Annals of Botany 85 (Supplement A): 203-209, 2000

doi:10.1006/anbo.1999.1056, available online at http://www.idealibrary.com on

IDEaL

Self-incompatibility in the Grasses

UTE BAUMANN, JUAN JUTTNER, XUEYU BIAN and PETER LANGRIDGE*
Department of Plant Science, University of Adelaide, Glen Osmond, SA 5064, Australia
Received: 21 July 1999

Accepted: 9 November 1999

Key words: Self-incompatibility, Poaceae, protein kinase, thioredoxin.

INTRODUCTION
The grass family Poaceae contains between 650 and 700
genera and includes approximately 10000 species (Watson
and Dallwitz, 1992). It is the fourth largest family of
flowering plants and the second largest family of the monocotyledons, eclipsed only by the Orchidaceae (Watson,
1990). Economically it is arguably the most important
family of plants providing all the cereal crops, most of the
world's sugar and many important feed and forage crops
for grazing animals. Ecologically, the grasses also represent
the most dominant family on earth as they are found in
almost every habitat available to flowering plants (Watson,
1990).

SELF-INCOMPATIBILITY IN THE GRASSES

The existence of self-incompatibility in the grasses has been
known for over a century. For example, Lundqvist (1954)
reported that in 1877 Rimpau proved the predominance of
self-sterile individuals in populations of rye. The earliest
comprehensive studies on self-incompatibility in the
Gramineae were carried out by several researchers,
including Kornicke (1890), Troll (1930, 1931) and Beddows
(1931). Connor (1979) summarized and updated the knowledge in this area and his review can be consulted for
specific references.
Self-incompatibility is widespread among the grasses
and present in at least 16 genera (Connor, 1979). Selfincompatible and self-compatible species are typically
* For correspondence. Fax +61 8 8303 7102, e-mail plangrid@
waite.adelaide.edu.au

0305-7364/00/0A0203 + 07 $35.00/00

found in the same genus, the frequency of selfincompatibility being higher in perennial than annual
species (K6rnicke, 1890; Beddows, 1931). Grasses display
some characteristics typical of plants with sporophytic selfincompatibility (Heslop-Harrison, 1982). Grass pollen is
tricellular and short-lived and the stigma is dry. The
incompatibility reaction is also generally rapid, although
the strength of the reaction appears to be species, and in
some cases genotype, specific (Shivanna et al., 1982). In
Guadinia fragilis (Pooideae) arrest of pollen tube growth
occurs almost immediately upon contact with the stigma
(Shivanna et al., 1982). Conversely, in Cynodon dactylon
(Chloridoideae) the incompatibility reaction is reported as
occurring in the style (Thomas and Murray, 1975).
Self-incompatible or predominantly cross-fertilizing
species (displaying inbreeding depression) have been identified from tribes representing five of the six subfamilies of
the Poaceae (summarized in Table 1). However, to date no
self-incompatible species belonging to the Bambusoideae,
Oryzidoideae or Centostecoideae have been described in the
literature.
Current evidence suggests that plants from the same
family will possess a common self-incompatibility system
(Conner et al., 1998) as demonstrated in all of the dicotyledonous species investigated at the molecular level. Selfincompatibility appears to be prevalent in the grasses.
However, whether the mechanism of incompatibility in this
large family is a common one, remains unclear.
GENETICS OF SI IN THE POACEAE
The genetics of SI in the Poaceae remained unknown until
studies in Secale cereale by Lundqvist (1954) and Phalaris
2000 Annals of Botany Company

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

The grasses represent one of the most important families of plants since they constitute our major crops and pastures
and dominate many natural ecosystems. Self-incompatibility (SI) is widespread in the grasses and is under the control
of a series of alleles at each of two unlinked loci, S and Z. Specification of the pollen grain is gametophytic and
depends upon the combination of S and Z alleles in the pollen grain. Both of these must be matched in the pistil for
the pollen grain to be incompatible. Several lines of research suggest that this two-locus SI system is shared by all
grass species of the Pooideae and possibly by the entire Graminae. Firstly, genetic studies demonstrated the presence
of the S-Z system in the Triticeae, the Poeae and Avenae. Secondly, linkage analyses showed common markers linked
to the S-gene in grass species from all three tribes. Recent molecular studies revealed remarkable synteny of
chromosomes and conservation of gene order within the Poaceae. Molecular markers have also been used to confirm
syntenous localization of S and Z in several species. Despite the complexity of the grass incompatibility system
relative to that in other families, the detailed genetic and physical maps for the crop species in the Triticeae and the
availability of large insert libraries and mutations at the incompatibility loci, makes this a particularly promising
family for molecular studies.
( 2000 Annals of Botany Company

