Anda di halaman 1dari 169

Portada: Vivienda ubicada en el valle de Ubaque-Fómeque, Cundinamarca

a una altura de 1850 metros sobre el nivel del mar. La región a una
distancia de 30 kilómetros de Bogotá, fue un área de alta infestación
domiciliar (mayor al 45%) durante la década de los años 90 antes
de que se adelantaran programas de control vectorial y por ende
de transmisión de Trypanosoma cruzi.
Los datos de serología positiva para T. cruzi en escolares de la
zona alcanzaron un promedio de 18%. Este rancho representa
una típica vivienda propicia para la infestación con triatominos,
construída en bahareque y techos de hojas de palma que ofrecen
refugio a los insectos transmisores de la enfermedad de Chagas.
Foto: Felipe Guhl, CIMPAT, Universidad de los Andes.

1
Biomédica Instituto Nacional de Salud
Volumen 27, Suplemento No. 1, Enfermedad de Chagas - Bogotá, D.C., Colombia - Enero, 2007

COMITÉ EDITORIAL
ELIZABETH CASTAÑEDA, editora jefe RUBÉN SANTIAGO NICHOLLS, coeditor CARLOS ARTURO HERNÁNDEZ, editor ejecutivo
Instituto Nacional de Salud Instituto Nacional de Salud Bogotá, D.C., Colombia
Bogotá, D.C., Colombia Bogotá, D.C., Colombia

EDITORES ASOCIADOS LEONARD MUNSTERMANN ÁNGELA RESTREPO


Yale University School of Medicine Corporación para Investigaciones Biológicas
New Haven, CN, Estados Unidos Medellín, Colombia
LUIS ALBERTO GÓMEZ RICARDO SÁNCHEZ
Instituto Nacional de Salud Universidad Nacional de Colombia
Bogotá, D.C., Colombia Bogotá, D.C., Colombia
MARÍA CRISTINA FERRO OMAR SEGURA
Bogotá, D.C., Colombia Instituto Nacional de Salud
MIGUEL A. GUZMÁN Bogotá, D.C., Colombia
Bogotá, D.C., Colombia

SECRETARIA DEL COMITÉ LINDA GRACE MOLANO

C OMITÉ CIENTÍFICO
JUAN MANUEL ANAYA LUIS GABRIEL C UERVO ALBERTO GÓMEZ
Corporación para Investigaciones Organización Panamericana de la Pontificia Universidad Javeriana
Biológicas Salud Bogotá, D.C., Colombia
Medellín, Colombia Washington, D.C., Estados Unidos ENRIQUE GONZÁLEZ
ARNOLDO BARBOSA RAMÍREZ PATRICIA DEL PORTILLO University of Texas Health Science
Hospital Clínic, Universidad de Corpogén Center at San Antonio
Barcelona, Barcelona, España Bogotá, D.C., Colombia San Antonio, TX, Estados Unidos
Centro de Investigação Em Saude ANDRÉS DE FRANCISCO JOHN MARIO GONZÁLEZ
Da Manhiça, Manhiça, Mozambique Foro Global para la Investigación Universidad de los Andes
ANTONIO BERMÚDEZ en Salud Bogotá, D.C., Colombia
Instituto Nacional de Salud Ginebra, Suiza FELIPE GUHL
Bogotá, D.C., Colombia FERNANDO DE LA HOZ Universidad de los Andes
JORGE H. BOTERO Universidad Nacional de Colombia Bogotá, D.C., Colombia
Universidad de Antioquia Bogotá, D.C., Colombia ANTONIO IGLESIAS
Medellín, Colombia JOSÉ LUIS DI FABIO Universidad Nacional de Colombia
Organización Panamericana de la Bogotá, D.C., Colombia
VÍCTOR CÁRDENAS
University of Texas Salud JORGE JARA
Washington, D.C., Estados Unidos BID/Secretaría de Salud
El Paso, TX, Estados Unidos
JORGE HERNANDO DONADO Tegucigalpa, Honduras
ALBERTO CONCHA-EASTMAN
Universidad Pontificia Bolivariana ERNESTO JARAMILLO
Organización Panamericana
Medellín, Colombia Organización Mundial de la Salud
de la Salud
Washington, D.C., Estados Unidos JOSÉ FIGUEROA Ginebra, Suiza
World Health Organization MARCELO LABRUNA
ZOILO CUÉLLAR
Ginebra, Suiza Universidade de São Paulo
Academia Nacional de Medicina
Bogotá, D.C., Colombia LUIS FERNANDO GARCÍA São Paulo, Brasil
Universidad de Antioquia
Medelín, Colombia

1
JAIRO LIZARAZO VÍCTOR E. REYES NANCY GORE SARAVIA
Hospital Universitario Erasmo Meoz University of Texas Medical CIDEIM
Cúcuta, Colombia Branch Cali, Colombia
Galveston, TX, Estados Unidos
JUAN GUILLERMO MCEWEN ROBERT TESH
Corporación para Investigaciones GERZAÍN RODRÍGUEZ University of Texas
Biológicas Universidad de la Sabana Galveston, TX, Estados Unidos
Medellín, Colombia Bogotá, D.C., Colombia ORLANDO TORRES-FERNÁNDEZ
ROBERTO MENDOZA GUSTAVO ROMÁN Instituto Nacional de Salud
The Hospital for Sick Children University of Texas Bogotá, D.C., Colombia
Toronto, Ontario, Canada Houston, TX, Estados Unidos BRUNO TRAVI
ALVARO MONCAYO PEDRO ROMERO University of Texas
Universidad de los Andes Ludwig Institute for Cancer San Antonio, TX, Estados Unidos
Bogotá, D.C., Colombia Research, Lausanne branch GUSTAVO VALBUENA
RICARDO NEGRONI Lausana, Suiza University of Texas
Hospital de Infecciosas ÁLVARO RUIZ Galveston, TX, Estados Unidos
Francisco Javier Muñiz Pontificia Universidad Javeriana JUAN MIGUEL VILLALOBOS
Buenos Aires, Argentina Bogotá, D.C., Colombia Universidade Federal de Rondônia
MARÍA TERESA OCHOA GIOCONDA SAN BLAS Porto Velho, Brasil
University of California Los Ángeles Instituto Venezolano de JOHN WALKER
Los Ángeles, CA, Estados Unidos Investigaciones Científicas Cideim
JUAN P. OLANO Caracas, Venezuela Cali, Colombia
University of Texas Medical Branch ÁLVARO SANABRIA MOISÉS WASSERMAN
Galveston, TX, Estados Unidos Pontificia Universidad Javeriana Universidad Nacional de Colombia
BLANCA RESTREPO Bogotá, D.C., Colombia Bogotá, D.C., Colombia
University of Texas
San Antonio, TX, Estados Unidos

