Springer 2005

Plant Molecular Biology (2005) 57:805818

DOI 10.1007/s11103-005-2066-9

Dierential regulation of chlorophyll a oxygenase genes in rice

Sichul Lee1, Jin-Hong Kim2, Eun Sang Yoo2, Choon-Hwan Lee2, Hirohiko Hirochika3
and Gynheung An1,*
1

National Research Laboratory of Plant Functional Genomics, Division of Molecular and Life Sciences,
Pohang University of Science and Technology (POSTECH), Pohang 790-784, Korea (*author for correspondence; e-mail genean@postech.ac.kr); 2Department of Molecular Biology, Pusan National University,
Keumjung-ku, Pusan 609-735, Korea; 3Department of Molecular Genetics, National Institute of Agrobiological Sciences, Kannondai 2-1-2, Tsukuba, Ibaraki 305-8602, Japan
Received 28 October 2004; accepted in revised form 9 February 2005

Key words: chlorophyll a oxygenase, DNA pool, T-DNA

Abstract
Chlorophyll b is synthesized from chlorophyll a by chlorophyll a oxygenase. We have identied two genes
(OsCAO1 and OsCAO2) from the rice genome that are highly homologous to previously studied chlorophyll
a oxygenase (CAO) genes. They are positioned in tandem, probably resulting from recent gene duplications.
The proteins they encode contain two conserved functional motifs the Rieske Fesulfur coordinating
center and a non-heme mononuclear Fe-binding site. OsCAO1 is induced by light and is preferentially
expressed in photosynthetic tissues. Its mRNA level decreases when plants are grown in the dark. In
contrast, OsCAO2 mRNA levels are higher under dark conditions, and its expression is down-regulated by
exposure to light. To elucidate the physiological function of the CAO genes, we have isolated knockout
mutant lines tagged by T-DNA or Tos17. Mutant plants containing a T-DNA insertion in the rst intron of
the OsCAO1 gene have pale green leaves, indicating chlorophyll b deciency. We have also isolated a pale
green mutant with a Tos17 insertion in that OsCAO1 gene. In contrast, OsCAO2 knockout mutant leaves
do not dier signicantly from the wild type. These results suggest that OsCAO1 plays a major role in
chlorophyll b biosynthesis, and that OsCAO2 may function in the dark.
Abbreviations: CAO, chlorophyll a oxygenase; GUS, a-glucuronidase; RT-PCR, reverse transcription PCR;
T-DNA, transferred DNA

Introduction
Chlorophyll plays a central role in photosynthesis
by harvesting light energy and converting it to
chemical energy. Land plants, green algae, and
protochlorophytes possess chlorophyll a and
chlorophyll b. The former is a component of both
the photosynthetic reaction centers and the lightharvesting antennae, whereas chlorophyll b is
restricted to the antenna complexes (Oster et al.,
2000). Those complexes show controlled changes
in adapting to various growing conditions,

enabling optimal utilization of available light

(Tanaka et al., 1998). For example, under high
light intensities, plants have smaller antennae; lowlight conditions, e.g., shady habitats, promote
larger antenna sizes.
Chlorophylls a and b have identical structures
except for the side chain at C-7, which is a methyl
group in chlorophyll a and a formyl group in
chlorophyll b. Their absorption spectra also dier.
Tanaka et al. (1998) have isolated six chlorophyll
b-less mutants of Chlamydomonas reinhardtii and
have shown that all possess a deletion in an

806
overlapping region of the nuclear genome, which
encodes a protein whose sequence is similar to
those of methyl monooxygenases. This chlorophyll
a oxygenase (CAO) protein contains consensus
sequences for a [2Fe2S] Rieske center and for
mononuclear iron binding sites. Espineda et al.
(1999) have used the conserved motif from CAO
sequences to isolate an Arabidopsis gene that
encodes the AtCAO protein. There, two chlorina1
alleles exhibit mutations in the AtCAO gene, providing genetic evidence that the AtCAO gene
co-segregates with the mutations. Furthermore,
AtCAO mRNA levels decrease in plants grown
under dim light. Mutations in the CAO gene result
in the complete loss of chlorophyll b, indicating
that Arabidopsis contains no redundant genes or
biochemical pathways. This same situation has
been reported from mutagenesis experiments in
C. reinhardtii (Tanaka et al., 1998).
A full-length CAO gene has been isolated from
Arabidopsis; the recombinant enzyme produced in
Escherichia coli catalyzes the conversion of chlorophyll a to chlorophyll b by an unusual two-step
monooxygenase reaction (Oster et al., 2000).
Overexpression of the AtCAO gene, under the
control of the 35S cauliower mosaic virus promoter, increases the antenna size of Photosystem II
in Arabidopsis (Tanaka et al., 2001), suggesting that
chlorophyll b biosynthesis controls that phenomenon. Therefore, based on those results, crop productivity may possibly be improved by modifying
the photosynthetic apparatus in higher plants.
High sequence homology in CAO occurs in
organisms as distant as Prochlorophyta and higher
plants (Rudiger, 2002). Comparisons of the
deduced amino-acid sequences of Chlamydomonas
and Arabidopsis CAOs have elucidated a highly
conserved region of about 300 amino-acid residues, an area that includes the [2Fe2S] Rieske
center and a mononuclear iron motif. In contrast,
the amino- and carboxy-terminal regions show low
similarity. Tomitani et al. (1999) have isolated
CAO genes and cDNAs from Prochlorothrix hollandica, Prochloron didemni (Prochlorophyta),
Dunaliella salina (Chlorophyceae), Marchantia
polymorpha (Bryophyta), and Oryza sativa (Angiospermae). Phylogenetic analyses have indicated
that these species share a common evolutionary
origin and that progenitors of oxygenic photosynthetic bacteria, including chloroplast ancestors,
had both chlorophyll b and phycobilins.

Sequencing of the rice genome has been nearly

completed (Go et al., 2002; Yu et al., 2002) and
functional analysis of those genes is now one of the
most important goals. The evaluation of mutants is
a valuable tool for revealing the role of a particular
plant gene in physiological and developmental
processes. Insertional mutant populations, gained
via transposons or T-DNA, have been generated in
rice (Chin et al., 1999; Jeon et al., 2000; Jeong
et al., 2002; Miayo et al., 2003; Kolesnik et al.,
2004) as part of ongoing studies of gene functioning (Takano et al., 2001; Jung et al., 2003; Tanaka
et al., 2003; Lee et al., 2004; Nonomura et al.,
2004). For reverse genetic screening of insertionalmutant lines, anking sequence database of insertion sites have been established (An et al., 2003;
Miayo et al., 2003). In addition, insertional mutants have been identied by PCR screening of
mutant DNA pools (Lee et al., 2003).
In this study, we identied T-DNA insertions in
rice genes that are highly homologous to CAO
genes in other plant species. Using mutant lines,
we assessed the functional roles of those rice CAO
genes.