Langridge et al.-Sef-incomnpatibility in the Grasses

204

TABLE 1. Summary of grass subfamilies and tribes in which self-incompatible or predominantly cross-fertilizing species
have been identified
Subfamily

Tribe

Pooideae

Pocae
Avencae
Agrogtideae
Triticeae
Bromeae
Stipeae
Paniceae
Andropogoneae
Chlorideae
Eragrostideae
Arundineae
Danthonieae

Panicoideae
Chloridoideae
Arundinoideae

Number of genera
7
9
5
4
5
8
4
1

Bambusoideae

Reference

Bush and Barrett (1993)

Mckone ct (al.(1998)
Daehler (1999)

TABLE 2. Species where the two

locus S Z sel!fincompatibility system has been demonstrated or suggested (after

Hayman, 1992)
Tribe

Species

Reference

Species in which the S Z system has been identified by studies using parental genotypes of known relationship
Lundqvist (1954)
Triticeae
Secale cereale
Poeae
Lundqvist (1955)
Festuca pratensis
Hayman (1956)
Aveneae
Phalariscoerulescens'
Lundqvist (1965)
Hordeun hulhosum
Triticeae
Lundqvist (1965)
Poeae
Dactylis aschersoniOna
Murray (1974)
Poeae
Briza media
Cornish et al. (1979)
Poeae
Lolium perenne
Fearon t al. (1983)
Poeae
Lolirm multiflorutn
Species in which a gametophytic system has been identified and there are differences between reciprocal crosses
Alopecurus mosuroiides

Aveneae

Leach and Hayman (1987)

Cvl7
nosurus cristatus
Hous lnaturs
Alopecurus pratensis
Arrhenatherum elatius
Festruca ruhra
Deschampiaflexuosa
Phalarisarundinacea

Poeae
Aveneae
Aveneae
Aveneae
Poeae
Aveneae
Aveneae

Weimarck
Weimarck
Weimarck
Weimarck
Weimarck
Weimarck
Weimarck

coerulescens by Hayman (1956). Both researchers proposed

that self-incompatibility in grasses was under the gametophytic control of two multiallelic genes, named S and Z,
which segregated independently. A pollen grain is incompatible when both its S and Z alleles are matched in the
recipient pistil. The S-Z system has been identified in eight
species and is likely to be present in another eight (Table 2).

FEATURES OF THE S-Z SYSTEM

Due to the complementary interaction of two genes, SI in
the grasses has features distinct from those of single locus
systems. These include differences in reciprocal crosses and
the degree of compatibility (i.e. the percentage of compatible pollen) between two plants. The degree of compatibility can be either 0, 50, 75 or 100%, depending on the

(1968)
(1968)
(1968)
(1968)
(1968)
(1968)
(1968)

genotypes. For instance, a cross between a plant with the

genotype S 1 1Z,.2 and S1.2Z. 3 as the pollen donor will show
75% compatible pollen grains, while in the reciprocal cross,
50% of the pollen will be compatible.
A fundamental difference between the single-locus
gametophytic SI systems in dicotyledons and the S-Z
incompatibility system is that autopolyploid grasses remain
self-incompatible. This has been demonstrated in Secale
cereale, Festuca pratense and Dactylis glomerata by
Lundqvist (1957, 1962, 1968) and in Lolium perenne by
Fearon and co-workers (Fearon et al., 1984a,b). Also unlike
single locus systems (Lewis, 1947), there are no dominant or
competitive interactions between alleles of the diploid
pollen or between the alleles of the tetraploid style. In an
autotetraploid grass, a pollen grain will be incompatible if
any one of the possible S--Z allele combinations is present
in the recipient pistil.

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

The number of genera represented by the species is presented.

Except where indicated (reference), all data are from Hayman (1992) and Conner (1979).

