Anda di halaman 1dari 68

EJERCICIOS DE LAS P.A.U.

Bioelementos:
a) Define el trmino bioelemento. (0.5)
b) Describa el grupo de los bioelementos primarios (1.5)
Los elementos biognicos se combinan entre s para formar biomolculas
(principios inmediatos) que aparecen siempre en la materia viva.
a)
indique las clases de elementos biognicos y explique sus diferencias (1)
b)
explique los tipos de biomolculas (principios inmediatos), segn su naturaleza
qumica (1)
Entre el lquido intracelular y el lquido extracelular de una clula animal
se observan las siguientes concentraciones de los productos A, B, C.
Lquido
Lquido
Al cabo de
Lquido
Lquido
intracelular
extracelular
unos minutos intracelular
extracelular
A 10 mM
A 4 mM
Se observan
A 12 mM
A 2 mm
B 50 mM
B 30 mM
los siguientes B 40 mM
B 40 mM
C 5 mM
C 20 mM
cambios
C 5 mM
C 20 mM
Nombre qu procesos han utilizado los compuestos A y B para moverse de un
lado para otro de la membrana (0.5)
seale la diferencia fundamental entre un proceso y otro (1)
por qu no han cambiado las concentraciones de C? (0.5)

a)
b)
c)

En relacin con las sales minerales:


a)
explique las formas en que se pueden encontrar las sales minerales en los seres
vivos, ponga un ejemplo de cada una de ellas e indique su funcin (1)
b)
en relacin con la clula explique los siguientes trminos: medio externo
isotnico, medio externo hipertnico, medio externo hipotnico, e indique en qu
consiste la smosis (1)
Las sales minerales son esenciales para el mantenimiento de la vida:
respecto al citoplasma celular, definir medio hipertnico y medio hipotnico
(0.5)
b)
explique razonadamente que le ocurrira a una planta si se riega con agua salada
(0.5)
c)
poner un ejemplo, mencionando composicin y funcin, de sales minerales en
estado slido (sales insolubles) presentes en los seres vivos. (1)
a)

a)
b)
c)

En relacin con las sales minerales en los organismos vivos:


explique en qu situacin las clulas estn turgentes (0,5)
explique en qu situacin las clulas estn plasmolizadas (0,5)
ponga un ejemplo de una sal mineral disuelta y otra precipitada e indique la
funcin de cada una de ellas (1)

El agua es la molcula ms abundante en la materia viva.


a)
Explique dos propiedades del agua (1)
b)
Explique dos funciones del agua en los seres vivos (1)
Con relacin a la importancia de las biomolculas inorgnicas en los seres
vivos:
1

a)
b)

explique dos funciones de las sales minerales (1)


explique dos propiedades fsico-qumicas del agua (1)
Se sumergen dos clulas en soluciones de distinta concentracin salina (A y
B del dibujo):
a) deduzca la concentracin relativa de las soluciones A y B (0.5)
b) nombre las estructuras sealadas en el dibujo (0.5)
c) explique el proceso por el cual el agua entra en A y sale en B. (1)

Para observar el proceso de smosis, tres muestras de sangre humana son


sometidas a una prueba en el laboratorio:
a) si se aade agua destilada a una de las muestras, indique qu les sucede a los
glbulos rojos y por qu. (0.75)
b) si se aade una solucin saturada de sal a otra de las muestras, indique qu
aspecto presentarn los glbulos rojos al microscopio, cmo se denomina este
fenmeno y explique cmo se produce. (0.75)
c) si a la tercera muestra se le aade una disolucin isotnica explique si se
alterara la forma y funcin del glbulo rojo (0.5)
En relacin con las propiedades fsico-qumicas del agua:
a) Indique cul es la causa de la polaridad de las molculas de agua, y qu tipo de
interacciones establecen entre s dichas molculas a causa de la polaridad (0.5)
b) Cite dos funciones del agua relacionadas con su poder disolvente (0.5)
c) Si se observa en unas clulas que el pH tiene un valor por debajo de 7, qu tipo de
sustancias estarn acumulando en su interior?. De forma muy resumida, explique qu
consecuencias puede tener para las clulas esta situacin e indique qu tipo de
disoluciones utilizan las mismas para amortiguar cambios bruscos de pH (1)
Las biomolculas:
a)
Explique qu son las sales minerales (0.5)
b)
Explique la importancia de las sales minerales en la turgencia celular (0.5)
c)
Indique a qu grupo de biomolculas pertenecen los glcidos y cite los
bioelementos que los constituyen (0.5)
d)
Con relacin a la proporcin en que se encuentran en la materia viva, indique a
qu grupo de bioelementos pertenecen los integrantes de los glcidos. Razone la
respuesta. (0.5)
Si un tejido vegetal o animal se introduce en soluciones de diferentes
concentraciones osmticas:
a) Qu ocurrira si la solucin utilizada fuera hipotnica?. Razona la respuesta. (0.5)
b)Qu ocurrira si la solucin utilizada fuera hipertnica?. Razone la respuesta. (0.5)
c) Explique con qu propiedad de la membrana plasmtica estn relacionadas las
respuestas de los apartados anteriores. (0.5)
d) Cite dos ejemplos: uno relacionado con la respuesta del apartado a) y otro con la
respuesta del apartado b). (0.5)
En relacin con la composicin de los seres vivos, defina los siguientes
trminos:
a) Bioelemento o elemento biognico (0.5)
2

b) Biomolcula (0.5)
c) Oligoelemento (0.5)
d) Glcido (0.5)
Los polisacridos son macromolculas presentes en los seres vivos.
a) concepto de polisacrido (0.5)
b) cite dos polisacridos: uno caracterstico de vegetales y otro de animales,
indicando su composicin y su funcin (1)
c) indique la localizacin, dentro de la clula, de cada uno de los ejemplos citados
(0.5)
En relacin con los glcidos:
a) indique si los siguientes compuestos: sacarosa, almidn, glucgeno y lactosa son
disacridos o polisacridos (1)
b) en relacin con los compuestos indicados en el apartado anterior, indique en qu
tipo de clula, animal o vegetal, se encuentran los homopolisacridos y cul
es su funcin (1).
Con relacin a los glcidos:
a)
Explique la constitucin de los disacridos (0.5)
b)
Indique si los compuestos que se citan a continuacin son monosacridos,
disacridos o polisacridos: galactosa, celobiosa, glucgeno y sacarosa (1)
c)
Indique la composicin qumica de la sacarosa y explique si se trata o no de un
azcar reductor (0.5)
Los glcidos son biomolculas que desempean diversas funciones
esenciales para el organismo.
a) enumere dos tipos diferentes de glcidos y ponga un ejemplo de cada uno de
ellos (0.5)
c) enumere dos tipos de asociacin entre glcidos y otras biomolculas (0.5)
d) explique dos de las funciones que desempean los glcidos en el organismo y
ponga un ejemplo de glcido en cada una de ellas (1)
En relacin con los glcidos:
a)
cite una pentosa e indique su funcin biolgica (0,5)
b)
explique como se establece la unin entre los monosacridos para formar un
disacrido (0,5)
c)
cite un disacrido de inters biolgico caracterstico de la clula vegetal y otro
de la clula animal e indique los componentes de cada uno de ellos (1)
Entre las biomolculas que se citan a continuacin: gliceraldehido, celulosa,
ribulosa, fructosa, sacarosa, lactosa, almidn y terpenos.
a) Cite aquellas que presenten enlace O-glucosdico y explique la formacin del
mismo. (0.75)
b) Alguna de las biomolculas citadas no tiene carcter reductor?. Razone la
respuesta. (0.75)
c) Cite una analoga y una diferencia entre la celulosa y el almidn (0.5)
Algunas clulas vegetales presentan unas biomolculas muy caractersticas,
como la calulosa, la hemicelulosa y el almidn.
a) Indique las semejanzas y las diferencias ms importantes entre la celulosa y
el almidn. (1)
b) Cite una semejanza y una diferencia entre la celulosa y la hemicelulosa. (0.5)
c) Explique la importancia biolgica de la celulosa en la clula vegetal. (0.5)

Referente a las biomolculas orgnicas:


a) Indique a que grupo de molculas biolgicas pertenece el ejemplo que se representa
y cite la denominacin del enlace sealado con la letra A. (0.5)

b) a la vista del ejemplo anterior, indique si el enlace establecido y sealado con la


letra A, es monocarbonlico o dicarbonlico. Razone la respuesta. (0.75)
c) Cite tres molculas que pertenezcan al mismo grupo general que el ejemplo del
primer apartado. (0.75)
Referente a los polisacridos:
a) Escriba la composicin, enlace caracterstico, funcin y localizacin celular
de la celulosa. (1)
b) Escriba la composicin, enlaces caractersticos, funcin y localizacin
fundamental del glucgeno. (1)
En relacin con los polisacridos:
a) Defina homopolisacridos y heteropolisacridos, y cite un ejemplo de cada uno de
ellos. (0.5)
b) Indique un homopolisacrido estructural de origen vegetal, y otro de origen animal, y
explique brevemente cules son las principales analogas y diferencias que se observan
entre la estructura y la funcin de ambas macromolculas. (1)
c) Indique qu tipo de polisacrido es el glucgeno, cules son sus principales
caractersticas estructurales y cul es su localizacin en el organismo. (0.5)
Lpidos
a)
Explique dos funciones biolgicas de los lpidos (1)
b)
Dibuje un esquema que represente una grasa neutra (acilglicrido) indicando el
nombre de las molculas implicadas y el tipo de enlace (1)
Los triacilglicridos o grasas son utilizados en la alimentacin humana.
a) explique su composicin qumica (0.5)
b) explique la diferencia, desde el punto de vista qumico entre los aceites (grasas
lquidas a temperatura ambiente) y los sebos (grasas slidas a temperatura
ambiente) (0.5)
c) explique en qu consiste la saponificacin (0.5)
d) mencione dos grupos de lpidos insaponificables (0.5)
Los fosfoglicridos son lpidos complejos que poseen un comportamiento
anfiptico.
a)
explique su composicin qumica y haga referencia al tipo de enlaces entre sus
componentes (1)
b)
en qu estructura celular se localizan de forma mayoritaria los fosfoglicridos?.
Explique el comportamiento anfiptico y su importancia en la organizacin de
esa estructura. (1)
Los lpidos constituyen un grupo de biomolculas estructural y
funcionalmente muy heterogneo.
a)
describa la estructura general de dos tipos de lpidos (1)
b)
indique cuatro funciones que desempean los lpidos en el organismo (1)

a)
b)
c)

Relacionado con los lpidos:


explique que es un lpido saponificable (0,5)
explique la composicin qumica de los fosfoglicridos (fosfolpidos) (1)
cite la funcin biolgica ms importante de los fosfolpidos e indique su
disposicin en la clula (0,5)

Referente a los lpidos:


a)
si se ponen en proporciones adecuadas: grasas (triglicridos), agua y una base
(NaOH o KOH), explique la reaccin que tendra lugar, cite su nombre e indique
el producto que se obtendra. (0.75)
b)
explique cmo se formara un triglicrido. (0.5)
c)
cite tres tipos de lpidos e indique la funcin de cada uno de ellos. (0.75
Los lpidos son componentes esenciales de las membranas celulares:
indique dos lpidos que se encuentren en ellas (0.5)
indique cul es la polaridad de stas molculas y explique su repercusin en la
formacin de la membrana (1)
c)
los lpidos de membrana pueden asociarse a otras biomolculas, indique a cuales
y seale su localizacin en la membrana. (0.5)
a)
b)

Todos los seres vivos presentan lpidos en su composicin.


a) Qu es un lpido?. Segn su estructura molecular, cite los tipos de lpidos y
explique las diferencias entre ellos. (1)
b) Indique a qu tipo de lpido de los respondidos en el apartado anterior,
pertenecen los Fosfolpidos y describa su composicin qumica. (0.5)
c) Por qu los Fosfolpidos son molculas antipticas?. Razone la respuesta. (0.5)
Con relacin a los lpidos:
a) Nombre un tipo de lpido con funcin estructural. Indique su localizacin celular (0.5
b) Nombre un lpido con funcin hormonal. Escriba la glndula hormonal que lo
segrega. (0.5)
c) Nombre un ejemplo de lpido con funcin energtica o de reserva. Indique su
localizacin en un ser vivo. (0.5)
d)
Nombre un ejemplo de lpido con funcin vitamnica. Indique un proceso
biolgico en el que intervenga. (0.5)
Las grasas son molculas orgnicas presentes en todos los seres vivos con
una gran heterogeneidad de funciones.
a) Indique la composicin qumica de un triacilglicrido de origen vegetal y explique su
formacin (1).
b) La obtencin del jabn se basa en una reaccin en la que intervienen algunos lpidos;
explique esta reaccin e indique cmo se denomina. Justifique si el aceite de oliva
empleado en la cocina podra utilizarse para la obtencin de jabn (1).

Con referencia a los lpidos:

a) Describa brevemente cules son las


propiedades qumicas de los cidos grasos.
(0.5)
b) El esquema que se muestra representa
con frmulas generales como se desarrolla
una importante reaccin de las grasas.
Indique los nombres de los compuestos

reaccionantes (sealados como 1 y 2) y el producto final de la reaccin, sealado como


3. Cmo se denomina esta reaccin?. (1)
c) Grasas y ceras. Indique cuales son las funciones que realizan estos dos tipos de
lpidos, y seale un ejemplo de cada uno de ellos. (0.5)
Referente a las biomolculas:
a) Indique a qu tipo de biomolculas pertenece el colesterol, y explique por qu es
insaponificable (0.5)
b) Indique la localizacin del colesterol en la clula y explique brevemente su
funcin biolgica. (0.5)
c) Una de las vitaminas est relacionada qumicamente con la molcula de
colesterol. Indique cul es dicha vitamina y qu enfermedad se produce por su
carencia. (0.5)
d) Enumere otros dos tipos de molculas de esteroides derivadas del colesterol,
indicando su funcin biolgica. (0.5)
Acerca de las propiedades de los fosfolpidos:
a) Describa las caractersticas fundamentales de dichas molculas, y seale las
diferencias con las molculas que constituyen las grasas. (0.5)
b) Explique cmo se establece la interaccin de los fosfolpidos con el agua, y
mencione dos ejemplos de las posibles estructuras en que se organizan. (0.5)
c) Explique brevemente cul es la funcin de los fosfolpidos en la clula,
indicando con qu otros tipos de compuestos tienen que interaccionar para
ejercer dicha funcin. (1)

En relacin con los fosfoglicridos:


a) Nombre los tipos de molculas que intervienen en su formacin y seale su
localizacin celular (1)
b) Explique y localice el carcter anfiptico de la molcula de un fosfoglicrido.
(1)

En la composicin de los seres vivos:


a) qu grupo de biomolculas se caracteriza por presentar enlaces
monocarbonlicos?cmo se origina dicho enlace?. (0.75)
b) Explique la propiedad que permite a algunos lpidos la formacin de
biomembranas. Ponga un ejemplo de un lpido con esta propiedad. (0.75)
c) qu significa la desnaturalizacin proteica? (0.5)
Las protenas son macromolculas esenciales en los seres vivos:
a) Explique los distintos tipos de estructuras que existen en las protenas. (1)
b) Suponga que dispone de albmina de huevo en un tubo de ensayo. Disee cuatro
experiencias fsicas o qumicas sencillas que alteren la conformacin nativa de
esa protena y explique brevemente el porqu de la alteracin en cada caso. (1)
Las protenas son importantes componentes moleculares de los seres vivos.
a) cita las principales funciones biolgicas de las protenas (1)
b) explique el tipo de enlace por el que las unidades constituyentes de las protenas
se unen, poniendo un ejemplo (1)
En relacin con la estructura de las protenas:
a) defina en qu consiste la estructura primaria de una protena (0.5)
b) mencione dos tipos de estructuras secundarias y seale qu tipo de enlaces
mantienen estas estructuras (0.5)
c) explique en qu consiste la estructura cuaternaria de las protenas y mencione un
ejemplo (0.5)
6

d) indique cmo se denomina el proceso por el que una protena pierde su


estructura terciaria o globular y cite una causa que lo desencadene (0.5)
Con referencia a las protenas:
a) Defina estructura terciaria y cuaternaria de una protena (0,5)
b) Explique el significado del trmino desnaturalizacin aplicado a las protenas
(0,5)
c) Diga cuatro funciones de las protenas indicando un ejemplo en cada caso (1).

a)
b)
c)
d)
e)

En relacin con las protenas.


a) Qu es una protena?. Explique su formacin (0.75)
b) Qu es la estructura primaria de la protena? por qu es importante?.
Razonando la respuesta, explique su relacin con el ADN (0.75)

Protenas:
Qu representa la siguiente molcula? (0.5)
qu tipo de enlace une las distintas unidades (0.5)
ponga 2 ejemplos de macromolculas con este tipo de enlace (0.5)
cite alguna de las funciones biolgicas de estas macromolculas (0.5)
Cite dos funciones de las protenas y ponga un ejemplo en cada caso. (0.5)

En el esquema se representa la molcula de la


lisozima:
a)
de qu tipo de molcula se trata y qu tipo de
estructura presenta? (1)
b)
cmo se llaman las subunidades representadas por
crculos y qu tipo de enlace las une? (0.5)
c)
de qu depende el que las subunidades se unan o
no en otro orden? (0.5)
a)
b)
c)

Las enzimas participan de forma clave en todas las reacciones metablicas.


defina brevemente los conceptos de enzima y coenzima (1)
explique dos caractersticas de las enzimas (0.5)
defina el concepto de vitamina (0.5)
Se tiene una disolucin de una enzima que es activa en los seres humanos.
a) Defina el concepto de enzima e indique la composicin qumica fundamental
de las enzimas. (0.75)
b) Que pasara si se calentara la disolucin a 90C?. Razone la respuesta. (0.5)
c) Defina y ponga un ejemplo de cofactor y de coenzima. (0.75)

Con relacin a las enzimas y vitaminas:


a)
Explique los siguientes trminos: enzima, cofactor, coenzima y vitamina (1)
b)
Cite dos vitaminas mencionando en cada caso una anomala carencial, e indique
si son liposolubles o hidrosolubles (1)
En relacin con las biomolculas, explique:
a) la formacin del enlace O-glucosdico (0,5)
b) la formacin del enlace peptdico (0,5)
7

c) la formacin del enlace que da lugar al nuclesido (0,5)


d) la formacin del enlace que da lugar al nucletido (0,5)
Muchos seres estn constituidos, entre otras cosas, por las siguientes
biomolculas: glucgeno, fosfolpidos, enzimas y ATP.
a) relacione cada una de ellas con su principal funcin biolgica (1)
b) indique las unidades estructurales de cada una (1).
Entre las siguientes macromolculas: cidos nucleicos, glcidos, protenas y
lpidos.
a) diga cules son los respectivos monmeros de las tres primeras macromolculas y sus
correspondientes tipos de enlace. (0.5)
b) indique cules de ellas tienen estructura secundaria. Razone la respuesta. (0.5)
c) Diga cules de ellas son constitutivas de las membranas celulares. Razone la
respuesta.(1)
De los compuestos celulares que se citan a continuacin: ribulosa,
hemicelulosa, NADH, FAD+, glucosa,NAD+, CO2, NADP+.
a) Cite cuatro compuestos que estn relacionados directamente con el proceso
fotosinttico e indique, para cada uno de ellos, su funcin, la etapa del proceso en la
que participan y la localizacin de sta a nivel de orgnulo (1)
b) Cite dos nucletidos que estn relacionados directamente con la respiracin e
indique, para cada uno de ellos su funcin, la etapa del proceso en la que
participan y la localizacin de sta a nivel de orgnulo (0,5).
c) Explique las caractersticas qumicas de la hemicelulosa y cite su funcin (0,5).

El cido ribonucleico (ARN) es una macromolcula presente en los seres


vivos.
a) explique la composicin del ARN (0.5)
b) indique los tipos de ARN que conozca, explicando la funcin de cada uno de
ellos (1)
c) en qu estructuras de la clula se encuentra ARN de forma significativa? (0.5).
Independientemente de la longitud y secuencia especfica de un ADN de
doble cadena:
a)
qu bases nitrogenadas podramos encontrar? (0.5)
b)
qu relaciones cuantitativas existiran entre dichas bases? (1)
c)
se cumpliran estas relaciones para el caso de un ADN de cadena sencilla?.
Razone su respuesta (0.5).
La molcula de ADN es portadora de informacin:
indique el nombre de los autores que propusieron el modelo de la doble hlice y
cite tres caractersticas de dicho modelo. (1)
b)
dado el siguiente fragmento de ARNm : 5 AUGCUAGCGAAA 3, indique,
razonando la respuesta, la molcula de ADN de la que procede y cite dos
diferencias entre ambos cidos nucleicos. (1)
a)

a)
b)
c)

En relacin con el cido desoxirribonucleico (ADN):


Cul es la composicin qumica del ADN? (0.5)
Indique la importancia biolgica de la estructura primaria del ADN (0.5)
Explique el modelo de la doble hlice de ADN (Watson y Crick) (1)

cidos nucleicos:
a) explicar las diferencias qumicas y estructurales de los dos tipos de cidos
nucleicos (1).
8

b) Mencionar al menos una localizacin de cada tipo de cido nucleico (0.5)


Referente al material hereditario:
a) Copie y complete la tabla que aparece a continuacin y que corresponde a las
cadenas complementarias de un fragmento de ADN. Utilice las letras: P para el cido
fosfrico, S para la pentosa (2 desoxirribosa), A para la adenina, C para la citosina, G
para la guanina y T para la timina. Indique en cada caso, el nmero de puentes de
hidrgeno que se establecen entre las dos bases nitrogenadas (1).
Cadena 1
P
-

S
-

A
C
-

N puentes de hidrgeno
?
?
?
?