 Instituto Nacional de Salud


La revista Biomédica del Instituto Nacional de Salud es una publicación trimestral, eminentemente científica. Está
amparada por la resolución número 003768 de 1981, emanada del Ministerio de Gobierno, y con tarifa postal reducida
según resolución número 1128 del 5 de mayo de 1982.
Ninguna publicación, nacional o extranjera, podrá reproducir ni traducir sus artículos ni sus resúmenes sin previa
autorización escrita del editor. Ni la revista, ni el Instituto asumen responsabilidad alguna por los puntos de vista
expresados por los autores. La revista no publicará ningún tipo de propaganda comercial. Los nombres de equipos,
materiales y productos manufacturados que eventualmente puedan mencionarse, no implican recomendación ni
propaganda para su uso y sólo se mencionan como identificación genérica.
La revista Biomédica aparece reseñada en Index Medicus/Medline de la National Library of Medicine, en el índice de
la Literatura Latinoamericana en Ciencias de la Salud (LILACS), en el Sistema de Información Bibliográfica Regional
Andina (SIBRA), en CAB Abstracts, Review of Medical and Veterinary Entomology, y forma parte del Índice Nacional
de Publicaciones Seriadas Científicas y Tecnológicas Colombianas de Colciencias y del Índice Latinoamericano de
Revistas Científicas y Tecnológicas (LATINDEX).
INSTITUTO NACIONAL DE SALUD
Avenida Calle 26 No. 51-60
Apartado aéreo 80334 y 80080
Bogotá, D.C., Colombia, S.A.

URL: http://www.ins.gov.co
biomedica@ins.gov.co

2
Contenido

Editorial Astrid C. Flórez, Claudia Quintero, Marcela Mercado,


La enfermedad de Chagas en 1909 y en 2006 Miguel Vacca, Santiago Nicholls, Concepción Puerta .. 83
Álvaro Moncayo Medina ................................................... 5 Variación del fenotipo antenal de poblaciones del
Presentación de caso domicilio, peridomicilio y silvestre de Triatoma dimidiata
Enfermedad de Chagas aguda en Colombia, una entidad (Hemiptera: Reduviidae) en Santander, Colombia.
poco sospechada. Informe de 10 casos presentados en Corina María Arroyo, Lyda Esteban, Silvia Catalá,
el periodo 2002 a 2005 Víctor Manuel Angulo ....................................................... 92
Rubén Santiago Nicholls, Zulma Milena Cucunubá, Comparación de los patrones de alimentación y
Angélica Knudson, Astrid Carolina Flórez, Marleny Montilla, defecación de Rhodnius colombiensis y Rhodnius
Concepción Judith Puerta, Paula Ximena Pavía .............. 8 prolixus (Hemiptera, Reduviidae, Triatominae) en
Artículos originales condiciones de laboratorio
Expresión de marcadores en células dendríticas de Andrea Arévalo, Julio César Carranza, Felipe Guhl,
pacientes chagásicos crónicos estimuladas con la
Jairo A. Clavijo, Gustavo Adolfo Vallejo ........................ 101
proteína KMP-11 y el péptido K1 de Trypanosoma cruzi Interacción tripanosoma-vector-vertebrado y su relación
Sandra Paola Santander, Adriana Cuéllar, con la sistemática y la epidemiología de la
María del Carmen Thomas, Fanny Guzmán, tripanosomiasis americana
Alberto Gómez, Manuel Carlos López, Gustavo Adolfo Vallejo,Felipe Guhl, Julio César Carranza,
Concepción Puerta .......................................................... 18 Omar Triana, Gerardo Pérez, Paola Andrea Ortiz,
Dairo Humberto Marín, Lina Marcela Villa, Jazmín Suárez,
Estructura poblacional y variabilidad genética de
Isaura Pilar Sánchez, Ximena Pulido,
Rhodnius prolixus (Hemiptera: Reduviidae) procedente
Ingrid Bibiana Rodríguez, Leyder Elena Lozano,
de diferentes áreas geográficas de Colombia
Daniel Alfonso Urrea, Fredy Arvey Rivera,
Diana Carolina López, Carlos Jaramillo,
César Cuba-Cuba, Jairo Alfonso Clavijo ...................... 110
Felipe Guhl ....................................................................... 28
Lesión celular del miocardio y actividad de la ATPsintasa Comparación del ciclo de vida de Rhodnius colombiensis
mitocondrial en ratas infectadas con una cepa Moreno, Jurberg & Galvão, 1999 y Rhodnius prolixus
colombiana de Trypanosoma cruzi Stal, 1872 (Hemiptera, Reduviidae, Triatominae) en
condiciones de laboratorio
Dairo Alonso Rendón, Carlos M. Genes,
Omar Triana ..................................................................... 40 Andrea Arévalo, Julio César Carranza, Felipe Guhl,
Jairo Alfonso Clavijo, Gustavo Adolfo Vallejo ............... 119
Análisis de polimorfismos en los genes tripanotión
reductasa y cruzipaína en cepas colombianas de Comunicación breve
Trypanosoma cruzi Seroprevalencia de la enfermedad de Chagas y factores
Winston Rojas, Maria Antonieta Caro, de riesgo asociados en una población de Morroa, Sucre.
Juan Guillermo Lopera, Omar Triana, Juan Carlos Dib, Richard Hoyos, Lisandro Pacheco, Luz Adriana Agudelo,
Gabriel Bedoya ................................................................ 50 German Zafra, Pedro Blanco, Omar Triana ................. 130

Caracterización biológica y genética de dos clones Patrones electroforéticos de hemoproteínas salivares


pertenecientes a los grupos I y II de Trypanosoma cruzi (nitroforinas) de Rhodnius colombiensis y Rhodnius
de Colombia prolixus (Hemiptera, Reduviidae, Triatominae)
Luz Adriana Botero, Ana María Mejía, Omar Triana ...... 64 Andrea Arévalo, Julio César Carranza, Felipe Guhl,
Gustavo Adolfo Vallejo ................................................... 137
Efecto tóxico de β-cipermetrina, deltametrina y fenitrotión
en cepas de Triatoma dimidiata (Latreille, 1811) y Revisión de tema
Triatoma maculata (Erichson, 1848) (Hemiptera, Actualización de la distribución geográfica y
Reduviidae) ecoepidemiología de la fauna de triatominos (Reduviidae:
Marlene Reyes, Víctor Manuel Angulo, Claudia Magaly Triatominae) en Colombia
Sandoval ........................................................................... 75 Felipe Guhl, Germán Aguilera, Néstor Pinto,
Daniela Vergara ............................................................. 143
Comparación de una prueba de PCR basada en los genes
codificantes para la histona H2A/SIRE con pruebas Instrucciones para los autores
serológicas convencionales para el diagnóstico de la
enfermedad de Chagas crónica en pacientes colombianos
Juliana Gil, Paula Pavía, Marleny Montilla,

