Question 1

What does RNA polymerase do when it meets a terminator?

It stops transcribing the DNA.
It continues translating the RNA.
It binds a special tRNA.
It continues transcribing the DNA.
It stops translating the RNA.

Question 2
This is a two-part question. In Part 1 (this question) you will choose the one boldface word or
term in this statement that makes the statement incorrect. In Part 2 (the next question) you
will choose one word to replace the word you have removed, to make the statement correct.
Consider the following incorrect statement. Which ONE word makes the statement incorrect?
RNA polymerase initiates replication when it encounters a promoter on the DNA strand.
RNA polymerase
replication
promoter
DNA strand

Question 3
This is a two-part question. In Part 1 (the previous question) you chose the one boldface word
or term in this statement that makes the statement incorrect. In Part 2 (this question) you will
choose one word to replace the word you have removed, to make the statement correct.
Consider the following incorrect statement. Which replacement word will make the statement
correct?
RNA polymerase initiates replication when it encounters a promoter on the DNA strand.
DNA polymerase
the ribosome

transcription
translation
start codon
stop codon
terminator
mRNA
protein

Question 4
Do the red bases in the image below represent a mismatched base pair or a SNV?

ACGTTAGGACCAATATCTAGAATG
|||||||||||||||||||||||
TGCAATCCTGTTTATAGATCTTAC
Mismatch
SNV
Either is possible; more information is needed.
Neither is possible.

Question 5
Make the following statement more precise by replacing the word 'gene' with either 'locus' or
'allele'
I have the gene for 'wet' earwax' but my brother has the gene for 'dry' earwax.
locus
allele

Question 6
Make the following statement more precise by replacing the word 'gene' with either 'locus' or
'allele'
The first fruitfly mutation discovered was in the 'white' gene.

locus
allele

Question 7
Make the following statement more precise by replacing the word 'gene' with either 'locus' or
'allele'
This E. coli strain has a different lacZ gene than the wildtype strain.
locus
allele

Question 8
For a diploid species as a whole, which of the following statements are true?
Choose all correct answers.

Each gene has two alleles.

Each gene has many codons.
Each gene has one promoter.
Each allele has three codons.
Each gamete has one allele of each gene.
Each gene has one locus.

Question 9
The two DNA strands of a chromosome remain together because of:
(Choose all that apply.)
base pairing
the telomeres
DNA polymerase
ribosomes
covalent bonds

Question 10

If a 30 base pair piece of double stranded DNA contains 18 A bases, how many G bases are
contained by one of the single strands of this molecule?
Hint: a drawing might help you work this out
12
24
36
42
not enough info

Question 11
In the past, people of different races were thought to be fundamentally different. What new
genetic information changes this view?
(Choose all that apply, but remember that a true statement isn't necessarily a correct answer to
the question.)
All people have 99.9% of our DNA sequences in common.
People's genomes differ at many positions.
People of different races have mostly different kinds of alleles.
Almost all the genetic differences between people of different races are also seen
between people of the same race.
None of the choices are correct.

Question 12
Which of the following does not describe a polymorphism?
(Choose all correct answers)

The frequency of the allele causing the M blood type is about 91%.
About 1 in 1,000,000 people of Asian descent have the allele causing Huntingtons
disease.
One variant of the hemoglobin allele occurs in 30% of Greeks but only 4% of Southeast
Asians.

Question 13

Which of the following are homologous?

Choose all correct answers.

Your chromosome 6 and Charles Darwins chromosome 6.

Your hand and your cats paw.
A bumblebees wings and a hummingbirds wings.
A tigers stripes and your cat's stripes.
Your hemoglobin gene and a chickens hemoglobin gene.
In accordance with the Coursera Honor Code, I (Hitesh Trivedi) certify that the answers
here are my own work.
You cannot submit your work until you agree to the Honor Code. Thanks!