G
T

Cadena 2
S
S

P
-

b) Al analizar las proporciones de bases nitrogenadas de un fragmento monocatenario


de ADN humano los resultados fueron los siguientes.: 27% de A, 35% de G, 25% de C
y 13% de T. Indique cul ser la proporcin de bases de la cadena complementaria.
(0.5)
c) Respecto a su composicin qumica, cite las diferencias existentes entre una
molcula de ADN y una de ARN. (0.5)
Los cidos nucleicos son biomolculas complejas formadas por monmeros
conocidos como nucletidos:
a) Indique los tres componentes del un nucletido de ADN. En qu difiere de un
nucletido de ARN?. (0.5)
b) Cite las tres clases de enlaces qumicos que se encuentran en una molcula de ADN
de doble hlice. cul es la funcin de cada uno de ellos?. (1)
c) Adems del ncleo, qu orgnulos contienen ADN en una clula animal? y en una
clula vegetal?(0.5)

En la replicacin del ADN:


a) qu significa que la replicacin del ADN es semiconservativa? (0.5)
b) qu significa que la replicacin del ADN es bidireccional? (0.5)
c) explique las semejanzas y diferencias en la sntesis de las dos cadenas de ADN en
una horquilla de replicacin (1)
Si un fragmento de una cadena de ADN tiene la secuencia:
3TAGCGTGACCAAGTC 5
a) cul ser la secuencia de bases de su ARN mensajero? (0.5)
b) cuntos aminocidos podra tener como mximo la cadena polipeptdica
resultante? (0.5)
c) cite la caracterstica del cdigo gentico que ha utilizado para calcular el nmero
de aminocidos (1)
En relacin con la expresin de la informacin gentica:
a) cite y defina los dos procesos que tienen lugar en la expresin de la
informacin gentica (1)
b) dnde tienen lugar los procesos anteriores en clulas eucariotas y procariotas
a)
b)
c)

Con relacin al cdigo gentico:


qu es el cdigo gentico y para qu sirve? (0.5)
qu es un codon? (0.5)
Explique cuatro caractersticas del cdigo gentico (1)

cidos nucleicos:
a) Explique con detalle el proceso de sntesis de ARN en el ncleo de una clula (1)
b) Indique tres tipos de ARN sealando el papel que desempean en la sntesis de
protenas (0.5)
c) Escriba la secuencia de ARN que se transcribira utilizando como molde la secuencia
inferior del ADN (0.5)
TCGCGTCGTCGT
A G C G C A G C A G C A
Observe el esquema siguiente:
ADN ARN protenas
d) cmo se denomina cada una de las etapas numeradas en el mismo? (1).
e) Indique cuales de estas etapas se producen normalmente en la clula eucaritica,
indicando dnde se produce cada una de ellas (1).
El dogma central de la biologa molecular se puede representar
esquemticamente de la siguiente manera: ADN ARN protenas
a) indique el nombre de los procesos ADN ARN y ARN protena e indique en
qu parte de la clula eucaritica se producen (0.5)
b) indique las diferencias que existen entre la composicin y estructura del ADN y
del ARN (1)
c) mencione tres tipos distintos de ARN y cite el proceso que permite el paso de
ARN a ADN (0,5)
El siguiente esquema muestra la secuencia de procesos conocida como EL
DOGMA CENTRAL DE LA BIOLOGA MOLECULAR:

a) indique y describa brevemente cada uno de los procesos biolgicos que se indican
con las letras a, b, c, d en el esquema (1).
b) cada uno de los elementos que se citan a continuacin actan en los procesos que ha
indicado en la pregunta anterior. Haga una lista colocando cada elemento en el
proceso que le corresponde: ARN polimerasa dependiente de ADN, ribosomas, ADN
polimerasa, anticodn, transcriptasa inversa, promotor, aminocidos, ARN
transferente y cebadores (1).
Referente a la expresin del material hereditario:
a) Represente mediante un esquema rotulado El Dogma Central de la Biologa
Molecular actualizado (0,5).
b) Explique brevemente las tres etapas del proceso de la transcripcin en procariontes
(0,75).
c) El siguiente esquema representa un ARN transcrito primario procedente de un
fragmento de un gen, correspondiente a una clula eucariota.
5
Exn
Intrn
Exn
Intrn
3
Explique brevemente el proceso de maduracin de este ARN transcrito primario hasta
obtener su ARNm maduro (0,75).
La siguiente secuencia polinucleotdica corresponde a un fragmento del
inicio de
un gen de una cepa bacteriana:
3 TACAATTCCCGGGCAACACAC 5
a) escriba la secuencia de bases del ARN mensajero que se puede sintetizar e
indique su polaridad (0.5)
10

b) cul es el nmero mximo de aminocidos que puede codificar este fragmento?


(0.5)
c) qu caractersticas del cdigo gentico ha utilizado para determinar el nmero
de aminocidos? (0.5)
d) si se detectara una variante de la cepa que produjera un polipptido de cinco
aminocidos, cmo pudo producirse la variante? (0.5)
La transcripcin y la traduccin son procesos fundamentales en la clula
eucariota.
a) Defina y distinga entre ambos procesos e indique en qu parte de la clula se
produce cada uno de ellos (1)
b) Nombre los tipos de ARN que intervienen en la traduccin y explique la funcin
de cada uno de ellos (1)
La siguiente secuencia de ADN corresponde a un fragmento de un gen:
3 GGCAATATCCGA 5
a) Indique la secuencia de nucletidos de su ARNm y la polaridad de la secuencia
(0.5)
b) Mencione el nmero mximo de aminocidos que se sintetizarn en el proceso
de traduccin (0.5)
c) Introduzca una mutacin puntual (gnica) en la secuencia de ADN e indique una
posible consecuencia de la mutacin en la secuencia de aminocidos de la
protena (0.5)
d) Explique dos posibles efectos de la mutacin puntual para la clula (0.5)
El siguiente fragmento de una cadena de ADN representa el inicio de un
gen:
3 TACCCGAGATGT........... 5
a) determine la secuencia de bases de su ARN mensajero e indique su polaridad. (0.5)
b) determine la secuencia de bases de la cadena complementaria de ADN e indique su
polaridad (0.5)
c) en qu componentes se diferencian el ADN y el ARN? (1)
La expresin de los genes es un proceso universal de todos los seres vivos.
a) cul es la naturaleza molecular de los genes? (0.5)
b) Explique los dos procesos fundamentales que tienen lugar en la expresin de un gen
(1)
c) En los organismos eucariticos, dnde tienen lugar los dos procesos anteriores?
(0.5).
a)
b)
c)
d)

Con relacin al proceso de replicacin del ADN:


qu es la replicacin del ADN? (0.5)
cul es su significado biolgico? (0.5)
Si una cadena de un fragmento de ADN tiene la secuencia siguiente:
3 ATTGGCATAGC 5
cul es la secuencia y polaridad de la otra cadena de la doble hlice? (0.5).
indique las etapas que tienen lugar en el proceso de la replicacin del ADN (0.5)

En el proceso de replicacin del ADN en bacterias (Escherichia coli):


a) explique el significado de los siguientes trminos: replicacin semiconservativa y
replicacin bidireccional (0,5)
b) explique brevemente el mecanismo de la sntesis de ADN en la cadena retardada
(1,5)

11


a)
b)

Con relacin a la etapa de iniciacin de la sntesis de una cadena


polipeptdica (primera etapa de la traduccin):
qu elementos constituyen el complejo de iniciacin? (1)
qu elementos constituyen un ribosoma completo y funcional? (1).

Con relacin al proceso de replicacin del ADN:


a) nombre las protenas y enzimas que intervienen en la etapa de desenrollamiento
y apertura de la doble hlice y explique sus funciones (1,5).
b) Explique dos diferencias en el proceso de replicacin del ADN en organismos
procariticos y eucariticos (0,5)
Un determinado segmento de ADN tiene la siguiente secuencia de
nucletidos en una de las cadenas:
.......3 TTCCAGCAT 5..........
a) cul debe ser la secuencia de nucletidos de la otra cadena?. Marque los
extremos 3y 5(0,5).
b) Si la enzima ARN polimerasa lee este segmento de ADN, cul debe ser la
secuencia de nucletidos de la cadena de ARN mensajero?. Marque los extremos
3 y 5 (0,5)
c) Defina los siguientes trminos de mutaciones puntuales (gnicas): mutacin
silenciosa y mutacin de cambio de sentido. Indique las consecuencias que
tendran estas mutaciones en la secuencia de aminocidos codificada (1).
Considere el siguiente segmento de ADN perteneciente a un organismo
procaritico:
.........5ATTCGCGATGGG 3......
.........3TAAGCGCTACCC 5......
Si la cadena inferior es la cadena molde utilizada por la enzima ARN polimerasa:
a)
escriba la secuencia de nucletidos del ARN transcrito y marque sus extremos 5
y 3 (0,5).
b)
qu papel desempeara este ARN transcrito en el proceso de traduccin? (0,5).
c)
en qu compartimento celular se localizara el proceso de transcripcin?, y el
proceso de traduccin? (0,5)
d)
defina los trminos de transcripcin y traduccin (0,5).
En relacin con la replicacin:
a)
explique de forma razonada cual es el significado y finalidad de la replicacin
semiconservativa y semidiscontinua del ADN (1)
b)
indique qu es un cebador y qu enzima es la encargada de su sntesis (0,5)
c)
considere el siguiente fragmento de una cadena de ADN cuya secuencia de
nucletidos es: 3 TTTACTGAA 5. Escriba la cadena complementaria tras la
replicacin del mismo, indicando su polaridad. Si el punto de inicio de la
replicacin hubiese sido el nucletido A, subrayado en la secuencia, conteste
razonadamente si desde ese punto hacia la izquierda la sntesis de la nueva cadena
hubiese sido continua o discontinua (0,5).
Referente a la transcripcin:
a) Cite y defina los procesos necesarios para la expresin de la informacin gentica
(0.75)
b) indique la secuencia y la polaridad del ARNm que se transcribira utilizando como
molde la secuencia inferior del siguiente ADN: (0.5)
5 ATCGAAGTT 3
3 TAGCTTCAA 5
c)
si la molcula de ARN obtenido en la cuestin anterior, comienza a leerse por el
primer nucletido del extremo 5, se obtienen tres tripletes o codones distintos. Escriba
12

para cada codn su anticodn correspondiente en el ARNt (0.75)


Referente a la expresin de la informacin hereditaria:
a) Defina el proceso de transcripcin e indique las etapas del mismo. (0.5)
b) Cite el nombre de la enzima implicada en este proceso. Cmo se denominan las
secuencias del ADN donde se une esta enzima para el comienzo de la transcripcin?.
(0.5)
c) Asocie a los procesos de transcripcin y traduccin los siguientes trminos:
ARNm / ARNt / ARN polimerasa/ ribosoma/ codn/ aminocido/ sitio P/ anticodn/
procesamiento o maduracin// sitio A/ intrn. (1)
En relacin con el material hereditario:
a) indique semejanzas y diferencias en cuanto a la composicin qumica del ADN y
ARN (1).
b) Defina el concepto de gen a nivel molecular e indique en qu se diferencian los
genes de procariotas y eucariotas (0.5)
c) Defina los trminos exn e intrn. (0.5)
Con relacin a la biosntesis de protenas en clulas eucariotas:
a)
mencione el nombre del proceso e indique su localizacin celular (0.5)
b)
indique el nombre de la molcula que lleva el codon y el nombre de la molcula
que lleva el anticodon (0.5)
c)
indique la funcin del ARN transferente en este proceso y explique la relacin
entre su estructura y su funcin.
Con relacin a la traduccin del mensaje gentico:
a) Indique los distintos tipos de ARN. (0.5)
b) Describa la funcin que desempea en la clula cada tipo de ARN. (1.5)
Con relacin a la expresin del material hereditario:
a) Para la siguiente secuencia de ARNm 5 AAACGGUUUUCA 3, determine la
secuencia de la cadena de ADN a partir de la cul se transcribi. Escriba su cadena
complementaria e indique la polaridad de ambas. (0.75)
b) Si la molcula de ARNm de la cuestin anterior comienza a leerse por el primer
nucletido del extremo 5, se obtienen cuatro codones o tripletes distintos. Escribe para
cada codn su anticodn correspondiente en el ARNt . (0.5)
c) Indique tres diferencias del proceso de transcripcin en procariotas y eucariotas.
(0.75)
Referente a la expresin en eucariotas:

a) El esquema adjunto representa los procesos de transcripcin, procesamiento o


maduracin y traduccin. Identifique los distintos elementos de la figura representados
por letras (1,25)
b) Explique qu es un exn e indique la funcin de los ARNt y de las enzimas
Aminoacil-ARNt sintetasas. (0,75)

Con referencia a distintos procesos biolgicos:

13

a) Para replicarse en clulas eucariticas, un virus de ARN monocatenario (similar al


del VIH) debe integrarse en el genoma de la clula husped, que es ADN
bicatenario. Explique las distintas etapas del proceso de replicacin (1,5).
b) Si en otro Planeta hubiera un ADN constituido por 6 nucletidos distintos, existieran
216 aminocidos esenciales y el cdigo gentico estuviera constituido por tripletes,
sera posible que existiera un mecanismo de traduccin igual al de la Tierra?
Razone la respuesta (0,5).
El ADN es una molcula que se encuentra sometida continuamente a las
agresiones producidas por sustancias de su entorno celular.
a) Qu son las mutaciones y qu tipo de agentes mutagnicos las producen? (0.5)
b) Enumere y explique los tipos de mutaciones que conoce (1)
c) Establezca la relacin entre mutaciones y evolucin (0.5)
El esquema adjunto corresponde a un importante proceso biolgico
relacionado
con el ADN:
a) qu proceso representa?en qu fase de ciclo celular se produce? (0.5)

b) qu finalidad tiene este proceso? (0.5)


c) A y B son las cadenas de nueva sntesis, indique la denominacin de cada una de
ellas. Qu representan C y D? (0.5)
d) por qu tiene que producirse la estructura marcada como D? (0.5)
El siguiente diagrama representa una molcula de ADN sujeta a
replicacin:
a) Copie el esquema y dibuje las cadenas de ADN nuevas indicando los siguientes
elementos: 1. cadenas lderes (conductoras) y retrasadas (retardadas). 2. Polaridad de las
mismas. 3. Fragmentos de Okazaki. 4. Cebadores de ARN (1).
b) Explique qu significa que la replicacin del ADN es bidireccional y
semiconservativa. (0.5)
c) Cite dos funciones de la ADN polimerasa I. (0.5)

El siguiente esquema representa un proceso importante:

14

a) Indique qu proceso representa e identifique todas las estructuras y las molculas


que aparecen marcadas con las letras A, B, C, D, E, F y G (1)
b) Explique brevemente el proceso representado (1)
Referente a la replicacin:
El siguiente esquema corresponde a la replicacin de una molcula de ADN, en el que
las flechas indican la direccin de replicacin de las nuevas cadenas.

a)
indique lo que significan las letras A, B, C y E (1).
b)
Explique por qu es necesaria la sntesis de los fragmentos, sealados en el
esquema con la letra C, e indique los pasos necesarios para que se unan dichos
fragmentos haciendo referencia al nombre y actividad de las enzimas implicadas en este
proceso (1)
El siguiente esquema representa un proceso fundamental de la expresin
gnica en procariotas:

a) Cite y defina el proceso representado en el esquema. (0.5)


b) A qu molculas se refieren las letras A y D?. Indique sus polaridades
(extremos de cada una de ellas). (0.5)
c) Respecto a su composicin qumica, qu diferencias existen entre ambas
molculas?. (0.5)
d) Cmo se denominan las cadenas representadas con las letras B y C?, y la
enzima representada con la letra F?. (0.5)
En relacin al material hereditario y su expresin:
a) Explique qu es la cromatina e indique su localizacin. Cite sus tipos y diga
en qu se diferencian. (0.5)
b) Qu es el nucleosoma?Cul es su estructura?. (0.5)
c) Copie la tabla en su hoja de examen y compltela.

Tenga en cuenta los siguientes datos: anticodon para Tyr es AUA, el codn para
Cys es UGU y elcodn para Pro es CCU. (1)
Referente a la replicacin, transcripcin y traduccin del ADN:
a) Durante la replicacin del ADN en procariotas, puede ocurrir que la enzima ADN
polimerasa III introduzca nucletidos errneos en la nueva cadena sintetizada. Explique
como pueden corregirse esos errores. (0.5)
b) Defina el proceso de transcripcin e indique el nombre de la enzima implicada en
este proceso. (0.5)
15

c) Explique la etapa de iniciacin de la traduccin en procariotas. (1)


Las mutaciones son alteraciones en el material gentico.
a)
Defina qu es una mutacin puntual (0.5)
b)
Enumere los tipos de mutaciones puntuales que conozca y las consecuencias que
c)
puede tener cada una de ellas en la secuencia de aminocidos de una protena.
Mutaciones:
a) Explique en qu consisten las mutaciones moleculares poniendo un ejemplo
concreto. (1)
b) Explique las diferentes consecuencias de que la mutacin suceda en un gameto o
en una clula somtica. (0.5)
c) Discuta brevemente estos dos agentes mutagnicos: tabaco y exposicin
prolongada al sol y sus efectos e implicaciones sociales. (0.5)
Con relacin a las mutaciones:
defina qu es una mutacin puntual (gnica) e indique el proceso celular
responsable de la aparicin de este tipo de mutaciones (0.5)
b)
En la siguiente secuencia de nucletidos de una cadena de ADN:
3 ATGCCA 5
introduzca una mutacin puntual y seale el tipo de mutacin producido (0.5)
c)
defina qu es un mutacin cromosmica y ponga un ejemplo (0.5)
d)
establezca la relacin entre mutacin y evolucin (0.5)
a)

En relacin con las mutaciones:


a)
explique el concepto de mutacin gnica e indique las consecuencias de estas
mutaciones segn que afecten a clulas somticas o a clulas germinales (0,75)
b)
considere el siguiente fragmento de un gen de un organismo procariota:
5 TCGGA 3
3 AGCCT 5
y que al replicarse la cadena indicada con una flecha, se introduce un error por la ADN
polimerasa III de forma que la nueva cadena sintetizada presenta la siguiente secuencia:
5 TCAGA 3
Explique qu error se ha producido y mencione un enzima que participe en la
correccin (0,5)
c)
defina los siguientes trminos: trisoma, triploida y monosoma.
Referente a la mutacin:
a) Explique qu se entiende por mutacin y realice una clasificacin de las mismas(0.5)
b) Cite un tipo de mutacin cromosmica y explique grficamente en qu consiste (0.5)
c) la siguiente secuencia de ADN corresponde a un fragmento de un gen:
5 CATGTTGGA 3
3 GTACAACCT 5
Si se produce el cambio de un par de bases en este fragmento, indique las posibles
consecuencias de esta mutacin en la secuencia de aminocidos de la protena. (0.5)
d) Explique qu relacin hay entre las mutaciones y la evolucin de las especies. (0.5)
Referente a la mutacin:
a) Defina mutaciones gnicas, cromosmicas y genmicas (0.75)
b) Indique que diferencias existen entre un individuo trismico y uno triploide (0.5)
c) Dado el siguiente fragmento de ADN de doble cadena:
5 TCGGACC 3
3 AGCCTGG 5
Tras su replicacin se ha originado un fragmento con la siguiente secuencia:
5 GCAGACC 3
16