Langridge et al.-Self-incomnpatibility in the Grasses

BREAKDOWN OF SI-INVOLVEMENT OF
FURTHER LOCI

Secale cereale (Voylokov et al., 1993).

GENETIC ORGANIZATION
Genes that are linked to either S or Z will show disturbed
segregation in a cross which is only partially compatible.
Hence, the analysis of such disturbed segregations should
allow the identification of genes linked to the SI loci and
might provide clues about their location in the genome.
Leach and Hayman (1987) used this approach to show that
the isozyme phosphoglycoisomerase, PGI-2, which is linked
to the S-locus in Lolium perenne (Cornish et al., 1980),

is also linked to the S-locus in Alopecurus myusorides,

Phalariscoerulescens, Festuca pratensis, Holcus lanatus and
Secale cereale.

Other studies have confirmed this observation and

provided further linkage information. The S-gene is now
known to be linked to PGI-2 and a leaf peroxidase, Prx-7,
and located on chromosome I R in rye and chromosome 6
in Lolium (Lewis et al., 1980; Gertz and Wricke, 1989). The
Z-gene is linked to beta-glucosidase and Esterases 4/11 and
located on chromosome 2R in rye (Wricke and Wehling,
1985; Fuong et al., 1993). In Lolium, linkage was indicated
between the Z-locus and the isozyme glutamate oxalacetatetransaminase, GOT-3 (Thorogood and Hayward, 1991),
which is located on chromosome 2 (Lewis et al., 1980). The
T-locus in rye is linked to the Esterase 5-7 complex and
located on chromosome 5R (Fuong et al., 1993). A recent
mapping analysis in Secale combined isozyme and morphological information with RFLP markers (Voylokov et al.,
1997). The study not only confirmed the chromosomal
locations but also identified closely linked molecular
markers for each of the loci. The use of these markers
may facilitate comparative mapping and map-based
cloning.

MOLECULAR BIOLOGY-ISOLATION OF
SELF-INCOMPATIBILITY GENES
Several strategies have been used to try and identify the
genes controlling self-incompatibility in the grasses. Li et al.
(1994) used a differential screening technique to identify a
putative S gene clone from Phalaris coerulescens. In this

approach a cDNA library made from mature pollen of

Phalariswas screened to identify sequences showing pollenspecific expression and differences in hybridization intensity
when probed with cDNA made from pollen RNA from
plants with different S or Z genotypes. The putative S gene
clone was named Bm2 but no Z candidates were identified
(Li et al., 1994). There were several lines of evidence to
support Bm2 as representing S: (1) co-segregation of an
RFLP detected with Bm2 with the S genotype of over 120
plants; (2) the gene was strongly expressed in the pollen
relative to other tissues. The difference was about 20 fold;
(3) presence of a highly conserved catalytic domain and a
variable, potentially allelic domain.
Bm2 was shown to encode a protein with thioredoxin
catalytic activity (Li et al., 1995). This was demonstrated by
synthesizing the thioredoxin domain in E. coli, purifying
the synthesized protein and assaying for the ability of the
protein to catalyse the reduction of insulin and to act as a
substrate for E. coli thioredoxin reductase.
Although it is now clear that the thioredoxin-like protein
encoded by Bm2 is not the S gene as originally proposed
(see below) this protein may still play a role in the events
following recognition during an incompatible pollination.
Detection of the Bm2 mRNA during in situ hybridization
has shown some interesting results. Figure 1 shows a series
of stigmas that have been pollinated with compatible,
incompatible or 50% compatible pollen. In the vicinity of
an incompatible pollination, massive expression of the Bm2
gene appears to occur. When a 50% compatible pollination
is made, only about half of the pollen grains appear to
induce this response. This suggests a direct role of the Bm2
protein in the incompatibility reaction. However, there is an
alternative explanation. Damage to the stigma also seems to
induce massive expression of Bm2. Indeed it is quite difficult
to produce the pictures shown in Fig. 1 since, in most
preparations, the whole stigma is labelled. Therefore, the
apparent induction of Bm2 expression in the incompatible
pollinations may reflect tissue damage at the site of pollen
rejection. Nevertheless this result does imply a role for the
Bm2 thioredoxin in some aspect of self-incompatibility,
particularly given the apparent speed of the response, and
this effect is being further investigated.
DOES Bm2 REPRESENT S?
An unexpected result came when the expression of the Bm2
gene was studied in other grasses. In Phalaris, Bm2 was
abundantly expressed in mature pollen. However, the Bm2
mRNA was barely detectable in the pollen of other grass
species including self-incompatible species such as Secale
cereale, Hordeum bulbosum and Lolium perenne (Li et al.,

