Neutral PNA molecules have a tendency to
aggregate to a degree that is dependent on the
sequence of the oligomer. PNA solubility is also
related to the length of the oligomer and purine:
pyrimidine ratio (35). Some recent modifications,
including the incorporation of positively charged
lysine residues (carboxyl-terminal or backbone modification in place of glycine), have shown improvement as to solubility. Negative charges may also be
introduced, especially for PNADNA chimeras,
which will enhance the water solubility. The extinction coefficients for PNA monomers are not as well
established as they are for DNA or RNA monomers.
It is expected that PNA oligomers should have
extinction coefficients different from their DNA or
RNA counterparts, as dissimilar backbones would
variously perturb the system of the nucleobases.
Since the extinction coefficients of different PNA
monomers are not well characterized and contributions of the peptide backbone to the perturbation in
the system of the nucleobases are not known, for
all practical purposes the concentration of a PNA
oligomer is determined by measuring the absorption
at 260 nm at 80C (36, 37). At that temperature, the
nucleobases are considered completely destacked
and contributions from an ordered backbone can be
assumed to be less important.
PNAs hybridize to complementary DNA and RNA
sequences in a sequence-dependent manner, following
the Watson-Crick hydrogen bonding scheme A, multistranded triplex structure containing both WatsonCrick and Hoogsteen base-pairing is also possible from
a 2:1 PNADNA complex (38 41) (Fig. 2). PNA-DNA
hybridization is severely affected by base mismatches
and PNA can maintain sequence discrimination up to
the level of a single mismatch. On the other hand, base
mismatches are less effective for corresponding DNADNA hybridization. Different properties as well as
structures of different PNAs and PNADNA complexes
have been well characterized by a combination of
various spectroscopic, crystallographic, and computational methods.
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

Figure 2. Schematic representation of different molecular


complexes formed on target-specific binding of PNA to DNA.
A) Formation of a prototype triple helical structure only
possible with cytosine-rich homopyrimidine PNAs. B) Stable
triplex invasion complex formed by homopyrimidine PNAs
binding to a homopurine DNA target. C) Double-duplex
invasion complex only possible with PNAs containing nonstandard nucleobases (116).

PNADNA/RNA and PNAPNA duplexes


The properties of various duplexes of PNA, both
pure and hybrid, have been investigated extensively
by absorption spectroscopy. The thermal melting
temperature (Tm), defined as the temperature at
which 50% of the complexes have been dissociated,
gives an idea of the stability of the PNA-DNA or
PNARNA duplex. Moreover, it provides information about different structural transitions. The PNA
oligomer H-TGTACGTCACAACTA-NH2 can form
an antiparallel duplex with complementary DNA
sequence, which has a Tm value of 70C. But the
corresponding DNADNA complex melts at only
53C. However, the corresponding parallel PNA
DNA duplex shows a transition temperature of 56C
(4). The thermal stability of a PNARNA duplex is
even higher than that of a PNADNA duplex (42). In
contrast to the pure DNA duplex, the stability of
PNADNA hybrids is not affected much by changes
in ionic strength except in the limit of low ionic
strength, where the stability increases. The binding
of PNA to a corresponding complementary DNA
oligomer takes place in a sequence-specific manner,
which means that the thermal stability of a hetero1043

TABLE 1. Thermal stabilities of PNADNA duplexes

DNA sequence

Melting
temperature

5-TTGTGAGGCACTGCC-3b
5-TTGTGAGACACTGCC-3
5-TTGTGAGACATTGCC-3
5-TTGTGAGGCGCTGCC-3
5-TTGTGAGGCACTGCC-3

72.3C
58.1C
39.0C
85C
69.9C

PNA sequence

H-egl-GGCAGTGCCTCACAA-NH2a
H-egl-GGCAGCGCCTCACAA-NH2

a
b
Self-melting of this PNA sequence is 44.7C.
The thermal melting temperature of the full complementary DNA duplex (5-TTGTGAGGCACTGCC-3 and its complementary sequence) is 42.2C.

duplex is considerably lowered by the presence of


mismatches. Corresponding DNA duplexes are not
affected by mismatches in this way. Owing to the
higher sequence specificity of PNA on binding to
nucleic acids, incorporation of any mismatch in the
duplex considerably affects the thermal melting temperature of the heteroduplex. For the heteroduplex
comprising the PNA oligomer H-egl-GGCAGTGCCTCACAA-NH2 (carboxyl-terminal) and its full complementary DNA 5-TTGTGAGGCACTGCC-3, a
mismatched incorporation of A in the in eighth
position of the DNA sequence, in place of G, reduces
the Tm value from 72.3C to 58.1C (Table 1; B.
Norden and co-workers, unpublished observations).
PNADNA chimeras also follow the basic WatsonCrick hydrogen bonding scheme on hybridization
with complementary DNA and RNA. The thermal
melting temperature of the duplex formed as a
result of the interaction between a PNA/DNA chimera and a DNA or RNA counterpart usually lies
between that of the corresponding PNADNA and
DNADNA duplexes. The Tm value of the chimera
DNA duplex also depends on the ratio of PNA and
DNA in the chimera strand and, above all, on the
nature and position of the linker molecule between
PNA and DNA bases (ref 29 and references therein).
Apart from these complexes with natural nucleic
acids, peptide nucleic acids can also bind to complementary sequences of PNA itself to form extremely
stable PNAPNA duplexes (43). Preference is found
for antiparallel duplexes with high melting temperatures compared to their hybrid (PNADNA duplex)
counterparts. The PNA decamer H-GTAGATCACTNH2 forms both antiparallel and parallel complexes
with complementary PNA and DNA sequences. The
Tm values corresponding to antiparallel PNAPNA,
PNADNA, and DNADNA sequences are 67C,
51C, and 33.5C, respectively. However, the parallel
PNAPNA complex with a Tm value of 47C is still
considerably more stable than the corresponding
DNADNA duplex (43). The increased thermal stability of PNAPNA duplexes relative to the corresponding DNADNA duplexes is fundamentally due
to the absence of any significant electrostatic repulsion between the two strands in the former complex.
Moreover, a PNA-PNA-PNA triplex construct is
1044

Vol. 14

June 2000

also possible from one purine and two pyrimidine


decamers, as evidenced from circular dichroic measurements (20, 44).
In general, PNA contains an achiral backbone and
does not show any circular dichroism (CD). However, PNAs with certain modifications of the backbone structure and its conjugation with complementary DNA and RNA sequences to form hybrids are
capable of exhibiting circular dichroic characteristics (Fig. 3). A PNA duplex containing L-lysinyl
amide attached to the carboxyl terminal of the PNAs
can demonstrate a handedness resulting from the
helicity of the structure. The chiral orientation of the
base pairs relative to each other is regarded as the
source of the CD signal, and the measured induced
helicity is dependent on the nucleobase sequence
proximal center (45). The CD spectra of DNADNA
and antiparallel PNADNA and PNARNA duplexes
are more or less similar. This suggests that the base
pair geometry of antiparallel right-handed PNAcontaining helices is not much different from that
found in a B- or an A-form DNA helix. In contrast,
the spectra of parallel PNADNA and PNARNA
duplexes deviate more from the DNA-DNA spec-

Figure 3. CD spectra of GTAGATCACTAGTGATCTAC duplexes: DNADNA (curve 1) and PNAPNA (curve 2) duplexes. Base pair concentration, 50 M; path length of the
cuvette, 1 cm. Adapted by permission from Dr. Pernilla
Wittung.

The FASEB Journal

RAY AND NORDEN

trum, which suggests a different kind of base stacking. It has been concluded that incorporation of a
PNA strand/strands drastically reduces the binding
capability of both minor groove binders and intercalators (46).
In solution, the PNA monomer exists as both the cis
and trans rotamers about the tertiary amide bond,
slightly favoring the trans conformation (20) as revealed from the 1H-NMR (nuclear magnetic resonance) spectra. The two rotamers interconvert on the
time scale of 1 s at room temperature. For longer
sequences, such as the PNA octamer H-GCTATGTCNH2, the 1H-NMR spectrum reveals the existence of a
multitude of structural species. For a total of N number
of residues, there can be 2N possible structural species.
The solution structures of the antiparallel PNA-DNA
(H-GCTATGTC-NH25d[GACATCGC]) duplex have
been determined by 1H-NMR (20, 47, 48). The duplex
shows a helical conformation with a Watson Crick
base-pairing scheme. The helical rise is 42 with 13
base pairs per turn, whereas the helical diameter is
close to 23 . The major groove is wide and deep but
the minor groove is quite narrow and shallow. The
carbonyl groups on the backbone base linkers of this
structure are oriented along the backbone, pointing in
the carboxyl-terminal direction. However, the sugar
puckering is predominantly in the C2-endo conformation with all antiglycosidic torsion angles and trans
primary amide bond conformations. The PNARNA
duplex molecule (GAACTC-5r[GAGUUC]), as revealed from proton NMR spectrum, has features similar to a right-handed A helix (20, 49). The carbonyl
groups of the PNA backbone linkers are directed
toward the carboxyl terminus and primary amide
bonds are in the trans configuration. The sugar puckering in the nucleic acid strand is C3-endo with
glycosidic torsional angles near 160, features similar
to an A-type conformation.
Rasmussen et al. (50) reported the crystal structure of a PNA duplex (H-CGTACG-NH2)2 at 1.7
resolution. The molecule crystallized in space group
P1bar, showing the presence of both a right- and a
left-handed helix in the unit cell (50). The helical
parameters estimated for this complex deviate significantly from the canonical A and B conformations.
The pitch is large (18 bp) and the helix width is 28
, whereas the twist, rise, base tilt, and displacement
values are 19.8, 3.2, 1.0, and 8.3 , respectively. One
helical turn of the PNA duplex is 58 long. From
the results of their crystallographic study, Nielsen
and co-workers (20, 50) have confirmed that a sugar
phosphate backbone is not a prerequisite for the
formation of a nucleobase double helix in accordance with the inferences based on earlier circular
dichroism results when this species was discovered
(43, 45).
It is also pertinent to briefly describe here the
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