3 CGTCTGG 5
Indique qu cambios se han producido y cite, en cada caso, si se trata de una transicin
o una transversin. (0.75)
Con relacin a las mutaciones cromosmicas:
a)
indique dos mutaciones que afecten al nmero de cromosomas en una especie
con genoma diploide (2n). (0,5 puntos)
b)
nombre los tipos de mutaciones que afectan a la morfologa de los cromosomas
y realice un esquema de dos de estas mutaciones. (1,5)
Referente a replicacin, expresin y mutacin:
a) explique cmo se mantiene y se transmite la informacin gentica en los seres vivos.
Describa brevemente cada uno de los procesos implicados. (1)
b) si durante la replicacin del ADN se inserta un nucletido incorrecto en la cadena de
nueva sntesis, indique el nombre de la enzima encargada de subsanar este error y
explique cmo lo hara. (0.5)
c) Indique en qu direccin son sintetizados siempre las nuevas cadenas de ADN y cite
cmo se denomina a la hebra de ADN que se transcribe en ARNm (0.5)
En relacin con la informacin gentica y sus alteraciones:
a) si un polipptido tiene 450 aminocidos, indique cuntos ribonucletidos tendr
el fragmento del ARNm que codifica esos aminocidos. Razone la respuesta.
(0.5)
b) 5 GUU-UUC-GCA-UGG 3, son cuatro codones de una molcula de ARNm.
Indique cules sern los anticodones de las molculas de ARNt . Qu significa
qu el cdigo gentico es degenerado? (0.5)
c) Suponga que en un fragmento de ADN que codifica un polipptido se produce
una mutacin puntual que afecta a un par de bases. Debido a ello, cuando la
clula sintetice de nuevo el polipptido, a ste le podra haber ocurrido uno de
los cuatro hechos siguientes:
1 Que se codifique el mismo aminocido que el sintetizado antes de la
mutacin.
2 La sustitucin de un aminocido por otro distinto.
3 Que el nuevo polipptido sintetizado sea ms corto
4 Que el nuevo polipptido sintetizado sea ms largo
Basndose en sus conocimientos del cdigo gentico, explique el por qu de cada uno
de los resultados. (1)
Referente a las alteraciones de la informacin gentica, defina y en su caso
ponga un ejemplo de:
a) Agente mutagnico (0.5)
b) Mutacin gnica o puntual (0.5)
c) Mutacin cromosmica (0.5)
d) Mutacin genmica (0.5)
En relacin con las alteraciones de la informacin gentica.
a) Defina mutacin cromosmica o estructural (0.5)
b) Defina brevemente las deficiencias o deleciones y explique sus consecuencias
para el individuo (0.5)
c) Defina brevemente las duplicaciones y explique por qu han sido importantes en
la evolucin (0.5)
d) Defina y explique brevemente las inversiones y sus tipos (0.5)
En relacin con la informacin gentica:
a) Defina euploidia e indique y explique sus tipos (0.75)
17

b) Defina aneuploidia e indique y explique sus tipos (0.75)


c) Ponga dos ejemplos de aneuploidias humanas indicando el sndrome que
producen (0.5)
Con relacin a las alteraciones de la informacin gentica:
a) Defina mutacin gnica o puntual e indique sus tipos (0.5)
b) Defina mutacin cromosmica o estructural e indique sus tipos. (0.5)
c) Al realizar el cariotipo de una persona en una consulta gentica se observ que uno
de los cromosomas de la pareja 9 haba intercambiado un brazo con otro de la pareja
21. Cmo se denomina este tipo de reestructuracin cromosmica?ser
transmisible a la descendencia?. Razone la respuesta. (0.5)
d) Hubiera sido mejor que el ADN fuera totalmente inmutable?. Razone la respuesta.
(0.5)
Con relacin a las mutaciones y el cncer:
a) Qu son las mutaciones? En qu se diferencian las mutaciones que afectan a las
clulas somticas de las que afectan a las clulas germinales?. (0.5)
b) Qu es el cncer?. Indique los tres tipos de genes relacionados con el cncer. (1)
c)Qu es un agente mutagnico?. Cite un ejemplo de agente fsico y otro de agente
qumico. (0.5)
Referente al cdigo gentico y mutacin:
A partir de la siguiente secuencia de bases correspondientes a un fragmento de gen:
5 . TAT ATA CAA TTT .3
3 ..ATA TAT GTT AAA5
a) indique cul ser la secuencia de ARNm correspondiente a la cadena inferior de este
fragmento, indicando su polaridad. (0.5)
b) Ayudndose de la tabla del cdigo gentico escriba la secuencia de aminocidos del
polipptido codificado por ese fragmento de gen indicando los extremos amino y
carboxilo. (0.5)
c) Si en el ADN se produjese una sustitucin del par C-G por el par T-A, indique cmo
se altera el ARNm y la cadena polipeptdica. (0.5)
d)
Explique qu significa que el cdigo gentico es degenerado. (0.5)
En relacin con el cdigo gentico:
a) cite cuatro caractersticas del cdigo gentico para todos los tipos celulares y
explique qu quiere decir que el cdigo gentico es degenerado (1)
b) Para la sntesis del pptido Tyr-Leu-Met-Phe se han utilizado los siguientes ARNt :
3 UAC 5; 3 AAU 5; 3 AAA5; 3 AUA 5
Escriba la secuencia de nucletidos de ARNm cuya traduccin da lugar al pptido
indicado y la secuencia de la cadena molde del ADN del gen correspondiente (1).

Dado el siguiente fragmento de ADN que ser transcrito y traducido:


18

5 AAATGCTACAAT 3
3 TTTACGATGTTA 5
a) Escriba la secuencia de nucletidos y
polaridad del ARNm que se sintetizara
utilizando como molde la cadena inferior del
ADN. (0.5)
b) Proporcione los anticodones de los ARNt
con sus polaridades. (0.5)
c) Escriba la secuencia de aminocidos del
tetrapptido que se sintetizara. (0.5)
d) Explique qu ocurrira si en el triplete que
codifica para Tyr se cambia la C por A o G.
Cules seran sus consecuencias?. (0.5)
En relacin con la Ingeniera Gentica:
a) Qu es una molcula de ADN recombinante? qu es un plsmido bacteriano?.
Explique con qu finalidad se introduce una molcula de ADN recombinante fabricada
in vitro dentro de un organismo husped (por ejemplo E. coli) (0.75)
b) Indique los pasos necesarios para construir in vitro una molcula de ADN
recombinante (0.5)
c) Explique qu es un organismo transgnico y cite dos aplicaciones de la ingeniera
gentica (0.75).
En relacin con la Biotecnologa:
a) Defina Ingeniera gentica. (0.5)
b) Defina organismo transgnico (0.5)
c) explique brevemente el proceso de introduccin de un fragmento de ADN en un
vector durante la formacin de molculas recombinantes. (1)
Con referencia a la moderna biotecnologa:
a) Defina los siguientes conceptos: Ingeniera gentica, clula hospedadora,
clonacin y vector de clonacin. (1).
b) Mencione cuatro aplicaciones prcticas de la ingeniera gentica y ponga un
ejemplo de cada una de ellas. (1)
a)
b)
c)
d)

A menudo aparecen en la prensa noticias referentes a ingeniera gentica:


Explique en qu consiste la ingeniera gentica (0.5).
Explique qu es un plsmido (0.5).
Explique cmo actan las enzimas de restriccin (0.5).
Ponga un ejemplo de una aplicacin prctica de la ingeniera gentica (0.5)

En relacin con la Ingeniera Gentica, mutagnesis y cncer:


a)
En qu consiste la terapia gnica? (0.5)
b)
Explique el concepto y el origen del cncer. (0.75)
c)
Defina protooncogenes y oncogenes. Indique cmo pueden originarse los
oncogenes. (0.75).
Referente a la Ingeniera Gentica:
a) Explique qu es un ADN recombinante y cul es la funcin de las enzimas de
restriccin (0,5).
b) Indique las etapas necesarias para producir clonacin gnica (1).
c) Qu es una planta transgnica? Cite una de sus aplicaciones (0,5).
En relacin con las aportaciones de Mendel al estudio de la herencia:
a) Defina qu es un retrocruzamiento. Describa, utilizando smbolos genticos, un
19

ejemplo del mismo (1)


b) Indique los genotipos y las proporciones fenotpicas de la descendencia obtenida
de la autofecundacin de un heterocigoto para dos caracteres (1).
Existen caracteres que no se comportan tpicamente como los Mendelianos
y sus patrones de herencia muestran caractersticas diferenciales debido a
que los genes que los rigen se encuentran en los cromosomas sexuales. En
relacin con este tipo de caracteres:
a) Defina herencia ligada al sexo (0,5 puntos).
b) Defina autosoma y cromosoma sexual o heterocromosoma (0,5).
c) Defina el concepto de sexo homogamtico. Ponga un ejemplo (0,5).
d) Defina el concepto de sexo heterogamtico. Ponga un ejemplo (0,5).

Con relacin a los conceptos bsicos de la gentica, defina:


a) Gen (0.5)
b) Alelo dominante (0.5)
c) Alelo recesivo (0.5)
d) alelo codominante (0.5)
Con relacin a la herencia mendeliana:
a) Qu es un gen?Como se denomina el conjunto de genes de un individuo?.
(0.5)
b) Cundo se dice que dos genes son independientes?Y cundo qu estn
ligados?. (0.5)
c) Si tuviera una mosca del vinagre (Drosophila melanogaster) de fenotipo A,
cmo comprobara si es AA o Aa?. Razone la respuesta (0.5)
d) Cul sera la segregacin genotpica que se obtendra del cruzamiento entre
un individuo diheterocigoto (dihbrido) por otro diheterocigoto para los mismos
caracteres?. Refleje en su examen cmo ha obtenido esta segregacin. (0.5)

a)
b)
c)

Relativo a la gentica mendeliana:


Defina monohbrido. (0.5)
Defina cruzamiento prueba. (0.5)
Usando trminos genticos, indique las proporciones genotpicas y fenotpicas
de los descendientes de un cruce entre dihbridos. (1)

Se cruzan dos cobayas homocigticos uno de ellos tiene pelaje liso de color
negro y el otro tiene pelaje rizado y color blanco. El rizado domina sobre el
liso, mientras el blanco es recesivo.
a) Utilizando smbolos genticos para los caracteres definidos, indique los
genotipos de ambos parentales (0.5)
b) Indique el fenotipo y genotipo que tienen los individuos de la F1 (0.5)
c) Calcule las proporciones genotpicas y fenotpicas de la F2 (1)
En relacin con la determinacin gentica del sexo:
a) Explique brevemente en qu consiste la determinacin cromosmica del sexo. (0.5)
b) Explique el sistema de determinacin cromosmica del sexo en mamferos. (0.5)
c) Indique dos sistemas de determinacin cromosmica del sexo diferente al de
mamferos. Poner un ejemplo. (1)
En la mosca de la fruta (Drosophila melanogaster), existen individuos de
cuerpo negro y otros que presentan cuerpo gris:
a) Se cruzan dos moscas grises y se obtiene una descendencia compuesta por 30
moscas grises y 10 moscas negras. Indique los genotipos de los parentales
razonando la respuesta. (1)
20

b) Entre las moscas grises de la descendencia del cruce anterior, Cmo averiguara
qu individuos son homocigticos?. Razone la respuesta. (1).
En el guisante, el tallo largo (planta alta) es dominante sobre el tallo corto
(planta enana). Si una planta de guisante homocigtica para el carcter
dominante se cruza con una planta enana:
a) Indicar los genotipos y fenotipos de los progenitores y de la F1 . (0.5)
b) Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta
de la F1 con el progenitor alto (0.5)
c) Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta
de la F1 con el progenitor enano. (0.5)
d) Indicar los genotipos, fenotipos y proporciones de la descendencia del
cruzamiento de dos plantas heterocigticas. (0.5)
En relacin con las aportaciones de Mendel al estudio de la herencia:
a) Una pareja de personas de fenotipo no albino tienen un hijo albino. Explique el
modo de herencia del albinismo e indique los genotipos de los padres y del hijo. (1)
b) Qu proporcin de hijos no albinos se puede esperar en la descendencia?. Razone
la respuesta. (0.5)
c)qu proporcin de hijos albinos se puede esperar en la descendencia?. Razone la
respuesta. (0.5)
Con relacin a las aportaciones de Mendel al estudio de la herencia:
El insomnio familiar fatal (IFF) es una enfermedad humana debida a una
mutacin en un gen R situado en el cromosoma 20. La enfermedad muestra una
herencia dominante. Una pareja, ambos con la enfermedad, tiene una hija que no
la padece.
a) Indique los genotipos de todos los miembros de esta familia (0.5)
b) Puede transmitir la enfermedad la hija sana?. Razone la respuesta (0.5)
c) Puede tener esta pareja otro hijo sano?. Razone la respuesta (0.5)
d) Puede tener esta pareja un hijo con la enfermedad?. Razone la respuesta (0.5)
En los conejos, el pelo corto (A) es dominante sobre el pelo largo (a). Se
llevan a cabo los siguientes cruzamientos que producen la progenie
mostrada:
Parentales
Progenie
puntuacin
e) Corto x largo
cortos y largos
(0.5)
f) Corto x corto
Todos cortos
(0.5)
g) Corto x largo
Todos cortos
(0.5)
h) Largo x largo
Todos largos
(0.5
Nombre todos los genotipos posibles de los parentales de cada cruzamiento. Razone las
respuestas.

Con relacin a las aportaciones de Mendel al estudio de la herencia:


Suponga que en la especie humana la herencia del color del pelo y de los ojos es
sencilla y est determinada por dos genes autosmicos con las siguientes
relaciones: color marrn de los ojos (A) dominante sobre el azul (a) y cabello
oscuro (B) dominante sobre el cabello rubio (b).
a) Un hombre de ojos marrones y cabello oscuro se casa con una mujer de ojos azules
y cabello oscuro y tienen dos hijos, uno de ojos marrones y pelo rubio y otro de ojos
azules y cabello oscuro. Indique razonadamente los genotipos de los padres y de los
hijos (1)
b) Si el hombre del apartado anterior de ojos marrones y cabello oscuro se casara con
una mujer de ojos azules y pelo rubio, Qu genotipos y fenotipos podran tener los
hijos de la pareja? (1).
21


En Drosophila melanogaster, un alelo mutante recesivo, black (negro), da
lugar en homocigosis, a un cuerpo muyoscuro. El color normal de tipo silvestre es
gris. Otro alelo mutante sepia tambien recesivo, da lugar a un color marrn de los
ojos. El color normal es rojo. Al cruzar un macho homocigoto de ojos rojos y
cuerpo negro con una hembra de ojos sepia y cuerpo gris, se obtuvo una F1 en la
que todas las moscas eran de ojos rojos y cuerpo gris. Posteriormente se cruzaron
entre s los machos y las hembras de la F1 para la obtencin de la F2 .
a) cules son los genotipos de los parentales y de los descendientes F1 ? (0.75)
b) Indique las proporciones genotpicas y fenotpicas de los descendientes F2 . (1.25)
Con relacin a las aportaciones de Mendel al estudio de la herencia:
La miopia se considera un defecto refractario ocular hereditario que impide
enfocar correctamente los objetos lejanos. La herencia de algunos tipos de
miopia se debe a un nico gen autosmico con dos alelos A y a. Un hombre y
una mujer miopes tienen un hijo miope y otro con visin normal.
A partir de estos datos determine:
a) Si la miopia que sufre esta familia es un carcter dominante o recesivo. Razone la
respuesta. (0.5)
b) Los genotipos de los padres y de los hijos. (0.5)
c) Se dispone de un ratn con fenotipo A. Disee un cruzamiento para saber si su
genotipo es AA o Aa. Indicar cmo se denomina este tipo de cruzamientos. (1)

El pedigr de la figura muestra la herencia de la alcaptonuria, un trastorno


bioqumico. Los individuos afectados, indicados por los crculos y cuadrados
negros, son incapaces de degradar el cido homogentsico, que da color negro a la
orina y tie los tejidos corporales. ( Los hombres se representan con un cuadrado
y las mujeres con un crculo).

a) Indique si el alelo responsable de esta enfermedad es dominante o recesivo. Razone


la respuesta (0.5)
b) Copie el rbol genealgico en su hoja de examen e indique los posibles genotipos de
todos los individuos (1.5). Utilice las letras (A) y (a) para los genotipos.

En la figura se indica la transmisin de un carcter autosmico en una


familia.
a) Indique si el carcter mostrado en
la genealoga por los smbolos
negros, est determinado por un
alelo dominante o por un alelo
recesivo. (Los hombres se
representan por un cuadrado y las
mujeres por un crculo). Razone la
respuesta (0,5).
b) Copie el rbol genealgico en su
hoja de examen e indique los
22

genotipos de los individuos de la genealoga (1,5).


Utilice la letra (A) para el alelo dominante y la letra (a) para el alelo recesivo.
Con relacin al mendelismo:
En los gatos las orejas rizadas son el resultado del alelo A que es dominante sobre el
alelo a para las orejas normales. El color negro es el resultado de un alelo B que
segrega de forma independiente, y que es dominante sobre el alelo para el color gris b.
Un gato homocigtico gris y de orejas rizadas se aparea con una gata homocigtica
negra con orejas normales. Todos los descendientes de la F1 son negros y con orejas
rizadas.
a) Si los gatos de la F1 se aparean qu proporciones genotpicas y fenotpicas se
esperan para la F2?. (1)
b) Una gata de la F1 se aparea con un gato callejero que es gris y posee orejas
normales. Qu proporciones genotpicas y fenotpicas se esperan para la
descendencia de este cruzamiento?. (1)
En relacin con las aportaciones de Mendel al estudio de la herencia:
a) Explique brevemente el tipo de herencia de una enfermedad hereditaria que padece
un varn cuyos padres no manifiestan la enfermedad. Indique los genotipos de los
padres y el hijo. (1)
b) Pueden tener un descendiente sano una pareja en que ambos miembros padecen una
enfermedad hereditaria dominante?. Razonar la respuesta indicando los fenotipos y
los genotipos de los progenitores y de la descendencia. (1)
Con relacin a la Gentica Mendeliana:
En los conejillos de Indias, el pelo negro B es dominante sobre el albino b, y el pelo
encrespado A es dominante sobre el pelo liso a. Cuando se realiza un cruce entre una
animal homocigtico negro y pelo encrespado y un albino con pelo liso.
a) Cmo es el genotipo de los parentales?Cul ser el genotipo de la F1?. (0.5)
b) Indique las proporciones genotpicas y fenotpicas de la F2. (1)
c) Qu proporciones genotpicas y fenotpicas se obtendran al cruzar un
descendiente de la F1 con el parental albino de pelo liso?. (0.5)
En relacin con las aportaciones de Mendel al estudio de la herencia:
a) Calcule las proporciones genotpicas de la descendencia del cruzamiento de un
individuo heterocigoto para dos caracteres independientes con un individuo homocigoto
recesivo para dichos caracteres. (0.5)
b) Determine los gametos (y proporciones) que puede producir un individuo AaBb y
otro Aabb. (0.5)
c) Si el color de la piel est determinado por la pareja allica B (piel oscura), b (piel
clara), y el color del cabello por A (castao), a (rubio), indique los posibles genotipos y
proporciones fenotpicas de los hijos de una pareja de piel oscura y el pelo castao que
han tenido un primer hijo con piel clara y pelo rubio. (1)
Referente a la teoria cromosmica de la herencia, defina los siguientes
conceptos:
a) Cromatina. (0.5)
b) Cromtidas. (0.5)
c) Centrmeros. (0.5)
d) Cromosomas homlogos. (0.5)

Con relacin a la teoria cromosmica de la herencia, define los siguientes


conceptos:
a) Genes ligados. (0.5)
b) Sobrecruzamiento (entrecruzamiento o crossing-over). (0.5)

23

c) Autosoma. (0.5)
d) Herencia ligada al sexo. (0.5)
En relacin con la evolucin celular:
a) Cite el primer tipo celular que aparece en la evolucin, y a qu otro tipo celular dio
lugar. (0.5)
b) Explique la teora endosimbintica (Lynn Margullis, 1970). (1)
c) Cite dos orgnulos celulares procedentes de endosimbiosis. (0.5)
Con respecto a los niveles de organizacin celular:
a) Defina clula procariota. Indique tres caractersticas fundamentales de la clula
citada (1)
b) Cite un ejemplo de clula procariota y dibuje un esquema rotulado de la misma (1)
Uno de los mayores hitos en la historia de la Biologa fue el enunciado de la
Teora Celular.
a) indique los postulados de la Teora Celular (1).
b) Cite los tres cientficos que primero postularon la Teora Celular y el que la
culmin demostrando su validez para el sistema nervioso (1).
En cuanto a la evolucin de la clula y sus orgnulos:
a) Defina la teora endosimbitica (Lynn Margullis, 1970) (1)
b) Cite tres diferencias entre una clula eucariota y una procariota y ponga un
ejemplo de clula procariota (1)
En el diario El Pas Antonio Lazcano Araujo public un artculo
necrolgico el 30/11/2011, que entre otras cosas deca: Enmend la plana a
Linneo y Haeckel y se ech a cuestas la reclasificacin de todas las criaturas
visibles e invisibles, a las que agrup en cinco grandes reinos. Los microbios
eran sus preferidos, y en su cartera llevaba las fotografas de sus protistas
preferidos al lado de las imgenes de sus hijos y nietos. Escritora prolfica y de
un enorme refinamiento intelectual, hizo de la promocin de la visin secular de
la evolucin uno de sus empeos fundamentales.
a) A qu investigadora se refiere, famosa entre otras razones por proponer la teora
endosimbionte? En qu consiste esta teora?. (1)
b) En este contexto, defina los siguientes trminos: Simbiosis, parasitismo, saprfito y
oportunista. (1)

Con referencia a las clulas vegetales:


a) Qu dos orgnulos de las mismas se consideran semiautnomos?. Indique sus
estructuras y principales componentes. (1)
b) Indique los componentes qumicos de la pared celular. (0.5)
c) Cul es el tipo de pared que inicialmente se forma tras el proceso mittico?.
Explique qu es la lmina media. (0.5)