Materials and methods

Sequence analysis
A Blast search program (http://www.tigr.org/tdb/
e2k1/osa1) in the TIGR rice database was utilized
for identifying the genes containing the conserved
Rieske domain. The genomic sequences were
annotated via the genome automated annotation
system (http://ricegaas.dna.arc.go.jp/) and the rice
full-length cDNA database (http://cdna01.dna.affrc.go.jp/cDNA/). Finally, a phylogenetic tree was
generated with Clustal W (http://www.ddbj.nig.ac.jp/E-mail/clustalw-e.html) and MEGA version
2.1 (http://www.megasoftware.net). TIGR locus
numbers used for the phylogenetic analysis included: rice CAO1, Os10g41780; rice CAO2,
Os10g41760; rice TIC55 (55-kD Rieske [2Fe2S]
Fesulfur protein putatively associated with transport through inner chloroplast membrane) homolog, Os10g41780; rice LLS1 (lethal leaf-spot1)
homolog, Os03g05310; rice LLS1-like genes,
Os03g59100, Os03g59110, and 9532.m00146.
Accession numbers for Arabidopsis sequences are:
AtCAO (AAD54323), AtCMO (T08550), AtTic55

807
(AC006585), AtACD1 (AL391254), and AtLLS1like (AL050400).
Isolation of OsCAO1 and OsCAO2 mutants
T-DNA tagged rice plants (Oryza sativa var.
japonica) were generated by the Agrobacteriummediated co-cultivation method (Jeon et al., 2000;
Jeong et al., 2002). T-DNA anking sequences
were determined as previously described (An et al.,
2003; Ryu et al., 2004). Thirty T2 plants were
grown for further analysis. PCR-based screening
was conducted to isolate the OsCAO1 and OsCAO2
mutants from DNA pools according to the method
of Lee et al. (2003). Primers for T-DNA and Tos17
have been reported previously (Takano et al., 2001;
Lee et al., 2003), and the gene-specic primers for
OsCAO1 and OsCAO2 are listed in Table 1.

0.2 lM of gene-specic primers, 10 mM dNTPs,

and 1 unit of rTaq DNA polymerase (TakaRa
Shuzo, Shiga, Japan). Tissue samples included
calli, shoots, and panicles. The gene-specic
primers for OsCAO1, OsCAO2, OsCab1, and
OsAct1 are listed in Table 1. PCR products were
separated by electrophoresis on a 1.2% agarose
gel.
DNA gel-blot analysis

Surface-sterilized seeds were germinated on a

Murashige and Skoog (MS) medium comprising
3% sucrose, 0.2% phytagel, and 0.55 mM myoinositol (Sigma, St. Louis, MO, USA). Seedlings
were grown for various time periods at 27 C
under continuous light or darkness. To test the
eect of irradiation, we exposed 4-day-old darkgrown seedlings to red, far-red, blue, or white light
for 4 h. After each treatment, leaf tissues were
frozen in liquid nitrogen.

Genomic DNA was extracted from leaves of the

23 weeks-old seedlings according to the procedure of Chen and Ronald (1999), except that the
samples were extracted with the MM300 Mixer
Mill (Retsch, Haan, Germany). Eight micrograms
of genomic DNA was digested with appropriate
restriction enzymes, separated on a 0.8% agarose
gel, blotted onto a Hybond N+ membrane
(Amersham, Buckinghampshire, UK), and
hybridized with a 32P-labeled probe by the random
priming method (Sambrook et al., 1988). Two
gene specic probes were prepared by PCR. For
the rst probe, the 800-bp fragment of the 3
region of the gene was amplied using the forward
primer (5-tatcgtccattccctcgtta-3) and the reverse
primer (5-atttgaccggtttgatgtgt-3). For the second
probe, the 750-bp fragment containing the conserved Rieske [2Fe2S] binding site was amplied
using the forward (5-gaagttcttcagactgggattg-3)
and reverse (5-ccactggtagctccatcactat-3) primers.

RT-PCR analysis

Pigment analysis

Total RNA was isolated with an RNA isolation

kit (Tri Reagent, MRC). For the cDNA synthesis,
we used 2 lg of total RNA and M-MLV reverse
transcriptase (Promega) in a 25-ll reaction mixture. RT-PCR was performed in a 50-ll solution
containing a 1-ll aliquot of the cDNA reaction,

Photosynthetic pigments were analyzed according

to the technique of Gilmore and Yamamoto
(1991). Leaf segments from 60-day-old plants were
frozen in liquid nitrogen and ground with a mortar
and pestle. Their pigments were then extracted by
gently agitating the leaf powder in ice-cold 100%

Seedling growth and light treatments

Table 1. Nucleotide sequences of the primers used in this study.

Gene

Forward primer (5-3)

Reverse primer (5-3)

Remarks

OsCAO1

tcaaccattggcatctcaaa
tacagatcatgggattcaaaattggac
agataatccctacagtaatg
gttcttctaaaggctcggaactgacat
ggagctcaaggtgaagaaga
gtatccatgagactacatacaact

cgtgatgctgtcgctagtgt
ttacccactgctcctcaaaacaatcta
tgatgacgttcttgaagcaa
aagaacttcaccaagctgacaaagatg
gggatcgagggagtatttgt
tactcagccttggcaatccaca

RT-PCR
DNA pool screening
RT-PCR
DNA pool screening
RT-PCR
RT-PCR

OsCAO2
OsCab1
OsAct1

808
acetone for 1 h. To minimize pigment degradation,
the extraction was performed in darkness at 4 C.
Cell debris was removed twice by centrifuging at
4 C for 10 min at 14,000 rpm (Micro 17R; Hanil,
Korea). The extracts were ltered through a
0.2-lM syringe lter. Pigment separation was
performed in an HPLC system (HP 1100 Series;
Hewlett Packard, Waldbronn, Germany) on a
Spherisorb ODS-1 column (Alltech, USA), as
described by Gilmore and Yamamoto (1991).
Concentrations of the pigments were estimated by
using the conversion factors for peak area (in
nanomoles) that had been calculated for this solvent mixture (Gilmore and Yamamoto, 1991).
Analysis of chlorophyll uorescence
The maximum photochemical eciency of PSII
was expressed as the ratio of variable uorescence
(Fv) to the maximum yield of uorescence (Fm),
according to the method of Genty et al. (1989). Fv
was obtained by subtracting the initial chlorophyll
uorescence (Fo) from Fm. After the samples were
dark-adapted for 10 min at room temperature
(RT), readings were taken using a portable uorometer (Plant Eciency Analyzer; Hansatech
Instrument, Norfolk, UK).
Chlorophyll uorescence quenching was monitored with a pulse-amplitude modulated uorometer
(PAM-2000;
Walz,
Germany).
The
photochemical quenching (qP) and non-photochemical quenching (NPQ) parameters were calculated with equations described by van Kooten and
Snel (1990). Namely, qP (Fm ) Ft)/(Fm ) Fo),
and NPQ (Fm ) Fm)/ Fm, where Fo was
measured after switching o the actinic light and