1997). Indeed, expression in Phalaris was several hundred

fold greater than in the other species. This result was

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

The study of the complete breakdown of self-incompatibility has revealed the existence of different kinds of
mutants with interesting characteristics. Working on rye,
Lundqvist (1958, 1962, 1968) identified mutations at or
near the S and Z loci. All mutants were pollen-only (pollenpart), which meant that the pollen had lost its SI specificity
whereas it was retained in the pistil of the same plant.
Thorogood and Hayward (1991) analysed a self-compatible mutant of Lolium perenne. Their results indicated that
the gene causing self-fertility was allelic to neither S nor Z
suggesting a third locus was involved.
The presence of a third locus was substantiated in an
extensive study of self-compatible mutants in Phalaris
coerulescens by Hayman and Richter (1992). The mutation
at the third locus, named T, which showed close linkage to a
leaf peroxidase isozyme, had an effect only in the pollen and
not in the pistil of the mutant plant. Pollen carrying the
T-mutation was compatible with any plant, irrespective of
its S or Z genotype. It is interesting to note that the
mutation identified by Thorogood and Hayward (1991) in
L. perenne also only affected pollen behaviour. A third
locus conferring self-compatibility was also identified in

205

206

Langridge et al.-Self-in,compatibility in the Grasses

inconsistent with the supposition that a common selfincompatibility system operates in the grasses.
Two further results have shown that Bm2 does not
represent S. First, recombination has been found between
Bm2 and S. It now appears that Bm2 is about 1cM from
S. Large populations have been constructed segregating for
S and Z. These were used to reassess the linkage between

Bm2 and S, and two recombinants were identified in the

first 100 plants of the new population.
Second, the isolation and sequencing of Phalaris Bm2
homologues from the self-incompatible species Lolium
perenne, Hordeum bulbosum and Secale cereale in addition

Intron 1

Exon 2

Phalaris SI s,

3'

PTrx I

5' I
I

3'
I.

I
I
I

S1
cgccgaccgacgcggttaattcacgggctcgcccacgcac
PTrxl CGCCGACCGACGCGGTTAATTCACGGGCTCGCCCACGCAC
gccggccgtccgtaccacgcggttaatccaccgttagctc
GCCGGCCGTCCGTCCGACGCGGTTAATCCACCGCGTCGTC
-------- cggcgtagtagtttgtg---ccagaaacacga
GCCGTCGCCGCCGTCGTCGT CGTCGCCTCCAGAAACACGA
gccggccatagCACGGCCGCGGAATATTCCACGTCCCTCC
GCCGGCCATAGCACGGCCGCGGAATATTCCACGTCCCTCC

FIG. 1. Whole-mount in situ localization of the S mRNA after

compatible or incompatible pollination. A, 100% incompatible pollination after 3-5 h; B, 100% compatible pollination after 35 h; C, 50%
incompatible pollination after 30 min pollination.

FIG. 2. Comparative alignment of the PTrxl sequence with a

homologous region covering the predicted first intron/second exon
boundary of the PhalarisS, sequence. The predicted first intron of the
S, sequence is given in lowercase letters. Different nucleotides are in
bold italics. Gaps in the alignment are indicated by dashes.