3
Contents

Editorial Astrid C. Flórez, Claudia Quintero, Marcela Mercado,


Chagas disease in 1909 and in 2006 Miguel Vacca, Santiago Nicholls, Concepción Puerta .... 83
Álvaro Moncayo Medina ................................................... 5
Antenal phenotype variation in sylvatic, peridomestic and
Case presentation domestic populations of Triatoma dimidiata (Hemiptera:
Acute Chagas disease in Colombia: a rarely suspected Reduviidae) from Santander, Colombia
disease. Report of 10 cases presented during the Corina María Arroyo, Lyda Esteban, Silvia Catalá,
2002-2005 period Víctor Manuel Angulo ....................................................... 92
Rubén Santiago Nicholls, Zulma Milena Cucunubá, Comparison on the feeding and defecation patterns of
Angélica Knudson, Astrid Carolina Flórez, Marleny Montilla, Rhodnius colombiensis and Rhodnius prolixus
Concepción Judith Puerta, Paula Ximena Pavía .............. 8 (Hemiptera, Reduviidae, Triatominae) under laboratory
conditions
Original articles
Expression of markers on dendritic cells from chronic
Andrea Arévalo, Julio César Carranza, Felipe Guhl,
chagasic patients stimulated with the KMP1 protein and
Jairo A. Clavijo, Gustavo Adolfo Vallejo ........................ 101
the K1 peptide from Trypanosoma cruzi Trypanosoma rangeli parasite-vector-vertebrate interac-
Sandra Paola Santander, Adriana Cuéllar, tions and their relationship to the systematics and
María del Carmen Thomas, Fanny Guzmán, epidemiology of American trypanosomiasis
Alberto Gómez, Manuel Carlos López, Gustavo Adolfo Vallejo,Felipe Guhl, Julio César Carranza,
Concepción Puerta .......................................................... 18 Omar Triana, Gerardo Pérez, Paola Andrea Ortiz,
Population structure and genetic variability of Rhodnius Dairo Humberto Marín, Lina Marcela Villa, Jazmín Suárez,
prolixus (Hemiptera: Reduviidae) from different geographic Isaura Pilar Sánchez, Ximena Pulido,
areas of Colombia Ingrid Bibiana Rodríguez, Leyder Elena Lozano,
Diana Carolina López, Carlos Jaramillo, Felipe Guhl ..... 28 Daniel Alfonso Urrea, Fredy Arvey Rivera,
César Cuba-Cuba, Jairo Alfonso Clavijo ...................... 110
Myocardial cellular damage and the activity of the
mitochondrial ATPsynthase in rats infected with a Comparison of the cycle life of Rhodnius colombiensis
Colombian strain of Trypanosoma cruzi Moreno, Jurberg & Galvão, 1999 and R. prolixus Stal,
Dairo Alonso Rendón, Carlos M. Genes, 1872 (Hemiptera, Reduviidae, Triatominae) under
Omar Triana ..................................................................... 40 laboratory conditions
Andrea Arévalo, Julio César Carranza, Felipe Guhl,
Analysis of polymorphisms on trypanothione reductase Jairo Alfonso Clavijo, Gustavo Adolfo Vallejo ............... 119
and cruzipain genes in Colombian strains of
Trypanosoma cruzi Brief communication
Winston Rojas, Maria Antonieta Caro, Seroprevalence of Chagas disease and associated risk
Juan Guillermo Lopera, Omar Triana, Juan Carlos Dib, factors in a population of Morroa, Sucre
Gabriel Bedoya ................................................................ 50 Richard Hoyos, Lisandro Pacheco, Luz Adriana Agudelo,
German Zafra, Pedro Blanco, Omar Triana ................. 130
Biological and genetic characterization of two Colombian
clones of Trypanosoma cruzi groups I and II Electrophoretic patterns of salivary hemeproteins
Luz Adriana Botero, Ana María Mejía, Omar Triana ...... 64 (nitrophorines) of Rhodnius colombiensis and Rhodnius
prolixus (Hemiptera, Reduviidae, Triatominae)
Toxic effect of β-cipermethrin, deltamethrin and
Andrea Arévalo, Julio César Carranza,
fenitrothion in colonies of Triatoma dimidiata (Latreille,
Felipe Guhl, Gustavo Adolfo Vallejo .............................. 137
1811) and Triatoma maculata (Erichson, 1848)
(Hemiptera, Reduviidae) Topic review
Marlene Reyes, Víctor Manuel Angulo, Claudia Magaly Present geographical distribution and ecoepidemiology of
Sandoval ........................................................................... 75 the triatomine fauna (Reduviidae: Triatominae) in Colombia
Felipe Guhl, Germán Aguilera, Néstor Pinto,
Comparison of a PCR-based on the histone H2A/SIRE
Daniela Vergara ............................................................. 143
genes with classical serological tests for the diagnosis of
chronic chagasic disease in Colombian patients
Juliana Gil, Paula Pavía, Marleny Montilla, Instructions for authors

4
Biomédica Instituto Nacional de Salud
Volumen 27, Suplemento No. 1, Enfermedad de Chagas - Bogotá, D.C., Colombia - Enero, 2007