simultaneously applying 3 s of far-red light

(735 nm); Fm was dened as the Fm value for
leaves light-acclimated for 10 min. Ft was the steady-state uorescence level under continuous actinic
illumination. In this experiment, all chlorophyll
uorescence parameters were measured at RT. Fm
was measured after 10 min dark-adaptation.
Fluorescence emission spectra
Low-temperature (77 K) emission spectra were
recorded from leaf segments using a uorescence
spectrophotometer (F-4500; Hitachi, Japan) and a
custom-made apparatus. All spectra were obtained
after excitation at 440 nm and presented without
correction for the spectral sensitivity of the photomultiplier.

Result
Identication of two rice genes, OsCAO1
and OsCAO2, which are highly homologous
to CAO genes from other plant species
From the TIGR rice database we have identied
two genes that are highly homologous to the CAO
gene of Arabidopsis. These genes contain two
conserved motifs the Rieske Fe-sulfur coordinating center and a non-heme mononuclear
Febinding site (Espineda et al., 1999). They are
designated as OsCAO1 (Accession number:
AK100517) and OsCAO2 (Accession number:
AK063367). OsCAO1 and OsCAO2 have nine
exons and eight introns (Figure 1), and encode
proteins of 541 and 542 amino acids, respectively.

Figure 1. Schematic diagrams of the rice CAO genes and insertion positions of T-DNA and Tos17. The nine exons are shaded and
eight introns are indicated with open boxes. In Line 1C-039-43, T-DNA is inserted into the rst intron of OsCAO1. One Tos17
insertion in OsCAO1 and four Tos17 insertions in OsCAO2 are indicated by vertical arrows labeled with names of the mutant lines.
Horizontal arrows indicate the primers (a to j, and RB) used for genotyping of T2 progeny.

809
The genes are located in tandem in the BAC clone
OSJNBa0057L21 on Chromosome 10, evidence of
recent gene duplication. Examination of the amino
acid sequences of these proteins has revealed high
(82%) overall amino acid identity between the
two. Compared with AtCAO, the OsCAO1 protein has 70% identity and the OsCAO2 protein has
67% identity. Expressed sequence tags are present
in cDNA libraries prepared from green calli,
shoots, and panicles, indicating that both are
functional genes.
Dierential expression patterns of OsCAO1
and OsCAO2
We studied expression patterns of the CAO genes
by RT-PCR (Figure 2). During vegetative growth,
OsCAO1 was expressed strongly in shoots and
leaves (Figure 2A). During the reproductive
development stages, its expression level was higher
in mature than in immature panicles. In contrast,
expression of OsCAO2 was stronger in non-pho-

tosynthetic tissues, and levels decreased as panicles

developed. When seedlings were grown under
continuous light, they accumulated higher levels of
OsCAO1 transcript than were measured in darkgrown plants (Figure 2B). However, OsCAO2
transcript levels were higher in the latter type of
seedlings.
To further study the eect of illumination, we
transferred dark-grown seedlings to light conditions and measured expression for the CAO genes.
Within the rst half hour after transfer, OsCAO1
transcript levels started to increase rapidly,
reaching a maximum level in 2 h (Figure 3A). The
induction kinetics was quite similar to that for
OsCab1 transcript. In contrast, the level of
OsCAO2 transcript rapidly decreased after the
transfer. In contrast, when light-grown plants were
transferred to dark conditions, OsCAO1 transcript
levels decreased while those of OsCAO2 increased
(Figure 3B). However, the rates were much slower
than those observed after the dark-to-light transfer. These results suggest dierent functions, i.e.,

Figure 2. Expression proles of OsCAO1 and OsCAO2. (A) PCR was performed with cDNA prepared from various vegetative and
reproductive organs: 1, calli; 2 and 3, shoots and roots of 7-day-old seedlings; 4, 5, and 6, leaves, stems and roots from 30-day-old
plants; 7, fully expanded mature leaves at the owering stage; 8, panicles <5 cm long; 9, panicles between 10 and 20 cm; 10, panicles
between 20 and 30 cm; 11, immature seeds 2 to 5 d after pollination. Rice actin1 OsAct1 transcript was amplied as control. (B)
Expression levels of OsCAO1 and OsCAO2 in seedlings 4, 5, and 6 d after germination; DAG grown under continuous light L or
darkness D.

810

Figure 3. Eect of light on OsCAO1 and OsCAO2. (A) Expression levels after etiolated 4 DAG seedlings were exposed to illumination.
(B) Expression patterns of 4 DAG light-grown seedlings after transfer to dark conditions. (C) Circadian regulation of OsCAO1 and
OsCAO2. Plants were grown in greenhouse 14 h/10 h light/dark, and then transferred to continuous darkness. Flag leaves of two or
three plants were harvested for RNA extraction. (D) Analysis of OsCAO1 and OsCAO2 under dierent light conditions. Expression
levels were determined in 4-day-old dark-grown wild-type seedlings after exposure to various light sources. D, darkness; Fr, far-red
light; R, red light; B, blue light; W, white light.