thermodynamic aspects of PNA binding to DNA and


the binding motif. The need for a detailed thermodynamic characterization of PNA-DNA interaction is essential in order to improve our overall understanding
of such a reaction, particularly to accurately predict the
thermodynamic properties of relatively new complexes
of sequences not studied before. So far there are only
a few reports concerning the determination of the
thermodynamic parameters H and S (4, 36, 51).
Two major techniques used to determine thermodynamic parameters are the thermal melting of peptide
nucleic acid complexes based on absorption hypochromicity of bases measured at 260 nm and the
isothermal titration calorimetry (36, 51, 52). The thermal melting profile or so-called equilibrium melting
curve reflects a structural transition from an ordered to
a disordered state or vice versa, and thermal melting
temperature Tm, H, and S are calculated from a
vant Hoff analysis of the curve. In the simplest case, a
bimolecular reaction (single strand [PNA] single
strand [PNA/DNA/RNA] N duplex) representing a
two-state model is assumed for analysis of the melting
curves (for a detailed discussion see refs 36, 51, 5355).
The model assumes that each single strand exists in
one of two possible states: completely based paired and
stacked or completely denatured and unstacked; partial base pairing is not considered. This model holds
well for short duplexes (520 base pairs). It is important to note that single-stranded peptide nucleic acids,
particularly at low temperature, can also exhibit an
ordered structure represented by a self-melting profile
of the oligomer (36, 51).
In contrast to the thermal melting method based
on the vant Hoff principle, calorimetric methods
measure the heat of reaction and change heat capacity, Cp, during a reaction; the thermodynamic
parameters are determined in a model-independent
manner (51, 52). Isothermal titration calorimetry
(ITC) measures the released or absorbed heat of
reaction, at a particular temperature, as a ligand is
titrated into a solution containing the reactant (for
details, see ref 52). Another method, known as
differential scanning calorimetry, can also be used to
complement the ITC technique. It measures the
change in heat capacity directly and the reaction
enthalpy, and entropy can be evaluated independent
of any model for binding. However, the requirement
of a high sample concentration (100 M) restricts
the use of certain PNAs with low solubility.
The overall free energy (G) can be divided into
enthalpic and entropic contributions. As discussed
earlier, both PNAPNA and PNADNA complexes
are thermally more stable than the corresponding
DNADNA duplexes. The additional stability of hybrid duplex over a pure DNA duplex can be attributed to a more favorable entropic contribution,
whereas the higher stability of a PNAPNA duplex
1045

over its DNADNA counterpart is mainly due to the


enthalpic contribution (36, 51). It is important to
mention that for PNADNA and DNADNA duplexes, enthalpic changes H are rather equal. This
is also reflected from the hypochromicity values
obtained for both complexes. It has been suggested
that the entropic contribution is possibly related to
the ion release associated with the formation of a
hybrid duplex (36, 51, 52). On the other hand, a
higher H value for the PNAPNA duplex compared
to its DNADNA counterpart signifies a larger structural rearrangements during the phase transition
(from native duplex to coiled state) of the duplex
(36, 51, 53, 54, 55). A higher hypochromicity value
was observed for PNAPNA duplexes compared to
their DNADNA counterparts, which is consistent
with the above interpretation. At low ionic strength
conditions, because PNA backbone is devoid of
electrostatic charges, a favorable enthalpy of hybridization is generally observed in this order: PNAPNAPNA-DNADNA-DNA (36, 51). It has been
suggested that hydrophobic interactions play an important role for the stabilization of PNA-containing
duplexes. The charge-neutral backbone of PNA interacts with the surrounding water molecules, the
so-called spine of hydration. The water is probably
organized differently in PNA-containing duplexes.
The interaction with surrounding water molecules is
not as favorable as with a DNADNA complex containing charged sugar phosphate backbones, which could
possibly explain the relative importance of enthalpic
contributions to the free energy of hybridization for
the PNA-containing duplexes over DNADNA duplexes. It has been observed that the presence of
terminal lysine residues contributes to the solubility of
a PNA oligomer and stabilizes PNADNA duplexes.
The H and S values for such lys-PNADNA duplexes
are less negative than the values determined for corresponding hybrid duplexes containing PNAs without
terminal lysine residues. The thermal stability of nucleic acids is strongly dependent on the sequence and
so is the thermodynamic information derived from the
thermal melting data. The thermal stability range of
PNA-containing duplexes has been found to be larger
than that for pure DNA duplexes (36, 51, 52, 56).
(PNA)2DNA triplexes
Homopyrimidine PNAs bind to complementary
DNA sequences to form (PNA)2DNA triplexes (Tm
70C). The stability of the complexes depends on
the length of the oligomers in a regular manner with
an increase in Tm of 10C per base pair. A PNA(DNA)2 triplex is observed from an interaction between a C-rich PNA and GC-rich DNA duplex. Since
a protonated cytosine is involved in the base triplet
formation, this particular triple helical structure
1046

Vol. 14

June 2000

Figure 4. Hoogsteen-bonded base triplets (involving


pyrimidine*purinepyrimidine). A) Different base triplets involving Watson-Crick and Hoogsteen hydrogen bonding. B)
Schematic representation of the formation of a strand invasion complex involving bis-PNA. Bis-PNA can bind to specific
target sequence to form an internal, triple-stranded invaded
complex and a looped-out single strand.

involving CGC triplets shows a pH dependence.


The structure is most stable in the pH range of
5.0 5.5. This problem could be circumvented by
incorporating pseudo-isocytosines (J bases) in place
of normal cytosine, e.g., in bis-PNAs (28) (Fig. 4),
which can form a C.G*J base triplet instead of
C.G*C, which is essentially independent of pH.
From measurements of linear dichroism, defined
as the anisotropic absorption of linearly polarized
light (57), it was early demonstrated that PNA-T8 can
form a right-handed PNA2/DNA triple helix with
poly(dA). The base triplets are arranged in such a
fashion that their planes are approximately perpendicular to the helix axis, similar to a standard
poly(dA)-(poly(dT))2 triplex (58). This PNA2/DNA
triplex structure is remarkably rigid, which indicates
an efficient stacking interaction; segments of PNA2
DNA triplexes, formed at subsaturated stoichiometric strand ratios, are distributed evenly on the
poly(dA) strand, separated by flexible singlestranded regions. The formation of (PNA)2RNA
triple helical structure has been investigated by biological experiments. The Tm values are more or less
the same as those of their (PNA)2DNA counterparts
(59). It was observed that the translation of CAT-

The FASEB Journal

RAY AND NORDEN

mRNA can be successfully inhibited by the action of


a triple helix-forming PNA.
Homopyrimidine PNAs can bind to complementary homopurine target sites in double-stranded
DNA by the mechanism of strand invasion (Fig. 2B).
The homopyrimidine PNA recognizes its complementary site in the dsDNA and displaces the pyrimidine strand of dsDNA, forming a stable internal
PNADNAPNA triplex involving the homopurine
strand and a looped-out, single-stranded structure
containing pyrimidine bases. The strand invasion is
favored by the presence of internal A-rich regions in
a duplex DNA and by moderately low ionic strength
( 50 mM NaCl). Gel retardation assay using DNA
restriction fragments containing single PNA targets
(1, 38) showed that strand invasion occurs in a highly
sequence-specific manner. The incorporation of a
single mismatch in a 10-mer PNA at 20C reduces the
binding constant by more than a factor of 100. The
presence of one further mismatch could make the
strand invasion virtually impossible.
The formation of a right-handed PNA2DNA triplex structure was first concluded from circular and
linear dichroism spectroscopic measurements (58).
However, the crystal structure of the PNA2DNA
triplex reveals considerable deviations from its nucleic acid counterpart (31). The purine DNA strand
forms a Watson-Crick base pair with the homopyrimidine PNA strand in an antiparallel orientation and
deploys a second set of base-pairing hydrogen bonds,
obeying a Hoogsteen base pairing scheme, to the
second PNA strand of identical sequence running
parallel with the DNA. There is also another H-bond
set between the backbones of those two strands. The
Watson-Crick paired PNADNA strands in the triplex structure resemble the PNADNA duplex. The
PNA2DNA triplex is wide (diameter 26 ) and the
pitch is 16 (triplet) bases. The sugar puckering in
the DNA strand is C3-endo and the backbone
torsional angles are similar to those of an A-form
structure. The structure is further stabilized through
a network of water molecules specifically bound in
the minor groove.
Recently, another kind of invasion complex has
been reported by Nielsen (60) that requires the
presence of nonstandard nucleobases in the PNAs.
The complex formed after the binding of PNA
molecules is known as double invasion complex,
since two PNA strands can simultaneously bind (invade) the two strands (Fig. 2C).
With the availability of NMR and X-ray crystallography data (20, 31, 4750), a few computational
studies have been made for further characterization
of peptide nucleic acid structures (61, 62). The
molecular dynamics simulation study of a PNADNAPNA triplex helix in aqueous solution by Shields et
al. (62) has been useful by concluding from enerMEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

getic analysis that the hybrid PNA-DNA-PNA triplex


has a characteristic helicity that is quite different
from its actual DNA counterpart. The reason is not
simply the replacement of sugar phosphate by PNA
backbones, but some definite conformational preferences of the PNA strands that have effects on the
conformational flexibility. The structure of a
PNADNA-PNA triple helix is based on a total of 12
acyclic torsion angles, which determine the conformation of adjacent bases in PNA vs. 9 variables,
including the sugar ring, in DNA (63). Moreover, a
torsional freedom, absent in the nucleic acid, is also
introduced into the structure involving PNA due to
the replacement of the sugar ring by a linear bond
sequence. The 12 torsional angles are divided into
two groups. The first group involves the independent variables, including torsional angles analogous
to the glycosyl and ring torsions of the nucleic acids.
The second or the dependent set arises in the
successful closure of the PNA backbone (63). The
results of these computational (modeling) studies
based on predicted structures and cross-verified
from the current spectroscopic, calorimetric, and
crystallographic data may explain why PNA never
forms very B-like structures.
Antigene and antisense applications of PNA
Peptide nucleic acids have promise as candidates for
gene therapeutic drugs design. They require wellidentified targets and a well-characterized mechanism for their cellular delivery. In principle, two
general strategies can be adapted to design gene
therapeutic drugs (Fig. 5). Oligonucleotides or their
potential analogs are designed to recognize and
hybridize to complementary sequences in a particular gene whereby they should interfere with the
transcription of that particular gene (antigene strategy). Alternatively, nucleic acid analogs can be designed to recognize and hybridize to complementary
sequences in mRNA and thereby inhibit its translation (antisense strategy). PNAs are chemically and
biologically stable molecules and have significant
effects on replication, transcription, and translation
processes, as revealed from in vitro experiments.
Moreover, no sign of any general toxicity of PNA has
so far been observed. As we shall see, PNA can
interfere with the translation process, and PNAdsDNA strand displacement complexes can inhibit
protein binding and block RNA polymerase elongation.
Inhibition of transcription
Peptide nucleic acids should be capable of arresting
transcriptional processes by virtue of their ability to
form a stable triplex structure or a strand-invaded or
1047

Figure 5. Antigene and antisense strategy. An antigene


oligomer (e.g., PNA) could
bind to a complementary sequence in the DNA and inhibit transcription of the
gene. On the other hand,
cells can also be treated with
an antisense oligomer, and
hybridization to a specific
mRNA sequence can inhibit
the expression of a protein
at the level of translation.