Editorial
La enfermedad de Chagas en 1909 y en 2006
Cuando Carlos Chagas fue comisionado por Oswaldo Cruz en 1907 para que viajara a Lassance en el
Estado de Minas Gerais a investigar y controlar una epidemia de paludismo, no podía imaginar que iba
a realizar un trabajo que lo inmortalizaría.
En efecto, al leer el informe científico de sus hallazgos, redactado magistralmente en un estilo claro y
elegante, el lector percibe que está ante las observaciones y las deducciones precisas de un grande de
la Medicina (1).
Chagas era en ese momento, a los 28 años, asistente de investigación en el Instituto Soroterápico de
Manguinhos dirigido por Oswaldo Cruz desde 1902, en donde estaba estudiando experimentalmente en
primates, un parásito flagelado al que inicialmente llamó Trypanosoma minasense, aislado de un insecto
reduvídeo proveniente del norte del Estado de Minas Gerias (2).
Cuando Chagas llegó a Lassance constató que estos mismos insectos habitaban en las hendiduras de
las paredes de barro de las habitaciones de los campesinos, a quienes picaban por las noches en la
cara y que, por ello, se conocían localmente como barbeiros.
Por otra parte, se enteró de que en esa área era frecuente una afección que aparecía en el hombre y
que atacaba principalmente a los niños. Consistía en un cuadro sintomático característico con episodios
febriles, anemia importante, esplenomegalia, edema palpebral y adenopatías ganglionares que, en la
gran mayoría de los casos, evolucionaba silenciosamente pero en una cierta proporción progresaba
hacia el desarrollo de lesiones cardíacas graves.
La descripción completa de este cuadro clínico la hace en una niña de dos años, Berenice, de cuya
sangre aisló los mismos tripanosomas que pudo inocular en los animales de laboratorio en los que,
posteriormente, describió las diferentes fases del ciclo evolutivo del parásito. Al describirlo en su
primera comunicación científica ya mencionada, lo denomina para siempre Trypanosoma cruzi, en
homenaje a su maestro.
Las alteraciones cardíacas, la forma más grave de las lesiones crónicas de esta enfermedad, ya las
había observado y las describe así:
“En la sintomatología verificada entonces, lo que más hondo me impresionó fue la frecuencia de las
alteraciones del ritmo cardíaco en extrasístoles en los habitantes de la región, especialmente en aquellos
de casas infestadas por el triatoma.”
El vínculo entre el agente causal, el insecto transmisor y el cuadro clínico estaba completo.
Estos notables descubrimientos los hizo Chagas en veinte meses, viviendo en un vagón del ferrocarril
central de Brasil donde había instalado su vivienda y su laboratorio de campo en Lassance.
A los 33 años, Carlos Chagas había completado sus descubrimientos y había publicado sus trabajos
científicos, por lo que entraría, con reconocimiento mundial, en la Historia de la Medicina.
En una secuencia que no tiene paralelo, Chagas descubre el agente etiológico, el insecto transmisor y
la enfermedad que lleva su nombre y la comunica en su artículo publicado en 1909 en el primer número
de las Memorias del Instituto Oswaldo Cruz.

- 5
Después de esta publicación y de las que siguieron, los homenajes y los reconocimientos mundiales se
suceden. Es nombrado director del Instituto de Manguinhos, director del Departamento Nacional de
Salud Pública y académico de la Academia Nacional de Medicina de Brasil y de otras Academias de
Medicina del continente, entre ellas la de Colombia, donde fue elegido en votación secreta y por
unanimidad como Miembro Correspondiente en la sesión del 27 de septiembre de 1918 (3).
En 1910, en la conferencia que presentó en la Academia Nacional de Medicina de Brasil, Carlos Chagas
dijo:
“Como veis, señores, el estudio de esta molestia presenta de curioso el hecho de que hemos partido
aquí del conocimiento previo del germen, de haberlo estudiado minuciosamente en su biología, para,
más tarde llegar, basado de alguna forma en esa misma biología, a demostrar que es el factor etiológico
de una especie mórbida humana. En el esclarecimiento etiológico de las otras especies mórbidas nada
de similar encontramos; en todas ellas, después de profundamente estudiada la molestia, en su
sintomatología, en sus condiciones epidemiológicas, se ha llegado a la verificación del agente
mórbido” (4).
Más adelante, previendo la necesidad y la factibilidad del control de la enfermedad con campañas de
salud pública, de fumigación y de mejoramiento de la vivienda rural, nos dice:
“¿Se podrá encontrar en la higiene pública medios eficaces de atenuación del mal? Creemos que sí, si
tal problema, seguramente problema de Estado y de humanidad, se convierte en preocupación de un
estadista científicamente bien orientado. En verdad, el hombre de Estado que haga de la campaña
contra ese mal un programa de administración y que obtenga éxito, habrá conquistado de mis
compatriotas, de las generaciones futuras de Minas, la mayor prenda de reconocimiento” (4).
Los notables adelantos en investigación sobre la enfermedad de Chagas deben acreditarse a los
investigadores de América Latina que han profundizado en el conocimiento de los componentes biológicos
y sociales de esta enfermedad.
Las publicaciones indexadas en bases de datos internacionales evidencian el alto nivel de los trabajos
científicos de los investigadores del continente.
Como ejemplo, analicemos los datos bibliométricos de la base de datos de la National Library of
Medicine de Washington, D.C. (www.nih.nlm.gov, 2005.). En 56 años, entre 1949 y 2005 se han publicado
8.976 artículos científicos sobre esta enfermedad que se reparten, según los temas, como aparece en
el siguiente cuadro:

Tema Artículos Años de la publicación


Trypanosoma cruzi, investigación básica 7.408 (83%) 1949-2005
Triatoma infestans, investigación básica 665 (7%) 1950-2004
Rhodnius prolixus, investigación básica 617 (7%) 1950-2004
Tratamiento de la enfermedad de Chagas 286 (3%) 1966-2005
Total 8.976 (100%) 1949-2005

El 97% del total de artículos indexados ha versado sobre temas de investigación básica sobre T. cruzi
y sobre dos de los más importantes de sus vectores, Triatoma infestans y Rhodnius prolixus. Es muy
contrastante esta proporción cuando se ve que solamente el 3% de los trabajos se refiere al tratamiento
y no se registran trabajos sobre el control de la enfermedad.