OsCAO1 playing an important role in green tissues

grown under light but OsCAO2 functioning in
non-photosynthetic tissues.
Because the expression pattern of OsCAO1 was
light-dependent, we examined whether its transcript
level followed a circadian rhythm. Plants were
placed in a growth chamber under a 14 h/10 h light/
dark cycle (Figure 3C). OsCab1 was used as a
control because its expression is under circadian
regulation (Sugiyama et al., 2000). Transcript levels

of OsCAO1 were higher during the daytime, but

much lower in the late afternoon and at night. This
expression pattern was similar to that of OsCab1,
although the dierences between day and night
were smaller for the former. During the nighttime,
OsCAO1 transcript levels were high whereas those
of OsCab1 were quite low. In addition, the change
in expression for OsCAO1 was gradual, reaching a
maximum level at 2 PM; its accumulation began in
the dark. However, OsCab1 transcript levels

811
uctuated rapidly, with accumulation occurring
only during the daytime. In contrast, OsCAO2
expression increased after dusk, then rapidly decreased in the morning after the dark phase ended.
This pattern of expression was maintained even
after the plants were transferred to continuous
darkness, suggesting that both OsCAO genes are
regulated by the circadian clock.
Finally, we examined the eect of red light, farred light, and blue light on CAO gene expression in
4-day-old etiolated seedlings. There, OsCAO1 was
inducible by all light treatments (Figure 3D), but
most signicantly under blue light. Interestingly,
expression of the OsCAO2 gene was suppressed by
that same blue light.
GUS expression pattern in transgenic Line
1C-039-43
We have previously reported the generation of
insertional mutant lines with T-DNA, in which the
promoterless GUS gene is present immediately
next to the right border (Jeon et al., 2000; Jeong
et al., 2002). Therefore, insertion of T-DNA in the
proper orientation within a gene can result in gene
fusion between the plant gene and the reporter
gene. In the current study, we identied Line
1C-039-43, in which T-DNA insertion occurred in
the rst intron of OsCAO1; the direction of the gus
reporter gene was the same. Analysis of that line
revealed GUS-positive homozygous and heterozygous plants but GUS-negative wild types,
thereby demonstrating that GUS expression and
T-DNA co-segregate.
GUS activity was observed in the protruding
embryo when the seed began to germinate
(Figure 4A, light conditions). This activity was
most prominent in the coleoptiles and leaf blades
of young seedlings. Shoot cross-sections at 5 DAG
(days after germination) showed that GUS activity
was conned to the mesophyll cells. Dark-grown
seedlings manifested a similar expression pattern,
albeit at much lower transcript levels (Figure 5A,
dark conditions). When 4-day-old etiolated seedlings were transferred to the light, GUS activity
rapidly increased in the shoots (Figure 4B). Conversely, transferring light-grown seedlings to
darkness reduced that activity. These results are
similar to those obtained from RT-PCR with the
OsCAO1 gene. Moreover, GUS activity was
strongly induced by blue light (Figure 4C), again

consistent with the RT-PCR results. It is known

that chlorophyll b absorbs light eectively in the
453-nm wavelength, i.e., blue light.

Identication of insertional mutations in OsCAO1

and OsCAO2
In Line 1C-039-43, T-DNA was present in the rst
intron of OsCAO1 (Figure 1). Genotyping our 30
T2 progeny resulted in the isolation of 4 homozygous, 17 heterozygous, and 9 wild-type segregating plants (Figure 5A). RT-PCR analysis
showed that OsCAO1 expression was disrupted in
homozygous plants #7, #12, #18 and #27
(Figure 5E), where the manifested phenotype was
one of pale green leaves and retarded growth
(Figure 6). In addition, those particular plants
produced fewer tillers, usually 35 compared with
1315 in the wild types.
To conrm that the phenotypic alterations
observed in Line 1C-039-43 were caused by a
mutation in OsCAO1, we used PCR-based screening of DNA pools (Lee et al., 2003) to search for
another allele from the T-DNA tagged population.
PCR with OsCAO1-specic primers and T-DNA
specic primers failed to identify an additional TDNA insertional allele. Because an average of four
new copies of Tos17 can be generated in T-DNA
insertional plants during the transformation procedure (Jeon and An, 2001), we screened for a Tos17
insertion in the OsCAO1 gene using Tos17-specic
primers and gene-specic primers. As a result, we
identied Line 1B-044-10, in which the Tos17 was
inserted into the fourth exon of OsCAO1 (Figure 1).
In genotyping its T2 progeny (Figure 5B), we isolated three homozygous plants, all of which showed
the phenotype of pale green leaves, stunted growth,
and less tillering. In contrast, the wild-type segregants and heterozygous plants displayed the normal
phenotype. This conrmed that insertional mutations in OsCAO1 resulted in abnormal phenotypes.
RT-PCR analysis showed that OsCAO1 expression
was disrupted in homozygous plants (Figure 6E).
Because disruption of OsCAO1 did not show
lethality, we tested whether another copies of the
gene exist in rice genome by DNA gel-blot analyses.
The results in Figure 7A show that the 3 region of
the CAO1 gene hybridized to a single genomic
region, indicating that CAO1 is unique. However, at
least three regions were hybridized with the probe

812

Figure 4. OsCAO1 gene expression patterns under light or dark conditions. (A) GUS activity in T3 homozygous seedling plants grown
under either continuous light L or dark D for 1 to 5 DAG. (B) GUS activity during 6 to 24 h illumination in 4-day-old etiolated
seedlings (upper), or 6 to 24 h after their transfer to dark conditions (lower). (C) GUS activity of T3 homozygous progeny from Line
1C-039-43 under various light conditions.

containing the conserved Rieske [2Fe2S] binding

site of CAO1 (Figure 7B). Database search revealed
at least seven genes that contain the Rieske [2Fe2S]
binding site. Among them, two genes (CAO1 and
CAO2) are highly homologous to the Arabidopsis
CAO gene (Figure 8).

Two insertional mutant alleles in the

OsCAO2 gene were isolated from the T-DNA
mutant population via PCR-based screening of
the DNA pools with Tos17-specic primers and
OsCAO2-specic primers. Line 1B-025-43 contained a Tos17 insertion in the fourth exon of

813

Figure 5. (A) Genotyping and GUS activity in progeny of Line 1C-039-43. Thirty plants were genotyped with primers a and b (upper), or
primers a and RB (lower). The 0.6-kb genomic DNA bands are PCR product using primers a and b, if no T-DNA insertion; 0.4-kb bands
are PCR products using primers a and RB, if T-DNA was inserted in rst intron. Lanes 2, 4, 8, 9, 13, 16, 22, 29, and 30 are wild-type W/W;
Lanes 1, 3, 5, 6, 10, 11, 14, 15, 17, 19, 20, 21 23, 24, 25, 26, and 28, heterozygous W/T; Lanes 7 , 12, 18 and 27, homozygous plants T/T. GUSpositive, +; GUS-negative, ). (B)(D) Genotyping of T2 progeny of Line 1B-044-10 (B), ND1064 (C) and 1B-025-43 (D). LTR2 is the 3
region-specic primer of Tos17. (E) RT-PCR analysis of OsCAO1 expression in progeny of Line 1C-039-43 and 1B-044-10. Note that in
homozygote progeny, expression of OsCAO1 disappeared. As an internal control, rice actin1 OsAct1 mRNA was also amplied. (F)
OsCAO2 expression in mutant lines. For Lines 1B-025-43 and ND1064, in which Tos17 was integrated in an exon, expression of OsCAO2
was disrupted, but for Lines 1A-078-34 and ND4036, in which Tos17 was integrated in an intron, expression of OsCAO2 was detected.