Existen dos tipos de organizacin celular:


a) Indique cmo se denominan y explique brevemente las diferencias
entre ambos tipos en lo que concierne a la estructura de su material
gentico. (1)
b) Cite un orgnulo que tengan en comn ambos tipos celulares y
mencione la funcin y las caractersticas propias de ese orgnulo en
cada clula. (0.5)
c) La figura adjunta representa un orgnulo relacionado , entre otras
cosas con la movilidad celular. Identifiquelo e indique su composicin
qumica as
24

como el tipo concreto de clula en el que se puede encontrar. (0.5)


Con relacin a la membrana celular de clulas eucariotas:
a) Cite sus componentes. (1)
b) Cite cuatro funciones de la misma. (1)
Las clulas procariotas tienen algunas similitudes con las eucariotas, pero
sin duda tambin muchas diferencias.
a) Compare ambos tipos de clulas y seale sus similitudes o sus diferencias en relacin
con la presencia/ausencia de: Citoesqueleto, ribosomas, ADN, envoltura nuclear (1).
b) Cules aparecieron primero? Cmo se supone que surgieron las otras? (1)

Entre las funciones de la membrana plasmtica se encuentra el transporte


de molculas a travs de la misma.
a) Indique los tipos y subtipos de transporte que conoce y explique sus caractersticas
(1,25)
b) En algunos tipos de clulas, la membrana se especializa para cumplir determinadas
funciones. Cite tres especializaciones de membrana e indique su funcin especfica.
(0,75)
El sistema de membranas celulares consta de la membrana plasmtica y del
sistema de endomembranas, poseyendo ambos una estructura similar.
a) Cite los componentes de la unidad de membrana y explique a qu se debe la
denominacin de mosaico fluido segn el modelo de membrana de Singer y
Nicholson. (1)
b) Define glucocalix. (0.5)
En relacin con la membrana plasmtica:
a) explique la composicin qumica de la membrana plasmtica (0.5)
b) modelo hipottico sobre su estructura. Explquelo mediante un esquema,
sealando sus componentes (0.75).
c) de qu formas puede realizarse el transporte de sustancias a travs de la
membrana? (0.75).
En toda clula eucariota existe un sistema de membranas.
a) Cite cuatro estructuras celulares formadas por membrana (1).
b) Dibuje un esquema rotulado de la estructura de la membrana segn Singer y Nicolson
(1).
Aunque existen diferencias entre las membranas de distintos tipos de
clulas, as como entre la membrana plasmtica y la que rodea a diversos
orgnulos, las membranas celulares tienen una estructura bsica comn a
todas ellas.
a) realice un esquema de la membrana plasmtica en el que figuren los principales
componentes de la misma (1).
b) Mencione cuatro de las funciones de la membrana plasmtica (1).
Las clulas vegetales estn rodeadas por una envoltura denominada pared
celular.
a) explique la composicin qumica y la estructura de dicha pared (1)
b) indique dos funciones que desempee la pared en la clula vegetal (0.5)
c) )indique el principal orgnulo implicado en la formacin de la pared celular y en
qu fase de la mitosis se origina (0.5).
Con relacin a la clula vegetal:
25

a)
b)
c)
d)

a)
b)
c)

explique la composicin qumica de la celulosa (0.5)


indique a qu grupo de biomolculas pertenece la hemicelulosa (0.5)
indique la localizacin de la celulosa en dicha clula (0.5)
cite dos biomolculas presentes en las clulas, vegetales o animales, con
idnticas caractersticas qumicas a las anteriores (0.5)

Con respecto a la membrana celular de la clula eucariota:


indique su composicin qumica (0.5)
cite dos funciones de la membrana celular (0.5)
dibuje un esquema del modelo de membrana propuesto por Singer y Nicolson y
seale sus componentes (1).

Una de las funciones de la membrana celular es la de transporte de


molculas entre el medio celular y el medio externo. Defina los siguientes
conceptos:
a) difusin simple (0.5)
b) difusin facilitada (0.5)
c) transporte activo (0.5)
d) endocitosis (0.5)
La clula vegetal, adems de la pared celular, tiene otras caractersticas
diferenciales con la clula animal.
a) cite las otras diferencias existentes (0.5)
b) explique la composicin qumica de la pared celular (1).
c) Cite dos funciones de la pared celular (0.5)
En relacin con los intercambios celulares a travs de las membranas:
a) indique las caractersticas del transporte pasivo que lo diferencian del transporte
activo (0.5)
b) cite los mecanismos de transporte pasivo que permiten entrar en la clula las
molculas de oxgeno y de glucosa (0.5)
c) nombre los mecanismos que permiten la entrada y salida de macromolculas en
la clula. Explique como se llevan a cabo estos procesos (1).
Los nmeros del dibujo adjunto representan el transporte de molculas a
travs de la membrana plasmtica:

a) Explique el transporte representado por los nmeros 1 y 4, y ponga un ejemplo de


iones o molculas que puedan ser transportadas por cada uno de ellos. (1)
b) Explique cmo se realiza el transporte de molculas de elevada masa molecular a
travs de la membrana plasmtica. (1)
Un componente fundamental del citoplasma de clulas eucariotas es el
citoesqueleto:
a) enumere los componentes de esta estructura (0,75)
b) de los anteriores, uno de ellos participa en el transporte de orgnulos y de partculas
en el interior de la clula. Ctelo, explique su estructura e indique otra funcin que

26

desempee (1,25).
En relacin con el citoesqueleto:
a) cite dos componentes del citoesqueleto e indique su composicin (1).
b) Explique la funcin de los dos componentes citados en el apartado anterior (1)
En relacin con las clulas eucariotas:
a) Enumere cuatro orgnulos citoplasmticos membranosos (1)
b) Cite una funcin de cada uno de los anteriores (1)
Con relacin a los orgnulos de la clula eucariota:
a) realice un esquema de la mitocondria y seale sus componentes (1)
b) indique las semejanzas, a nivel estructural, entre las mitocondrias y los cloroplastos.1
Existen sustancias proteicas que se sintetizan en la clula y posteriormente
son segregadas al exterior.
a) cite, por orden de actuacin, las estructuras y orgnulos citoplasmticos que
intervienen en este proceso. (1)
b) en su paso a travs del complejo de Golgi, por qu cara del complejo entran
estas molculas y por cul salen? (0,5)
c) con qu denominacin se conoce el proceso ms habitual de excrecin de
sustancias al exterior y qu estructuras celulares intervienen en l? (0,5)
En cuanto a los tipos de clulas procariotas y eucariotas:
a) cite los componentes esenciales comunes (1)
b) cite sus diferencias (1)
Con relacin a la clula:
a) defina la clula. (0.5)
b) cite los componentes comunes de las clulas procariotas y eucariotas (1)
c) cite dos componentes exclusivos de las clulas eucariotas (0.5).
En relacin con el proceso de secrecin en clulas eucariotas:
a) Cite las molculas y orgnulos celulares que intervienen en el proceso, desde su
sntesis hasta su excrecin al exterior celular. (1)
b) Indique la funcin de cada una de las molculas y orgnulos citados en el
apartado anterior. (1)
Con relacin al aparato ciliar de la clula:
a ) exponga la estructura y funcin de un cilio (1.5)
b) dibuje el esquema de la seccin transversal de su axonema (0.5)
Respecto a los cilios:
a) Cite sus diferencias estructurales. (0.75)
b) Dibuje un esquema rotulado de un corte transversal de su tallo, indicando sus
elementos. (1.25)
Las clulas eucariotas se caracterizan por poseer ncleo y orgnulos
membranosos.
a) Describa los componentes estructurales del ncleo. (1)
b) El ncleo se encuentra fsicamente unido a otro orgnulo celular. Indique de qu
orgnulo se trata y explique brevemente las funciones de ste. (1)

Para la clula eucaritica:


a) Explique las caractersticas estructurales del Aparato de Golgi. (0.5)
b) Explique la participacin del Aparato de Golgi en el proceso de formacin de la
27

pared celular. (0.75)


c) Cite tres polisacridos de la pared celular e indique la composicin qumica de
cada uno de ellos. (0.75).
Con relacin al Aparato de Golgi (complejo de Golgi):
a ) explique sus caractersticas estructurales (1)
b) cmo se originan las vesculas golgianas?, cul es su funcin? (0.5)
c) cite dos funciones del aparato de Golgi (0.5)

Con relacin a la siguiente figura:


a) Indique el nombre que recibe cada cilindro, as como el conjunto
de ambos. (0.5)
b) En qu tipode clula (animal, vegetal o ambas) est presente?
Qu estructura origina en el momento de la divisin celular?.
(0.5)
c) Indique las funciones que realizan los cilios y flagelos y
establezca sus diferencias. (1)

En relacin con el aparato de Golgi y el retculo endoplasmtico rugoso:


a) relacionad entre s y nombre en ellos sus componentes (1)
b) Haga un dibujo del aparato de Golgi y otro del retculo endoplasmtico rugoso.
Explique la relacin funcional del aparato de Golgi y del retculo endoplasmtico
rugoso (0.5)
c) Indique dos orgnulos o estructuras celulares en las que intervenga el aparato de
Golgi en su formacin (0.5)
En relacin con los ribosomas:
a) explique su estructura (0.5)
b) explique su composicin qumica (0.5)
c) explique la funcin de los ribosomas (0.5)
d) indique la localizacin de los ribosomas en clulas procariotas y eucariotas (0.5)
En el dibujo de esta clula:
a) nombre 10 de los elementos sealados (1)

b) explique si se trata de una clula animal o vegetal y en qu fase del ciclo celular
se encuentra (1).
En relacin con los lisosomas:
a) defina lisosoma primario (0,5)
b) cite el orgnulo que origina los lisosomas y otro orgnulo que intervenga en la
sntesis de su contenido (0.5)
c) explique cmo se convierte un lisosoma primario en lisosoma secundario o
fagolisosoma (0.5)
d) cite la funcin de los lisosomas (0.5)
Respecto a los lisosomas:
28

a) Explique su estructura, composicin y funcin (1)


b) defina lisosoma primario y lisosoma secundario (0.5)
c) Explique el significado y funcin de fagolisosoma (0.5)
Con respecto a los lisosomas:
a) Indique su origen, estructura y funcin. (0.75)
b) Diga sus tipos y en qu se diferencian (0.75)
c) Distinga entre vacuolas heterofgicas y vacuolas autofgicas. (0.5)
En el siguiente esquema se representa un cloroplasto:
a) nombre los compartimentos y estructuras que se sealan (1).

b) Mencione las partes de la estructura de este orgnulo asociadas con los siguientes
procesos: sntesis de ATP, ciclo de Calvin, cadena de transporte de electrones y fotolisis
(1).
El dibujo representa un esquema simplificado de una bacteria:
a) Indique las estructuras sealadas con una flecha.
b) mencione 5 estructuras u orgnulos celulares presentes en eucariotas y procariotas
que no puedan estar presentes en una bacteria, indicando su funcin (1)

En las clulas vegetales, la pared celular es externa y rgida.


a) Explique cmo se origina la pared celular. (0.5)
b) Cite las macromolculas que constituyen la pared celular y explique cmo se han
sintetizado las mismas. (0.75)
c) Indique tres funciones que realice la pared celular. (0.75)
En la clula eucariota se encuentran diversos orgnulos:
a) Indique qu son los lisosomas, y explique sus tipos. (1)
b) Indique la funcin y la clasificacin de los lisosomas. (1)

La clula es la unidad estructural y funcional de los seres vivos.


a) Defina los siguientes componentes estructurales de la clula eucariota:
Lisosoma, Retculo endoplasmtico, Membrana plasmtica y Pared celular.
(1)
b) Cite una funcin de cada uno de los componentes estructurales del apartado
a). (1)

Las clulas eucariotas poseen diversos orgnulos:


a) Identifique el orgnulo cuyo esquema aparece en la figura adjunta, as como las
29

distintas partes del mismo sealadas con nmeros (1)


Indique el tipo de organismos en los que se encuentra este orgnulo y exprese, mediante
la ecuacin general del proceso, la funcin principal del mismo (0.5)
b) Indique los lugares concretos dentro del orgnulo en los que se llevan a cabo las
distintas fases del proceso (0.5)

Los plastos son unos orgnulos caractersticos de las clulas vegetales:


a) Respecto al esquema adjunto escriba
el nombre de este plasto, qu proceso
metablico realiza y el nombre que
corresponde a cada nmero. (1.5)
b) Indique el lugar concreto donde se
realiza el ciclo de Calvin y la
finalidad del mismo. (0.5)
Este dibujo representa el esquema de una clula eucariota.
a) Indique si se trata de una clula animal o
vegetal. Razone la respuesta (0.5)
b) Escriba el nombre de las estructuras
numeradas (1)
c) Respecto a las estructuras sealadas con la
letra A (ampliadas para una
mejor visualizacin), escriba su nombre e
indique su composicin qumica y
las funciones que realizan. (0.5)
El dibujo representa una mitocondria:
a) Nombre los componentes sealados con un nmero (1)
b) Indique cul es la funcin que caracteriza a la mitocondria y en qu tipo de clula se
encuentra este orgnulo (0.5)
c) Seale la funcin que realizan los componentes 3 y 4 del esquema (0.5)

30

La figura adjunta representa un orgnulo celular:

a) Diga de qu orgnulo se trata e identifique las partes del mismo sealadas con
nmeros (0.5)
b) Indique las funciones que se desarrollan en los compartimentos 1 y 3. (0.5)
c) Qu otros componentes esenciales para el correcto funcionamiento del orgnulo
faltaran en el esquema?. Indique las funciones de los mismos. (1)

la imagen adjunta representa la estructura general de un tipo determinado


de organizacin celular:

a)

Indique a qu tipo de organizacin celular pertenece dicha imagen e identifique


cada una de las estructuras sealadas con nmeros. (1.25)
b) Explique la estructura y funcin de los componentes celulares sealados con los
nmeros 3 y 8. (0.75)

Este dibujo representa el esquema de una


clula eucariota.

a) Indique de qu tipo se trata. Razone la


respuesta. (0.5)
b) Escriba el nombre de las estructuras que se
sealan. (1)
c) Respecto a la estructura sealada con el
nmero 2, indique dos de sus funciones. (0.5)
El cromosoma metafsico
a) haga un esquema del cromosoma metafsico en el que seale y nombre todos los
elementos o partes que conozca (1.5).
b) nombre los tipos morfolgicos de cromosomas metafsicos que conozca (0.5)
En el cromosoma,
a) haga un esquema del cromosoma metafsico indicando los siguientes
componentes: cromtida, brazo cromosmico, centrmero, telmero,
constriccin secundaria y cinetocoro (1.5)
b) explique qu es un cariotipo (0.5)

31

c) qu cantidad de ADN tendra esta clula durante la metafase I?. Razone la


respuesta. (0.5).
En relacin a los cromosomas metafsicos:
a) defina qu son los telmeros, e indique cuntos tendra un cromosoma
metacntrico en la metafase mittica (0.5)
b) explique qu entiende por centrmero y por cinetocoro (0.5)
c) Cuntos brazos y cuntas cromtidas tendra un cromosoma metacntrico y uno
telocntrico? (0.5)
d) realice una representacin grfica de una pareja de cromosomas metacntricos y
otra de telocntricos en metafase mittica, y seale la presencia de una
constriccin secundaria en la pareja de metacntricos. (0.5)
En relacin con los cromosomas:
a) Realice un esquema de un cromosoma en metafase mittica y seale las partes
principales del mismo. (1)
b) Cmo se clasifican en relacin con la posicin que ocupa la constriccin
primaria?. Defina cada uno de ellos. (1)

Con referencia al proceso de mitosis:


a) Identifique las estructuras que vienen sealadas con
los nmeros del 1 al 4. (1)
b) Defina las estructuras sealadas con los nmeros 1, 2,
y 3 e indique la ploidia de la clula. (1)

Con relacin a la divisin celular por mitosis:


a) Cite de forma secuencial las diferentes etapas del proceso. Para ello escriba en
orden adecuado las letras asignadas a los diferentes dibujos (0.5)

b) Describa cuatro acontecimientos que estn ocurriendo en la fase representada en


el dibujo C (1)
c) Razone si se trata de una clula animal o vegetal (0.5)

Con referencia a los procesos de divisin celular:


a) Identifique en el dibujo adjunto el tipo de divisin
celular y la fase representada. (0.5)
b) Explique los principales acontecimientos que tienen
lugar durante esta fase. (1)
c) Indique la ploida de esta clula y la de las clulas hijas.
(0.5)

32

Cuando en el laboratorio se cultivan clulas, se observa que pasan por una


primera etapa de crecimiento, donde su actividad metablica es muy intensa, y
una segunda etapa donde las clulas presentan su estructura interna muy
modificada (material gentico visible en forma de cromosomas).
a) Cmo se denominan cada una de las etapas anteriormente descritas? (0.5)
b) Si las clulas cultivadas tuvieran 4 cromosomas. Aumentara el nmero de
cromosomas en la fase donde se duplica la cantidad de ADN?. Razone la
respuesta (0.5)
c) La tubulina es una protena sintetizada durante la etapa de gran actividad
metablica para formar el huso acromtico. Qu misin desempea el huso
acromtico y en qu fase comienza a observarse en las clulas? (1)

a)
b)
c)

En relacin a la divisin de una clula somtica animal:


Qu sucesos ocurren durante la profase?. (0.5)
Qu diferencias existen entre la anafase y la telofase?. (1)
Realice un esquema de una clula con 2n=4 en anafase. (0.5)

Realice un esquema y enumere las caractersticas principales de:


a) Citocinesis en una clula animal. (1)
b) Citocinesis en una clula vegetal. (1)
Con referencia al ciclo celular en clulas somticas:
a) Explique qu es la interfase y qu sucede en cada una de las etapas en las que se
subdivide. (1)
b) Defina los siguientes trminos: centrmero, cromtida hermana, bivalente y
telmero. (1)
Respecto al proceso de divisin celular en animales y en vegetales
superiores:
a) haga un esquema grfico de una anafase mittica en una clula animal y en una
clula vegetal para una dotacin cromosmica de 2n = 6. (1)
b) explique en qu difiere la citocinesis tpica de una clula animal y la de una
clula vegetal. (1)
El genoma de una especie animal diploide est formado por 4 cromosomas,
de los cuales, un par posee estructura metacntrica y otro estructura
acrocntrica.
a) Dibuje una anafase mittica, e indique todas las estructuras caractersticas de esta
fase (1)
b) Dibuje la dotacin cromosmica de un gameto de esta especie, y cite cmo se
denomina el proceso que conduce a la formacin de los gametos (0.5)
c) Respecto a la variabilidad gentica, explique la importancia de la meiosis en la
evolucin de las especies. (0.5)

Una determinada especie animal tiene tres pares de cromosomas:


a) Indique cuntos cromosomas tendr un espermatozoide. cuntos tendr un
vulo?. Razone la respuesta. (0.5)
b) Haga un esquema de la metafase mittica de una clula de ese organismo (0.5)
c) Indique en qu tipo de clulas de ese animal se llevara a cabo la mitosis, y la
meiosis? (0.5)
d) qu tipos de espermatozoides puede formar ese animal en funcin de los
cromosomas sexuales?. Razone la respuesta (0.5)

33

El esquema adjunto representa las distintas fases por las que pasa una
clula en su ciclo celular.
a) Sabiendo que el n 2 representa la telofase, indique qu representaran todos los
dems nmeros (1)
b) Indique cuatro procesos celulares que se producen durante la interfase celular (1)
* Con relacin a la divisin celular:
a) Respecto a la citocinesis: (1) en qu consiste?, (2) cundo ocurre?, (3) qu
diferencia bsica existe entre la citocinesis de una clula animal y de una
vegetal?, y (4) cmo se denominan las estructuras que facilitan la citocinesis en
ambos tipos de clulas? .(1)
b) Respecto a la anafase: (1) qu regiones cromosmicas interactan con los
microtbulos?, (2) qu les sucede a esos microtbulos?, (3) qu estructuras
migran a polos opuestos en la anafase I de la meiosis? y (4) qu estructuras
migran en la anafase II de la meiosis? (1).