strand displacement complex with DNA. Such complexes can create a structural hindrance to block the
stable function of RNA polymerase and thus are
capable of working as antigene agents (Fig. 4).
Evidence from in vitro studies supports the idea that
such complexes are indeed capable of affecting the
process of transcription involving both prokaryotic
and eukaryotic RNA polymerases. PNA targeted
against the promoter region can form a stable PNA
DNA complex that restricts the DNA access of the
corresponding polymerase. PNA strand displacement complexes, located far downstream from the
promoter, can also efficiently block polymerase progression and transcription elongation and thereby
produce truncated RNA transcripts; the PNA (DNA
poly-purine) target must be present in the gene of
interest. Nielsen et al. (64) have demonstrated that
even an 8-mer PNA (T8) is capable of blocking phage
T3 polymerase activity (64). The presence of a PNA
target within the promoter region of IL-2R gene
has been used to understand the effect of PNA
binding to its target on this gene expression (10, 65).
The PNA2/DNA triplex arrests transcription in vitro
and is capable of acting as an antigene agent. But
one of the major obstacles to applying PNA as an
antigene agent is that the strand invasion or the
formation of strand displacement complex is rather
slow at physiological salt concentrations (36, 66).
Several modifications of PNA have shown improvement in terms of binding. Modifications of PNA by
chemically linking the ends of the Watson-Crick and
Hoogsteen PNA strands to each other (28), introducing pH-independent pseudoisocytosines into the
Hoogsteen strand (28), incorporating intercalators
(67), or positively charged lysine residues (28, 68) in
PNA strand can drastically increase the association
rates with dsDNA. Lee et al. (69) have demonstrated
that PNA as well as the PNADNA chimera complementary to the primary site of the HIV-I genome can
completely block priming by tRNA3Lys. Consequently, in vitro initiation of the reverse transcription
by HIV-1 RT is blocked. Thus, oligomeric PNAs
targeted to various critical regions of the viral genome are likely to have a strong therapeutic poten1048

Vol. 14

June 2000

tial for interrupting multiple steps involved in the


replication of HIV-1 (69).
It has been found that under physiological salt
conditions, binding of PNA to supercoiled plasmid
DNA is faster compared to linear DNA (66, 68). This
result is relevant to the fact that the transcriptionally
active chromosomal DNA usually is negatively supercoiled, which can act as a better target for PNA
binding in vivo. It has also been found that the
binding of PNA to dsDNA is enhanced when the
DNA is being transcribed. This transcription-mediated PNA binding occurs about threefold as efficiently when the PNA target is situated on the
nontemplate strand instead of the template strand.
As transcription mediates template strand-associated
(PNA)2/DNA complexes, which can arrest further
elongation, the action of RNA polymerase results in
repression of its own activity, i.e., suicide transcription (70). These findings are highly relevant for the
possible future use of PNA as an antigene agent.
We wish to refer to reports describing the ability of
PNA to activate transcription, although this is not
actually related to its antigene effect. Mollegaard et
al. (71) have efficiently demonstrated that the
looped-out single-stranded structure formed as a
result of strand invasion is also capable of acting as
efficient initiation sites for Escherichia coli and mammalian RNA polymerases in which the polymerase
might start transcription using the single-stranded
loop as a template (65). This is consistent with the
affinity of RNA polymerase for single-stranded DNA
and its ability to transcribe single-stranded DNA.
Inhibition of translation
The basic mechanism of the antisense effects by
oligodeoxynucleotides is considered to be either a
ribonuclease H (RNase H) -mediated cleavage of the
RNA strand in oligonucleotide-RNA heteroduplex or
a steric blockage in the oligonucleotideRNA complex of the translation machinery (59). Oligodeoxynucleotide analogs such as phosphorothioates
activate RNase H and thus hold promise of working
as antisense agents. However, they also exhibit some
nonspecificity in their action. PNA/RNA duplexes,

The FASEB Journal

RAY AND NORDEN

on the other hand, cannot act as substrates for RNase


H. Normally, the peptide nucleic acid antisense
effect is based on the steric blocking of either RNA
processing, transport into cytoplasm, or translation.
It has been concluded from the results of in vitro
translation experiments involving rabbit reticulocyte
lysates that both duplex- (mixed sequence) and
triplex-forming (pyrimidine-rich) PNAs are capable
of inhibiting translation at targets overlapping the
AUG start codon (59). Triplex-forming PNAs are
able to hinder the translation machinery at targets in
the coding region of mRNA. However, translation
elongation arrest requires a (PNA)2RNA triplex
and thus needs a homopurine target of 10 15 bases.
In contrast, duplex-forming PNAs are incapable of
this. Triplex-forming PNAs can inhibit translation at
initiation codon targets and ribosome elongation at
codon region targets.
Mologni et al. (72) showed effects of three different types of antisense on the in vitro expression of
PML/RAR gene. The first one was complementary
to the first AUG (initiation) site. The second could
bind to a sequence in the coding region that includes the second AUG, the starting site for the
synthesis of an active protein. The third PNA was
targeted against the 5-untranslated region (UTR) of
the mRNA, the point of assembly of the translation
machinery. Together, these three PNAs could efficiently inhibit translation even at a concentration
much below the critical concentration used for each
individual. The result suggests that the PNA targeting of RNA molecules like PML/RAR requires
effective blocking of different sequences on the 5
part of the messenger. A 5-UTR PNA target can also
be used as efficiently as an initiation (AUG) target to
achieve an antisense activity of PNA, and a more
effective translation inhibition can be achieved by
combining PNA directed toward 5-UTR and AUG
regions.
Triple helix-forming PNAs can also hinder the
translation process. Bis-PNA or clamp-PNA structures are capable of forming internal triple helical
constructs. In principle, if targeted against the coding region of mRNA, PNA2/RNA triple helix-forming derivatives can also cause a stop in translation,
which can be easily verified by the detection of a
truncated protein. (59). However, this methodology
requires a sequence optimization for each new target.
Recent studies show that E. coli cells are somewhat
permeable for PNA molecules. Good and Nielsen
(73, 74) have shown that it is possible to achieve PNA
antisense effects in the leaky mutant strains of E.
coli. PNAs targeted against the AUG region of the
mRNA corresponding to -galactosidase and -lactamase genes were indeed capable of down-regulating
the expression of these two genes (73). Another
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

study (74) demonstrated the effect of two bis-PNAs,


targeted against the homopurine stretches in rRNA,
either in the peptidyl transferase center or in the
-sarcin loop, in inhibiting the ribosome function in
a cell-free system. The translation was arrested at
submicromolar range of PNA concentration. The
growth of a mutant strain of E. coli, namely, AS19, was
also inhibited by using the same PNAs at low micromolar concentration.
Inhibition of replication
It is also possible by using PNA to inhibit the
elongation of DNA primers by DNA polymerase.
Further, the inhibition of DNA replication should be
possible if the DNA duplex is subjected to strand
invasion by PNA under physiological conditions or if
the DNA is single stranded during the replication
process. Efficient inhibition of extrachromosomal
mitochondrial DNA, which is largely single-stranded
during replication, has been demonstrated by Taylor
et al. (75). The PNA-mediated inhibition of the
replication of mutant human mitochondrial DNA is
a novel (and also potential) approach toward the
treatment of patients suffering from ailments related
to the heteroplasmy of mitochondrial DNA. Here
wild-type and mutated DNA are both present in the
same cell. Experiments have shown that PNA is
capable of inhibiting the replication of mutated
DNA under physiological conditions without affecting the wild-type DNA in mitochondria.
Interaction of PNA with enzymes
RNase H
The activation of the intracellular enzyme RNase H
by oligonucleotides to cleave RNA bound to deoxyribonucleic acid oligomers depends on the chemical
structure of RNase H-stimulating oligonucleotides.
The antisense oligonucleotide with an RNase H
activity (e.g., phosphorothioate oligos) is considered
a better antisense molecule (inhibitor) than one
without the activity (methylphosphonates and hexitol nucleic acids) (29). Despite their remarkable
nucleic acid binding properties, PNAs generally are
not capable of stimulating RNase H activity on
duplex formation with RNA. However, recent studies
have shown that DNA/PNA chimeras are capable of
stimulating RNase H activity. On formation of a
chimeric RNA double strand, PNA/DNA can activate
the RNA cleavage activity of RNase H (Fig. 6).
Cleavage occurs at the ribonucleotide parts basepaired to the DNA part of the chimera. Moreover,
this cleavage is sequence specific in such a way that
certain sequences of DNA/PNA chimeras are preferred over others (29). They are also reported to be
1049

Telomerase

Figure 6. Schematic representation of RNase H-mediated


cleavage activity after the binding of a PNADNA chimera to
an RNA target.

taken up by cells to a similar extent as corresponding


oligonucleotides (29). Thus, PNA/DNA chimeras
appear by far the best potential candidates for antisense PNA constructs.
Polymerase and reverse transcriptase
In general, there is no direct interaction of PNA with
either DNA polymerase or reverse transcriptase.
However, different groups have shown indirect involvement of PNA in inhibiting these enzyme functions (activity) under in vitro conditions. For example, PNA oligomers are capable of terminating the
elongation of oligonucleotide primers by either
binding to the template strand or directly competing
with the primer for binding to the template. Primer
extension by MMLV reverse transcriptase has been
shown to be inhibited by introducing a PNA oligomer (10). In another experiment, Nielsen et al.
(76) demonstrated that the primer extension catalyzed by Taq-polymerase can be terminated by incorporating a PNA oligomer (PNA-H(t)10) into the
system. The latter can bind to a (dA)10 sequence in
the template and thereby terminate the primer
extension. Moreover, uncharged PNA primers with
only a single 5-amino-2,5-dideoxynucleoside at the
carboxyl terminus can be recognized by the Klenow
fragment for DNA pol I and VentDNA polymerase
(Thermococcus litoralis) (77), and a linear amplification is possible with the use of an excess of PNA-DNA
primer and suitable thermostable polymerases (77).
Moreover, the reverse transcription of gag gene of
HIV I is also inhibited in vitro by PNAs (78). The
inhibition has been achieved by using a bis-PNA
construct, which is more efficient than the corresponding mono PNA construct (72). Also, the reverse transcription can be completely inhibited by a
pentadecameric antisense PNA, using a molar ratio
of 10:1 (PNA/RNA), without any noticeable RNase
H cleavage of the RNA (78).
1050

Vol. 14

June 2000

Human telomerase, a ribonucleoprotein complex


consisting of a protein with DNA polymerase activity
and an RNA component, synthesizes (TTAGGG)n
repeats at the 3 end of DNA strands. PNA oligomers
that are complementary to the RNA primer binding
site can inhibit the telomerase activity. Studies have
shown that the telomerase inhibition activity of PNA
is better than that of corresponding activity of phosphorothioate oligonucleotides. This is mainly due to
a higher binding affinity of PNA compared to phosphorothioates (79). Corey and co-workers (80) have
demonstrated an efficient inhibition of telomerase
after lipid-mediated delivery of template- and nontemplate-directed PNA into the cell.
PNA as a molecular-biological tool
Peptide nucleic acids also exhibit potential for use as
a tool in biotechnology and molecular biology. Here
we will mainly present indications of PNA becoming
an important molecular biology tool.
Enhanced PCR amplification
The polymerase chain reaction (PCR) has been
widely used for various molecular genetic applications including the amplification of variable number
of tandem repeat (VNTR) loci for the purpose of
genetic typing (81, 82). However, in some cases
preferential amplification of small allelic products
relative to large allelic products presents a problem.
This results in an incorrect typing in a heterozygous
sample (83). PNA has been used to achieve an
enhanced amplification of VNTR locus D1S80 (6).
Small PNA oligomers are used to block the template,
and the latter becomes unavailable for intra- and
interstrand interaction during reassociation. On the
other hand, the primer extension is not blocked;
during this extension, the polymerase displaces the
PNA molecules from the template and the primer is
extended toward completion of reaction. This approach shows the potential of PNA application for
PCR amplification where fragments of different sizes
are more accurately and evenly amplified. Since the
probability of differential amplification is less, the
risk of misclassification is greatly reduced.
Misra et al. (84) demonstrated that PNADNA
chimera (85) lacking the true phosphate backbone
are capable of acting as a primer for the polymerase
reaction catalyzed by DNA polymerases. The chimera (PNA)19-TPG-OH, consisting of a 19 base PNA
part linked to a single phosphate-containing dinucleotide (TPG-OH) with a free 3-OH terminus, when
annealed with a complementary RNA or DNA template strand works as an efficient primer to catalyze

The FASEB Journal

RAY AND NORDEN

Figure 7. The PNA-assisted


rare cleavage technique:
Symbols (red straight horizontal line), (filled red
square), (filled gray square)
represent PNA binding site,
restriction enzyme site, and
methylated restriction enzyme site, respectively. Methylated sites are not subjected
to a restriction digestion.

the addition of nucleotide by polymerase enzymes.