Figure 6. Phenotype comparisons between OsCAO1 KO and

WT plants at 30 DAG. T/T, homozygous mutant plant; W/W,
wild-type segregant from tagged line; W/T, heterozygous plant.

OsCAO2 whereas Line 1A-078-34 had a Tos17

insertion in the eighth intron (Figure 1). Using
the tagged end sequence database of the Tos17

insertional lines that were generated through

tissue culture (Miyao et al., 2003), we were able
to nd two additional alleles in Lines ND1064
and ND4036 that carried the Tos17 insertion in
the third exon and fourth intron, respectively.
Genotyping the T2 progeny of the Tos17 insertional lines identied both homozygous and
heterozygous plants as well as wild-type segregants (Figure 5C and D). RT-PCR analyses
showed that expression of the OsCAO2 gene was
below the detectable level in homozygous plants
from Lines 1B-025-43 and ND1064, where Tos17
was inserted into the exons (Figure 5F). However, in the lines where insertions occurred in the
introns, the OsCAO2 gene was expressed normally (Figure 5F). In homozygous Lines 1B-02543 and ND1064, in which expression of the
OsCAO2 gene was abolished, we did not observe
any obvious phenotypic alterations during the
vegetative and reproductive stages. This indicates
that OsCAO2 is dispensable for normal plant
growth.

814
tained 45% less chlorophyll a and no chlorophyll b. The mutant plants also had less
neoxanthin, lutein, and violaxanthin. This result is
consistent with the reduced level of neoxanthin
reported for chlorina 3613, the barley chlorophyll
b decient mutant (Hartel et al., 1996), thereby
suggesting a correlation between chlorophyll b and
the xanthophylls. Finally, the pigment composition in our OsCAO2 plants was similar to that of
the wild types.
Chlorophyll uorescence characteristics

Figure 7. DNA gel-blot analyses of CAO1. DNA was digested

with EcoRI (E), HindIII (H), PstI (P), or EcoRV (V), fractionated on a 0.8% agarose gel, and hybridized with a probe
prepared from the 800-bp fragment containing the 3 region of
OsCAO1 gene (A) or the Rieske [2Fe2S] binding site (B). The
PstI-digested lamda DNA size markers are indicated.

Maximal quantum yields of PSII, i.e., Fv/Fm,

were similar among the wild-type plants and the
OsCAO1 and OsCAO2 mutants (Table 3). This
indicates that the functioning eciencies for the
PSII reaction centers in those two mutants are
nearly equivalent. However, the OsCAO1 mutant
had 25% and 72% lower values for its qP and
NPQ parameters, respectively, compared with the
wild type. These dierences are possibly linked to
a strong reduction of light harvesting complex
(LHC) II and LHC I proteins, as has been demonstrated in research with the chlorina mutant
(Krol et al., 1995, 1999; Preiss and Thornber,
1995; Bossmann et al., 1997; Knoetzel et al.,
1998). Furthermore, Hartel et al. (1996) have
suggested that structural changes within the LHC
proteins, mediated by xanthophyll cycle operation,
determine the basis for the development of a major
portion of NPQ. In contrast to the performance of
OsCAO1 in our study, NPQ values were not
signicantly altered by OsCAO2.
77 K uorescence excitation spectra

Figure 8. Phylogeneic trees of the proteins containing the

conserved Rieske [2Fe2S] binding site from rice and Arabidopsis. Note that there are two genes related to the CAO clade in
rice, but only one in Arabidopsis.

Pigment analysis of OsCAO1 and OsCAO2

mutants
We used HPLC to measure pigment levels in the
CAO mutants and wild-type segregants (Table 2).
Compared with those of the wild-type plants, the
pale green leaves from the OsCAO1 mutant con-

We used low-temperature uorescence emission

spectroscopy to investigate emissions in the longwavelength region, which is believed to emanate
from PSI (Krause and Weis, 1991). Leaves from
wild-type plants and OsCAO2 mutants showed
maximal 77 K emission at 742 nm (Figure 9).
However, their spectra diered from that of the
OsCAO1 mutant, where the emission peak was
reduced and shifted from 742 to 725 nm. Similar
results have been reported with the chlorina
mutant clo-b125 (Bossmann et al., 1997; Knoetzel
et al., 1998). In these reports, the emission at
742 nm was attributed to one of LHC I antenna

815
Table 2. Pigment contents in mature leaves of wild-type, OsCAO1 and OsCAO2 plants.
Pigment

Fresh weight (lmol g)1)

OsCAO1-W/W

OsCAO1-T/T

OsCAO2-W/W

OsCAO2-T/T

Neoxanthin
Lutein
b-Carotene
Violaxanthin
Antheraxanthin
Chl a
Chl b

0.63
1.37
0.88
0.90
0.02
2.96
0.71

0.12
0.54
0.94
0.51
0.03
1.62
0

0.75
1.67
1.27
1.05
0.02
3.68
0.90

0.67
1.46
1.07
0.93
0.02
3.28
0.80

0.01
0.21
0.25
0.14
0.00
0.56
0.13

0.01
0.03
0.16
0.06
0.00
0.09

0.05
0.09
0.06
0.07
0.01
0.26
0.05

0.10
0.27
0.33
0.13
0.00
0.54
0.14

Pigments were separated from the leaves of 60-day old plants. All values are means SD of three experiments. OsCAO1-T/T,
OsCAO1 knockout plants; OsCAO1-W/W, wild-type segregants from the OsCAO1 knockout line; OsCAO2-T/T, OsCAO2 knockout
plants; OsCAO2-W/W, wild-type segregants from the OsCAO2 knockout line.

Table 3. Steady-state chlorophyll uorescence characteristics

of wild-type and two OsCAO plants.

Fv/Fm
qPa
NPQa

WT

OsCAO1-T/T

OsCAO2-T/T

0.823 0.009
0.856 0.092
1.499 0.030

0.835 0.009
0.644 0.021
0.426 0.018

0.810 0.005
0.702 0.006
1.615 0.192

a
qP and NPQ were calculated as described in Materials and
Methods section. All values are means SD of more than two
measurements.

Figure 9. Fluorescence emission spectra at 77 K for leaf segments from wild-type (WT), OsCAO1 and OsCAO2 plants.
Spectra were normalized to their 685-nm emission. Digits
indicate emission maxima.

proteins, Lhca4. Furthermore, the shift from 742

to 725 nm and the reduction of emission peak
could be correlated with a distinguishable Lhca
pattern showing trace amounts of Lhca1 and
Lhca4 and slightly reduced amounts of Lhca2 and
Lhca3.