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

to two new alleles from Phalaris coerulescens (genotype

S,2Z,,) have provided data that conflict with previously
published results. The Bm2 homologues isolated have an
open reading frame (ORF) which translates into a protein
of 131 amino acids, less than half the size of the predicted
S l and S2 protein sequences (Li et al., 1994) which are
reported to be 282 and 281 amino acids, respectively. The
ORFs represent the first encountered in all frames of all
sequences and the only ones identified in the sequences of
all four species. The deduced protein sequences are almost
identical to the thioredoxin domains of the putative Sl and
S2 alleles of Phalaris. Since these genes appear to encode a
novel class of thioredoxin proteins they have been called
PTrxl and PTrx2 although they are actually identical to
the thioredoxin domains of the putative S, and S.
Comparing the new sequence data with the previously
published putative Phalaris S sequence, a discrepancy in
the region of the first intron-second exon boundary was
found (Fig. 2). The cDNA sequence at the 5' end of the
genes isolated in this study identified regions of homology
to, and terminating within, the first intron of the PhalarisS,
sequence reported by Li et al., 1994. When one compares
the structure of the Bm2 homologues from the various
grasses (Fig. 3) the number and, in several cases, conserved
position of upstream stop codons, makes it clear that the
thioredoxin-like proteins do not constitute a component of
larger proteins. Furthermore, when the sequences of PTrxl
and PTrx2 were compared with the published Phalaris
coerulescens S, and S2 sequences, it became apparent that
the proposed allelic domain almost certainly represented

Langridge et al.-Self-incompatibility in the Grasses

I

Il

207
Phalaris PTrxl

Phalaris PTrx2
_-IiMI-II__MMMIMMIMIIIMMIIIIIImmm

Lolium perenne

I~R~mmmmmmmmmm

III

Rn

I
I Stop codon

II

Secale cereale

lnllllInsm~rra

I1

ATG start codon

Hordeum bulbosum

Thioredoxin coding region

FIG. 3. Structure of the Bm2 mRNA from several grass species including three alleles from Phalaris.Messenger RNA was prepared from mature
pollen of Phalaris, Lolium, Secale and Hordeum. This was used as template for RT-PCR. The PCR products were cloned and sequenced.

ROLE OF PROTEIN KINASES IN

SELF-INCOMPATIBILITY
Wehling et al. (1994a) proposed that pollen protein
phosphorylation was part of the signal transduction
mechanism of self-incompatibility in rye. Pollen germinated
in vitro in the presence of self-stigma extract was found to
show a higher phosphorylation activity than pollen germinated in the presence of cross-stigma extract. In addition,
significantly reduced basic phosphorylation activity was
detected in a self-compatible mutant and three proteins
failed to be phosphorylated.
These researchers also studied the effect of protein kinase
inhibitors and Ca 2+ antagonists on the self-incompatibility
response. Isolated pistils were placed on agar medium
containing the inhibitor and pollinated with self-pollen. Of

the inhibitors tested, Lavendustin A, a tyrosine kinase

inhibitor, showed the strongest effect and verapamil, a
calcium channel blocker, resulted in almost complete
suppression of the SI response.
Speculating on the involvement of molecules similar to
those controlling the SI response in Brassica, the S-locus
glycoprotein (SLG) and S-receptor kinase (SRK), Wehling
et al. (1994b) used primers derived from SLG-sequences in
PCR reactions with rye DNA as the template. Amplified
bands were subsequently separated using denaturing
gradient gel electrophoresis and a 280 bp PCR fragment
was identified which displayed a polymorphism that cosegregated with the S-genotypes of 46 plants tested.
As part of our study on pollen-expressed genes which are
potentially involved in pollen-stigma interactions, we have
isolated four clones from a pollen cDNA library of Phalaris
coerulescens which show homology to protein kinases
(Table 3). All clones are predominantly or exclusively
expressed in mature pollen and represent very abundant
mRNAs. DNA hybridization experiments showed that all
four cDNA clones represented low or single copy genes.
However, mapping experiments for B4e, A4 and Bm7d
suggest that none of the clones represents either the S or the
Z gene in Phalarisbut one of these genes could represent T.
It has not yet been possible to map the clone A12a due to
the absence of any detectable polymorphisms between the
parents of the mapping populations, so this may still be an
S or Z candidate. The role of these protein kinases is
currently under investigation.

