Anda di halaman 1dari 1

PF

Secara fisik, terjadi demam yang cukup tinggi, diikuti dengan lemas, diare, dan artralgia.
Lepuhan di mulut berukuran 2-3 mm yang segera pecah dan membentuk ulkus yang
dirasakan sangat perih terutama saat makan/minum. Jumlah ulkus di mulut mencapai 5-10
yang tersebar di daerah bukal, palatal, gusi, dan lidah. Ulkus di lidah paling lama sembuh.
Lepuhan atau vesikel di kaki dan tangan dijumpai pada 2/3 penderita, yang terutama tumbuh
di bagian dorsal dan sisi-sisi jari serta telapak tangan. Lepuhan/vesikel yang dikenal dalam
istilah kedokteran sebagai erythema multiforma (7,12,13,14) ini secara khas berbentuk bulat
atau elips yang akan mengering sendiri selama 3-7 hari.
Permasalahan utama pada anak-anak dan balita adalah kesulitan untuk makan dan minum
yang dengan beberapa bentuk komplikasi seperti mual, muntah, dan diare akibat ulkus di
saluran pencernaan, serta demam panas, dapat menyebabkan dehidrasi. Di samping itu
kemungkinan terjadinya superinfeksi oleh mikroba lain dapat memperparah penyakit dan
menyebabkan berbagai komplikasi.
PP
Sampel (spesimen) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab
ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak. Spesimen dibawa
dengan Hanks Virus Transport. Isolasi virus dengan cara biakan sel dengan suckling
mouse inoculation. Setelah dilakukan Tissue Culture, kemudian dapat diidentifikasi
strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi
untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi virus:
- Immuno histochemistry (in situ)
- Imunofluoresensi antibodi (indirek)
- Isolasi dan identifikasi virus.
Pada sel Vero RD L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA:
RT-PCR
Primer : 5 CTACTTTGGGTGTCCGTGTT 3
5 GGGAACTTCGATTACCATCC 3
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis:
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya)
pada sel Vero. Uji elisa sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat
mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
Graham, B.S., MD, Hand-Foot-and-Mouth Disease, e-Medicine.com
Departemen
of
Dermatology

http://tray.dermatology.uiowa.edu/Coxsack01.htm

Univ.

Iowa

College

of

Medicine,