Discussion
We have found two putative chlorophyll b synthase genes (OsCAO1 and OsCAO2) in the rice
genomic databases. Their high sequence similarity
and close genomic location suggest that they were
generated by recent duplications, as has been the
case with a large portion of the Arabidopsis genome (Blanc et al., 2000). In fact, systemic analysis
of the GATA family transcription factors in both
Arabidopsis and rice indicates that gene duplication and exon shuing occurred during the evolutionary process of the gene family (Reyes et al.,
2004).
Although OsCAO1 and OsCAO2 have high
sequence similarity, their expression patterns differ. Whereas the former is light-inducible, the latter accumulates under dark conditions and is
expressed mainly in non-photosynthetic tissues.
Nevertheless, expression levels of both OsCAO
genes in reciprocal knockout mutants do not
change. Our results suggest that OsCAO1 and
OsCAO2 function independently and are not
interchangeable despite their high sequence similarity. Such dierential expression of genes
involved in chlorophyll biosynthesis is apparently
not rare. For example, the light-dependent
NADPH-protochlorophyllide
oxidoreductase
(POR) genes, which encode proteins that catalyze
the photo-reduction of protochlorophyllide a to
chlorophyllide a in plastids, are dierentially
expressed (Oosawa et al., 2000). Moreover, three
structurally related POR genes (PORA, PORB,
PORC) exist in Arabidopsis thaliana. Beer and
Griths (1981), Armstrong et al. (1995), and

816
Oosawa et al. (2000) have reported that, in etiolated seedlings, PORC transcript gradually
increases upon illumination, but is undetectable in
the darkness. In contrast, PORA transcript levels
rapidly decrease under illumination, while PORB
expression remains constant during the light
treatment. In separate research, barley PORA
mRNA rapidly declines and soon disappears during the illumination of dark-grown seedlings
whereas PORB mRNA remains at an approximately constant level in both dark-grown and
green seedlings (Holtorf et al., 1995). Those results
suggest that chlorophyll synthesis in barley is
controlled by two light-dependent POR enzymes,
one active only transiently in etiolated seedlings at
the beginning of illumination, the other also
operating in green plants.
In rice, 16 strains of chlorophyll b-decient
mutants have been generated by ionizing radiation
and various mutagenic chemicals (Terao et al.,
1985). These strains are divided into two groups
according to their chlorophyll a/b ratios. The
group of interest here is Type I, i.e., the chlorophyll b-less mutants, which includes those either
lacking chlorophyll b or having chlorophyll a/b
ratios close to or >20. One example of this type is
the OsCAO1 KO mutant.
In Arabidopsis, overexpression of AtCAO in
chlorophyll b-less (chlorina 1-1 and chlorina 1-3)
strains under the control of the CaMV35S promoter results in the substantial accumulation of
chlorophyll b in transformed lines (Oster et al.,
2000). The recombinant enzyme of AtCAO produced in E. coli catalyzes a two-step oxygenase
reaction in the chlorophyll cycle of higher plants
(Oster at al., 2000). Because CAO sequences are
highly conserved from cyanobacteria to higher
plants (Tomitani et al., 1999), the reaction mechanism of these enzymes also can be conserved.
Expression of AtCAO in a cyanobacterium that
normally does not synthesize chlorophyll b will
induce its accumulation in transformed cyanobacteria cells (Satoh et al., 2001).
The lack of chlorophyll b can aect the abundance of certain proteins and pigment-protein
complexes (Falbel et al., 1996). Mutants without
chlorophyll b typically fail to accumulate signicant quantities of chlorophyll a/b binding light
harvesting complexes. Because chlorophyll b is
needed for the stabilization of LHCs, its absence
leads to smaller photosynthetic unit sizes and the

development of abnormal thylakoid membrane

systems. In the barley chlorina f2 mutant, only the
25-kDa (Type 3) apoprotein in the major LHC IIb
complex survives, and the amount of minor LHC
II pigment-proteins is considerably reduced,
although not to zero. This suggests that the two
largest LHC IIb and LHC Ib apoproteins require
chlorophyll b for stable integration into the
membrane. Reduced qP and NPQ in OsCAO1
mutants may reect structural changes in LHC I
and LHC II, which possibly results in poor
development of grana stacks in the thylakoids.
However, Nakatani and Baliga (1985) have described a chlorophyll b-lacking ch5 mutant (U374)
in sweet clover that exhibits grana that are nearly
as normal as those in the wild type, thereby indicating that components other than LHC II are
involved in grana stacking. Nevertheless, biochemical studies, such as nondenaturing green gels
and immunoblot analysis, are necessary in order to
obtain a detailed characterization of OsCAO
mutants and to survey the photosynthetic apparatus in OsCAO1 and OsCAO2 mutants.

Acknowledgements
We thank Priscilla Licht for critically reading the
manuscript. This work was in part supported, in
part, by grants from the 21st Century Frontier
Program (CG-1111); from the Biogreen 21 program, Rural Development Administration; from
the NRL program, Korea Institute of Science and
Technology Evaluation and Planning (KISTEP);
and from POSCO.

References
An, S., Park, S., Jeong, D.-H., Lee, D.Y., Kang, H.-G., Yu,
J.H., Hur, J., Kim, S.R., Kim, Y.H., Lee, M., Han, S., Kim,
S.J., Yang, J., Kim, E., Wi, S.J., Chung, H.S., Hong, J.P.,
Choe, V., Lee, H.K., Choi, J.H., Nam, J., Kim, S.R., Park,
P.B., Park, K.Y., Kim, W.T., Choe, S., Lee, C.B. and An, G.
2003. Generation and analysis of end sequence database for
T-DNA tagging lines in rice. Plant Physiol. 133: 20402047.
Armstrong, G.A., Runge, S., Frick, G., Sperling, U. and Apel, K.
1995. Identication of NADPH:protochlorophyllide oxidoreductases A and B: A branched pathway for light-dependent
chlorophyll biosynthesis in Arabidopsis thaliana. Plant Physiol. 108: 15051517.
Beer, N.S. and Griths, W.T. 1981. Purication of the enzyme
NADPH: protochlorophyllide oxidoreductase. Biochem J.
195: 8392.