Con referencia a los ciclos de divisin celular:


a) El esquema adjunto representa cromosomas eucariticos que se encuentran en
mitosis. Indique la fase o fases en las que se podran observar estos cromosomas.
Podra ser tambin una metafase I meoitica?. Razone la respuesta. (1)

b) Con referencia al mismo esquema, indique su nivel de ploida. Se trata de una


clula somtica o de un gameto?. (0.5)
c) Explique el significado de la meiosis con relacin a la variabilidad gentica.(0.5)
Con referencia a las divisiones celulares de los organismos eucariticos:
a) Explique razonadamente las diferencias entre los cromosomas metafsicos
mitticos y los de ambas metafases meiticas. (1)
b) Para una clula animal con 2n=4, indique:
1. clulas resultantes en mitosis y en meiosis
2. nmero de cromtidas en un ncleo hijo mittico y en un ncleo hijo meitico
3. nmero de citocinesis en mitosis y meiosis
4. nmero de bivalentes en mitosis y en meiosis. (1)
Con relacin a la meiosis:
a) Qu sucesos especficos ocurren durante la profase de la primera divisin
meitica?. (0.5)
b) Qu es un quiasma y cundo se visualiza?. (0.5)
c) Qu sucede en la anafase de la primera divisin meitica?. (0.5)
d) En la representacin mostrada a la derecha aparece un bivalente al final de la
profase de la primera divisin meitica. Qu error presenta ese esquema?.
e) Realice un esquema en el cul el error est subsanado. (0.5)

34

Con relacin a la meiosis:


a) Explique cmo se genera la variabilidad gentica. (0.5)
b) Cuntas divisiones ocurren durante la meiosis, y cuntas clulas se generan a
partir de una clula?.(0.5)
c) Teniendo en cuenta un organismo con 2n=4, copie y complete el siguiente
cuadro. (1)
Metafase meitica I
Metafase meitica II
Nmero de cromosomas
Nmero de bivalentes
Nmero de cromtidas por
cromosoma
Ploida de la clula
Con referencia a los procesos de divisin celular:
a) Indique las dos diferencias ms aparentes entre la telofase de una mitosis
astral y la de una anastral. Mencione un tipo de organismos en los que se da cada
una de ellas. (1)
b) Indique los acontecimientos que tienen lugar durante la telofase mittica. (1)
La grfica adjunta representa la variacin del contenido de ADN a lo largo
del ciclo celular de un determinado tipo de clulas.
a) Explique cmo cambia el contenido de ADN desde la fase A hasta la fase G,
razonando el tipo de divisin celular que se ha producido (1.5)
b) Nombre la fase a la que corresponda la letra A e indique dos acontecimientos
que se producen en dicha fase (0.5)

Con referencia a la divisin celular.


a) Haga un esquema grfico de las anafases I y II de un organismo animal con
2n=4 (1)
b) Describa los principales acontecimientos que tienen lugar durante la citocinesis
de una clula vegetal y la de una clula animal (1)
En un organismo eucaritico de reproduccin sexual con un nmero
cromosmico 2n=4 y todos los cromosomas telocntricos:
a) Dibuje un esquema de una anafase II. (1)
b) Cul es el sentido biolgico de la meiosis? (1)

El siguiente dibujo representa una pareja de cromosomas homlogos


durante la meiosis, y las letras representan los genes presentes en estos
cromosomas.

35

a) Si se produce un sobrecruzamiento en el lugar indicado con una cruz, dibuje


todos los gametos posibles formados tras el proceso de meiosis. (1)
b) En qu fase de la divisin meitica se produce el sobrecruzamiento. Explique las
consecuencias biolgicas que conlleva este proceso. (1)
La figura adjunta representa clulas de un organismo diploide en divisin:
a) Estas clulas estn en divisin meitica o mittica?. Razone la respuesta. (1)
b) En qu etapa de la mitosis o de la meiosis se encuentran? Razone la respuesta.
(1)

Referente al ciclo celular en organismos eucariticos:


a) desde el inicio de al interfase, site secuencialmente los periodos G2, G1 y S.
Indique los principales acontecimientos que tienen lugar en cada uno de ellos.
(0.75)
b) explique las diferencias entre los siguientes conceptos: (0.75)
divisin celular / ciclo celular; mitosis / citocinesis; centrmero / cinetocoro
c) describa los principales acontecimientos que tienen lugar durante la profase
mittica (0.75)
Respecto a la divisin celular:
a) Cite cuatro sucesos que ocurren en la profase de una clula somtica. (1)
b) Identifique y explique los dos tipos de anafase que aparecen representadas a
continuacin teniendo en cuenta que las clulas tienen dos cromosomas
telocntricos. (1)

El dibujo representa una clula en un momento


concreto de su ciclo:
a) Indique el tipo de divisin celular y la fase del mismo
representada. Identifique cada una de las estructuras
sealadas con nmeros. (1)
b) Razonando su contestacin, indique si se trata de una
clula animal o vegetal. (0.5)
c) Describa brevemente los tipos cromosmicos
representados. (0.5)

36

Con relacin al proceso de mitosis:


a) Copie y complete el siguiente cuadro en su hoja de examen. (1)
1. Fase en la que se vuelve a originar el nucleolo
2. Fase en la que los cromosomas se disponen en la placa ecuatorial
3. Fase en la que los cromosomas se separan de sus cromtidas
4. si una clula epitelial contiene 20 cromtidas en la anafase mittica,
cuntos cromosomas tendr cada una de las clulas hijas?
b) Explique el proceso de la citocinesis en una clula animal y en una clula vegetal. (1)
Con referencia a los procesos de divisin celular:
a) En el ser humano y otros mamferos, tiene lugar una meiosis gametognica o
cigtica?. Razone la respuesta (0.5)
b) Dibuje un cromosoma submetacntrico indicando el nombre de cada una de las
partes del mismo (0.5)
c) Indique cul de las dos partes de la meiosis es reduccional. Explique los
principales acontecimientos que tienen lugar durante la misma (1)
Con referencia al ciclo de divisin celular:
a) Suponga que el valor C es la cantidad de ADN por genoma haploide. Utilizando
dicho valor, exprese la variacin que sufre el contenido de ADN en todas y en
cada una de las fases del ciclo celular de una clula somtica de un organismo
diploide. (1)
b) Copie y complete la tabla adjunta, indicando en la columna de la derecha a qu
corresponden los conceptos de la columna de la izquierda. (1)
1. los cromosomas que son similares en
dimensiones, forma y contenido gentico se llaman
2. la desaparicin del nucleolo tiene lugar durante
3. durante la citocinesis vegetal, la constitucin de
la pared en las clulas hijas tiene lugar gracias a la
formacin de un tabique llamado
4. la sntesis de ADN en un meiocito tiene lugar
durante
Con relacin al proceso meitico de un organismo 2n=6:
a) Cundo se produce la formacin de bivalentes?. Explique brevemente en qu
consiste. (0.5)
b) Haga un esquema de la anafase II. (0.5)
c) Explique el significado biolgico de la meiosis. (1)
Con relacin a la meiosis de una clula vegetal:
a)
dibuje la anafase I y la anafase II para 2n=6 (1)
b)
explique los acontecimientos que tienen lugar durante la profase I (1).
Con relacin a los procesos de mitosis y meiosis en clulas animales o
vegetales superiores:
a) en qu tipo de clulas de estos organismos tiene lugar la meiosis? y la mitosis?
(0.5)
b) en cul de estos procesos y en que fase del mismo se produce
sobrecruzamiento?. Haga un esquema grfico del sobrecruzamiento. (0.5).
c) explique la importancia biolgica de la meiosis (1).

37

Respecto a los procesos de mitosis y meiosis, y para un organismo con 2n =8


cromosomas:
a) si se tratara de un vegetal, dibuje una anafase II. Cules son las diferencias
respecto a la anafase I? (1).
b) Indique las principales diferencias entre la citocinesis de una clula animal y la
de una vegetal. (0.5).
Respecto al ciclo celular de los organismos eucariticos:
a) indique las etapas del mismo, y haga una breve descripcin de los principales
acontecimientos que tienen lugar en cada una de ellas (1).
b) una clula haploide puede experimentar meiosis? Razone la respuesta (0.5)
Respecto al proceso meitico:
a) cmo se denomina la estructura que se forma por el apareamiento de
cromosomas homlogos? en qu fase del proceso se lleva a cabo? (0.5).
b) defina los siguientes trminos: quiasmas, meiocito, gameto, cinetocoro (1)
c) para una clula con 2n = 6 cromosomas:cuntas cromtidas existen en cada
polo en anafase II?. Razone la respuesta (0.5)
d) explique en qu se diferencia la metafase mittica de la metafase I de la meiosis
(0.5).

a)
b)
c)

Con relacin a los procesos de mitosis y meiosis:


seale dos diferencias entre ambos (0.5)
haga un dibujo de la anafase mittica para una clula 2n=6 (0.5)
explique la importancia biolgica del proceso meitico (1).

Suponga una clula vegetal con tres pares de cromosomas que sufre una
mitosis. Cada una de las clulas resultantes sufre posteriormente una
meiosis:
a) Cuntas clulas se han producido al final de ambos procesos. Razone la
respuesta (0.5)
b) Indique la dotacin cromosmica que tiene cada uno de ellas. Razone la
respuesta (0.5)
c) Haga un dibujo esquemtico sencillo de la anafase mittica y otro de la primera
anafase meitica (1)
Con relacin al proceso meitico:
a) indique cundo se produce el reparto de las cromtidas hermanas entre los ncleos
hijos. Razone la respuesta (0.5)
b) explique el significado biolgico de la meiosis. (1)
c) para una dotacin cromosmica 2n = 4, haga un esquema grfico de la anafase II
(0.5)
Con referencia a los procesos de divisin celular eucariota:
a) Establezca tres diferencias entre los acontecimientos que tienen lugar durante la
profase mittica y la profase I meitica (1)
b) Qu representa la meiosis en la reproduccin y variabilidad de las especies (0.5)
c) Haga un esquema de un bivalente indicando sus componentes (0.5)
Con respecto a la divisin meitica:
a) explique qu es la meiosis cigtica y la meiosis gametognica. Indique en cada
caso en qu tipo de organismos se lleva a cabo. (0.5)
b) explique la importancia biolgica de la meiosis. (1)
c) dibuje una anafase II para una dotacin cromosmica 2n = 6. (0.5)

38

Considerando el proceso meitico:


a) Puede una clula haploide sufrir meiosis?. Razone la respuesta. (0.5)
b) podra un organismo haploide sufrir meiosis en alguna parte de su ciclo?.
Razone su respuesta. (0.5)
c) explique la importancia biolgica de la meiosis. (1)
Con referencia al ciclo celular y a los procesos de divisin:
a) defina los siguientes trminos: Periodo G1; cromosoma homlogo;
sobrecruzamiento; haploide. (1)
b) haga un esquema grfico de una anafase II meitica y de una anafase mittica en
un vegetal con una dotacin cromosmica 2n = 6. (0.5)
c) explique el significado biolgico de la mitosis. (0.5)
En relacin con los procesos de mitosis y meiosis:
a) En cul de los dos procesos se producen bivalentes?. Dibuje un bivalente (0.5).
b) Mencione en qu fase se separan los bivalentes y explique qu acontecimientos
tienen lugar durante una metafase mittica (0.75).
c) Dibuje la anafase I meitica de un organismo 2n= 6 cromosomas (0.75).
La grfica representa la variacin del contenido de ADN por clula durante
un supuesto ciclo celular. Responda razonadamente a las siguientes
preguntas:
a) Qu ocurre en el intervalo de tiempo entre 1 y 2 y cmo se denomina esta fase?
(0.5)
b) Cmo se llaman las fases que tienen lugar en el intervalo comprendido entre 2
y 3? (1)
c) Nombra la fase en que el contenido de ADN es mnimo. (0.5)

En relacin con la meiosis:


a) para una especie 2n= 6 cromosomas haga un esquema de la metafase I meitica
(1).
b) Por qu se dice que la primera divisin meitica es reduccional? (0.5).
c) Cul es el significado gentico de la meiosis? (0.5).
En una etapa de la meiosis los cromosomas homlogos se acercan formando
parejas y se aparean ntimamente.
a) qu nombre reciben estas parejas de cromosomas? (0.5).
b) qu fenmeno ocurre en estas parejas que resulta en un aumento de la
variabilidad gentica? (1).
c) en qu etapa concreta se observan estas parejas de cromosomas? (0.5).
En relacin con los procesos de mitosis y meiosis de los organismos
pluricelulares.
a) En cul de estos dos procesos se produce recombinacin gentica?. Mencione
el mecanismo responsable de la recombinacin (0.5).
b) En qu tipos de clulas tienen lugar la mitosis y la meiosis? (0.5).
c) Cuntas clulas hijas se producen en cada uno de ellos? (0.5).
d) Explique el significado biolgico del proceso de la meiosis (0.5).
39

Meiosis:
a) Significado biolgico de la meiosis (0.5).
b) Haga un esquema de una clula en anafase I meitica de un organismo con 2n=
4 cromosomas en la que se haya producido un quiasma en uno de los bivalentes
(1).
c) Indique las diferencias ms notables entre la anafase I meitica y la anafase
mittica (0.5).
Referente a la divisin celular:
a) Qu nombre reciben las parejas de cromosomas apareados? en qu proceso y
etapa del mismo se observan dichas parejas? (0.5)
b) Haga un esquema grfico del contenido de ADN a lo largo del ciclo celular de
una clula somtica suponiendo que la cantidad de ADN gamtica es C (1)
c) Explique brevemente el significado de la meiosis respecto a la variabilidad de los
seres vivos (0.5)
Los dibujos adjuntos representan los posibles gametos de un determinado
individuo que presenta mitosis astrales.
a) Haga un esquema de la metafase de una clula somtica de ese individuo, indicando
su constitucin gentica (1).
b) El individuo en cuestin, es diploide o haploide? Razone su respuesta (0,5).
c) Defina gameto y cigoto (0,5).

Referido al ciclo celular:


a) Dibuje un esquema de las etapas del ciclo celular indicando cada una de sus
fases en sucesin cronolgica (1)
b) Defina y explique brevemente el significado biolgico de G0 y de S (1)
En una clula somtica de una especie animal con un n cromosmico 2n=
6:
a) Representar un esquema de una profase y de una metafase (1)
b) Cules son los eventos principales de la anafase y de la telofase? (1)
Con referencia a los procesos de divisin celular y reproduccin de los
organismos:
a) indique la importancia biolgica del proceso mittico (0.5)
b) Suponiendo una dotacin cromosmica de 2n= 6, represente grficamente una
anafase mittica y una anafase II meitica (1)
c) Defina los siguientes conceptos: cromosoma homlogo, cromtidas hermanas
(0.5)
Con referencia al proceso meitico:
a) Dibuje una anafase II para una dotacin cromosmica 2n=6 en la que un par de
cromosomas es metacntrico y los otros dos pares son acrocntricos (0,5).
b) Explique la diferencia entre la meiosis cigtica y la meiosis gametognica. Indique en
cada caso en qu tipo de organismos se lleva a cabo (0,5).
c) Explique la importancia biolgica de la meiosis (1).

40

Con referencia al ciclo celular de una clula eucariota:


a) Dibuje un cromosoma metacntrico y otro acrocntrico, cada uno de ellos en
metafase y anafase mitticas indicando en cada caso sus diversas partes o
componentes (1)
a) Indique cules son las diferencias ms notables entre el significado biolgico de
la mitosis y de la meiosis. (1)
Con referencia al ciclo celular de un organismo con dos pares de
cromosomas homlogos, uno acrocntrico y otro metacntrico:
a) Haga un esquema grfico de una anafase mittica (0.5)
b) Describa los principales acontecimientos que tienen lugar en la profase mittica
(1)
c) Indique una similitud y una diferencia entre una anafase mittica y una anafase
II meitica (0.5)

Referente a la divisin celular:


a) Haga un esquema grfico del contenido de ADN a lo largo del ciclo celular de
una clula somtica suponiendo que la cantidad de ADN gamtica es C. (1)
b) Explique brevemente el significado de la meiosis respecto a la variabilidad de
los seres vivos. (0.5)
c) Indique qu tipo de meiosis (cigtica o gametognica) tiene lugar en el ser
humano y otros mamferos. Razone la contestacin. (0.5)

Referente a los procesos de divisin celular:


a) suponga que los cromosomas del esquema adjunto corresponden a una pareja de
homlogos. Qu ha acontecido entre ellos y cmo se denomina el proceso?
(0.5)

b) Copie y complete el siguiente cuadro (1)


(1) la divisin del citoplasma se denomina
(2) los homlogos se aparean entre s, originndose en la zona de
contacto una estructura llamada
(3) la desespiralizacin de los cromosomas ocurre en
(4) La sntesis de ADN se produce durante
c) Explique dos diferencias entre mitosis y meiosis (0.5)
Considrese el ciclo celular de un organismo que posee dos pares de
cromosomas y presenta divisiones astrales:
a) Haga una representacin grfica de la anafase mittica y de la anafase I meitica.
Indique las principales diferencias entre ambas. (1)
b) Defina citocinesis e indique los principales acontecimientos que tienen lugar durante
la citocinesis de las clulas del mencionado orgamismo. (0.5)
c)
Si el organismo en cuestin posee un genotipo de AaBb, indique el genotipo de
sus clulas producidas por mitosis y el genotipo de las clulas resultantes de
meiosis. (0.5)

Con referencia al ciclo celular:


a) Indique la composicin de la cromatina y explique brevemente la organizacin de la
misma. (1)
b) Defina los siguientes conceptos: cromosoma metafsico, cromosoma metacntrico,
41

centrmero, cinetocoro. (1)


Los esquemas del dibujo adjunto representan clulas de la raz de un
vegetal en diversas fases de la mitosis.

a) Nombre la fase en la que se encuentran las clulas numeradas razonando la


respuesta (1,5)
b) de dnde parten las fibras del huso mittico en este tipo de clulas? (0.5
Con referencia al ciclo celular de una clula somtica:
a) Indique en orden cronolgico las distintas fases del ciclo en las que los cromosomas
estn constituidos por dos cromtidas. Razone las contestaciones (1).
b) Suponiendo que se tratase de una clula vegetal, indique a partir de qu orgnulos se
forman la envoltura nuclear y la pared celular de las clulas hijas (0,5).
c) Indique la constitucin qumica de las fibras del huso acromtico. En qu fase tiene
lugar la formacin del huso? (0,5).
Relativo a los procesos de divisin celular:
a) Copie y complete el siguiente cuadro en su hoja de examen. (1)

b) La figura adjunta representa una clula en un determinado momento de su


ciclo. Indique la fase yel tipo de divisin celular y describa los principales
acontecimientos que tienen lugar durante la misma. (1)

Con referencia a los ciclos de reproduccin celular:


a) Copie y complete el siguiente cuadro en su hoja de examen indicando el
proceso o procesos, as como las fases en que ocurren los siguientes
acontecimientos. (1.25)

b) Los organismos eucariticos se pueden reproducir asexual y/o sexualmente.


42

Indique las diferencias entre estos dos procesos. (0.75)


Con relacin al ciclo celular de un organismo 2n=6, cuyas clulas presentan
divisiones anastrales:
a) Haga un esquema de la anafase mittica. (0.5)
b) Con respecto a la informacin gentica que contienen, explique en qu se
diferencian un cromosoma metafsico mittico y un cromosoma metafsico de
meiosis. (0.5)
c) Explique el significado biolgico de los procesos de mitosis y de meiosis en
los organismos. (1)
Referente al ciclo celular de un organismo 2n=6, cuyas clulas presentan
mitosis anastrales:
a) Haga un esquema de la metafase y otro de la anafase mittica. (0.5)
b) Si los 6 cromosomas del organismo equivalen a 10 pg de ADN, qu cantidad
de ADN tendr una clula de ese organismo en los periodos G1 y G2?. Razone
la respuesta. (0.5)
c) Explique el significado biolgico de los procesos de mitosis y meiosis. (1)
Con relacin al ciclo celular:
a) Defina brevemente qu es la interfase y las etapas en las que se subdivide (1)
b) Indique cul de las dos partes de la meiosis es reduccional. Explique los
principales acontecimientos que tienen lugar durante la misma. (1)
Referente a un organismo eucariota con reproduccin sexual, cuyo nmero
de cromosomas es 2n= 4, de los que una pareja es acrocntrica y la otra
metacntrica:
a) Dibuje un esquema de una clula en anafase I de la meiosis. (1)
b) Cul es el sentido biolgico de la mitosis?. (1)
Con referencia al proceso meitico:
a) Defina qu es el sobrecruzamiento. (0.5)
b) Haga un esquema de cmo se lleva a cabo el sobrecruzamiento y seale en qu
fase se produce (1)
c) Mencione cules son las diferencias entre anafase I y anafase II. (0.5)
Con referencia a los procesos de mitosis y meiosis en organismos
pluricelulares:
a) En cul de estos dos procesos se produce recombinacin gnica?. Explique el
mecanismo responsable de la recombinacin. (0.5)
b) Indique en qu tipos de clulas tienen lugar la mitosis y la meiosis, cuntas
clulas hijas se producen en cada uno de estos procesos y, con referencia a los
cromosomas, cmo son las clulas hijas con respecto a la clula de la que
proceden?. (0.5)
c) Explique el significado biolgico del proceso de la meiosis. (1)

Con referencia a las clulas musculares cardiacas y a las clulas plasmticas


productoras de anticuerpos de una determinada especie de mamfero:
a) cul de los dos tipos celulares tendr mayor abundancia de mitocondrias?cul
tendr ms ribosomas?. D una explicacin a ambas respuestas. (1)
b) Si el nmero diploide de la especie en cuestin es de 46 cromosomas, cuntos
cromosomas tendrn las clulas del tejido cardiaco?y las clulas plasmticas? y un
espermatozoide? y un vulo?. (1)

Con referencia al ciclo celular:


43

a) Copie y complete el siguiente cuadro en su hoja de examen. (1)

b) Indique los principales acontecimientos que tienen lugar durante la profase mittica.
(1)
Con referencia al ciclo celular:
a) Copie y complete el siguiente cuadro en su hoja de examen, indicando la fase del
ciclo en que se produce. (1)
1. Periodo en el que se sintetiza el ADN y se forman los
cromosomas duplicados con dos cromtidas hermanas
2. Etapa en la que se produce la divisin del citoplasma
3. Periodo que transcurre entre la duplicacin del ADN y el inicio
de la mitosis
4. Periodo en el que los cromosomas no estn replicados, aumenta
el volumen celular y se sintetizan orgnulos
b) Indique cuatro de los principales acontecimientos que tienen lugar durante la telofase
mittica. (1)
En relacin con el metabolismo de los seres vivos:
a) Indique los tipos de procesos metablicos y la finalidad de cada uno de ellos (1)
b) Indique los tipos de organismos en relacin a su metabolismo, la fuente de
carbono utilizada en cada caso y seale dicha fuente (1)
Con referencia al catabolismo:
a) Explique la diferencia entre respiracin y fermentacin (1)
b) Explique a que se debe el diferente rendimiento energtico en estos procesos (1)
En relacin con el metabolismo celular:
a) Explique el significado de anabolismo y de catabolismo. (1)
b) Explique la diferencia fundamental entre un organismo aerobio y otro anaerobio.
(0.5)
c) Cite un proceso catablico que se realice en anaerobiosis y otro en aerobiosis.
Indique la localizacin celular de cada ejemplo citado. (0.5)
En el metabolismo de los seres vivos:
a) Indique qu es un coenzima y qu papel desempea (1)
b) Ponga un ejemplo de un coenzima oxidado e indique una ruta metablica en la
que acte (0.5)
c) Explique qu ocurre con los coenzimas reducidos en la cadena respiratoria (0.5)
Relacionado con el metabolismo celular.
a) Defina anabolismo y catabolismo. Cite un ejemplo de ruta anablica (0.75)
b) De acuerdo con la forma de obtener el carbono, indique cmo se clasifican los
organismos. Razone la respuesta. (0.5)
c) Segn la fuente de energa que emplean, indique los tipos de organismos y
relacinelos con la respuesta del apartado anterior (0.75)
44

El Adenosn trifosfato o ATP es una molcula central en el metabolismo


celular.
a) Describa su estructura general y explique la importancia del ATP en el
metabolismo (1)
b) En una clula vegetal, indique en qu orgnulos se realiza mayoritariamente la
sntesis de ATP y mencione el nombre de los procesos de sntesis (1)
Referente a la sntesis de ATP:
a) indique sus mecanismos de sntesis en la clula (0.5)
b) cite la localizacin de los mecanismos de sntesis de ATP en la mitocondria y
explique el mecanismo de produccin en el citado orgnulo (0.75)
c) indique la denominacin de los procesos de sntesis de ATP en los cloroplastos y
cite una diferencia entre ambos procesos (0.75)
Referente a la formacin de ATP en los procesos biolgicos:
a) Explique sus mecanismos de sntesis. (1)
b) Para cada mecanismo de sntesis de ATP, cite un proceso biolgico e indique su
localizacin celular y a nivel de orgnulo (1)
Respecto al ATP:
a) Indique el grupo de molculas al que pertenece y cul es su papel metablico (0.5)
b) Explique las posibles formas de sntesis de ATP (1)
c) Indique dos rutas metablicas donde se obtenga ATP (0.5)

a)
b)
c)
d)

Defina los siguientes trminos:


organismos fotoauttrofos o fotosintticos. (0.5)
organismos quimioauttrofos o quimiosintticos. (0.5)
organismos aerbicos o aerobios. (0.5)
organismos anaerbicos o anaerobios. (0.5)

Relacionado con el metabolismo celular:


a) Defina anabolismo y catabolismo. (0.5)
b) Nombre el sustrato inicial y el producto final de la glucolisis e indique si se trata
de una va anablica o catablica. (0.5)
c) Nombre un sustrato inicial y el producto final de la gluconeognesis e indique si
se trata de una va anablica o catablica. (0.5)
d) Indique los compartimentos celulares donde se realizan las vas metablicas
nombradas en los apartados b y c. (0.5)
Para llevar a cabo sus funciones, las clulas necesitan produccin
energtica.
a) Cite el orgnulo responsable de la produccin energtica en clulas animales.
Dibuje un esquema del mismo en el que figure su estructura y sus componentes
y explique cmo se produce la gnesis de ste orgnulo (1)
b) Cite otro orgnulo especfico, responsable tambin de la produccin energtica
en clulas vegetales. Dibuje un esquema del mismo en el que figure su estructura
y sus componentes y explique cmo se produce la gnesis de este orgnulo (1)

a)
b)
c)

Relacionado con el metabolismo celular.


Defina anabolismo y catabolismo (0.5)
Indique la finalidad de las reacciones catablicas (0.5)
Cite dos rutas catablicas e indique su localizacin celular y a nivel de orgnulo
(1)

45

El NAD es un compuesto esencial en el metabolismo:


a) Indique la naturaleza qumica del mismo y explique brevemente su funcin. (1)
b) Escriba las formas reducida y oxidada del NAD y ponga un ejemplo de una
reaccin metablica en la que esta molcula se obtenga en forma reducida y otra
en la que se obtenga de forma oxidada. (1)
El esquema siguiente est relacionado con procesos catablicos
fundamentales en los seres vivos:
GLUCOSAPIRUVATO+NADH+ATP
a) De qu proceso biolgico se trata?, de qu tipo de clula es caracterstico,
de la clula animal o de la clula vegetal?, indique su localizacin a nivel
celular. (0.75)
b) Explique el mecanismo de sntesis de ATP en el proceso mencionado en el
apartado anterior. (0.5)
c) Indique los productos que se pueden originar a partir del piruvato. (0.75)
Referente al metabolismo celular:
a) Segn la fuente de carbono que utilicen los seres vivos para su desarrollo,
explique los tipos de metabolismo. (0.5)
b) Las molculas que se citan a continuacin: FAD, NAD +, NADP y O2 tienen
relacin con reacciones de los procesos fotosinttico y respiratorio. Indique la
relacin de cada molcula con cada proceso. (1)
c) Relacione los procesos anteriormente citados (fotosinttico y respiratorio) con
los tipos de metabolismo aludidos en el primer apartado. (0.5)
En relacin con el metabolismo celular:
a) Explique la finalidad (significado biolgico) del ciclo de Krebs e indique su
localizacin a nivel de orgnulo (0.75)
b) Explique la finalidad (significado biolgico) del ciclo de Calvin e indique su
localizacin a nivel de orgnulo (0.75)
c) Indique en qu tipo de clula, vegetal y/o animal, se producen los ciclos citados
(0.5)
Con relacin a la gluclisis:
a) indique a qu tipo de reacciones del metabolismo pertenece. Razone la respuesta
(0.5).
b) indique en qu compartimento celular se lleva a cabo el proceso (0.5).
c) mencione los productos iniciales y finales de la ruta (0.5).
d) indique qu molculas colaboran en esta ruta para captar los electrones (poder
reductor) y la energa (0.5).
En el catabolismo de la glucosa:
a) Seale la ruta metablica comn a los procesos de respiracin aerobia y
fermentacin, el producto final de dicha ruta y su localizacin celular. (0.75)
b) Compare el rendimiento energtico de ambos procesos. (0.5)
c) Seale un tipo de fermentacin, un organismo capaz de realizarla y el producto
final. (0.75)
En relacin con el metabolismo celular:
a) Nombre la ruta metablica anaerobia por la que las clulas obtienen ATP a partir de
glucosa. Indique cul es el producto final de dicha ruta y el compartimento celular en el
que transcurre. (0.75)
b) Nombre las etapas que seguir dicho producto final en una clula eucariota en
condiciones aerobias. (0.75)
c) Indique el destino que seguir dicho producto final en condiciones anaerobias.
46

Nombre un organismo o una clula capaces de seguir este proceso. (0.5)


Respecto al catabolismo de glcidos en una clula eucariota:
a) nombre las etapas que experimentar una molcula de glucosa hasta que se
convierte por completo en CO2 y HO2 . (1)
b) cite los compartimentos celulares por los que transcurren dichas etapas. (0.5)
c) Indique dos mecanismos mediante los cuales se sintetiza ATP a lo largo de esas
etapas. (0.5)
Relacionado con el ciclo de Krebs para una clula eucaritica:
a) Nombre el compartimento celular en el que transcurre y cite el sustrato que se
incorpora al ciclo. (0.5)
b) Cite el nombre de dos coenzimas que intervienen en dicho ciclo para recoger el
poder reductor. (0.5)
c) Indique una finalidad de dicho ciclo y diga si se trata de una va aerobia o
anaerobia. (0.5)
d) Nombre dos rutas de las que puede proceder el sustrato que se incorpora al ciclo.
(0.5)
Con relacin al tipo de metabolismo que presentan los seres vivos:
a) explique el significado de anabolismo y catabolismo (1)
b) indique a qu tipo de reacciones anablicas o catablicas, pertenecen las
siguientes rutas metablicas: gluclisis, gluconeognesis, ciclo de Calvin y boxidacin de los cidos grasos (1)
En la degradacin aerobia de la glucosa se pueden distinguir las siguientes
etapas:
gluclisis, transformacin de piruvato en acetil-CoA, ciclo de
Krebs y cadena transportadora de electrones:
a) Site en la clula eucaritica cada una de estas etapas (1)
b) Explique qu coenzimas reducidos se producen y en qu etapas (0.5)
c) Explique para qu se utilizan estos coenzimas reducidos en el proceso
respiratorio (0.5)
La siguiente va metablica, cuya reaccin global se indica a continuacin,
es esencial para el metabolismo de las clulas animales:
Glucosa + 2 NAD+ +2 ADP + 2 Pi 2 Piruvato + 2 NADH +2H+ + 2 ATP + 2H2O
a) Indique el nombre de la va y en qu compartimento celular se produce (0.5)
b) Explique los posibles destinos metablicos que puede tener el piruvato
producido (1)
c) Escriba la reaccin global de oxidacin de la glucosa (0.5)
Los esquemas siguientes A y B, estn relacionados con dos procesos
catablicos que tienen lugar en los seres vivos:
(A) GLUCOSAPIRUVATOLACTATO
(B) GLUCOSAPIRUVATOACETIL-CoA
a) A qu proceso corresponde cada esquema?. (0.5)
b) Cite las etapas del proceso representado en el esquema A. (0.5)
c) En el esquema B indique, a nivel subcelular, dnde se forma el Acetil-CoA, las
etapas que sigue hasta finalizar el proceso metablico y la localizacin de cada
una de ellas tambin a nivel subcelular. (1)
Las mitocondrias son unos orgnulos que estn presentes en las clulas
eucariotas.
a) Haga un esquema o dibujo de la mitocondria y seale sus componentes (1)
b) Indique la localizacin en las mitocondrias de los siguientes procesos
47

metablicos: cadena de transporte de electrones y ciclo de Krebs (0.5)


c) Cmo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus
electrones a la cadena de transporte electrnico?, cul es el aceptor final de los
electrones? (0.5)
Sobre las mitocondrias en las clulas eucariotas:
a) Cite el proceso metablico que las caracteriza, describa brevemente sus etapas e
indique su localizacin a nivel de orgnulo. (0.75)
b) Defina fosforilacin a nivel de sustrato. Indique en qu etapa de las aludidas en el
apartado anterior, se produce este tipo de fosforilacin. (0.75)
c) Indique, razonando la respuesta, si el proceso a que se refiere el primer apartado, es
un proceso anablico o catablico. (0.5)
Con referencia al ciclo de Krebs o ciclo de los cidos tricarboxlicos de una
clula eucariota:
a) indique el compartimiento celular en el que transcurre y diga si se trata de una
ruta anablica, catablica o anfiblica. (0.5)
b) nombre tres rutas de las que puede proceder el Acetil- C 0A que se incorpora al
ciclo. (0.75)
c) nombre los coenzimas que participan en el ciclo recogiendo el poder reductor e
indique si se obtienen oxidados o reducidos. (0.75)

Referente al ciclo de Krebs:


a) Indique, razonando la respuesta, si est relacionado con el anabolismo, con el
catabolismo o con ambos. (0.5)
b) Cite los productos finales. (0.5)
c) Cul es la va metablica que sigue al citado ciclo?. Explique la finalidad de
esa va e indique su localizacin a nivel de orgnulo. (1)

a)
b)
c)

Con referencia al catabolismo:


qu son las reacciones catablicas?. Cite un ejemplo. (0.5)
qu son las fermentaciones?. Cite un ejemplo. (0.5)
cite el nombre de las etapas que seguir el cido pirvico en una clula
eucaritica hasta quedar degradado a CO2 y HO2, y nombre el compartimento
celular donde tienen lugar. (1)

En una clula muscular:


a) indique: (I). qu principio inmediato le proporciona energa para realizar la
contraccin; (II) a travs de qu rutas metablicas se obtiene y (III) cmo se
denomina el proceso. (1)
b) cuando el aporte de oxgeno al msculo es insuficiente y ste debe continuar la
contraccin, indique: (I) qu ruta metablica utilizara; (II) el producto final de
dicha ruta y (III) la relacin que ste tiene con la aparicin de las agujetas. (1)
Los orgnulos celulares presentan diversos componentes:
a) Defina fotosistema, tilacoides y estroma (0.5)
b) Con qu proceso metablico se relacionan estos trminos?, cul es la finalidad
de dicho proceso? (0.5)
c) En qu componente de los citados en el primer apartado se produce ATP?.
Explique los principales acontecimientos que tienen lugar durante la misma (1)
En la glucolisis la glucosa se oxida a piruvato.
a) En qu tipo de molculas se puede transformar el piruvato en condiciones
anaerobias? Como se denominan estos procesos?. En cada caso, ponga un
ejemplo de su aplicacin industrial. (1)
48

b) Cul sera el destino del piruvato en condiciones aerbicas?. En qu parte de


la clula se produce?. (0.5)
c) Explique cmo se produce la sntesis de ATP en la glucolisis. (0.5)
Indique el proceso representado en el diagrama, nombrando las etapas
numeradas del 1 al 5. (2)

El siguiente esquema representa procesos importantes en el metabolismo


animal:

a) diga cmo se denominan los compuestos indicados con los nmeros 1 y 2, as


como los procesos con las letras A, B y C (1)
b) En qu compartimentos celulares se desarrollan dichos procesos? (0.5)
c) Aparte de los productos finales, en qu se diferencian los procesos B y C?.
(0.5).
Referente al metabolismo celular:
a) Defina el proceso de fotofosforilacin, indicando sus tipos y los productos que se
originan en cada uno de ellos. (1)
b) Indique dos semejanzas y dos diferencias importantes entre la fotofosforilacin y la
fosforilacin oxidativa. (1)
Los cidos grasos se degradan por la va metablica conocida como oxidacin o hlice de Lynen:
a) En qu compartimento celular tiene lugar esta va en clulas eucariotas? (0.5)
b) Cul es el producto final de la degradacin de los cidos grasos? (0.5)
c) A qu proceso metablico, orientado a la obtencin de energa, se incorpora
este producto final? (0.5)
d) En qu compartimento celular tiene lugar este ltimo proceso metablico? (0.5)
Respecto del catabolismo de un triacilglicrido en clulas animales:
a) indique las cuatro molculas que se obtienen de su hidrlisis y la localizacin
celular del proceso. (0.75)
b) nombre la ruta metablica que permite la degradacin de las tres molculas
similares obtenidas por hidrlisis y su localizacin celular a nivel de orgnulo.
(0.5)
c) en la ruta metablica indicada en el apartado b, cite qu producto se incorpora al
ciclo de krebs para continuar su degradacin y qu dos coenzimas reducidas se
obtienen. (0.75)

49

Con relacin al catabolismo de lpidos:


a) indique a qu tipo de ruta pertenece la -oxidacin de los cidos grasos, el
compartimento celular en el que se realiza y el producto final que se obtiene.
(0.75)
b) mencione la va que sigue el producto final al que se alude en el apartado
anterior hasta oxidarse por completo. Indique el compartimento subcelular
donde ocurre esta va y cules son los productos finales de la misma. (1.25)
El esquema adjunto representa un proceso esencial en la Biosfera.
a) Identifique de qu proceso se trata y cite el tipo de seres vivos que lo llevan a
cabo. (0.5)
b) Indique la denominacin de las dos partes del proceso (sealadas como A y B) y
cite la localizacin subcelular donde se realizan. (0.5)
c) considera que se trata de un proceso : anablico o catablico?. Razone la
respuesta. (0.5)
d) En la parte B del proceso participa un enzima considerado el ms abundante del
planeta. Indique de qu enzima se trata y escriba la reaccin que cataliza. (0.5)

En un laboratorio se est trabajando con plantas utilizando hojas como


material de estudio:
a) cite el proceso anablico ms caracterstico que tiene lugar en el rgano aludido,
mencione las fases del mismo e indique los productos que se originan en cada
una de ellas. (1)
b) realice un esquema rotulado del orgnulo donde se realizan las fases aludidas en
el apartado anterior y seale sus componentes. (1)
Con relacin al metabolismo celular:
a) explique cul es la finalidad de las reacciones anablicas. (0.5)
b) A qu tipo de proceso metablico pertenece la fotosntesis?. Razone la
respuesta. (0.5)
c) Cite las fases del ciclo de Calvin e indique su localizacin a nivel de orgnulo
(1)
El ciclo de Calvin:
a) Indique si se trata de un proceso anablico o catablico y su localizacin a nivel
orgnulo (0.5)
b) Seale la molcula que se regenera en el ciclo y la coenzima reducida que se
requiere (0.5)
c) Indique la molcula que aporta energa al ciclo y en que etapa se ha obtenido la
citada molcula (0.5)
d) Explique cul es la finalidad de dicho ciclo (0.5)
Con relacin al proceso fotosinttico:
a) indique las etapas del mismo y su localizacin en el orgnulo implicado (1).
c) cul es la diferencia entre fotofosforilacin acclica y la cclica?. Razone la
respuesta. (0.5)
50

d) cite otro orgnulo de la clula vegetal donde se produzca ATP de forma


mayoritaria e indique la denominacin del proceso. (0.5).
En el proceso fotosinttico:
a) Indique sus fases y qu proceso bsico se realiza en cada una de ellas (1)
b) Indique el papel que desempean los fotosistemas y seale su localizacin a
nivel de orgnulo (0.5)
c) Indique el mecanismo de obtencin de ATP en tal proceso y su localizacin a
nivel de orgnulo (0.5)
Relacionado con el metabolismo de los seres vivos auttrofos:
a) Indique dos procesos por los que diferentes seres vivos pueden realizar un
anabolismo auttrofo (0.5)
b) Nombre un organismo capaz de realizar cada uno de los procesos citados en el
apartado anterior (0.5)
c) Cite dos componentes de un fotosistema (0.5)
d) Nombre las dos etapas que constituyen el anabolismo auttrofo de cualquiera de
los organismos citados anteriormente (0.5)
Con relacin a la fotosntesis:
a) explique qu es un fotosistema (0.5)
b) indique un organismo que realice la fotosntesis oxignica y otro que realice la
fotosntesis anoxignica e indique en qu compartimentos celulares realiza cada
c) Explique la importancia fisiolgica y ecolgica de la fotosntesis oxignica (0.5)
Con relacin a la fuente de energa utilizada por los organismos:
a) explique la diferencia fundamental entre un organismo quimioauttrofo
(quimiosinttico) y un organismo fotoauttrofo (fotosinttico) (0.5).
b) explique la diferencia fundamental entre fotofosforilacin (fosforilacin
fotosinttica y fosforilacin oxidativa (0.5).
c) indique el tipo de clulas y el compartimento celular donde se producen los
procesos indicados en el apartado anterior (1).
En relacin con la fotosntesis:
a) Defina los siguientes trminos: grana, fotosistema II, estroma y ciclo de Calvin
b) A qu procesos de la fotosntesis est asociada la obtencin de los siguientes
productos: ATP, oxgeno, ribulosa 1, 5-bifosfato, NADPH (1).
En la clula vegetal, la formacin de ATP tiene lugar durante determinados
procesos metablicos.
a) Explique las caractersticas qumicas del ATP, y cite los enlaces entre sus
componentes y seale su importancia en el metabolismo celular (1)
b) Indique en qu procesos se produce la sntesis de ATP y seale los lugares de la
clula dnde suceden (1)
Referente al proceso fotosinttico en organismos eucariticos:
a) Indique que organismos lo realizan y la localizacin subcelular concreta donde
se lleva a cabo (0.5)
b) Escriba de forma abreviada la ecuacin general de dicho proceso (0.5)
c) Indique la finalidad y cules son las principales etapas del ciclo de Calvin (1)
Relativo al ciclo de Calvin:
a) indique cul es la finalidad de dicho ciclo y nombre el compartimento celular en
el que transcurre. (0.5)
b) nombre las fases de dicho ciclo. (0.75)
51

c) escriba una reaccin global para dicho ciclo y cite el mecanismo por el que se ha
obtenido el ATP necesario. (0.75)
Con relacin a la fotosntesis:
a) defina fotosntesis oxignica y fotosntesis anaoxignica. (0.5)
b) defina fotofosforilacin cclica y fotofosforilacin no cclica (acclica) en los
vegetales. (0.5)
c) indique el nombre de la ruta metablica en la que ocurre la fijacin del carbono
y el compartimento celular en el que se lleva a cabo. (0.5)
d) indique la reaccin global de la ruta a la que se ha referido en el apartado
anterior. (0.5)
Con relacin al proceso fotosinttico:
a) explique qu es un fotosistema e indique sus componentes. (0.75)
b) explique brevemente el transporte cclico de los electrones e indique su
finalidad. (0.5)
c) indique las etapas del ciclo de Calvin. (0.75)
En un cultivo de plantas medicinales, donde la hoja es el principal rgano
de utilizacin en la industria farmacutica, se observ una importante
disminucin del contenido de clorofila.
a) qu proceso fisiolgico se vera afectado de forma directa con la
disminucin del citado pigmento? Razone la respuesta. (0.75)
b) Cite las etapas del proceso fisiolgico aludido en el apartado anterior e
indique la localizacin a nivel subcelular de cada una de ellas. (0.5)
c) cmo podra afectar a nivel ecolgico la disminucin de clorofila?y a nivel
econmico? Razone la respuesta. (0.75)
Sobre el ciclo de Calvin:
a) Indique sus fases y explique cada una de ellas. (1.5)
b) Cite dos diferencias con el ciclo de Krebs. (0.5)
Relacionado con el metabolismo celular:
a) Defina fotofosforilacin, indique sus tipos y los productos que se originan. Cite el
proceso metablico relacionado con la fotofosforilacin y la etpa del mismo donde
tiene lugar. (1)
b) Cuales son las semejanzas y las diferencias ms relevantes entre la fotofosforilacin
y la fosforilacin oxidativa?. Razone la respuesta. (!)
Para llevar a cabo las funciones celulares es necesario aportar energa.
a) Dibuje un esquema rotulado del orgnulo energtico de clulas animales (0,75).
b) Indique las etapas del proceso de respiracin aerobia que se efectan en este orgnulo
y en qu localizacin se lleva a cabo cada una de ellas (0,5).
c) Dibuje un esquema rotulado del orgnulo energtico de las clulas vegetales (0,75).
El esquema siguiente representa un proceso bsico en algunos organismos:
a) Indique la denominacin del proceso representado y su localizacin a nivel de
orgnulo. Complete los nmeros 1, 2, 3, 4 y 5 (1,5).
b) Explique el significado biolgico del proceso representado en el esquema (0,5).