6
Sin embargo, los logros que se han obtenido para interrumpir la transmisión del parásito causante de la
enfermedad, T. cruzi, por medio de la eliminación del vector domiciliado, T. infestans, mediante programas
de fumigación con insecticidas de efecto residual, se deben a los compromisos políticos y financieros
de los gobiernos de los países endémicos, en particular, de los países que constituyen la Iniciativa del
Cono Sur, es decir, los ministerios de Salud de Brasil, Chile y Uruguay, donde la transmisión se ha
interrumpido.
El pasado 8 de julio de 2006 se celebró en el Ministerio de Salud de Brasil, en Brasilia, el acto de
declaración de la interrupción de la transmisión vectorial de la enfermedad de Chagas por T. infestans
en toda el área endémica de Brasil, certificada por una Comisión Internacional de Expertos convocada
por la Organización Panamericana de la Salud. Este es un triunfo de la salud pública brasilera y
continental, que honra al ministerio de Salud y a las instituciones de investigación biomédica de Brasil.
Por fortuna, este deseo de Carlos Chagas expresado –como vimos- en 1910 se ha cumplido en su país
y en otros del continente.
En Colombia, la investigación clínica y de laboratorio, particularmente en diagnóstico serológico,
bioquímica y caracterización del parásito y en estudios sobre genética de poblaciones vectoriales –
como lo demuestra este número de Biomédica–, han tenido importantes avances.
Sin embargo, no existe un programa de control vectorial a nivel nacional que marque las pautas de
acción, las implemente y las evalúe sistemáticamente. Creo que el gobierno nacional está en deuda
con las poblaciones de colombianos que están viviendo en zonas endémicas para controlar los vectores
y evitar la infección con el parásito causante de la enfermedad de Chagas.
Álvaro Moncayo Medina
Investigador asociado, CIMPAT, Universidad de los Andes, Bogotá, D. C., Colombia.
Académico, Academia Nacional de Medicina, Bogotá, D. C., Colombia.
Referencias
1. Chagas C. Nova tripanozomiase humana. Estudos sobre a morfolojía e o ciclo evolutivo de
Schizotrypanum cruzi n.gen., n.sp., ajente etiolójico de nova entidade morbida do homen. Mem Inst
Oswaldo Cruz 1909;1:159-218.
2. Brener Z. A descoberta: homenagem aos 80 anos da descoberta da doença de Chagas. Mem Inst
Oswaldo Cruz 1989;84(Suppl. II):1-6.
3. Academia Nacional de Medicina de Colombia. Libro de actas, 1914-1918. Bogotá: Archivos de la
Academia; 1919. p.156.
4. Chagas C. Nova entidade morbida do homem. Brazil Medico 1910;XXIV:443-7.

7
Nicholls
BiomédicaR.S., Z.M., Knudson A. et al
Cucunubá1):8-17
2007;27(supl. Biomédica 2007;27(supl. 1):8-17

PRESENTACIÓN DE CASO

Enfermedad de Chagas aguda en Colombia, una entidad poco


sospechada. Informe de 10 casos presentados en el periodo
2002 a 2005
Rubén Santiago Nicholls 1, Zulma Milena Cucunubá 2, Angélica Knudson 1,
Astrid Carolina Flórez 1, Marleny Montilla 1, Concepción Judith Puerta 3, Paula Ximena Pavía 3

1
Grupo Parasitología, Instituto Nacional de Salud, Bogotá, D.C., Colombia
2
Escuela de Medicina, Universidad Pedagógica y Tecnológica de Colombia, Tunja, Boyacá, Colombia
2
Laboratorio Parasitología Molecular, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia

Introducción. Los casos de enfermedad de Chagas aguda informados en Colombia son


esporádicos.
Objetivo. Describir 10 casos notificados al Grupo de Parasitología del Instituto Nacional de
Salud entre 2002 y 2005.
Materiales y métodos. Utilizando información de historias clínicas, fichas epidemiológicas,
informes de resultados de exámenes de laboratorio y análisis de sangre, se tabularon variables
demográficas, hallazgos clínicos, paraclínicos y de laboratorio. Se realizaron extendidos de
sangre periférica, identificación serológica para IgG mediante inmunofluorescencia indirecta,
aislamiento en cultivo e inoculación en ratones, pruebas de reacción en cadena de la polimerasa
y análisis isoenzimático.
Resultados. El 100% de los casos procedían de zonas endémicas; tres se informaron en
Putumayo, dos en cada uno de los departamentos de Arauca, Casanare, Norte de Santander
y uno en Santander. La presunta vía de transmisión fue vectorial; en el 30% había convivencia
con el vector. El 70% fueron adultos entre los 18 y los 50 años y el 30% niños entre los seis
meses y los dos años. El síntoma predominante fue fiebre en el 90%. Los signos de puerta de
entrada fueron infrecuentes; solamente un paciente presentó un probable signo de Romaña.
Tres pacientes presentaron miocarditis, dos desarrollaron falla cardiaca, y uno taponamiento
cardíaco. La parasitemia fue evidente en nueve casos; las pruebas serológicas fueron reactivas
en cinco casos y también en cinco casos se logró aislamiento del parásito. El análisis
isoenzimático identificó Trypanosoma cruzi grupo I.
Conclusiones. La variabilidad clínica predominó. Ningún caso se sospechó clínicamente. Es
importante incluir esta enfermedad como diagnóstico diferencial del síndrome febril en regiones
endémicas debido a su buena respuesta al tratamiento etiológico el cual previene la fase
crónica.
Palabras clave: Colombia, enfermedad de Chagas, Trypanosoma cruzi , fase aguda,
miocarditis, serología, reacción en cadena de la polimerasa.
Acute Chagas disease in Colombia: a rarely suspected disease. Report of 10 cases
presented during the 2002-2005 period
Introduction. In Colombia, reported cases of acute Chagas disease are sporadic.
Objective. Ten cases were described that had been reported to the Parasitology Laboratory of
the Colombian National Health Institute between December 2002 and November 2005.
Materials and methods. Information from clinical records, epidemiological report forms,
laboratory and blood tests was collated. In addition the following data were compiled:
demographic variables, clinical findings, results of laboratory tests and other exams (such as
peripheral blood smears), IFAT for IgG antibodies, isolation in culture medium, inoculation in
mice, polymerase chain reaction tests and isoenzyme eletrophoresis.
Results. All the cases presented in known endemic areas for Chagas disease transmission in
Colombia. Three cases were from Putumayo Province, two each from the provinces of Arauca,

8
Biomédica 2007;27(supl. 1):8-17 Chagas agudo en Colombia 2002-2005

Casanare, Norte de Santander and one from Santander Province. The probable mode of
transmission was vector-borne. Seven cases presented in adults aged 18 to 50, three in children
aged 6 months to 2 years. Seven were male and three were female. The most frequent symptom
was fever in nine cases. Signs of portal of entry were rare; only one patient presented a possible
Romaña´s sign. Three patients presented myocarditis, two acute cardiac failure and one cardiac
tamponade. Parasitemia was evident in nine cases; five had positive IgG serological tests; five
cases were confirmed through parasite isolation; isoenzyme electrophoresis showed
Trypanosoma cruzi group I.
Conclusions. Clinical variability prevailed. In none of the cases was a clinical diagnosis
suspected. The diagnosis was made and confirmed through laboratory tests alone. The results
highlight the importance of including this disease in the differential diagnosis of febrile syndrome
in endemic regions due to its good response to etiological treatment and thereby preventing its
progression to the chronic phase.
Key words: Colombia, Chagas disease, Trypanosoma cruzi, acute phase, myocarditis, serology,
polymerase chain reaction.