817
Blanc, G., Barakat, A., Guyot, R., Cooke, R. and Delseny, M.
2000. Extensive duplication and reshuing in the Arabidopsis genome. Plant Cell. 12: 10931101.
Bossmann, B., Knoetzel, J. and Jansson, S. 1997. Screening of
chlorina mutants of barley Hordeum vulgare L. with
antibodies against light-harvesting proteins of PS I and PS
II: Absence of specic antenna proteins. Photosynth Res. 52:
127136.
Chen, D.H. and Ronald, P.C. 1999. A rapid DNA minipreparation method suitable for AFLP and other PCR applications. Plant Mol. Biol. Rep. 17: 5357.
Chin, H.G., Choe, M.S., Lee, S.H., Park, S.H., Koo, J.C., Kim,
N.Y., Lee, J.J., Oh, B.G., Yi, G.H., Kim, S.C., Choi, H.C.,
Cho, M.J. and Han, C.D. 1999. Molecular analysis of rice
plants harboring an Ac/Ds transposable element-mediated
gene trapping system. Plant J. 19: 615623.
Espineda, C.E., Linford, A.S., Devine, D. and Brusslan, J.A.
1999. The AtCAO gene, encoding chlorophyll a oxygenase, is
required for chlorophyll b synthesis in Arabidopsis thaliana.
Proc. Natl. Acad. Sci. USA 96: 1050710511.
Falbel, T.G., Meehl J.B. and Staehelin, L.A. 1996. Severity of
mutant phenotype in a series of chlorophyll-decient wheat
mutants depends on light intensity and the severity of the
block in chlorophyll synthesis. Plant Physiol. 12: 821832.
Genty, B., Briantais, J.M. and Baker, N.R. 1989. The
relationship between the quantum yield of photosynthetic
electron transport and quenching of chlorophyll uorescence. Biochim. Biophys. Acta. 990: 8792.
Gilmore, A.M. and Yamamoto, H.Y. 1991. Resolution of
lutein and zeaxanthin using a nonencapped, lightly carbonloaded C-18 high-performance liquid chromatographic column. J. Chromatogr. 543: 137145.
Go, S.A., Ricke, D., Lan, T.H., Presting, G., Wang, R.,
Dunn, M., Glazebrook, J., Sessions, A., Oeller, P., Varma,
H., Hadley, D., Hutchison, D., Martin, C., Katagiri, F.,
Lange, B.M., Moughamer, T., Xia, Y., Budworth, P.,
Zhong, J., Miguel, T., Paszkowski, U., Zhang, S., Colbert,
M., Sun, W.L., Chen, L., Cooper, B., Park, S., Wood, T.C.,
Mao, L., Quail, P., Wing, R., Dean, R., Yu, Y., Zharkikh,
A., Shen, R., Sahasrabudhe, S., Thomas, A., Cannings, R.,
Gutin, A., Pruss, D., Reid, J., Tavtigian, S., Mitchell, J.,
Eldredge, G., Scholl, T., Miller, R.M., Bhatnagar, S., Adey.
N., Rubano, T., Tusneem, N., Robinson, R., Feldhaus, J.,
Macalma, T., Oliphant, A. and Briggs, S. 2002. A draft
sequence of the rice genome (Oryza sativa L. ssp. japonica).
Science 296: 92100.
Hartel, H., Lokstein, H., Grimm, B. and Rank, B. 1996. Kinetic
studies on the xanthophyll cycle in barley leaves. Inuence of
antenna size and relations to nonphotochemical chlorophyll
uorescence quenching. Plant Physiol. 110: 471482.
Holtorf, H., Reinbothe, S., Reinbothe, C., Bereza, B. and Apel,
K. 1995. Two routes of chlorophyllide synthesis that are
dierentially regulated by light in barley Hordeum vulgare L.
Proc. Natl. Acad. Sci. USA 92: 32543258.
Jeon, J.S. and An, G. 2001. Gene tagging in rice: a high
throughput system for functional genomics. Plant Sci. 161:
211219
Jeon, J.S., Lee, S., Jung, K.H., Jun, S.H., Jeong, D.-H., Lee, J.,
Kim, C., Jang, S., Yang ,K., Nam, J., An, K., Han, M.-J.,
Sung, R.J., Choi, H.S., Yu, J.H., Choi, J.H., Cho, S.Y., Cha,
S.S., Kim ,S.I. and An, G. 2000. T-DNA insertional mutagenesis for functional genomics in rice. Plant J. 22: 561570.
Jeong, D.-H., An. S., Kang, H.-G., Moon, S., Han, J.-J., Park,
S., Lee, H.S., An, K. and An, G. 2002. T-DNA insertional

mutagenesis for activation tagging in rice. Plant Physiol. 130:

16361644.
Jung, K.H., Hur, J., Ryu, C.-H., Choi, Y., Chung, Y.Y.,
Miyao, A., Hirochika, H. and An, G. 2003. Characterization
of a rice chlorophyll-decient mutant using the T-DNA
gene-trap system. Plant Cell Physiol. 44: 463472.
Knoetzel, J., Bossmann, B. and Grimme, L.H. 1998. Chlorina
and viridis mutants of barley Hordeum vulgare L. allow
assignment of long-wavelength chlorophyll forms to individual Lhca proteins of Photosystem I in vivo. FEBS Lett.
436: 339342.
Kolesnik, T., Szeverenyi, I., Bachmann, D., Kumar, C.S.,
Jiang, S., Ramamoorthy, R., Cai, M., Ma, Z.G., Sundaresan, V. and Ramachandran, S. 2004 Establishing an ecient
Ac/Ds tagging system in rice: Large-scale analysis of Ds
anking sequences. Plant J. 37: 301314.
Krause, G.H. and Weis, E. 1991. Chlorophyll uorescence and
photosynthesis: The basics. Annu. Rev. Plant. Physiol. Plant
Mol. Biol. 42: 313349.
Krol, M., Ivanov, A.G., Jansson, S., Kloppstech, K. and
Huner, N.P.A. 1999. Greening under high light or cold
temperature aects the level of xanthophyll-cycle pigments,
early light-inducible proteins, and light-harvesting polypeptides in wild-type barley and the chlorina f2 mutant. Plant
Physiol. 120: 193203.
Krol, M., Spangford, M.D., Huner, N.P.A., Oquist, G.,
Gustafsson, P. and Jansson, S. 1995. Chlorophyll a/b-binding
proteins, pigment conversions, and early light-induced proteins in a chlorophyll b-less barley mutant. Plant Physiol. 107:
873883.
Lee, S., Kim, J., Han, J.-J., Han, M.-J. and An, G. 2004.
Functional analyses of the owering time gene OsMADS50,
the putative SUPPRESSOR OF OVEREXPRESSION OF
CO 1/AGAMOUS-LIKE 20 SOC1/AGL20 ortholog in rice.
Plant J. 38: 754764.
Lee, S., Kim, J., Son, J.S., Nam, J., Jeong, D.-H., Lee, K., Jang,
S., Yoo, J., Lee, J., Lee, D.-Y., Kang, H.-G. and An, G.
2003. Systematic reverse genetic screening of T-DNA tagged
genes in rice for functional genomic analyses: MADS-box
genes as a test case. Plant Cell Physiol. 44: 14031411.
Miyao, A., Tanaka, K., Murata, K., Sawaki, H., Takeda, S.,
Abe, K., Shinozuka, Y., Onosato, K. and Hirochika, H.
2003. Target site specicity of the Tos17 retrotransposon
shows a preference for insertion within genes and against
insertion in retrotransposon-rich regions of the genome.
Plant Cell. 15: 17711780.
Nakatani, H.Y. and Baliga,V. 1985 A clover mutant lacking
chlorophyll a- and b-containing protein antenna complexes.
Biochim. Biophys. Res. Commun. 131: 182189.
Nonomura, K., Nakano, M., Fukuda, T., Eiguchi, M., Miyao,
A., Hirochika, H. and Kurata, N. 2004. The novel gene
HOMOLOGOUS PAIRING ABERRATION IN RICE
MEIOSIS1 of rice encodes a putative coiled-coil protein
required for homologous chromosome pairing in meiosis.
Plant Cell. 16: 10081020.
Oosawa, N., Masuda, T., Awai, K., Fusada, N., Shimada, H.,
Ohta, H. and Takamiya, K. 2000. Identication and lightinduced expression of a novel gene of NADPH-protochlorophyllide oxidoreductase isoform in Arabidopsis thaliana.
FEBS Lett.474: 133136.
Oster, U., Tanaka, R., Tanaka, A. and Rudiger, W. 2000.
Cloning and functional expression of the gene encoding the
key enzyme for chlorophyll b biosynthesis CAO from
Arabidopsis thaliana. Plant J. 21: 305310.