TABLE 3. Pollen-expressedprotein kinasesfrom Phalaris

Name of cDNA clone

Expression

Homology

B4e
A12a
A4
Bm7d

Pollen-specific
Pollen-specific
Pollen-specific
Predominantly pollen, but at lower levels also in
pistils, anthers, leaves and roots

Calcium-dependent calmodulin-independent protein kinases

Serine/threonine protein kinase
Serine/threonine protein kinase
Mitogen-activated protein kinase

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

the 5' untranslated region of these genes. The small number

of 5' sequence differences found when S and S2 are
compared with PTrxl and PTrx2 indicates that they
represent different alleles. The misinterpretation of the
allelic domain in the S, and S2 sequences undoubtedly
resulted from the prediction of the first intron and exon.
From these data it is concluded that the Bm2 genes
represent a new class of thioredoxin-like proteins. PTrxl
and PTrx2 represent two alleles of the Bm2 gene. It is clear
that Bm2 does not represent the S gene. Rather Bm2
represents a thioredoxin-like gene linked to the S-locus.
Whether this gene contributes to the self-incompatibility
reaction remains to be investigated.

208

Langridge et al.-Self-incompatibility in the Grasses

ALTERNATIVE STRATEGIES FOR CLONING

S AND Z

(1) Small genome size. The 2C genome size of Phalarisis

estimated at between 28 and 90 pg (Watson, 1990).
This is only two to three times the size of the rice
genome. The small genome implies that the physical
distance that will need to be analysed will be far smaller
than for many other grasses including rye and barley
(17 and 11 pg, respectively).
(2) Good genetic linkage maps and abundant RFLP
probes from wheat, barley and rye that can be
transferred readily across to Phalaris.
(3) Ease of producing a large population of defined S or Z
genotype. The structure of the crosses to be used means
that only a single S or Z genotype can be produced
(Fig. 3). Consequently, tedious genotyping of a large
number of plants is not needed.
(4) In contrast to rye, Phalaris is a perennial grass and
recombinant lines identified in the mapping work can
be maintained indefinitely so that new markers can be
regularly added to the maps to increase marker density.
In any map-based cloning exercise the size of the mapping
population is critical and should be in excess of 1000
meiotic products.
CONCLUSIONS
The grasses present a particularly interesting system for the
study of self-incompatibility. Genetic studies indicate that a
common self-incompatibility system operates in the grasses.
The involvement of two unlinked loci in determining
specificity adds complexity relative to the single locus
systems that have attracted most attention in recent years.
The activity of two loci also suggests that there is not only
an interaction between the pollen and stigma gene products
but between the S and Z gene products in both the pollen
and the stigma.
Although neither the S nor Z gene has as yet been
cloned, initial molecular work has provided evidence that
protein kinases and possibly a thioredoxin are involved in
the reaction. Future work will concentrate on the use of the
extensive genetic data on the grasses and the detailed

Cross

Pollen

Progeny

SlIZ

12 x S2Z

Z population
St 2 Z11 XSlIZ

SlZl

SiZI

S2Zl

SlZ 2

S12Zl

S12Z2

S1 2 Z1 2

SlIZ

12

12

FIG. 4. Construction of the S and Z mapping populations. For each

cross only a single pollen genotype will be able to effect fertilization,
this is the SZ, pollen for the S population and the S,Z, for the Z
population. For both populations all progeny will be heterozygous at
the target locus, S or Z. Consequently, no genotyping is necessary for
the self-incompatibility loci during mapping. Recombinants will be
revealed as homozygous for the marker locus.

linkage maps that have been produced for wheat, barley

and relatives. These provide valuable tools in map-based
cloning of the S and Z loci.
Importantly, the effort in elucidating the molecular basis
of self-incompatibility in the grasses has drawn several new
converts in recent years with at least seven groups around
the world now working on identifying the genes involved in
controlling this process. The systems being studied include
Phalaris,Secale, Hordeum and Lolium. Significant advances
can be expected.