The primer is also recognized by reverse transcriptase and by the Klenow fragment of E. coli DNA
polymerase I. The results suggested that the diameter of the duplex region rather than the presence of
phosphate backbone of the template primer is the
critical factor for a proper template-primer reaction
and accommodating the enzyme within the binding
domain. It also appears that the primer phosphate
backbone may not be essential, at least not in this
case, for the polymerase recognition and binding.
PNA hybridization as alternative to Southern
hybridization
Southern hybridization is perhaps one of the most
widely used techniques in molecular biology. Despite
its great potential to predict both size and sequence
information and information regarding the genetic
context, there are certain disadvantages of this process. It requires a laborious multistep washing procedure and there could sometimes be poor sequence
discrimination between closely related species. PNA
pre-gel hybridization simplifies the process of Southern hybridization by reducing the required time, as
the cumbersome post separation, probing, and washing steps are eliminated. Labeled (fluoresceinated)
PNA oligomers are used as probes and allowed to
hybridize to a denatured DNA sample at low ionic
strength. The mixture is thereafter subjected directly
to electrophoresis for size separation and singlestranded DNA fragments separated on the basis of
length. The charge-neutral PNA allows hybridization
at low ionic strength and renders higher mobility to
the complex compared to the excess unbound PNA.
The DNA-PNA hybrids are blotted (transferred)
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

onto a nylon membrane, dried, UV cross-linked, and


detected using standard chemiluminescent techniques (8). Alternatively, the bound PNA can be
detected by using capillary electrophoresis (vide infra), which can make use of the direct fluorescence
detection method. Under the same conditions, a
normal DNADNA duplex will tend to disrupt
whereas the PNADNA duplex will remain intact due
to the strong binding of PNA to DNA. This allows
specific sequence detection with simultaneous size
separation of the target DNA following a simple and
straightforward protocol. Consequently, the analysis
is much faster than conventional the Southern hybridization technique.
PNA-assisted rare cleavage
Peptide nucleic acids, in combination with methylases
and other restriction endonucleases, can act as rare
genome cutters (9). The method is called PNA-assisted
rare cleavage (PARC) technique (Fig. 7). It uses the
strong sequence-selective binding of PNAs, preferably
bis-PNAs, to short homopyrimidine sites on large DNA
molecules, e.g., yeast or DNA. The PNA target site is
experimentally designed to overlap with the methylation/restriction enzyme site on the DNA, so a bound
PNA molecule will efficiently shield the host site from
enzymatic methylation whereas the other, unprotected
methylation/restriction sites will be methylated. After
the removal of bis-PNA, followed by restriction digestions, it is possible to cleave the whole DNA by enzymes
into limited number of pieces (9). DNA is efficiently
protected from enzymatic digestion due to methylation
in most of the sites except for those previously bound
to PNA. Thus, short PNA sequences, particularly positively charged bis-PNAs, in combination with various
1051

methylation/restriction enzyme pairs can constitute an


extraordinary new class of genome rare cutters.
Artificial restriction enzyme system
S1 nuclease cleaves single-stranded nucleic acids
releasing 5-phosphoryl mono- or oligonucleotides.
It removes the single-stranded overhangs of DNA
fragments and can be used in RNA transcript mapping and construction of unidirectional deletions.
PNA in combination with S1 nuclease can work as an
artificial restriction enzyme system. Homopyrimidine PNA oligomers hybridize to the complementary
targets on dsDNA via a strand invasion mechanism,
leading to the formation of looped-out noncomplementary DNA strands. The enzyme nuclease S1 can
degrade this single-stranded DNA part into welldefined fragments. If two PNAs are used for this
purpose and allowed to bind to two adjacent targets
on either the same or opposite DNA strands, it will
essentially open up the entire region, making the
substrate accessible for the nuclease digestion and
thereby increasing the cleavage efficiency (5).
Determination of telomere size
The conventional method for the determination of
telomere length involves Southern blot analysis of
genomic DNA and provides a range for the telomere
length of all chromosomes present. The modern
approach uses fluorescein-labeled oligonucleotides
and monitor in situ hybridization to telomeric repeats. However, a more delicate approach resulting
in better quantitative results is possible by using
fluorescein-labeled PNAs, as shown by Lansdorp et
al. (86). This PNA-mediated approach permits accurate estimates of telomeric length. In situ hybridization of fluorescein-labeled PNA probes to telomeres
is faster and requires a lower concentration of the
probe compared to its DNA counterpart. Low photobleaching and an excellent signal-to-noise ratio
make it possible to quantitate telomeric repeats on
individual chromosomes in this way. Experiments
suggest that variations of this approach can possibly
be applied to other repetitive sequences.
Nucleic acid purification
Based on its unique hybridization properties, PNAs
can also be used to purify target nucleic acids. PNAs
carrying six histidine residues have been used to
purify target nucleic acids using nickel affinity chromatography (7). Also, biotinylated PNAs in combination with streptavidin-coated magnetic beads may
be used to purify Chlamydia trachomatis genomic DNA
directly from urine samples. However, it appears that
this simple, fast, and straightforward purification by
1052

Vol. 14

June 2000

hybridization approach has certain drawbacks. It


requires the knowledge of a target sequence and
depends on a capture oligomer to be synthesized for
each different target nucleic acid. Such target sequences for the short pyrimidine PNA, i.e., the most
efficient probe for strand invasion, are prevalent in
large nucleic acids. Thus, short PNAs can also be
used as generic capture probes for purification of
large nucleic acids. It has been shown that a biotintagged PNA-thymine heptamer could be used to
efficiently purify human genomic DNA from whole
blood by a simple and rapid procedure.
PNA as a diagnostic tool
The high-affinity binding of PNA oligomers has led
to the development of new applications of PNA,
especially as a diagnostic probe for detecting genetic
mutations: applications are possible for the detection of genetic mutation and mismatch analysis that
can use its unique hybridization properties. The
ensuing sections will highlight some of the recent
developments related to the use of PNA as a probe to
detect genetic mutations and corresponding mismatch analysis confirming its potential as a diagnostic tool for clinical applications.
Single base pair mutation analysis using PNAdirected PCR clamping
Amplification of the target nucleic acid by the PCR
technique is considered an important step for detection of genetic diseases. The higher specificity of PNA
binding to DNA, higher stability of a PNADNA duplex
compared to the corresponding DNADNA duplex,
and its inefficiency to act as a primer for DNA polymerases are the bases for this novel technique. This
strategy (Fig. 8) includes a distinct annealing step
involving the PNA targeted against one of the PCR
primer sites. This step is carried out at a higher
temperature than that for conventional PCR primer
annealing where the PNA is selectively bound to the
DNA molecule. The PNA/DNA complex formed at
one of the primer sites effectively blocks the formation
of a PCR product. PNA is also able to discriminate
between fully complementary and single mismatch
targets in a mixed target PCR. Sequence-selective
blockage by PNA allows suppression of target sequences that differ by only one base pair. Also, this
PNA clamping was able to discriminate three different
point mutations at a single position, as demonstrated in
rum et al. (13).
a model system by O
Thiede et al. (15) have reported a novel approach
for simple and sensitive detection of mutations in the
ras proto-oncogenes. Their strategy, which is also
rum et al.
based on the principle described by O
(13), is schematically presented in Fig. 8. Chromo-

The FASEB Journal

RAY AND NORDEN

Figure 8. Mutation analysis using PNA-directed PCR clamping: schematic representation of the strategy for the PCR cycle
involving PNA-directed clamping. In the case of the normal (wild-type) DNA, the bound PNA will sterically hinder annealing
of a partially overlapping primer sequence, thus preventing the normal sequence from appropriate PCR amplification. In the
case of mutant alleles, the melting temperature of the PNA/DNA is reduced and the primer can out-compete PNA annealing
to carry on preferential amplification of mutant sequences.

somal DNA is hybridized to a 15-mer PNA probe


complementary to a normal wild-type sequence surrounding codons 12 and 13. For the wild-type Ki-ras,
formation of PNA/DNA duplex will be favored,
which in turn would sterically hinder the annealing
of overlapping oligonucleotides preventing normal
Ki -ras sequences from being sufficiently (PCR) amplified. On the other hand, in the case of the mutant
alleles, the melting temperature of the mutated or
mismatched PNA-DNA hybrid is much lower than
the corresponding normal one. Hence, the binding
of primer oligonucleotide will be favored to outcompete PNA annealing. Consequently, mutated
sequences will be preferentially amplified (15).
One major advantage of this PNA-mediated PCR
clamping is that it allows detection of mutations
stretched over 4 6 bp regions in a single reaction,
and this could also be used to detect other hot-spot
mutations (13, 15).
Screening for genetic mutations by capillary
electrophoresis
In capillary electrophoresis (87 89), the separation
is generally carried out using a long, thin fused silica
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

capillary (typically 50 80 cm long, inner diameter


10 300 m). A portion of the coating, close to one
end of the capillary, is removed to allow optical
detection of the analyte. The analyte passes the
detection window during a separation process and
can be visualized by online, automated, UV, or
laser-induced fluorescence (LIF) detection systems.
Capillary electrophoresis is capable of analyzing
minute amounts of sample (typically on the order of
picograms to femtograms). However, it is not possible to analyze more than one sample at a time (for
details, see refs 87 89), which is regarded as the
major disadvantage compared to slab gel electrophoresis.
A novel diagnostic method for the detection of
genetic mutation using PNA as a probe for capillary
electrophoresis has been reported by Carlsson et al.
(14). The method is sensitive enough to detect a
single mismatch in the sample DNA. The model
system consisted of four 50-mer, single-stranded
DNA fragments representing a part of the cystic
fibrosis transmembrane conductance regulator
gene, one wild-type and three mutant sequences
(Table 2), and a 15-mer PNA probe having a sequence complementary to the wild-type oligomer.
1053

TABLE 2. Synthetic DNA fragments of the cystic fibrosis gene and corresponding PNA probe (14)
Nucleic acid fragment

Sequence

Mutation

Wild type (WT)

5- - -TGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATA- - - -3

None

F508

5- - -TGGCACCATTAAAGAAA-ATATCAT- - TGGTG-TTTCCTATGATGAATATA- - - -3

Deletion of three bases

MU1

5- - -TGGCACCATTAAAGAAAATATCGTCTTTGGTGTTTCCTATGATGAATATA- - - -3

One-base substitution

MU2

5- - -TGGCACCATTAAAGAAAATATACTCTTTGGTGTTTCCTATGATGAATATA- - - -3

Two-base substitution

PNA (15 mer)