La enfermedad de Chagas constituye un como cardiopatía o enfermedad digestiva, entre


importante problema de salud pública en Centro y otras. Sin embargo, sólo de 20% a 40% de la
Sur América. Afecta aproximadamente a 20 población infectada llega a esta fase; el resto
millones de personas, y 100 millones se permanece asintomático y probablemente muera
encuentran en riesgo de infección. Cada año se por una causa ajena a la enfermedad de Chagas
presentan aproximadamente 500.000 casos (2,4,11).
nuevos de infección, de los cuales 300.000 son
La fase aguda clínicamente evidente se presenta
niños (1). La enfermedad está directamente
por lo general en niños menores de 10 años y en
relacionada con las dificultades socioeconómicas
formas benignas, con una tasa de mortalidad entre
de las comunidades, sus condiciones de vivienda,
2% y 8% (4,9). Sin embargo, el diagnóstico de
el acceso a la educación y los movimientos
esta fase a cualquier edad se dificulta debido a la
migratorios (2-7). En Colombia, se calcula que el
heterogeneidad de los hallazgos clínicos, lo cual
7% de la población está infectada y que el 23%
sugiere que la mayoría de los casos agudos de
se encuentra en riesgo de contraer la infección (8).
enfermedad de Chagas no son diagnosticados (9).
Se ha descrito la presentación clínica en tres
El último informe publicado sobre casos de
fases. La primera, fase aguda, ocurre más o menos
Chagas agudo en Colombia fue el de un brote en
dos a cuatro semanas después a la infección, es
1999 en Guamal, Magdalena, zona sin
sintomática sólo en 1% a 2% de los casos (1,4,9),
antecedentes de transmisión de enfermedad de
se caracteriza por alta parasitemia y en ausencia
Chagas, en donde se describieron 13 casos de
de tratamiento, los síntomas persisten por dos a
síndrome febril asociado a miocarditis aguda, cinco
cuatro meses (10). En la segunda, fase
de ellos fatales (12).
indeterminada, disminuye la parasitemia y con ella
desaparecen las manifestaciones clínicas; ésta En el presente trabajo se describen las
se detecta por métodos serológicos (4,7). características epidemiológicas y los hallazgos
Finalmente, la fase crónica puede manifestarse clínicos y de laboratorio de diez casos de Chagas
al cabo de 10 o más años después de la infección agudo, que fueron notificados al Grupo de
Parasitología del Instituto Nacional de Salud (INS)
Correspondencia: Colombia, durante el periodo comprendido entre
Rubén Santiago Nicholls, Grupo de Parasitología, Instituto
Nacional de Salud diciembre de 2002 y noviembre de 2005.
Avenida Calle 26 No. 51-60, Bogotá, D.C., Colombia
Tel.: +571 2207700, ext. 423
Materiales y Métodos
rnichols@ins.gov.co Se utilizó la información correspondiente a
Recibido: 20/09/05; aceptado: 17/02/06 historias clínicas, fichas epidemiológicas, informes

9
Nicholls R.S., Cucunubá Z.M., Knudson A. et al Biomédica 2007;27(supl. 1):8-17

de resultados de laboratorios y análisis de sangre años; la distribución por sexos correspondió a siete
de los diez pacientes, y se tabularon las variables casos en hombres y tres en mujeres.
demográficas y epidemiológicas, y los principales
El síntoma predominante en 90% de los casos
hallazgos clínicos, paraclínicos y de laboratorio.
fue la fiebre. Otros síntomas importantes fueron
Hubo limitantes metodológicas, pues los casos
cefalea, astenia y adinamia en el 40%. Los signos
se reportaron de distintas maneras y procedían
de puerta de entrada no fueron frecuentes, sólo
de diferentes fuentes, por lo que la información
un paciente presentó posible signo de Romaña,
suministrada no guardaba uniformidad. En los
que no se pudo confirmar, y otro, un posible
casos en que se remitieron muestras de sangre
chagoma. El 30% de los pacientes presentó
al Grupo de Parasitología del INS, se realizaron
miocarditis y el 20% desarrolló falla cardiaca, uno
extendidos de sangre periférica utilizando
de ellos con taponamiento cardiaco que requirió
coloraciones de Giemsa y gota gruesa, aislamiento
cirugía (ventana pericárdica) y manejo en cuidados
en cultivos con medio de NNN modificado y REI
intensivos.
modificado al 2% con suero bovino fetal y
antibiótico gentamicina 100 µg/ml (13), inoculación La parasitemia fue evidente con examen en fresco
en ratones Balb c (14), manteniendo durante un en el 90% de los casos, en los cuales se
mes en una sala de alta seguridad del bioterio del identificaron tripomastigotes circulantes; ésta fue
Instituto Nacional de Salud, análisis electroforético la principal herramienta diagnóstica. Las pruebas
para identificación de zimodemas en acetato de serológicas anti - IgG fueron reactivas en el 50%
celulosa con las enzimas malato deshidrogenasa, de los casos aún en la fase aguda. En el 50% se
glucosa fosfato isomerasa, isocitrato deshidroge- logró aislamiento del parásito por medio de
nasa y enzima málica (15), y reacción en cadena inoculación en ratones, cultivo y confirmación del
de la polimerasa (PCR) con los iniciadores parásito con PCR. El análisis isoenzimático
TcH2AF/R (16) y S35/S36 (17), el primero es una identificó T. cruzi grupo I. En ninguno de los casos
secuencia que se mantiene a lo largo de todos hubo sospecha clínica inicial de tripanosomiasis.
los tripanosomatidos, y el segundo es específico
A continuación se presenta una breve descripción
de Trypanosoma cruzi. Los métodos serológicos
de cada uno de los casos siguiendo el orden
para identificación de anticuerpos IgG fueron el
cronológico de la notificación.
ensayo inmuno-enzimático (Elisa) y la
inmunofluorescencia indirecta (IFI) (8), con puntos Caso 1
de corte en 0,4 y 1:32, respectivamente. El Niña de seis meses, natural y procedente de zona
tratamiento, benzonidazol (Rochagán R), fue rural del municipio de Puerto Guzmán, Putumayo,
suministrado por el INS a todos los pacientes. llevada a consulta por una lesión supurante en
Resultados cuello presente desde el nacimiento, la cual no
cedió con antibióticos. En el examen físico se
Todos los casos se presentaron en zonas
encontró una lesión que sugería una fístula, según
endémicas conocidas por su infestación con
lo referido en la historia clínica. Con este
triatominos; 30% de ello se informó en Putumayo,
diagnóstico se programó para cirugía. En
dos en cada uno de los departamentos de Arauca,
exámenes prequirúrgicos se reportó la presencia
Casanare y Norte de Santander, y uno en
de tripomastigotes de T. cruzi en extendido de
Santander, todos en residentes en zonas rurales,
sangre periférica. Se prescribió tratamiento
incluidos dos soldados en ejercicio. La presunta
etiológico con benzonidazol por 60 días. El
vía de transmisión fue vectorial, pero sólo en el
diagnóstico fue confirmado mediante aislamiento,
30% de los casos los pacientes manifestaron
cultivo, isoenzimas, inoculación en ratón y PCR.
convivir con el vector.
Caso 2
Setenta por ciento de los pacientes era adulto,
con edades entre los 18 y los 50 años, y 30% Mujer de 50 años, procedente de zona rural del
niños con edades entre los seis meses y los dos municipio de Saravena, Arauca. Presentó un