LITERATURE CITED
Beddows AR. 1931. Seed setting and flowering in various grasses.
University College of Wales Series H 12: 5-99.
Bush EJ, Barrett SCH. 1993. Genetics of mine invasions by
Deschampsia cespitosa (Poaceae). Canadian Journal of Botany
71:1336 1348.
Conner HE. 1979. Breeding systems in the grasses: a survey. New
Zealand Journal oJ Botany 17: 547-574.
Conner JA, Conner P, Nasrallah ME, Nasrallah JB. 1998. Comparative
mapping of the Brassica S locus region and its homeolog in
Arabidopsis: implications for the evolution of mating systems in
the Brassicaceae. The Plant Cell 10: 801-812.
Cornish MA, Hayward MD, Lawrence MJ. 1979. Self-incompatibility
in diploid Lolium perenne L. Heredity 43: 95 106.
Cornish MA, Hayward MD, Lawrence MJ. 1980. Self-incompatibility
in ryegrass. III. The joint segregation of S and PGI-2 in Loliur
perenne L. Heredity 44: 55-62.
Daehler CC. 1999. Inbreeding depression in smooth cordgrass
(Spartina alterniflora, Poaceae) invading San Francisco Bay.
American Journal of Botan 86: 131 139.
Fearon CH, Hayward MD, Lawrence MJ. 1983. Self-incompatibility in
rye grass. V. Genetic control, linkage and seed set in diploid
Lolium multiflorum Lam. Heredity 50: 35 46.
Fearon CH, Hayward MD, Lawrence MJ. 1984a. Self-incompatibility
in rye grass. VII. The determination of incompatibility genotypes
in autotetraploid families of Lolium perenne L. Hereditl 53:
403-413.

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

As described above, it is expected that there are at least four

genes involved in self-incompatibility recognition: the
stigma S, pollen S, stigma Z and pollen Z genes. The
isolation of pollen only (or pollen-part) mutants in several
systems including Phalaris(Hayman and Richter, 1992), the
very nature of the pollen stigma recognition reaction, and
transformation results using the tobacco and petunia
systems (Lee et al., 1994; Murfett et al., 1994), supports
the assumption that the pollen and stigma genes are very
closely linked but discrete genes. It is, therefore, probable
that the S and Z loci comprise several genes, at least two
each, and may occupy a large physical region of the
genome. The map-based cloning approach provides a
means of obtaining all genes in the S and Z regions. The
grass system, and Phalaris in particular, offers advantages
for this approach for the following reasons:

S population

Langridge et al.-Self-incompatibility in the Grasses

Lundqvist A. 1965. Self-incompatibility in Dactylis aschersoniana

Graebn. Hereditas 54: 70-87.
Lundqvist A. 1968. The mode of origin of self-fertility in grasses.
Itereditas 59: 413-426.
Lundqvist A. 1969. Self-incompatibility in Dactylis glomerata L.
Hereditas 61: 353-360.
Mckone MJ, Lund CP, Obrien JM. 1998. Reproductive biology of two
dominant prairie grasses (Andropogon gerardii and Sorghastrum
nutans, Poaceae)-male-biased sex allocation in wind pollinated
plants. American Journal of Botany 85: 776-783.
Murfett J, Atherton RL, Mou B, Grasser CS, McClure BA. 1994.
S-RNase expressed in transgenic Nicotiana causes S-allele specific
pollen rejection. Nature 367: 563-566.
Murray BG. 1974. Breeding systems and floral biology in the genus
Briza. Heredity 33: 285-292.
Oka H-I, Morishima H. 1967. Variations in the breeding systems of
wild rice, Oryza perenni. Evolution 21: 249-258.
Shivanna KR, Heslop-Harrison Y, Heslop-Harrison J. 1982. The
pollen-stigma interaction in the grasses. 3. Features of the selfincompatibility response. Acta Botanica Neerlandica 31: 307-319.
Thomas SM, Murray BG. 1975. A new site for the self-incompatibility
reaction in the Gramineae. Incompatibility Newsletter 6: 22-23.
Thorogood D, Hayward MD. 1991. The genetic control of selfcompatibility in an inbred line of Lolium perenne L. Heredity 67:
175-181.
Troll HJ. 1930. Die Bedeutung der Blih- und Befruchtungsverhiltnisse
von Grisern fir ihre Ziichtung. Der Zachter Band II: 330-336.
Troll HJ. 1931. Untersuchungen fiber die Selbststerilitit und Selbstfertilitat bei Grasern. Zeitschriftfur Zuchtung. A. Pflanzenzuchtung XVI: 105-136.
Voylokov AV, Fuong FT, Smirnov VG. 1993. Genetic studies of selffertility in rye (Secale cereale L.) 1. The identification of genotypes
of self-fertile lines for the S alleles of self-incompatibility genes.
Theoretical and Applied Genetics 83: 616-618.
Watson L. 1990. The grass family, Poaceae. In: Chapman GP, ed.
Reproductive versatility in the grasses. Cambridge: Cambridge
University Press, 1-31.
Watson L, Dallwitz MJ. 1992. The grass genera of the world. Wallingford: CAB International.
Wehling P, Hackauf B, Wricke G. 1994a. Phosphorylation of pollen
proteins in relation to self-incompatibility in rye (Secale cereale
L.). Sexual Plant Reproduction 7: 67-75.
Wehling P, Hackauf B, Wricke G. 1994b. Identification of S-locus
linked PCR fragments in rye (Secale cereale L.) by denaturing
gradient gel electrophoresis. Plant Journal 5: 891-893.
Weimarck A. 1968. Self-incompatibility in the Gramineae. Hereditas
60: 157-166.
Wricke A, Wehling P. 1985. Linkage between an incompatibility locus
and a peroxidase isozyme locus (Prx-7) in rye. Theoretical and
Applied Genetics 71: 289-291.