H-CACCAAAGATGATAT-lys-NH2

----------

The probe PNA only binds to the fully matched


DNA, and the presence of this duplex is detected
using free solution capillary electrophoresis (14).
Separation of full match from mismatch duplexes
was accomplished at a high temperature (70C;
Fig. 9) and 50 mM ionic strength. At this temperature and ionic strength, only the hybrid duplex
carrying the wild-type DNA sequences remains stable, while the hybrid complex carrying single mismatch DNA will be melted. Free PNA binds to the
capillary wall and is not detected. In another related
experiment, the same PNA probe was added to a

Figure 9. Free solution capillary electrophoresis of a mixture


of PNA and DNA. A) The electrophoregram at 70C of a
mixture of PNA and DNA (MU1, Table 2). The latter has a
single-base substitution in the recognition region. At 70C,
PNA cannot remain bound to the mutant DNA sequence and
the peak corresponding to PNADNA hybrid duplex will not
appear. B) Control electropherogram at the same temperature representing the interaction of the same PNA (Table 2)
with the wild-type DNA sequence. Adapted by permission
from Carlsson et al., 1996 (ref 14).
1054

Vol. 14

June 2000

PCR preparation of the 142-mer wild-type CF fragments and the 139-mer three-base deletion fragments. At 50C, the wild-type PNADNA duplex was
identified whereas no signal at all was seen for the
mutant. Norden and co-workers (unpublished observations) have also used free solution capillary electrophoresis to detect point mutation in a 15-mer
DNA fragment representing a vulnerable part of the
p53 gene. The 15-mer PNA probe was complementary to the wild-type p53 sequence (in this case, the
15-mer oligonucleotide). The experimental temperature was lower than the thermal melting temperature of the fully matched PNA-DNA hybrid, but
higher than the melting temperature of the PNA
DNA duplex with a mismatch at the 8th position.
(The mismatch corresponds to a mutation in the
codon 175 of the p53, resulting in an altered P53
protein with an arginine replaced by a histidine.) At
this temperature, the fully matched duplex maintained its structural integrity but the PNA probe
could not bind to the single mismatch DNA sequence, so the fully matched duplex could be separated from the mismatch complexes. This method is
able to detect single-base substitutions. A big advantage of using PNA instead of DNA as a hybridization
probe is that it provides a more efficient way of
sequence discrimination and allows separation at
high temperature at which DNA-DNA hairpin structures, responsible for band compression in gel electrophoresis, are eliminated.
PNA probes with fluorescent tags offer sensitive
detection and require only a very low concentration of
the sample. At high temperature (as described above),
the LIF detection system will generate a signal for the
bound PNAs since free PNA is efficiently removed. It
might be possible in the future to establish a universal
screening strategy for any genetic disease with a known
spectrum of mutations by developing a PNA probe
library, possibly using multiple fluorescent tags for
multiplex testing of one or more exons.

The FASEB Journal

RAY AND NORDEN

The RNA binding properties of PNAs have also


been characterized using capillary gel electrophoresis (90). Like free solution capillary electrophoresis,
only a minute amount ( fmol) is required for
analysis. Compared to free solution capillary electrophoresis, this method shows a greater dependence
on mass. This method, which can quantitatively
resolve free and bound PNA, enables the measurement of relative binding kinetics using gel-filled
capillaries.
Another gel-based strategy, commonly known as
affinity electrophoresis, can be exploited in PNAbased diagnostics. Depending on the noncovalent
interaction of two species, this requires the immobilization of one of the interacting species in a gel
matrix (91). If PNA is entrapped in the gel matrix, it
can cause a retardation of the complementary oligonucleotides and allow specific hybridization during
electrophoretic passage of a complementary DNA.
The retardation of DNA is directly related to the
binding of PNA through complementarity. Hence,
the PNA-DNA hybridization in the gel matrix is also
sensitive to mismatch. The method allows the visualization of hybridization between an immobilized
PNA and a complementary DNA, migrating in an
electric field, in real time. Moreover, a more sensitive
detection of a reasonable number of samples in real
time is possible by using the LIF detection system
using fluorescent samples.
PNA as a probe for nucleic acid biosensor
The DNA biosensor technology holds promise for
rapid and cost-effective detection of specific DNA
sequences. A single-stranded nucleic acid probe is
immobilized onto optical, electrochemical, or masssensitive transducers to detect the complementary
(or mismatch) strand in a sample solution. The
response from the hybridization event is converted
into a useful electrical signal by the transducer. We
describe here the use of PNA as a novel probe for
sequence-specific biosensors and highlight some of
the promise it holds to work as the recognition layer
in DNA biosensors.
BIAcore technique
The PNA hybridization and corresponding mismatch analysis can be studied using a BIAcore (biomolecular interaction analysis) instrument (92),
which can evaluate a real-time biomolecular interaction analysis using optical detection technology. The
real-time interactions are monitored on a sensor
(surface) chip, which constitutes the core part of a
BIAcore instrument. The probe molecule is attached
directly to the surface and the analyte molecule is
free in solution. The detection principle in BIA uses
MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

surface plasmon resonance (92). The response signal of the BIAcore apparatus is proportional to the
change in the refractive index at the surface and is
assumed to be proportional to the mass of substance
bound to the chip.
The first report regarding the study of PNA-DNA/
RNA hybridization using the BIAcore technique came
from the work of Jensen et al. (42) in 1997. The sensor
chip used in this case was basically a thin gold surface
covered with a layer of dextran and containing streptavidin chemically coupled to the dextran (Pharmacia
sensor chip SA5). A biotinylated PNA (biotin-(eg1)3TGTACGTCACAACTA-NH2) probe was immobilized
on the surface by using the strong coupling between
biotin and streptavidin. The amount of bound substance (fully complementary as well as various singly
mismatched RNA and DNA oligonucleotides) was measured as a function of time when a solution containing
the complementary strands passed over the chip surface. In this way the association kinetics could be
studied. The dissociation was subsequently studied by
washing the surface with appropriate buffer and monitoring the time dependence of the mass decrease.
Assuming a two-state model, A B N AB, analysis of
the hybridization kinetics was carried out. The PNA
surface can be regenerated in SA5 by removing the
remaining hybridized products with HCl. Thus, consecutive studies could be carried out with the same immobilized PNA.
Norden and co-workers (unpublished observations) have also explored the possibility of carrying
out BIAcore measurements using a plain gold surface (e.g., BIAcore sensor chip J1) to which PNA
molecules carrying cystein at the amino-terminal can
be immobilized using the strong coupling between
gold and sulfur. In this way, erroneous results due to
nonspecific binding of ligands to the dextran layer, if
any, can be eliminated. However, it should be kept in
mind that DNA has a high affinity for gold and
generally is nonspecifically adsorbed to the surface.
Direct addition of analyte DNA molecules onto the
sensor surface to study its binding with PNA might
facilitate its adsorption to the gold surface. Short
spacer molecules, e.g., mercaptohexanol, can be
used together with the ligand (probe) to form the
PNA monolayer at the top of the sensor (gold)
surface to prevent DNA from being nonspecifically
adsorbed to the surface.
Quartz crystal microbalance (QCM)
The quartz crystal microbalance has been used for
some time to monitor mass or thickness of thin films
deposited on surfaces, study gas adsorption and
deposition on surfaces in the monolayer and submonolayer regimes (93), research areas related to
electrochemistry, or study protein adsorption. Only
1055

recently has this sensitive mass measuring device


begun to be used in the area of biochemistry and
biotechnology, such as for studying the hybridization
of nucleic acids on surface (94 96). The resonant
frequency of the crystal changes due to a minute
weight increase on the surface. It is expected that
immobilized PNA strands (or probes) would show an
improved distinction between the closely related
target sequences compared to an immobilized DNA
probe. A recent report by Wang and co-workers (97)
on quartz crystal microbalance biosensor, based on
peptide nucleic acid probes, showed that the system
can differentiate between a full complementary and
single mismatch oligonucleotide. A rapid and sensitive detection of mismatch sequences is possible by
monitoring the frequency/time response of the
PNA-QCM biosensor. The PNA probes used in the
above-mentioned study (97), which formed the
monolayer onto the gold QCM surface, contained a
cysteine attached to the PNA core with the help of an
ethylene glycol unit. The remarkable specificity of
the immobilized probe provides a rapid hybridization with corresponding oligonucleotides. Such a
mismatch sensitivity of PNA-immobilized QCM biosensors could be of great importance for diagnostic
applications, particularly for genetic screening and
diagnosis of malignant diseases.
MALDI-TOF mass spectrometry
MALDI-TOF mass spectrometry (for nucleic acid-based
applications, see refs 32, 98, 99) has been used successfully in PNA-based diagnostic research to study discrimination of single-nucleotide polymorphisms (SNPs) in
human DNA (33). Human genomic and mitochondrial DNA contain many SNPs that may be linked to
diseases. Rapid and accurate screening of important
SNPs, based on high-affinity binding of PNA probes to
DNA, is possible by using MALDI-TOF mass spectroscopy. The captured, single-stranded DNA molecules
are PCR-amplified and thereafter hybridized with PNA
probes in an allele-specific fashion. MALDI-TOF can
rapidly and accurately detect (identify) these hybridized PNA probes. This provides a straightforward,
rapid, accurate, and specific detection of SNPs in
amplified DNA (33, 100). The detection of multiple
point mutations using allele-specific, mass-labeled PNA
hybridization probes is also possible by using a direct
MALDI-TOF-MS analysis method (101). The mass
spectra will show peaks of distinct masses corresponding to each allele present, and in this way a mass
spectral fingerprint of each DNA sample can be
obtained.
Potentiometric measurements
Wang et al. (16) have also reported the use of PNA as
a recognition probe for the electrochemical detec1056

Vol. 14

June 2000

tion of the hybridization event using chronopotentiometric measurements. The method consists of
four steps: probe (PNA) immobilization onto the
transducer surface, hybridization, indicator binding,
and chronopotentiometric transduction. A carbon
paste electrode is in this process containing the
immobilized DNA or PNA probe. The hybridization
experiment was carried out by immersing the electrode into the stirred buffer solution containing a
desired target, followed by measurement of signal.
Cellular effects and delivery of PNA
It is important to understand the effect of peptide
nucleic acids on intact cells and problems related to
its delivery into the cell. The cellular uptake of this
unique nucleic acid analog is very slow, which is still
considered to be the major challenge that must be
overcome before it can be used as a therapeutic
drug. So far, there is hardly any report of the
antisense activity of PNA in cell culture without the
use of brute techniques to help bypass the membrane barrier.
Effects of PNAs on intact cells have been demonstrated on cellular microinjection; antisense activity
against a transfected gene has also been established
in this way (10, 18). Serious efforts are being made to
increase the cellular uptake of PNA, particularly by
modifying the molecule itself or conjugating to it
suitable potential ligand molecules that could enhance a physical or receptor-mediated cellular uptake (102104). Incorporation of a guide sequence
or some vector peptides is one potential approach
whereby PNA is attracted to the cell membrane and
helped in docking into it. Several methods have been
proposed to facilitate the uptake of PNAs in eukaryotic cells. These include transient permeabilization
with streptolysin O (102), cell membrane permeabilization by lysolectin (12) or detergents like Tween
(79), or conjugation with peptides capable of being
internalized easily (103105).
Recently, Aldrian-Herrada et al. (106) showed that
peptide nucleic acids are rapidly internalized in
culture neurons when coupled to a delivery peptide
[retro-inverso (107, 108) analog of the 16-mer
p-Antp peptide]. A PNA antisense for the AUG
translation initiation region of prepro-oxytocin
mRNA was coupled to the vector retro-inverso peptide. The conjugated construct was internalized by
cultured cerebral cortex neurons within minutes
whereas the penetration of nonconjugated single
PNA molecules was rather slow. Both PNA and the
peptide-PNA construct lowered the amounts of
mRNA coding for prepro-oxytocin in these neurons.
This result is promising and demonstrates that PNAs
guided by suitable vector peptides could work as
antisense agents. Corey and co-workers (80) have