10
Biomédica 2007;27(supl. 1):8-17 Chagas agudo en Colombia 2002-2005

cuadro clínico de 15 días de evolución consistente se envió suero para confirmación en el INS, como
en fiebre, deposiciones diarréicas y, posterior- tampoco información más detallada acerca de la
mente, disnea, el cual la obligó a consultar en historia clínica. Se prescribió tratamiento con
varias ocasiones. La sintomatología, especial- benzonidazol a dosis de 300 mg/día por 60 días.
mente la disnea, empeoró, por lo cual consultó
Caso 5
nuevamente, encontrándose en el examen físico
signos claros de insuficiencia cardiaca. En la Hombre de 26 años, procedente de zona rural del
radiografía de tórax se evidenció cardiomegalia y municipio de Tibú, Norte de Santander. Consultó
derrame pleural, y el ecocardiograma reportó por cuadro de cinco días de fiebre, escalofríos,
taponamiento cardiaco. Se la programó para dolores musculares, cefalea, artralgias, astenia y
cirugía, se le realizó ventana pericárdica, y en el adinamia. Se realizó estudio para hemoparásitos,
líquido pericárdico obtenido se encontraron encontrándose ocasionales tripomastigotes,
tripomastigotes de T. cruzi según lo reportado por según el reporte del Laboratorio Clínico del Hospital
el Laboratorio Clínico del Hospital Erasmo Meoz. Erasmo Meoz. El ecocardiograma mostró leve
Luego de un mes de hospitalización y tratamiento derrame pericárdico y leve dilatación ventricular
médico en cuidados intensivos, la paciente izquierda. Además, se encontró franca leucopenia
evolucionó hacia la mejoría y se inició tratamiento (3.200 leucocitos/µl) y plaquetopenia (69.000
etiológico con benzonidazol en dosis de 350 mg/ plaquetas/µl). Se administró tratamiento etiológico
día por 60 días. Se logró aislamiento del parásito, con benzonidazol en dosis de 350 mg/día por 60
cultivo, e identificación por isoenzimas y PCR. días. El diagnóstico se confirmó por lectura de
Caso 3 lámina de extendido de sangre periférica en el INS.

Hombre de 35 años, proveniente de zona rural del Caso 6


municipio de Támara, Casanare. En la historia Hombre de 16 años, procedente de zona rural del
clínica se registró un cuadro de doce días de municipio El Peñón, Santander. Consultó por cuadro
evolución, cuya única manifestación fue la fiebre, de cinco días de evolución consistente en eritema
y examen físico normal. Se realizó gota gruesa y edema palpebral izquierdo progresivo asociado
encontrándose formas de T. cruzi, según el reporte a secreción ocular purulenta. En el examen físico
del Laboratorio Departamental de Salud Pública se encontró edema palpebral y conjuntiva
de Casanare. En el mismo laboratorio se realizó izquierda hiperémica sin secreciones. Se hizo
determinación de anticuerpos específicos tipo IgG diagnóstico de celulitis periorbitaria y se inició
mediante Elisa e IFI con resultados positivos. Se manejo antibiótico ambulatorio. Un año después
administró tratamiento etiológico con benzonidazol consultó por cuadro de tres días consistente en
a dosis de 300 mg/día por 60 días. El diagnóstico debilidad, fiebre subjetiva, disnea, cefalea,
fue confirmado por extendido de sangre periférica malestar general y dolor faríngeo. En la ficha epide-
e IFI reactivo 1:128, en el INS. miológica se consignó signo de Romaña positivo
Caso 4 (probablemente en retrospectiva). Se realizaron
pruebas serológicas, reportadas como Elisa
Hombre de 31 años, soldado, procedente del positivo e IFI reactivo con título de 1:32, por parte
municipio de Girón, Santander. Consultó en del Laboratorio Departamental de Salud Pública
repetidas ocasiones, por cuadro de astenia, de Santander. Se administró tratamiento etiológico
adinamia y fiebre esporádica. Luego de cuatro con benzonidazol a una dosis de 250 mg/día
meses de esta sintomatología y múltiples manejos durante 60 días. El diagnóstico fue confirmado
médicos, se realizó gota gruesa encontrándose mediante serología por IFI reactiva 1:64 en el INS.
formas de T. cruzi según el reporte del Laboratorio No se envió muestra de sangre para cultivo.
Clínico del Hospital San Juan de Dios de Girón,
Caso 7
confirmado por el Laboratorio Departamental de
Salud Pública de Santander. Según este último, Soldado de 18 años, natural de Ibagué y
las pruebas serológicas IgG fueron negativas. No procedente de Putumayo. Consultó por cuadro de