Downloaded from http://aob.oxfordjournals.org/ by guest on September 21, 2016

Fearon CH, Hayward MD, Lawrence MJ. 1984b. Self-incompatibility

in rye grass. VIII. The mode of action in the pollen of autotetraploids of Lolium perenne L. Heredity 53: 415-422.
Fuong FT, Voylokov AV, Smirnov VG. 1993. Genetic studies of selffertility in rye (Secale cereale L.) 2. The search for isozyme marker
genes linked to self-incompatibility loci. Theoretical and Applied
Genetics 83: 619-623.
Gertz A, Wricke G. 1989. Linkage between the incompatibility locus Z
and a beta-glucosidase locus in rye. Plant Breeding 102: 255-259.
Hayman DL. 1992. The S Z incompatibility system. In: Chapman GP,
ed. Grass evolution and domestication. Cambridge: Cambridge
University Press, 117-137.
Hayman DL. 1956. The genetic control of incompatibility in Phalaris
coerulescens DESF. Australian Journal of Biological Sciences 9:
321-331.
Hayman DL, Richter J. 1992. Mutations affecting self-incompatibility
in Phalaris coerulescens. Heredity 68: 495-503.
Heslop-Harrison J. 1982. Pollen-stigma interaction and crosscompatibility in the grasses. Science 215: 1358-1364.
Kornicke F. 1890. Uber die autogenische und heterogenetische
Befruchtung bei den Pflanzen. Verhandlungen des naturhistorischen
Vereines des preussischen Rheinlandes Band 5 47: 84-99.
Leach CR, Hayman DL. 1987. The incompatibility loci as conserved
linkage groups in the Poaceae. Heredity 58: 303 305.
Lee HS, Huang S, Kao T-h. 1994. S protein controls rejection of
incompatible pollen in Petunia infiata. Nature 367: 560 563.
Lewis D. 1947. Competition and dominance of incompatibility alleles
in diploid pollen. Heredity 1: 85-108.
Lewis EJ, Humphreys MW, Caton MF. 1980. Chromosomal location of
two isozyme loci using primary trisomics. Theoretical and Applied
Genetics 57: 237-239.
Li X, Nield J, Hayman D, Langridge P. 1994. Cloning a putative selfincompatibility gene from the pollen of the grass Phalaris
coerulescens. Plant Cell 6: 1923 1924.
Li X, Nield J, Hayman D, Langridge P. 1995. Thioredoxin activity in
the C terminus of PhalarisS protein. Plant Journal 8: 133-138.
Li X, Paech N, Nield J, Hayman D, Langridge P. 1997. Selfincompatibility in the grasses: evolutionary relationship of the S
gene from Phalariscoerulescens to homologous sequences in other
grasses. Plant Molecular Biology 34: 223-232.
Lundqvist A. 1954. Studies on self-sterility in rye, Secale cereale L.
Hereditas 40: 278-294.
Lundqvist A. 1955. Genetics of incompatibility in Festuca pratensis
Huds. Hereditas 47: 542-562.
Lundqvist A. 1957. Self-incompatibility in rye. II. Genetic control in the
autotetraploid. Hereditas 43: 467-511.
Lundqvist A. 1958. Self-incompatibility in rye.'IV. Factors relating to
self-seeding. Hereditas 44: 193-256.
Lundqvist A. 1962. The nature of the two-loci incompatibility system
in grasses. I. Hypothesis of a duplicative origin. Hereditas 48:
153-168.

209