The FASEB Journal

RAY AND NORDEN

reported a novel method for in vitro cellular delivery


of peptide nucleic acids using a cationic lipid. The
cationic lipid is capable of associating with the
negatively charged phosphodiester backbone of
DNA and RNA and fusing with the cell membrane to
allow the oligonucleotide to enter into the cell
through an endocytotic pathway. This technique has
been improvised for the delivery of PNA molecules
into the cells. Desired PNA oligomers are hybridized
to overlapping oligonucleotides and the complex is
mixed with cationic lipid (80). The cationic lipid
DNAPNA complex thus formed can be internalized, and the partially hybridized PNA is imported
into the cell as a passive cargo (80). On passive
delivery into the cell, peptide nucleic acid is expected to dissociate itself from the complex.
Another strategy that has been adapted to improvise the delivery of PNA in vitro is to incorporate it
into delivery vehicles (vesicles), e.g., liposomes.
There are also some reports of direct PNA uptake
in rat embryo fibroblasts (109) and human myoblasts
(75), although at extremely high exposure concentrations (20 M). The poor cellular uptake of
naked regular PNA is still considered a major obstacle against the prospective use of PNA as a gene
therapeutic drug. Peptide nucleic acidnucleic acid
chimeras are reported to be taken up by Vero or
NIH3T3 cells even at a relatively lower extracellular
concentration (1 M), which leaves us with the idea
that a PNADNA chimera may be a better antisense
agent. The kinetics of uptake is similar to that
observed for an oligonucleotide of the same sequence. At a higher concentration of PNA, cytotoxic
effects could also be observed (110, 111).
CONCLUSIONS
Peptide nucleic acids provide a novel class of compounds with wide biological potential. Their very specific interactions with DNA and RNA and their chemical and biological stability make them promising both
as therapeutic lead compounds and agents for diagnostic applications. The application of PNA as a genetic
therapeutic agent has to await the development of
efficient and safe methods for its uptake and cell
penetration. By contrast, its application as a recognition molecule has already led to promising developments in many areas of chemistry, biology, and biotechnology (74, 75). Recent efforts to provide further
applications of this exciting nucleic acid analog include
modifications of backbone and the development of
novel base analogs (29, 85, 112120).

2.

3.

4.

5.

6.
7.

8.

9.
10.

11.
12.

13.
14.

15.

16.

17.
18.
19.
20.

REFERENCES
1.

Nielsen, P. E., Egholm, M., Berg, R. H., and Buchardt, O.


(1991) Sequence selective recognition of DNA by strand

MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

21.
22.

displacement with a thymine substituted polyamide. Science


254, 14971500
Egholm, M., Buchardt, O., Nielsen, P. E., and Berg, R. H.
(1992) Peptide nucleic acids (PNA). Oligonucleotide analogues with an achiral peptide backbone. J. Am. Chem. Soc. 114,
18951897
Egholm, M., Buchardt, O., Christensen, L., Behrens, C., Frier,
S. M., Driver, D. A., Berg, R. H., Kim, S. K, Norden, B., and
Nielsen, P. E. (1993) PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen bonding
rules. Nature (London) 365, 566 568
Egholm, M., Nielsen, P. E., Buchardt, O., and Berg, R. H.
(1992) Recognition of guanine and adenine in DNA by
thymine and cytosine containing peptide nucleic acids. J. Am.
Chem. Soc. 114, 96779678
Demidov, V., Frank-Kamenetskii, M. D., Egholm, M., Buchardt,
O., and Nielsen, P. E. (1993) Sequence specific double strand
DNA cleavage by peptide nucleic acid (PNA) targeting using
nuclease S1. Nucleic Acids Res. 21, 21032107
Demers, D. B., Curry, E. T., Egholm, M and Sozer, A. C. (1995)
Enhanced PCR amplification of VNTR locus D1S80 using
peptide nucleic acid (PNA). Nucleic Acids Res. 23, 3050 3055
rum, H., Nielsen, P. E., Jorgensen, M., Larsson, C., Stanley,
O
C., and Koch, T. (1995) Sequence-specific purification of
nucleic acids by PNA-controlled hybrid selection. BioTechniques
19, 472 480
Perry-OKeefe, H., Yao, X.-W., Coull, J. M., Fuchs, M., and
Egholm, M. (1996) Peptide nucleic acid pre-gel hybridization:
an alternative to Southern hybridization. Proc. Natl. Acad. Sci.
USA 93, 14670 14675
Veselkov, A. G., Demidov, V., Nielsen, P. E., and FrankKamenetskii, M. D. (1996) A new class of genome rare cutters.
Nucleic Acids Res. 24, 24832487
Hanvey, J. C., Peffer, N. C., Bisi, J. E., Thomson, S. A., Cadilla,
R., Josey, J. A., Ricca, D. J., Hassman, C. F., Bonham, M. A., Au,
K. G., Carter, S. G., Bruckenstein, D. A., Boyd, A. L., Noble,
S. A., and Babiss, L. E. (1992) Antisense and antigene properties of peptide nucleic acids. Science 258, 14811485
Nielsen, P. E., Egholm, M., Berg, R. H., and Buchardt, O.
(1993) Peptide nucleic acids (PNA). Potential antisense and
antigene agents. Anti-Cancer Drug Design 8, 53 63
Boffa, L. C., Morris, P. L., Carpeneto, E. M., Louissaint, M., and
Allfrey, V. G. (1996) Invasion of the CAG triplet repeats by a
complementary peptide nucleic acid inhibits transcription of
the androgen receptor and TATA binding protein genes and
correlates with refolding of an active nucleosome containing a
unique AR gene sequence. J. Biol. Chem. 271, 13228 13233
rum, H., Nielsen, P. E., Egholm, M., Berg, R. H., Buchardt,
O
O., and Stanley, C. (1993) Single base pair mutation analysis by
PNA directed PCR clamping. Nucleic Acids Res. 21, 53325336
Carlsson, C., Jonsson., M., Norden, B., Dulay, M. T., Zare,
R. N., Noolandi, J., Nielsen, P. E., Tsui, L-C., and Zielenski, J.
(1996) Screening for genetic mutations. Nature (London) 380,
207
Thiede, C., Bayerdorffer, E., Blasczyk, R., Wittig, B., and
Neubauer, A. (1996) Simple and sensitive detection of mutations in the ras proto-oncogenes using PNA-mediated PCR
clamping. Nucleic Acids Res. 24, 983984
Wang, J., Palecek, E., Nielsen, P. E., Rivas, G., Cai, X., Shirashi,
H., Dontha, N., Luo, D., and Farias, P. A. M. (1996) Peptide
nucleic acid probes for sequence-specific DNA biosensors.
J. Am. Chem. Soc. 118, 76677670
Nielsen, P. E. (1998) Structural and biological properties of
peptide nucleic acid (PNA). Pure Appl. Chem. 70, 105110
Nielsen, P. E. (1998) Sequence-specific recognition of doublestranded DNA by peptide nucleic acids. Adv. DNA SequenceSpecific Agents 3, 267278
Corey, D. R. (1997) Peptide nucleic acids: expanding the scope
of nucleic acid recognition. Trends Biotechnol. 15, 224 229
Eriksson, M., and Nielsen, P. E. (1996) PNA-nucleic acid
complexes: Structure, stability and dynamics. Q. Rev. Biophys.
29, 369 394
Merrifield, R. B. (1963) Solid-phase synthesis. I. The synthesis
of a tetrapeptide. J. Am. Chem. Soc. 85, 2149 2154
Merrifield, B. (1986) Solid-phase synthesis. Science 232, 341
347

1057

23.

24.

25.

26.

27.

28.

29.
30.

31.
32.
33.

34.

35.
36.

37.

38.
39.

40.

41.
42.