818
Preiss, S. and Thornber, J.P. 1995. Stability of the apoproteins
of light-harvesting complex I and II during biogenesis of
thylakoids in the chlorophyll b-less barley mutant chlorina
f2. Plant Physiol. 107: 709717.
Reyes, J.C., Muro-Pastor, M.I. and Florencio, F.J. 2004. The
GATA family of transcription factors in Arabidopsis and
rice. Plant Physiol. 134: 17181732.
Rudiger, W. 2002. Biosynthesis of chlorophyll b and the
chlorophyll cycle. Photosynth. Res. 74: 187193.
Ryu, C.-H., You, J.-H., Kang, H.-G., Hur, J., Kim, Y.-H.,
Han, M.-J., An, K., Chung, B-C., Lee, C.-H. and An, G.
2004. Generation of T-DNA tagging lines with a bidirectional gene trap vector and the establishment of an insertionsite database. Plant Mol. Biol. 54: 489502.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1988. Molecular
cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Satoh, S., Ikeuchi, M., Mimuro, M. and Tanaka, A. 2001.
Chlorophyll b expressed in cyanobacteria functions as a
light-harvesting antenna in photosystem I through exibility
of the proteins. J. Biol. Chem. 276: 42934297.
Sugiyama, N., Izawa, T., Oikawa, T. and Shimamoto, K. 2000.
Light regulation of circadian clock-controlled gene expression in rice. Plant J. 26: 607615.
Takano, M., Kanegae, H., Shinomura, T., Miyao, A.,
Hirochika, H. and Furuya, M. 2001. Isolation and characterization of rice phytochrome A mutants. Plant Cell. 13:
521534.
Tanaka, A., Ito, H., Tanaka, R., Tanaka, N.K., Yoshida, K.
and Okada, K. 1998. Chlorophyll a oxygenase CAO is
involved in chlorophyll b formation from chlorophyll a.
Proc. Natl. Acad. Sci. USA 95: 1271912723.
Tanaka, K., Murata, K., Yamazaki, M., Onosato, K., Miyao,
A. and Hirochika, H. 2003. Three distinct rice cellulose

synthase catalytic subunit genes required for cellulose

synthesis in the secondary wall. Plant Physiol. 133: 7383.
Tanaka, R., Koshino, Y., Sawa, S., Ishiguro, S., Okada, K. and
Tanaka, A. 2001. Overexpression of chlorophyllide a oxygenase CAO enlarges the antenna size of photosystem II in
Arabidopsis thaliana. Plant J. 26: 365373.
Terao, T., Yamashita, A. and Katoh, S. 1985. Chlorophyll
b-decient mutant of rice. I. Absorption and uorescence
spectra and chlorophyll a/b ratio. Plant Cell Physiol. 26:
13611367.
Tomitani, A., Okada, K., Miyashita, H., Matthijs, H.C., Ohno,
T. and Tanaka, A. 1999. Chlorophyll b and phycobilins in
the common ancestor of cyanobacteria and chloroplasts.
Nature. 400: 159162.
van Kooten, O. and Snel, F.H. 1990. The use of chlorophyll
uorescence nomenclature in plant stress physiology.
Photosynth. Res. 25: 147150.
Yu, J., Hu, S., Wang, J., Wong, G.K., Li, S., Liu, B., Deng, Y.,
Dai, L., Zhou, Y., Zhang, X., Cao, M., Liu, J., Sun, J., Tang,
J., Chen, Y., Huang, X., Lin, W., Ye, C., Tong, W., Cong,
L., Geng, J., Han, Y., Li, L., Li, W., Hu, G., Huang, X., Li,
W., Li, J., Liu, Z., Li, L., Liu, J., Qi, Q., Liu, J., Li, L., Li, T.,
Wang, X., Lu, H., Wu, T., Zhu, M., Ni, P., Han, H., Dong,
W., Ren, X., Feng, X., Cui, P., Li, X., Wang, H., Xu, X.,
Zhai, W., Xu, Z., Zhang, J., He, S., Zhang, J., Xu, J., Zhang,
K., Zheng, X., Dong, J., Zeng, W., Tao, L., Ye, J., Tan, J.,
Ren, X., Chen, X., He, J., Liu, D., Tian, W., Tian, C., Xia,
H., Bao, Q., Li, G., Gao, H., Cao, T., Wang, J., Zhao, W.,
Li, P., Chen, W., Wang, X., Zhang, Y., Hu, J., Wang, J.,
Liu, S., Yang, J., Zhang, G., Xiong, Y., Li, Z., Mao, L.,
Zhou, C., Zhu, Z., Chen, R., Hao, B., Zheng, W., Chen, S.,
Guo, W., Li, G., Liu, S., Tao, M., Wang, J., Zhu, L., Yuan,
L. and Yang, H. 2002. A draft sequence of the rice genome
(Oryza sativa L. ssp. indica). Science 296: 7992.