52

Suponga que en el genoma de cierta especie vegetal se han introducido dos


genes: uno relacionado con la actividad de la rubisco (ribulosa-1,5bisfosfato carboxilasa/oxigenasa) y otro con la fotlisis del agua.
a) Cite el proceso y la etapa del mismo en la que interviene la rubisco y su localizacin
a nivel de orgnulo (0,5).
b) Explique la importancia biolgica de esta enzima, qu aplicacin podra tener el
aumento de su actividad? (0,5).
c) Qu es la fotlisis del agua? Cul es su finalidad? (0,5 puntos).
d) Cmo se llaman las plantas obtenidas mediante tcnicas similares a la del
enunciado? Con qu propsito se realizan estas tcnicas?, ponga un ejemplo (0,5).

Para los trminos que se citan a continuacin:


a) Indique las diferencias ms relevantes entre fotofosforilacin acclica y
fotofosforilacin cclica y cite su localizacin a nivel de orgnulo. (0.5)
b) Explique la diferencia fundamental entre respiracin y fermentacin. (0.5)
c) Indique las diferencias entre quimiosntesis y fotosntesis. (0.5)
d) Explique la diferencia entre procesos anfiblicos y procesos anablicos. Ponga un
ejemplo de cada caso. (0.5)
Referente al ciclo de Calvin:
a) Indicar el gasto de NADPH y de ATP en el ciclo de Calvin para sintetizar una
molcula de hexosa a partir de CO2 . (0.5)
b) Indicar el enzima ms importante que interviene en el ciclo de Calvin, as como la
reaccin que cataliza. (0.75)
c) Indicar cules son las principales etapas del ciclo de Calvin. (0.75)
Referente al metabolismo celular:
a) Concepto de fermentacin. Indique sus tipos y cite su localizacin celular. (0.75)
b) Explique la sntesis de ATP durante la fermentacin. (0.5)
c) Cul es la relacin entre las fermentaciones y la elaboracin del queso?. Indique el
sustrato y el producto final. Qu microorganismos intervienen?. (0.75)
Relacionado con los procesos metablicos:
a) Defina fermentacin e indique sus tipos. Cul es su localizacin celular?. (0.75)
b) Explique la formacin del ATP durante la fermentacin. (0.5)
c) Cul es la relacin entre el metabolismo fermentativo y la fabricacin del vino?.
Cite los productos: inicial y final. Indique los microorganismos que intervienen (0.75)
Algunas bacterias pueden obtener energa por quimiosntesis.
a) Concepto de quimiosntesis. (0.5)
b) Cite las fases de la quimiosntesis. (0.5)
c) Ponga un ejemplo de una bacteria que participe en el ciclo del N y explique
su importancia en los ciclos geoqumicos. (1)
Respecto a la quimiosntesis:
a) Explique el significado de la quimiosntesis. (0.5)
b) Indique, razonando la respuesta, si se trata de un proceso anablico o catablico.
(0.5)
c) Qu organismos realizan este tipo de metabolismo?. Describa la estructura de
estos organismos. (1)

Sobre la respiracin celular:


a) Indique razonando la respuesta, si es un proceso anablico o catablico.(0.5)
b) Enumere sus etapas, describa brevemente cada una de ellas e indique su
53

localizacin en la clula y a nivel de orgnulo. (0.75)


c) Explique las diferencias entre fosforilacin a nivel de sustrato y fosforilacin
oxidativa. En qu etapa o etapas de la respiracin celular se produce la
fosforilacin a nivel de sustrato?. (0.75)
El diagrama representa el proceso de consumo anaerobio de glucosa en el
tejido muscular:

a) Complete el diagrama poniendo en las casillas el nmero de carbonos de cada


uno de los 3 compuestos. (0.5)
b) Indique el nombre de los procesos sealados con X e Y. (0.5)
c) En qu lugar de la clula sucede el proceso X?. (0.5)
d) Qu ganancia neta en ATP hay en el proceso X?. (0.5)
El esquema siguiente est relacionado con un proceso metablico celular
bsico:
a) A qu proceso metablico se refiere el enunciado?, indique el lugar de sntesis a
nivel subcelular y de orgnulo de cada uno de los compuestos indicados en el
esquema (1).

b) Explique el mecanismo de formacin de ATP en el esquema (0,5).


c) Cite otras dos rutas metablicas que pueda seguir el piruvato, e indique para cada una
de ellas: su denominacin, el producto originado y el lugar dnde se produce (0,5).
En los procesos de fermentacin:
a) Indique un tipo de fermentacin, sealando la molcula inicial, el producto final y un
microorganismo capaz de realizar dicho proceso (1)
b) Explique por qu en la fermentacin se obtiene un menor rendimiento energtico que
en la respiracin (0.5)
c) Explique qu ocurre en la fermentacin con el coenzima NADH obtenido en la
glucolisis (0.5)
El esquema que se indica presenta un proceso catablico de la clula:
a) A qu proceso se refiere el enunciado? Cite sus etapas e indique su

54

localizacin a nivel de la clula y de orgnulo. Qu ocurre en cada una de


esas etapas?. (1)
b) Explique cmo se produce la sntesis de ATP en cada uno de los casos del
esquema del enunciado: (A), (B) y , y relacinelos con las etapas aludidas
en el apartado anterior. (1)
Los compuestos siguientes estn relacionados con la respiracin y la
fotosntesis: ribulosa 1,5- bisfosfato, NADH, FADH2, NADP.
a) Relacione cada uno de los compuestos con el proceso correspondiente y con
la etapa del mismo donde participa. (1)
b) Explique las caractersticas qumicas del NADP y FADH2 e indique su
funcin. (0.5)
c) Explique las caractersticas qumicas y la funcin de la ribulosa 1,5bisfosfato. (0.5)
Los microorganismos intervienen activamente en diversos ciclos
biogeoqumicos, en este contexto:
a) Explique brevemente el ciclo del nitrgeno, indicando cual es el reservorio
principal de N en el planeta. (1)
b) Indique dos microorganismos que fijen el N2 gaseoso. (0.5)
c) Explique brevemente el papel de las leguminosas en el ciclo del N. (0.5)
El nitrgeno es un elemento muy abundante en la atmsfera, a la vez que
componente esencial de los seres vivos. Sin embargo, slo unos pocos
microorganismos son capaces de fijar el N2 atmosfrico.
a) Explique un ejemplo de fijacin bacteriana del N2 (1).
b) Otras bacterias del suelo obtienen energa oxidando el amoniaco a compuestos
asimilables por las plantas. Explique el proceso (1).
Algunos microorganismos viven en simbiosis con los vegetales.
a) Explique en qu consiste la simbiosis (0.5).
b) Mencione los tipos de microorganismos que intervienen en el ciclo del nitrgeno
(0.5).
c) Explique la importancia para la agricultura de la simbiosis microorganismosplantas en el ciclo del nitrgeno y ponga un ejemplo (1).
Con referencia a la organizacin celular procariota:
a) Defina los siguientes trminos: pptido-glicano (o murena), gram negativo,
plsmido, nucleoide. (1)
b) Describa en pocas palabras y haga un esquema grfico del proceso de biparticin
binaria. (1)
La microbiologa estudia un grupo muy diverso de microorganismos:
a) excluyendo los virus, enumere los tres reinos fundamentales en los que se
clasifican los microorganismos, indicando una caracterstica relevante de cada
uno de ellos (0.75).
b) Cite tres ejemplos de microorganismos pertenecientes a cada uno de los reinos
mencionados en el apartado anterior (0.75)
En relacin con la diversidad microbiana:
a) Mencione tres microorganismos pertenecientes a distintos reinos, indicando en
cada caso el reino al que pertenece. (0.5)
b) Seale si cada uno de los microorganismos mencionados en el apartado anterior,
tiene o no organizacin celular y de qu tipo. (0.5)

55

c) Cite tres enfermedades humanas producidas por microbios, indicando el


organismo patgeno correspondiente. (0.5)
d) Mencione tres microorganismos beneficiosos para el ser humano o para el medio
ambiente, con indicacin de sus efectos. (0.5)
Con relacin a la biologa celular y la microbiologa:
a) Seale las aportaciones cientficas de Anton van Leeuwenhoek y de Robert
Hooke (0.5)
b) Describa brevemente en qu consiste la teora de la generacin espontnea.
Es correcta esta teora?. Razone la respuesta (0.75)
c) Qu es la tincin de Gram? Explique su fundamento biolgico. (0.75)
En relacin con las bacterias:
a) Mencione dos mecanismos de transferencia de material gentico entre bacterias,
indicando en qu consiste cada uno de ellos. (0.5)
b) Indique las principales funciones de la pared celular bacteriana. (1)
c) Respecto al metabolismo bacteriano, indique el significado de los trminos
quimiotrofo y aerobio facultativo. (0.5)
Para llevar a cabo el estudio e identificacin de los microbios se utilizan una
serie de tcnicas:
a) enumere las ms importantes. (0.5)
b) Explique dos de ellas. (1)
c) Indique la forma de vida de los microorganismos saprofitos. (0.5)
En relacin con las bacterias:
a) Complete el cuadro siguiente (1):
Pared celular
(ausencia/presencia) y
Ejemplos y/o enfermedad
caractersticas.
Bacterias Gram+
Bacterias GramMicoplasmas
Arqueobacterias
b) Dibuje y rotule las estructuras ms relevantes de una clula bacteriana tpica. (1)

a)
b)
c)
d)

En relacin con los microorganismos:


En qu consiste la esterilizacin? (0.5)
Cite dos mtodos de esterilizacin (0.5)
Cul es la finalidad de la pasteurizacin? (0.5)
Indique para qu sirve la tincin de Gram. (0.5)

Los microorganismos son un grupo muy heterogneo de seres vivos:


a) Formule y explique la teora de la simbiognesis (endosimbiosis) y exponga la
transcendencia de esta teora en la Biologa contempornea. (1)
b) Defina los siguientes conceptos: simbiosis, parasitismo, zoonosis y pandemia (1)
En relacin con las enfermedades infecciosas:
a) Defina los conceptos de infeccin, epidemia, pandemia y microorganismo
patgeno. (1)
b) Seale dos enfermedades infecciosas humanas, transmitidas por animales. (0.5)
c) Indique con qu sustancias, administradas a una persona, se puede conseguir una
inmunidad activa y pasiva frente a estas enfermedades. (0.5)
Algunos microorganismos y otros agentes patgenos son los responsables de
56

numerosas enfermedades infecciosas.


a) cite cuatro vas de transmisin de las enfermedades infecciosas y ponga un
ejemplo para cada una de ellas (1).
b) Qu significan los siguientes trminos: epidemia, pandemia, enfermedad
endmica y zoonosis (1).
Algunos microorganismos, por su capacidad para producir toxinas, pueden
causar enfermedades infecciosas en los seres vivos.
a) Explique que significa el trmino infeccin. Cmo se denominan los
microorganismos que producen enfermedades? (0.5).
b) Explique qu significa el trmino virulencia e indique, en funcin de la
misma, los distintos tipos de microorganismos (0.5).
c) Explique que significa el trmino toxina e indique sus tipos (1).
Relacionado con las enfermedades infecciosas:
a) cite un ejemplo de agente patgeno perteneciente a cada uno de los siguientes
grupos: bacterias, virus, protoctistas y hongos. Indique la enfermedad que
produce cada uno de ellos (1)
b) Defina el concepto de toxina. Enumere los tipos de toxinas que conozca
indicando sus diferencias y cite un ejemplo de enfermedad causada por un
microorganismo productor de toxinas. (1)
Con relacin a los microorganismos:
a) mencione las principales tcnicas de tincin utilizadas en la visualizacin y
estudio de los microorganismos (0.5).
b) explique el significado del trmino esterilizacin y mencione dos
procedimientos diferentes de esterilizacin (1).
c) Explique el significado del trmino quimioterapia y cite un ejemplo de agente
quimioteraputico (0.5).
En relacin con los agentes infecciosos y microorganismos de inters
industrial.
a) Desde un punto de vista taxonmico, mencione cuatro grupos distintos de
agentes infecciosos (1).
b) Ponga un ejemplo de agente infeccioso y mencione la enfermedad que causa
(0.5).
c) Mencione un proceso industrial en el que participe un microorganismo,
sealando el grupo taxonmico al que pertenezca (0.5).
La principal contribucin del mdico britnico Joseph Lister (1827-1912) a
la historia de la medicina fue el descubrimiento y aplicacin de la asepsia y
de los antispticos (sustancias antimicrobianas que se aplican a un tejido
vivo) en la ciuga, por lo que contribuy a reducir en gran medida el
nmero de muertes por infecciones contradas en el quirfano despus de
que los pacientes fueran sometidos a intervenciones quirrgicas.
a) En este contexto, comente razonadamente las medidad de prevencin de infecciones.
(1)
b) En relacin con la lucha contra los microorganismos patgenos, qu diferencia hay
entre esterilizacin y pasteurizacin?. Seale otros dos sistemas de tratamiento
antimicrobiano que se aplica a los alimentos.(1)

La salazn es un sistema de conservacin de alimentos muy utilizado desde


antiguo, y consiste en aadir una considerable cantidad de sal al alimento
para preservarlo del ataque de microorganismos que puedan alterarlo.
a) Explique este hecho de forma razonada. (1)
57

b) A finales del siglo XIX se empieza a aplicar otro sistema de conservacin de


alimentos muy utilizado en la actualidad, descubierto por Louis Pasteur. En
qu consiste?. (1)
Un gran nmero de enfermedades infecciosas son producidas por bacterias,
similares en muchos casos a la que se muestra en el esquema adjunto.

a) Identifique los nmeros del esquema con cada uno de los siguientes
elementos: flagelo, ribosomas, nucleoide, pared, cpsula, membrana
plasmtica. Indique la funcin d las estructuras sealadas con el nmero 1.
(1)
b) En funcin de su capacidad para teirse, cmo se clasifican las bacterias?A
qu se debe esta desigual capacidad? Qu nombre reciben determinadas
formas acelulares parsitas de las bacterias?. (1)
Las fermentaciones son procesos catablicos de enorme importancia en la
Biologa y en la Biotecnologa.
a) En qu consiste un proceso catablico?. Cite algn proceso anablico importante en
la Naturaleza. (0.5)
b) Indique dos similitudes y dos diferencias entre la fermentacin alcohlica y la
fermentacin lctica. (1)
c) Indique los procesos industriales basados en fermentaciones. (0.5)

Con relacin a los virus:


a) Defina qu es un virus y mencione sus caractersticas biolgicas ms
importantes (0.5)
b) Mencione dos criterios diferentes utilizados en la clasificacin de los virus. (0.5)
c) Explique las diferencias que existen entre los ciclos lisognico y ltico de un
virus (0.5)
d) Cite dos enfermedades humanas causadas por virus. (0.5)
Con referencia a los virus y otros agentes infecciosos:

a) Indique a qu tipo de ciclo corresponde el siguiente esquema y explique


brevemente cada una de las fases representadas por nmeros. (1)
b) Definas los trminos retrovirus y prin. (0.5)
c) Indique las diferencias entre el significado de los trminos epidemia y pandemia.
(0.5)
Indique la clasificacin de los virus:
58

a)
b)
c)
d)

Segn el husped que parasitan (0.5)


Segn el material hereditario (0.5)
Segn la forma de la cpsida (0.5)
Enuncie los tipos de multiplicacin vrica (0.5)

a)
b)
c)

Respecto a los virus:


Defina que es un virin e indique su composicin (0.5)
Haga el esquema de un bacterifago sealando sus diferentes partes (1)
Mencione las dos formas de reproduccin de un bacterifago, cul de ellas
provoca la lisis de la bacteria? (0.5)

a)
b)
c)

En relacin con los virus:


Qu es un virus y cul es su composicin? (0.5)
Mencione las fases que comprende el ciclo ltico de un virus bacterifago (1).
Ponga un ejemplo de una enfermedad causada por un virus e indique la va de
transmisin (0.5).