1058

Christensen, L., Fitzpatrick, R., Gildea, B., Petersen, K. H.,


Hansen, H. F., Koch, T., Egholm, M., Buchardt, O., Nielsen,
P. E., Coull, J., and Berg, R. H. (1995) Solid-phase synthesis of
peptide nucleic acids. J. Peptide Sci. 3, 175183
Norton, J. C., Waggenspack, J. H., Varnum, E., and Corey, D. R.
(1995) Targeting peptide nucleic acid-protein conjugates to
structural features within duplex DNA. Bioorg. Med. Chem. 3,
437 445
Haaima, G., Lohse, A., Buchardt, O., and Nielsen, P. E. (1996)
Peptide nucleic acids (PNAs) containing thymine monomers
derived from chiral amino acids: hybridization and solubility
properties of D-lysine PNA. Angew. Chem. Int. Ed. Engl. 35,
1939 1942
Dueholm, K., Egholm, M., Behrens, C., Christensen, L., Hansen, H. F., Vulpius, T., Petersen, K. H., Berg, R. H., Nielsen,
P. E., and Buchardt, O. (1994) Synthesis of peptide nucleicacid monomers containing the 4 natural nucleobasesthymine, cytosine, adenine, and guanine and their oligomerization. J. Org. Chem. 59, 57675773
Thomson, S. A., Josey, J. A., Cadilla, R., Gaul, M. D., Hassman,
C. F., Luzzio, M. J., Pipe, A. J., Reed, K. L., Ricca, D. J., Wiethe,
R. W., and Noble, S. A. (1995) Fmoc mediated synthesis of
peptide nucleic-acids. Tetrahedron 51, 6179 6194
Egholm, M., Christensen, L., Dueholm, K. L., Buchardt, O.,
Coull, J., and Nielsen, P. E. (1995) Efficient pH-independent
sequence-specific DNA-binding by pseudoisocytosine-containing bis-PNA. Nucleic Acids Res. 23, 217222
Uhlmann, E., Peyman, A., Breipohl, G., and Will, D. W. (1998)
PNA: synthetic polyamide nucleic acids with unusual binding
properties. Angew. Chem. Int. Ed. 37, 2796 2823
Koch, T., Naesby, M., Wittung, P., Joergensen, M., Larsson, C.,
Buchardt, O., Stanley, C. J., Norden, B., Nielsen, P. E., and
rum, H. (1995) PNA-peptide chimerae. Tetrahedron Lett. 36,
O
6933 6936
Betts, L., Josey, J. A., Veal, J. M., and Jordan, S. R. (1995) A
nucleic acid triple helix formed by a peptide nucleic acid-DNA
complex. Science 270, 1838 1841
Butler, J. M., Jing-Baucom, P., Huang, M., Belgrader, P., and
Gairard, J. (1996) Peptide nucleic acid characterization by
MALDI-TOF mass spectrometry. Anal. Chem. 68, 32833287
Ross, P. L., Lee, K., and Belgrader, P. (1997) Discrimination of
single-nucleotide polymorphisms in human DNA using peptide nucleic acid probes detected by MALDI-TOF mass spectrometry. Anal. Chem. 69, 4197 4202
Eriksson, M., Christensen, L., Schmidt, J., Haaima, G., Orgel,
L., and Nielsen, P. E. (1998) Sequence dependent N-terminal
rearrangement and degradation of peptide nucleic acid (PNA)
in aqueous solution. New J. Chem. 10551059
Hyrup, B., and Nielsen, P. E. (1996) Peptide nucleic acids
(PNA): synthesis, properties and potential applications. Bioorg.
Med. Chem. 4, 523
Tomac, S., Sarkar, M., Ratilainen, T., Wittung, P., Nielsen,
P. E., Norden, B., and Graslund, A. (1996) Ionic effects on the
stability and conformation of peptide nucleic acid complexes.
J. Am. Chem. Soc. 118, 5544 5552
Kuhn, H., Demidov, V. V., Frank-Kamenetskii, M. D., and
Nielsen, P. E. (1998) Kinetic sequence discrimination of
cationic bis-PNAs upon targeting of double-stranded DNA.
Nucleic Acids Res. 26, 582587
Nielsen, P. E., Egholm, M., and Buchardt, O. (1994) Evidence
for (PNA)2/DNA triplex structure upon binding of PNA to
dsDNA by strand displacement. J. Mol. Recog. 7, 164 170
Cherney, D. Y., Belotserkovskii, B. P., Frank-Kamenetskii,
M. D., Egholm, M., Buchardt, O., Berg, R. H., and Nielsen,
P. E. (1993) DNA unwinding upon strand displacement binding of a thymine-substituted polyamide to double-stranded
DNA. Proc. Natl. Acad. Sci. USA 90, 16671670
Peffer, N. J., Hanvey, J. C., Bisi, J. E., Thomson, S. A., Hassman,
C. F., Noble, S. A., and Babiss, L. E. (1993) Strand-invasion of
duplex DNA by peptide nucleic acid oligomers. Proc. Natl.
Acad. Sci. USA 90, 10648 10652
Wittung, P., Nielsen, P. E and Norden, B. (1996) Direct
observation of strand invasion by peptide nucleic acid (PNA)
into double-stranded DNA. J. Am. Chem. Soc. 118, 7049 7054
rum, H., Nielsen, P. E., and Norden, B. (1997)
Jensen, K. K., O
Kinetics for hybridization of peptide nucleic acids (PNA) with

Vol. 14

June 2000

43.
44.
45.
46.
47.

48.
49.
50.
51.
52.

53.
54.
55.
56.
57.
58.

59.
60.
61.
62.
63.
64.
65.

66.

DNA and RNA studied with the BIAcore technique. Biochemistry


36, 50725077
Wittung, P., Nielsen, P. E., Buchardt, O., Egholm, M., and
Norden, B. (1994) DNA like double helix formed by peptide
nucleic acid. Nature (London) 368, 561563
Wittung, P., Nielsen, P., and Norden, B. (1997) Extended
DNA-recognition repertoire of PNA. Biochemistry 36, 79937979
Wittung, P., Eriksson, M., Lyng, R., Nielsen, P. E., and Norden,
B. (1995) Induced chirality in PNA-PNA duplexes. J. Am. Chem.
Soc. 117, 1016710173
Wittung, P., Kim, S. K., Buchardt, O., Nielsen, P. E., and
Norden B. (1994) Interactions of DNA binding ligands with
PNA-DNA hybrids. Nucleic Acids Res. 22, 53715377
Leijon, M., Graslund, A., Nielsen, P. E., Buchardt, O., Norden,
B., Kristensen, S. M., and Eriksson, M. (1994) Structural
characterization of PNA-DNA duplexes by NMR. Evidence for
DNA in a B-like conformation. Biochemistry 33, 9820 9825
Eriksson, M., and Nielsen, P. E. (1996) Solution structure of a
peptide nucleic acid-DNA duplex. Nature Struct. Biol. 3, 410
413
Brown, S. C., Thomson, S. A., Veal, J. M., and Davis, D. G.
(1994) NMR Solution structure of a peptide nucleic acid
complexed with RNA. Science 265, 777780
Rasmussen, H., Kastrup, J. S., Nielsen, J. N., Nielsen, J. M., and
Nielsen, P. E. (1997) Crystal structure of a peptide nucleic acid
(PNA) duplex at 1.7 resolution. Nature Struct. Biol. 4, 98 101
Ratilainen, T., Holmen, A., Tuite, E., Haaima, G., Christensen,
L., Nielsen, P. E., and Norden, B. (1998) Hybridization of
peptide nucleic acid. Biochemistry 37, 1233112342
Holmen. A., and Norden, B. (1999) Thermodynamics of
PNA-nucleic acid interactions. In Peptide Nucleic Acids: Protocols
and Applications (Nielsen, P. E., and Egholm, M., eds) pp.
8797, Horizon Press, Wymondham, U.K.
Marky, L. A., and Breslauer, K. J. (1987) Calculating thermodynamic data for transitions of any molecularity from equilibrium melting curves. Biopolymers 26, 16011620
Puglisi, J. D., and Tinoco, I., Jr. (1989) Absorbance melting
curves of RNA. Methods Enzymol. 180, 304 325
Vesnaver, G., and Breslauer, K. J. (1991) The contribution of
DNA single-strand order to the thermodynamics of duplex
formation. Proc. Natl. Acad. Sci. USA 88, 3569 3573
Giesen, U., Kleider, W., Berding, C., rum, H., and Nielsen,
P. E. (1998) A formula for thermal stability (Tm) prediction of
PNA/DNA duplexes. Nucleic Acids Res. 26, 16011620
Norden, B., Kubista, M., and Kurucsev, T. (1992) Linear
dichroism spectroscopy of nucleic acids. Q. Rev. Biophys. 25,
51170
Kim, S. K., Nielsen, P. E., Egholm, M., Buchardt, O., Berg,
R. H., and Norden, B. (1993) Right-handed triplex formed
between peptide nucleic acid PNA-T8 and poly(dA) shown by
linear and circular dichroism spectroscopy. J. Am. Chem. Soc.
115, 6477 6481
Knudsen, H., and Nielsen, P. E. (1996) Antisense properties of
duplex- and triplex-forming PNAs. Nucleic Acids Res. 24, 494
500
Nielsen, P. E. (1999) Peptide nucleic acids as therapeutic
agents. Curr. Opin. Struct. Biol. 9, 353357
Sen, S., and Nilsson, L. (1998) Molecular dynamics of duplex
systems involving PNA: structural and dynamical consequences
of the nucleic acid backbone. J. Am. Chem. Soc. 120, 619 631
Shields, G. C., Laughton, C. A., and Orozco, M. (1998)
Molecular dynamics simulation of a PNA-DNA-PNA triple helix
in aqueous solution. J. Am. Chem. Soc. 120, 58955904
Srinivasan, A. R., and Olson, W. K. (1998) Molecular models of
nucleic acid triple helixes. II. PNA and 2-5 backbone complexes. J. Am. Chem. Soc. 120, 492 499
Nielsen, P. E., Egholm, M., and Buchardt, O. (1994) Sequencespecific transcription arrest by peptide nucleic acid bound to
the DNA template strand. Gene 149, 139 145
Praseuth, D., Grigoriev, M., Guieysse, A. L., Pritchard, L. L.,
Harel-Bellan, A., Nielsen, P. E., and Helene, C. (1996) Peptide
nucleic acids directed to the promoter of the alpha-chain of
the interleukin-2 receptor. Biochim. Biophys. Acta 1309, 226 238
Bentin, T., and Nielsen, P. E. (1996) Enhanced peptide nucleic
acid binding to supercoiled DNA: possible implications for
DNA breathing dynamics. Biochemistry 35, 8863 8869

The FASEB Journal

RAY AND NORDEN

67.

68.

69.

70.

71.

72.

73.
74.
75.

76.
77.

78.

79.
80.
81.

82.
83.
84.

85.
86.

87.

rum, H., and SchusArmitage, B., Koch, T., Frydenlund, H., O


ter, G. B. (1998) Peptide nucleic acid (PNA)/DNA hybrid
duplexes: intercalation by an internally linked anthraquinone.
Nucleic Acids Res. 26, 715720
Kuhn, H., Demidov, V. V., Frank-Kamenetskii, M. D., and
Nielsen, P. E. (1998) Kinetic sequence discrimination of
cationic bis-PNAs upon targeting of double-stranded DNA.
Nucleic Acids Res. 26, 582587
Lee, R., Kaushik, N., Modak, M. J., Vinayak, R., and Pandey,
V. N. (1998) Polyamide nucleic acid targeted to the primer
binding site of the HIV-1 RNA genome blocks in vitro HIV-1
reverse transcription. Biochemistry 37, 900 910
Larsen, H. J., and Nielsen, P. E. (1996) Transcription-mediated
binding of peptide nucleic acid (PNA) to double-stranded
DNA: sequence-specific suicide transcription. Nucleic Acids Res.
24, 458 463
Mollegaard, N. E., Buchardt, O., Egholm, M., and Nielsen,
P. E. (1994) Peptide nucleic acid. DNA strand displacement
loops as artificial transcription promoters. Proc. Natl. Acad. Sci.
USA 91, 38923895
Mologni, L., leCoutre, P., Nielsen, P. E., and GambacortiPasserini, C. (1998) Additive antisense effects of different
PNAs on the in vitro translation of the PML/RAR gene.
Nucleic Acids Res. 26, 1934 1938
Good, L., and Nielsen, P. E. (1998) Inhibition of translation
and bacterial growth by peptide nucleic acid targeted to
ribosomal RNA. Proc. Natl. Acad. Sci. USA 95, 20732076
Good, L., and Nielsen, P. E. (1998) Antisense inhibition of
gene expression in bacteria by PNA targeted to mRNA. Nature
Biotechnol. 16, 355358
Taylor, R. W., Chinnery, P. F., Turnbull, D. M., and Lightowlers, R. N. (1997) Selective inhibition of mutant human mitochondrial DNA replication in vitro by peptide nucleic acids.
Nature Genet. 15, 212215
Nielsen, P. E., Egholm, M. Berg, R. H: and Buchardt, O. (1993)
Peptide nucleic acids (PNAs): potential antisense and antigene
agents Anti-Cancer Drug Design 8 53 63
Lutz, M. J., Benner, S. A., Hein, S., Breipohl, G., and Uhlmann,
E. (1997) Recognition of uncharged polyamide-linked nucleic
acid analogs by DNA polymerases and reverse transcriptases.
J. Am. Chem. Soc. 119, 31773178
Koppelhus, U., Zachar, V., Nielsen, P. E., Liu, X., Eugen-Olsen,
J., and Ebbesen, P. (1997) Efficient in vitro inhibition of HIV-1
gag reverse transcription by peptide nucleic acid (PNA) at
minimal ratios of PNA/RNA. Nucleic Acids Res. 25, 21672173
Norton, J. C., Piatyszek, M. A., Wright, W. E., Shay, J. W., and
Corey, D. R. (1996) Inhibition of human telomerase activity by
peptide nucleic acids. Nat. Biotech. 14, 615 620
Hamilton, S. E., Simmons, C. G., Kathiriya, I. S., and Corey,
D. R. (1999) Cellular delivery of peptide nucleic acids and
inhibition of human telomerase. Chem. Biol. 6, 343351
Petersen, M. B., Economou, E. P., Slaugenhaupt, S. A., Chakravarti, A., and Antonarakis, S. E. (1990) Linkage analysis of the
human HMG14 gene on chromosome 21 using a GT dinucleotide repeat as polymorphic marker. Genomics 7, 136 138
Pena, S. D., and Chakraborty, R. (1994) Paternity testing in the
DNA era. Trends Genet. 10, 204 209
Walsh, P. S., Erlich, H. A., and Higuchi, R. (1992) Preferential
PCR amplification of alleles: mechanisms and solutions. PCR
Methods Appl. 1, 241250
Misra, H. S., Pandey, P. K., Modak, M. J., Vinayak, R., and
Pandey, V. N. (1998) Polyamide nucleic acid-DNA chimera
lacking the phosphate backbone are novel primers for polymerase reaction catalyzed by DNA polymerases. Biochemistry 37,
19171925
Koppitz, M., Nielsen, P. E., and Orgel, L. E. (1998) Formation
of oligonucleotide-PNA-chimeras by template-directed ligation. J. Am Chem. Soc. 120, 4563 4569
Lansdorp, P. M., Verwoerd, N. P., van de Rijke, F. M.,
Dragowska, V., Little, M. T., Dirks, R. W., Raap, A. K., and
Tanke, H. J. (1996) Heterogeneity in telomere length of
human chromosomes. Hum. Mol. Genet. 5, 685 691
Righetti, P. G., and Gelfi, C. (1996) Capillary electrophoresis of
DNA. In CRC Series in Analytical Bio/Technology, Capillary Electrophoresis in Analytical Bio/Technology (Righetti, P. G., ed) pp.
431 476, CRC. Boca Raton

MEDICAL AND BIOTECHNICAL APPLICATIONS OF PNA

88.

89.

90.
91.

92.
93.
94.

95.

96.
97.

98.

99.
100.
101.
102.
103.

104.

105.
106.

107.
108.

Arakawa, H., Maeda, M., and Hanai, T. (1998) Strategies for


electromigration separations of biologically relevant compounds. In Advanced Chromatographic and Electromigration Methods in Biosciences (Deyl, Z., Miksik, I., Tagliaro, F., and Tesarova,
E., eds) pp. 5393, Elsevier Science, Amsterdam
Gilar, M., Smisek, D. L., and Cohen, A. S. (1998) Nucleic acids
and their constituents. In Advanced Chromatographic and Electromigration Methods in Biosciences (Deyl, Z., Miksik, I., Tagliaro,
F., and Tesarova, E., eds) pp. 576 607, Elsevier Science,
Amsterdam
Rose, D. J. (1993) Characterization of antisense binding properties of peptide nucleic acids by capillary gel electrophoresis.
Anal. Chem. 65, 35453549
Igloi, G. L. (1998) Variability in the stability of DNA-peptide
nucleic acid (PNA) single-base mismatched duplexes: real-time
hybridization during affinity electrophoresis in PNA containing gels. Proc. Natl. Acad. Sci. USA 95, 8562 8567
BIAcore X Instrument Handbook (1996) Preliminary Ed, Pharmacia Biosensor AB, Uppsala, Sweden
Lu, C., and Czanderna, A. W., eds (1984) Applications of
Piezoelectric Quartz Crystal Microbalances, Elsevier, Amsterdam
Okahata, Y., Matsunobo, Y., Ijiro, K., Mukae, M., Murakami, A.,
and Makino, K. (1992) Hybridization of nucleic-acids immobilized on a quartz crystal microbalance. J. Am. Chem. Soc. 114,
8299 8300
Okahata, Y., Niikura, K., Sugiura, Y., Sawada, M., and Morii, T.
(1998) Kinetic studies of sequence-specific binding of GCN4bZIP peptides to DNA strands immobilized on a 27-MHz
quartz-crystal microbalance. Biochemistry 37, 5666 5672
Niikura, K., Matsuno, H., and Okahata, Y. (1998) Direct
monitoring of DNA polymerase reactions on a quartz-crystal
microbalance. J. Am. Chem. Soc. 120, 8537 8538
Wang, J., Nielsen, P. E., Jiang, M., Cai, X., Fernandes, J. R.,
Grant, D. H., Ozsoz, M., Beglieter, A., and Mowat, M. (1997)
Mismatch-sensitive hybridization detection by peptide nucleic
acids immobilized on a quartz-crystal microbalance. Anal.
Chem. 69, 5200 5202
Kirpekar, F., Nordhoff, E., Larsen, K. K., Kristiansen, K,
Roepstorff, P., and Hillenkamp, F. (1998) DNA sequence
analysis by MALDI mass spectrometry. Nucleic Acids Res. 26,
2554 2559
Berkenkamp, S., Kirpekar, F., and Hillenkamp, F. (1998)
Infrared MALDI mass spectrometry of large nucleic acids.
Science 281, 260 262
Egholm, M. (1997) Spectrometry senses more than a small
difference. Nature Biotechnol. 15, 1346
Griffin, T. J., Tang, W., and Smith, L. M. (1997) Genetic
analysis by peptide nucleic acid affinity MALDI-TOF mass
spectrometry. Nature Biotechnol. 15, 1368 1372
Faruqi, A. F., Egolm, M., and Glazer, P. M. (1997) Peptide
nucleic acid-targeted mutagenesis of a chromosomal gene in
mouse cells. Proc. Natl. Acad. Sci. USA 95, 1398 1403
Pooga, M., Soomets, U., Hallbrink, M., Valkna, A., Saar, K.,
Rezaei, K., Kahl, U., Hao, J. X., Xu, X.-J., Wiesenfeld-Hallin, Z.,
et al. (1998) Cell penetrating PNA constructs regulate galanin
receptor levels and modify pain transmission in vivo. Nat.
Biotechnol. 16, 857 861
Basu, S., and Wickstrom, E. (1997) Synthesis and characterization of a peptide nucleic acid conjugated to a D-peptide analog
of insulin-like growth factor 1 for increased cellular uptake.
Bioconj. Chem. 8, 481 488
Simmons, C. G., Pitts, A. E., Mayfield, L. D., Shay, J. W., and
Corey, D. R. (1997) Synthesis and permeability of PNA-peptide
conjugates. Bioorg. Med. Chem. Lett. 7, 30013007
Aldrian-Herrada, G., Desarmenien, M. G., Orcel, H., BoissinAgasse, L., Mery, J., Brugidou, J., and Rabie, A. (1998) A
peptide nucleic acid (PNA) is more rapidly internalized in
culture neurons when coupled to a retro-inverso delivery
peptide. The antisense activity depresses the target mRNA and
protein in magnocellular oxytocin neurons. Nucleic Acids Res.
26, 4910 4916
Krotz, A. H., Buchardt, O., and Nielsen, P. E. (1995) Synthesis
of Retro-Inverso peptide nucleic acids: 1. Characterization of
the monomers. Tetrahedron Lett. 36, 6937 6940
Krotz, A. H., Buchardt, O., and Nielsen, P. E. (1995) Synthesis
of Retro-Inverso peptide nucleic acids: 2. Oligomerization
and stability. Tetrahedron Lett. 36, 6941 6944

1059

109.

110.
111.
112.

113.

1060

Noble, S. A., Bonham, M. A., Bisi, J. E., Bruckenstein, D. A.,


Brown, P. H., Brown, S. C., Cadilla, R., Gaul, M. D., Hanvey,
J. C., Hassman, C. F., Josey, J. A., Luzzio, M. J., Myers, P. M.,
Pipe, A. J., Ricca, D. J., Su, C. W., Stevenson, C. L., Thomson,
S. A., Wiethe, R. W., and Babiss, L. E. (1995) Impact of
biophysical parameters on the biological assessment of peptide
nucleic acids, antisense inhibitors of gene expression. Drug
Dev. Res. 34, 184 195
Uhlmann, E. Will, D. W., Breiphol, G., Langer, D., and Ryte, A.
(1996) Synthesis and properties of PNA/DNA chimeras. Angew. Chem. 108, 27932797
Uhlmann, E. Will, D. W., Breiphol, G., Langer, D., and Ryte, A.
(1996) Synthesis and properties of PNA/DNA chimeras. Angew. Chem. Int. Ed. Engl. 35, 26322635
Lagriffoule, P. Wittung, P. Eriksson, M. Jensen, K. K. Norden,
Buchardt, O., and Nielsen, P. E. (1997) Peptide nucleic acids
with a conformationally constrained chiral cyclohexyl-derived
backbone. Chem. Eur. J. 3, 912919
Efimov, V. A., Choob, M. V., Buryakova, A. A., Kalinkina, A. L.,
and Chakhmakhcheva, O. G. (1998) Synthesis and evaluation
of some properties of chimeric oligomers containing PNA and
phosphono-PNA residues. Nucleic Acids Res. 26, 566 575

Vol. 14

June 2000

114.
115.
116.
117.
118.

119.

120.

rum, H., and


Armitage, B., Ly, D., Koch, T., Frydenlund, H., O
Schuster, G. B. (1998) Hairpin-forming peptide nucleic acid
oligomers. Biochemistry 37, 94179425
Chirstensen, L., Hansen, H. F., Koch, T., and Nielsen, P. E.
(1998) Inhibition of PNA triplex formation by N 4-benzoylated
cytosine. Nucleic Acids Res. 26, 27352739
Nielsen, P. E. (1999) Applications of peptide nucleic acids.
Curr. Opin. Biotechnol. 10, 7175
Hansen, H. F., Christensen, L., Dahl, O., and Nielsen, P. E.
(1999) 6-thioguanine in peptide nucleic acids: synthesis and
hybridization properties. Nucleosides Nucleotides 18, 59
Falkiewicz, B., Kowalska, K., Kolodziejczyk, A. S., Wisniewski,
K., and Lankiewicz, L. (1999) Synthesis of new chiral peptide
nucleic acid (PNA) monomers by a simplified reductive animation method. Nucleosides Nucleotides 18, 353361
Lutz, M. J., Will, D. W., Breiphol, G., Brenner, S. A., and
Uhlmann, E. (1999) Synthesis of a monocharged peptide
nucleic acid (PNA) analogue and its recognition as substrate
by DNA polymerases. Nucleosides Nucleotides 18, 393 40
Ardhammar, M., Norden, B., Nielsen, P. E., Malmstrom, B. G.,
and Wittung-Stafshede, P. (1999) In vitro membrane of modified peptide nucleic acid (PNA). J. Biol. Struct. Dyn. 17, 33 40

The FASEB Journal

RAY AND NORDEN