El virus VIH es el causante de la enfermedad denominada sndrome de


inmunodeficiencia adquirida ms conocida por SIDA y su material gentico es
ARN.
a) Mencione dos mecanismos o vas de transmisin o contagio de este virus (0.5)
b) Qu tipo de clulas son el blanco de este virus? (0.5).
c) Cmo se denomina el proceso por el que el ARN del virus pasa a ADN? (0.5).
d) Cmo se denominan los virus animales cuyo material gentico es ARN y que
realicen el proceso descrito en el apartado c? (0.5).
Se pueden producir alteraciones patolgicas en el funcionamiento del
sistema inmunitario:
a) Indique qu tipo de estructura es el V.I.H y el tipo de enfermedad que provoca. (0.5)
b) Cite el tipo celular afectado por el V.I.H y explique el proceso de penetracin celular
y de replicacin intracelular. (1)
d) Mencione los mecanismos de transmisin de la enfermedad. (0.5)

Defensa contra las infecciones virales.


a) Explique por qu es reconocida por el sistema inmune una clula infectada por
un virus (1).
b) Qu tipo de linfocito reconoce a las clulas infectadas por virus y cmo acta?
(1).
En relacin con la biotecnologa:
a) Qu microorganismos se utilizan en el proceso de fabricacin del yogur, la
cerveza y el pan?. (0.5)
b) Qu reacciones qumicas tienen lugar en los procesos antes mencionados?.
Seale los productos qumicos que se obtienen en cada una de las reacciones.
c) Adems de en la industria alimentara, seale otros dos campos en los que se
emplee la biotecnologa. (0.5)
Con referencia a la moderna biotecnologa:
a) Defina los siguientes conceptos: ingeniera gentica, clula hospedadora,
clonacin y vector de clonacin. (1)
b) Mencione cuatro aplicaciones prcticas de la ingeniera gentica y ponga un
ejemplo de cada una de ellas. (1)
Con relacin a la utilizacin de los microorganismos con fines industriales:
a) defina el concepto de biotecnologa (0.5)
59

b) mencione un microorganismo utilizado en la industria alimentara y explique


brevemente el proceso en el que participa (0.75)
c) mencione un microorganismo utilizado en la industria farmacutica y explique
brevemente el proceso en el que participa (0.75)

a)
b)
c)

En relacin a los microorganismos y sus aplicaciones:


Qu son los antibiticos? (0.5)
Indique dos grupos de microorganismos capaces de fabricar antibiticos (0.5)
Seale otras dos sustancias producidas por la industria farmacutica obtenidas
mediante procesos biotecnolgicos y su utilidad mdica (1)

Durante la fabricacin de la cerveza se producen una serie de reacciones


anaerobias:
a) Indique cmo se llama el proceso global y qu tipo de microorganismo
interviene (0.5).
b) Describa, desde el punto de vista qumico, la reaccin global de este proceso y
en qu parte de la clula se localiza (1).
c) Cite dos ejemplos de otros de otros procesos similares, indicando su inters
industrial (0.5).
En muchos procesos relacionados con la industria alimentara se producen
fermentaciones por microorganismos.
a) ponga un ejemplo de dichos procesos y mencione el tipo de microorganismo
implicado (0.5).
b) Comente la funcin metablica que desempea el microorganismo citado e
indique los productos iniciales y finales del proceso (0.75).
c) Realice un esquema del microorganismo citado, haciendo referencia a su
organizacin estructural (0.75).
La Microbiologa y la Biotecnologa son dos disciplinas implicadas en
algunos procesos de la industria alimentaria.
a) Describe qu etapas son comunes y cules son diferentes en la fabricacin del
vino y la cerveza (1)
b) Describe qu etapas son comunes y cules son diferentes en la fabricacin del
yogur y el queso (1)
Los microorganismos pueden ser de gran utilidad para el hombre ya que
intervienen en muchos procesos de inters como la produccin de
antibiticos, la elaboracin de la cerveza, vino, pan, productos lcteos, etc.
a) Qu tipo de microorganismos participan en los procesos de elaboracin del vino y
de la cerveza? (0.5)
b) Qu proceso metablico se produce en la elaboracin de estos productos? (0.5)
c) Qu tipo de microorganismos participan en la elaboracin del yogur?. (0.5)
d) Qu tipo de proceso metablico se da en la elaboracin del yogur?. (0.5)
En la industria alimentara existen procesos en los que se utilizan levaduras.
a) ponga un ejemplo de proceso industrial relacionado con la industria alimentara
en el que se utilicen levaduras e indique cmo se denomina el proceso
metablico que tiene lugar (0.5).
b) Cul es el balance global del proceso metablico citado anteriormente? (0.5).
c) Realice un esquema de la organizacin celular de las levaduras (1).
Existen muchas sustancias de gran inters que, como los antibiticos,
pueden extraerse de microorganismos. El descubrimiento de la penicilina
por el Dr. A. Fleming (1928), marc un cambio radical en el tratamiento y
60

curacin de las enfermedades producidas principalmente por bacterias.


a) Defina el concepto de antibitico explicando el modo de accin de uno de ellos
(1).
b) Cite algunos microorganismos que intervienen en la produccin de antibiticos
(1).
Con relacin a la utilizacin de los microorganismos en la industria
alimentara:
a) mencione el microorganismo que se utiliza en la fabricacin del queso e indique
otra aplicacin del mismo en la industria alimentara (0.5)
b) indique la reaccin metablica que realiza dicho microorganismo en el proceso
de elaboracin del queso, indicando los productos iniciales y finales de la
reaccin (0.75).
c) dibuje un esquema del microorganismo citado donde se aprecie su organizacin
estructural (0.75).
La elaboracin de ciertos productos lcteos se inicia con una primera
reaccin en la que intervienen un determinado tipo de microorganismos.
Posteriormente se requiere que intervengan otros microorganismos hasta
obtener el producto final.
a) Indique brevemente esa primera reaccin que se lleva a cabo (nombre del
sustrato inicial y productos finales), y el microorganismo (A) que interviene en
esta etapa del proceso. (1)
b) El hongo Penicillium roquefortii es responsable del aspecto, olor y sabor de un
determinado producto lcteo, sabra indicar cul es este producto y si este
hongo participa antes o despus del microorganismo A en el proceso?. (0.5)
c) Otras especies de Penicillium se han empleado en la industria farmacutica.
Indique el nombre de la primera sustancia que se obtuvo gracias a l y el nombre
genrico de estos frmacos. (0.5)
Bacterias y levaduras son microorganismos que pueden realizar
fermentaciones para la obtencin de energa.
a) Seale las diferencias fundamentales de organizacin celular entre estos dos
tipos de microorganismos (1).
b) Ponga un ejemplo de fermentacin realizada por bacterias e indique el balance
global de la misma (0.5).
c) Ponga un ejemplo de fermentacin realizada por levaduras y mencione un
proceso industrial en el que tenga aplicacin (0.5).
La obtencin de determinados productos alimentarios se basa en algunos
procesos metablicos celulares:
a) Explique la transformacin que sigue la glucosa durante el proceso de elaboracin
del pan. Cmo se denomina el proceso?En qu etapa se produce la sntesis de
ATP?. (1)
b) Qu organismos estn relacionados con la elaboracin del pan?A qu tipo de
organizacin celular pertenecen estos organismos?. Indique sus componentes
estructurales. (1)

En un peridico apareci la siguiente informacin: ...Un equipo de


investigacin de dicha Universidad est poniendo a punto un antibitico de
enorme poder bactericida con la idea de que en el futuro se disperse por el
medio ambiente y as se acabe con todas las bacterias del planeta. Un
mundo sin bacterias ser un mundo libre de enfermedades infecciosas.
a) Redacte una crtica cientfica a esta supuesta noticia, tanto si la informacin fuese
verdad, como si fuese inventada (1).

61

b) Cmo sera un mundo sin bacterias? Se acabaran las enfermedades infecciosas?


(1).
En relacin con la Biotecnologa y la Microbiologa.
a) Qu tienen en comn la fabricacin del pan y la del vino? (0,5).
b) Cul es y de dnde procede la molcula de partida?, Cul es y dnde va la
molcula resultante de la reaccin bsica de estos procesos industriales? (1).
c) Qu organismo es el responsable de esta reaccin? (0,5).
El significado original de antgeno es generador de anticuerpos. Los
antgenos son molculas que cuando penetran en el organismo son
reconocidos por algunos tipos celulares:
a) Nombre los dos tipos principales de clulas sanguneas que reconocen antgenos.
(0.5)
b) Mencione cul de estos dos tipos celulares est implicado en la respuesta humoral.
(0.5)
c) Mencione cul de estos dos tipos celulares est implicado en la respuesta inmune
celular. (0.5)
ci) Mencione cul de estos dos tipos celulares, una vez reconocido el antgeno,
induce la secrecin de anticuerpos contra ese antgeno. (0.5)
Referente al sistema inmunitario:
a) En un medio de comunicacin aparece la siguiente noticia:
las manifestaciones clnicas de las picaduras de insectos de la clase himenpteros
(bsicamente abejas y avispas) son variadas. Sin tener en cuenta las reacciones
txicas por picada mltiple (ms de 50), en las picadas aisladas se presentan
reacciones locales pequeas que se consideran normales. Pero algunas personas
presentan reacciones que no se explican por el efecto txico del veneno de una sola
picada. Se trata de pacientes que han desarrollado alergia IgE mediada a los
componentes de este veneno. La anafilaxia por picadura de insectos puede
representar, en un pequeo nmero de pacientes, un riesgo vital. Aunque la mayora
de picaduras de insecto producen reaccin local, situaciones potencialmente
mortales ocurren tanto en nios como en adultos.
Indique cmo se denomina ese tipo de reaccin en esos pacientes. Defnala en pocas
palabras. (0.5)
b) Defina alrgeno (0.5)
c) Indique qu tipo concreto de agente patgeno es el VIH, qu enfermedad
provoca y dos de los principales mecanismos de transmisin de la misma (1).
Con relacin a la respuesta inmunolgica especfica humoral:
a) defina el trmino memoria inmunolgica y cite la clula responsable de su
existencia. (1)
b) defina respuesta primaria y respuesta secundaria y explique dos diferencias
existentes entre ellas. (1)

a)
b)
c)

Con relacin a la inmunidad:


defina respuesta inmune. (0.75)
indique y explique los tipos de respuesta inmunitaria especfica. (0.5)
cite tres clulas que participan en la respuesta inmune. (0.75)

a)
b)
c)

Con relacin al sistema inmunitario:


Defina los conceptos antgeno y anticuerpo (0.5)
Qu se entiende por respuesta inmune (0.5)
Indique los tipos de respuesta inmune y explique cada uno de ellos (1)

62

Con referencia al sistema inmunolgico:


a) Defina el concepto de interfern e indique brevemente como lleva a cabo su
accin.(1)
b) Diga qu es la hipersensibilidad (0.5)
c) Defina el concepto de antgeno (0.5)
Con relacin a la respuesta inmune, explique brevemente los siguientes
conceptos y mencione el tipo de clula y/o molcula que participa:
a) inmunidad humoral (0.5)
b) inmunidad celular (0.5)
c) memoria inmunolgica (0.5)
d) inmunidad natural pasiva (0.5)
Los linfocitos T son clulas indispensables para un buen funcionamiento del
sistema inmune:
a) Indique donde se produce su clula precursora y en qu lugar del organismo se
diferencian para poder cumplir su misin (0,5)
b) Cite el tipo de inmunidad en el que actan y dos estructuras a las que destruyan
(0,75)
c) Indique los dos grupos principales en que se clasifican y los subgrupos que se
originan de ellos (0,75)

a)
b)
c)
d)

Con respecto a los tipos de inmunidad dependiendo de la forma adquirida:


Defina inmunidad natural pasiva (0.5)
Defina inmunidad natural activa (0.5)
Defina inmunidad artificial pasiva (0.5)
Defina inmunidad artificial activa (0.5)

En relacin con la respuesta inmune:


a) Defina inmunidad especfica e inespecfica (0.5)
b) Diga en cul de ambos mecanismos participan: los linfocitos, el interfern, la
inflamacin y los anticuerpos (1)
c) Defina inmunidad natural e indique su origen (0.5)
En algunas vacunas hay que administrar varias dosis para alcanzar una
proteccin suficiente:
a) Explicar lo que ocurre al administrar la primera dosis y lo que ocurre con dosis
posteriores (1).
b) En qu casos se espera que la vacuna reproduzca de forma atenuada algunos
sntomas de la enfermedad? (0.5)
c) En qu casos la vacuna no va a producir ningn sntoma de la enfermedad?
(0.5)
Referente a los linfocitos T:
a) Qu tipos de linfocitos T conoce y cmo acta cada uno de ellos? (1).
b) Mencione dnde se originan y dnde maduran (1).
Con respecto a las alteraciones de la respuesta inmune:
a) explique el concepto de inmunodeficiencia (0.5)
b) explique las diferencias que existen entre inmunodeficiencias congnitas y
adquiridas. Cite un ejemplo de inmunodeficiencias (0.75)
c) explique el concepto de enfermedad autoinmune y cite un ejemplo (0.75)
Considerando la respuesta inmune:
a) defina el concepto de antgeno (0.5)
63

b) defina el concepto de anticuerpo (0.5)


c) mencione e indique el origen de las clulas sanguneas que se encargan de la
produccin de anticuerpos (1).

a)
b)
c)

Con relacin a las clulas que participan en la respuesta inmune:


indique el origen, tipos y funciones de los linfocitos T (1)
indique el origen y funcin de los linfocitos B (0.5)
indique el origen y funcin de los macrfagos (0.5)

El esquema representa una de las molculas ms importantes en la


respuesta inmune:

a) nombre esta molcula indicando su estructura y su funcin (1).


b) Diga qu clulas del cuerpo humano producen estas molculas, explicando de
qu tipo celular proceden (0.5).
c) Explique el papel de estas molculas en las enfermedades autoinmunes (0.5).
El sistema inmunitario es responsable del rechazo que se produce en
algunos casos de transplantes o injertos.
a) mencione las molculas responsables del rechazo (0.5).
b) Explique por qu los transplantes entre gemelos idnticos o univitelinos no
provocan reacciones de rechazo (0.5).
c) Ponga un ejemplo de trasplante e indique cuando se aconseja su realizacin
(0.5).
d) Explique una medida para reducir el riesgo de rechazo en los trasplantes (0.5)
En relacin con la respuesta inmune primaria y secundaria.
a) Cundo se origina la respuesta inmune secundaria y primaria? (0.5).
b) Explique dos diferencias entre la respuesta inmune primaria y la secundaria e
indique qu tipo de clulas son las responsables de las diferencias entre ambos
tipos de respuestas (0.75).
c) Qu mtodo de inmunizacin artificial se basa en inducir el desarrollo de la
respuesta inmune?. Explique el procedimiento de este mtodo y su finalidad
(0.75).

a)
b)
c)

La lactancia materna proporciona al beb inmunidad natural pasiva.


Explique en qu consiste en este caso la inmunidad (0.5).
Ponga otro ejemplo diferente de inmunidad natural pasiva (0.5).
Explique en qu consiste la inmunidad artificial pasiva y cundo debe utilizarse
(1).

La alergia o hipersensibilidad se produce cuando un antgeno, normalmente


inocuo, da lugar a una reaccin inmunolgica que puede llegar a tener
graves consecuencias para el organismo.
a) Explique qu es un alrgeno y mencione un ejemplo (0.5).
b) Nombre una molcula responsable de los sntomas de la alergia o mediador
alrgico (0.5).
c) Explique en qu consiste y que consecuencias puede tener el shock anafilctico

64

(0.5).
d) Cite dos medidas para reducir los sntomas que se manifiestan en la alergia (0.5).

a)
b)
c)

Respecto a la respuesta inmune:


Defina el concepto de antgeno (0.5)
Defina el concepto de anticuerpo (0.5).
Mencione el tipo de clulas sanguneas que se encargan de la produccin de
anticuerpos y el tipo celular del que se diferencian (0.5).
d) Nombre el tipo de enfermedades originadas al producirse anticuerpos contra
estructuras del propio organismo. Ponga un ejemplo de este tipo de
enfermedades (0.5).

a)
b)
c)

En relacin con la respuesta inmune:


Qu son las vacunas y con qu fin se utilizan?(0.5)
En qu casos deben utilizarse las vacunas? (0.5).
Describa cuatro tipos de antgenos utilizados en la obtencin de las vacunas (1).

Como parte importante de las defensas del organismo se encuentra la


respuesta inmunitaria.
a) Definela. (1)
b) Cite las clulas que intervienen en ella y la funcin de cada una de ella. (1)
Entre las alteraciones patolgicas del sistema inmunitario se encuentran las
enfermedades autoinmunes.
a) Explique en qu consisten y su mecanismo etiopatolgico (mecanismo de
produccin), aludiendo a los conceptos de autoantgeno y tolerancia
inmunolgica. (1.5)
b) Cite dos ejemplos de enfermedades autoinmunes. (0.5)
Relacione entre s mediante un trazo los trminos de las dos columnas (2)
Linfocitos B
Anticuerpos
Inmunidad celular
Linfocitos T
Inmunidad artificial pasiva
Inmunidad humoral
Gammaglobulina
Inmunidad artificial activa
Vacunas
Sueros

a)
b)
c)

Con respecto al trasplante de rganos:


defina los conceptos de xenotrasplante e isotrasplante (0.5)
explique brevemente el concepto y las causas del rechazo inmunolgico (1)
explique brevemente las medidas utilizadas en la prevencin del rechazo
inmunolgico (0.5)

Los trasplantes son procedimientos quirrgicos tiles en casos de


insuficiencias irreversibles de rganos y sistemas.
a) Indique cual es el mayor problema que se puede presentar con posterioridad a la
ejecucin de un trasplante, qu molculas son las desencadenantes del mismo y
cules son las clulas que primero actan. Cite el tipo de frmacos que se
utilizan para evitarlo (1).
b) Cite y defina cuatro tipos de trasplantes segn el origen del rgano o tejido
trasplantado (1)
Referido a la respuesta inmune, explique brevemente los siguientes
conceptos:
a) respuesta inmune (0.5)
b) inmunidad humoral (0.75)
65

c) inmunidad celular (0.75)


Referido a la respuesta inmune:
a) Diga qu es una inmunodeficiencia y mencione cuntos tipos hay (0.5)
b) Explique en qu consiste la inmunizacin pasiva y diga una ventaja y un
inconveniente de la misma (1)
c) Define enfermedad autoinmune y diga un ejemplo (0.5)
Referente a la respuesta inmune:
a) Relacione los siguientes conceptos con cada tipo de respuesta inmune: linfocitos
B, anticuerpos, clulas diana, respuesta inmune celular, linfocitos T, respuesta
inmune humoral. (0.5)
b) Explique las diferencias entre la inmunidad natural activa y la pasiva. (1)
c) Qu son las enfermedades autoinmunes?. (0.5)
Entre los procesos con que cuenta el sistema inmune para la defensa del
organismo, se encuentra la inmunidad celular.
a) defina inmunidad celular y cite sus diferencias con respecto a la inmunidad
humoral. (0.75)
b) cite la clula responsable de la inmunidad celular y sus dos tipos principales.
(0,5)
c) cite la funcin de los TH (cooperadores), de los TC (citotxicos) y de los TS
(supresores). (0.75)
En relacin con las clulas implicadas en el proceso inmunolgico:
a) indique el lugar de maduracin de los linfocitos T y cite el tipo de inmunidad en
la que intervienen. (0.5)
b) cite tres tipos de linfocitos T y explique sus funciones respectivas. (1.5)

a)
b)
c)

Los anticuerpos intervienen en la defensa inmune:


explique su naturaleza qumica y cite dos tipos. (0.75)
cite la clula productora y el tipo de inmunidad en el que interviene. (0.5)
dibuje el esquema de n anticuerpo y seale sus componentes marcando la zona
donde se une al antgeno. (0.75)

La activacin de la defensa especfica es un proceso fundamental en la


respuesta inmune:
a) defina defensa especfica. (0.5)
b) cite la clula responsable de la inmunidad humoral, en que otra clula se
diferencia y la funcin de esta ltima.(0.75)
c) describa qu tipo de molcula es un anticuerpo y dibuje un esquema rotulado del
mismo, indicando donde se produce la unin al antgeno. (0.75)
En el sistema defensivo del organismo existen clulas fagocticas.
a) Cite dos de estas clulas e indique a qu tipo de defensa pertenecen (0.75)
b) Explique el mecanismo de la fagocitosis y sus etapas (1,25)
El sistema inmunitario de un individuo es capaz de generar inmunidad
contra antgenos determinados:
a) Defina inmunidad artificial, cite otra denominacin con la que se conozca este
proceso, e indique sus tipos. (1)
b) Explique en qu consiste cada uno de los tipos indicados en la respuesta anterior.(1)

El dibujo adjunto representa el esquema bsico de una molcula


relacionada con la inmunidad:
66

a) Indique de que molcula se trata y la clula responsable de su produccin


(0.5)
b) Copie el esquema, compltelo aadiendo lo que falta y rotule sus
componentes (1)
c) Cite los tipos de respuesta inmunitaria e indique en cul de ellos interviene
la molcula adjunta (0.5)
La clula plasmtica es una diferenciacin del linfocito B cuya nica
funcin es la produccin de anticuerpos y su liberacin al espacio
extracelular.
a) Teniendo en cuenta lo anterior, deduzca su ultraestructura comentando sus orgnulos
celulares predominantes y razonando la respuesta (1).
b) Indique qu clase de molculas son los anticuerpos y cite sus tipos (0,5).
c) Dibuje un esquema de la estructura de un anticuerpo indicando sus diferentes partes
(0,5).

El macrfago es una clula perteneciente al sistema inmunitario y al tejido


conjuntivo que se caracteriza por llevar a cabo, como una de sus funciones
principales, la fagocitosis.
a) Basndose en lo anterior, deduzca qu orgnulo predominar en su citoplasma y
explique su estructura, composicin y funcin (1).
b) El orgnulo aludido en el apartado anterior puede presentar distintos tipos. Explique
la estructura, composicin y funcin de cada uno de ellos (1).

Las inmunodeficiencias son trastornos importantes del sistema inmunitario


de una persona:
a) Defina brevemente el concepto de inmunodeficiencia congnita. (0.5)
b) El SIDA es una enfermedad que produce inmunodeficiencia de qu tipo?, cul es el
agente causante?. (0.5)
c) Cules son las vas de transmisin del virus del SIDA?. (0.5)
d) Qu se entiende por individuo seropositivo?. (0.5)

Con relacin a la respuesta inmune:


Defina el trmino fagocitosis. (0.5)
Qu tipos de glbulos blancos realizan la fagocitosis?. (0.5)
Por qu los fagocitos son un tipo de defensa inespecfica?. Razone la respuesta.
(0.5)
d) Qu estructuras corporales actan como reservorio de estos glbulos blancos?.
Indique el lugar dnde se originan los fagocitos. (0.5)

a)
b)
c)

Las principales molculas que actan en la inmunidad son los anticuerpos.


a) Indique qu tipo de molculas son los anticuerpos y explique
su composicin. (0.5)
b) Cite la molcula que los produce, de dnde proviene sta y las
clases de anticuerpos. (1)
c) Identifique el anticuerpo que est representado a la izquierda
y explique la razn de su identificacin. (0.5)

67

En los pases desarrollados, entre el 15% y 20% de la poblacin puede tener


alterada la respuesta de su sistema inmunitario.
a) Explique el concepto de hipersensibilidad y alrgeno, y cite un ejemplo de alrgeno.
(1)
b) Indique qu tipo de agente patgeno es el VIH, qu enfermedad provoca y cite dos de
los principales mecanismos de transmisin de la misma.(1)

El siguiente esquema representa el mecanismo de defensa del sistema


inmunitario.
a) Indique los tipos de clulas y las
estructuras que aparecen sealadas
con los nmeros de 1 al 5. (1)
b) Cite en qu rgano maduran las
estructuras sealadas con los nmeros
2 y 5. (0.5)
c) Indique dos diferencias entre las
estructuras sealadas con los nmeros
2 y 3. (0.5).

68