11
Nicholls R.S., Cucunubá Z.M., Knudson A. et al Biomédica 2007;27(supl. 1):8-17

ocho días consistente en mareo, fiebre


intermitente de predominio nocturno y cefalea fron-
tal intensa; además informó caída desde su propia
altura con pérdida de la conciencia. Se realizó
extendido de sangre periférica encontrándose dos
formas de tripomastigotes de T. cruzi, según el
Laboratorio del Establecimiento de Sanidad Militar
“Simona de Luz Duque de Alzate”. Se prescribió
tratamiento con benzonidazol por 60 días. El
diagnóstico se comprobó por medio de lectura de
lámina (Figura 1), aislamiento, cultivo, isoenzimas,
inoculación en ratón y PCR, a pesar de lo cual el
paciente presentó pruebas serológicas para
Figura 1. Tripomastigote en sangre periférica de un paciente
anticuerpos IgG persistentemente negativas (una con enfermedad de Chagas en fase aguda.
prueba Elisa a los 12 días de enfermedad en el
Laboratorio Departamental de Salud Pública y dos
pruebas IFI en el INS con intervalo de un mes antibióticos. Sin embargo, la paciente persistió
durante un periodo de dos meses). sintomática con picos febriles repetidos; se realizó
estudio para hemoparásitos encontrándose
Caso 8 tripomastigotes de T. cruzi, según informe del
Niño de dos años procedente del área rural de Laboratorio Clínico del Hospital Erazmo Meoz. Se
Casanare. Fue llevado a consulta por presentar administró tratamiento etiológico con benzonidazol
fiebre de un mes de evolución y síntomas de en dosis de 300 mg/día por 60 días. El diagnóstico
faringitis, por lo que recibió manejo antibiótico en fue confirmado en el INS por lámina de extendido
dos oportunidades. Sin presentar mejoría, consultó de sangre periférica, y serología reactiva por IFI
nuevamente por persistencia de fiebre y aparición 1:64. El cultivo fue negativo cuatro meses
de edemas. Le fue realizada radiografía de tórax después de tomado. Posteriormente, el
que evidenció cardiomegalia. El ecocardiograma Laboratorio Departamental de Salud Pública de
reportó miocardiopatía y derrame pericárdico y Norte de Santander informó Western blot positivo
pleural, por lo cual fue remitido a Bogotá donde para VIH.
se inició manejo médico. Se realizó serología para Caso 10
Chagas con resultado positivo, confirmado con
IFI reactivo 1:32, por el Laboratorio del Hospital Niño de dos años y medio de edad, procedente
de La Misericordia. El paciente presentó evolución de zona rural del municipio de Puerto Leguízamo,
favorable. Se administró tratamiento etiológico con Putumayo. Fue llevado al Hospital de María
benzonidazol en dosis de 100 mg/día por 60 días. Angelines por presentar un cuadro de 15 días
El diagnóstico fue comprobado en el INS por medio consistente en fiebre alta e intermitente, astenia
de aislamiento, cultivo, isoenzimas, inoculación y adinamia. El examen físico reveló fiebre,
en ratón y PCR. adenopatías múltiples y leve hepatoesple-
nomegalia. Se realizó gota gruesa lográndose
Caso 9 identificar tripomastigotes de T. cruzi. La
Mujer de 38 años, procedente de zona rural de radiografía de tórax y el electrocardiograma fueron
Durania, Norte de Santander. Consultó por cuadro normales. El cuadro cedió rápidamente, se inició
de 15 días consistente en fiebre, escalofrío, tratamiento etiológico con benzonidazol en dosis
osteomialgias y malestar general. Los paraclínicos de 100 mg/día por 60 días. El diagnóstico fue
diagnosticaron infección de vías urinarias y se confirmado en el INS por lámina de extendido de
inició manejo antibiótico. Sin presentar mejoría sangre periférica y cultivo positivo un mes depués
consultó nuevamente; se diagnosticó enfermedad de tomado. La serología inicial con técnica de IFI
pélvica inflamatoria, la cual se manejó con a los cinco días de sintomatología fue negativa,

12
Biomédica 2007;27(supl. 1):8-17 Chagas agudo en Colombia 2002-2005

pero una segunda, a las dos semanas, fue positiva interpretación en retrospectiva de la fase aguda
con resultado 1:64. En estudio de campo no se ocurrida un año atrás (caso siete). Adicionalmente,
identificaron vectores ni otros pacientes infectados en el caso uno, la fístula en el cuello pudo haber
cuyas muestras fueron sometidas a extendido de tenido su origen en un chagoma. A pesar de que
sangre periférica y serología. Se logró aislar en en otras publicaciones se ha encontrado una
cultivo hasta luego de seis meses. La PCR fue incidencia alta, en esta serie de diez casos, no
reactiva. fue común encontrar los signos de puerta de
entrada (19,20).
Discusión
La manifestación más frecuente es la fiebre (18)
Hallazgos epidemiológicos y demográficos
presentándose en esta serie en el 90% de los
En todos los casos descritos, el principal casos (Cuadro 1). Esta no tiene una característica
antecedente epidemiológico fue la residencia en específica, puede ser intermitente ó incluso
una zona endémica para transmisión de T. cruzi manifestarse como síndrome febril prolongado sin
por triatominos (8). Se ha descrito que la mayoría otra sintomatología (4). En cuanto a síntomas
de pacientes con manifestaciones agudas de la neurológicos, en un caso se registró cefalea
enfermedad de Chagas son niños (9) pero la intensa, asociada con caída desde su propia altura
mayoría de los casos aquí descritos ocurrieron y pérdida de conciencia, pero el paciente se
en adultos, al igual que en otras series (18-20). recuperó rápidamente. La meningoencefalitis
chagásica aguda es una manifestación
La vía de transmisión probablemente fue vectorial.
especialmente frecuente en lactantes (4, 22), pero
Solamente tres pacientes conocían los triatominos
no se evidenció en ninguno de los dos niños de
y convivían con estos, pero únicamente se realizó
esta serie.
estudio de convivientes en uno de los casos y no
se hallaron otras personas afectadas. Debido a La evolución de la enfermedad chagásica aguda
esto, y a la actividad predominante en regiones es generalmente benigna, a pesar de lo cual 20%
selváticas, es probable que la infección en los de los casos presentó manifestaciones graves de
soldados y en algunos pacientes se adquiriera a compromiso cardiaco. En la Guyana Francesa,
través de vectores selváticos. No hubo nexo de se reportaron seis casos entre 1994 y 1999, todos
tipo espacial ni temporal entre los casos. Por en adultos, con miocarditis aguda, pericarditis,
estudios previos sobre distribución geográfica de falla cardiaca grave, disfunción sistólica y derrame
triatominos en Colombia se sabe que en todos pericárdico (19). En Brasil, de cuatro casos
los sitios de procedencia de los casos hay reportados recientemente, tres pacientes
presencia de triatominos (2,8).
Variabilidad clínica Cuadro 1. Distribución de signos y síntomas en los casos
de Chagas agudo 2002 a 2005.
La variabilidad en las manifestaciones clínicas y
los hallazgos paraclínicos fue predominante, tal Signos y síntomas Frecuencia
como lo describieron otros autores (18-20), n/N
especialmente en un estudio realizado en Fiebre 9/10
Venezuela entre los años 1988 y 1996, el cual Astenia/adinamia 4/10
describió 59 casos de Chagas agudo con 19 Cefalea 3/10
patrones sintomáticos (18). Cardiomegalia 3/10
Falla cardiaca 2/10
Los signos de puerta de entrada aparente más Edemas 2/10
Hepatomegalia 2/10
frecuentemente reportados son el complejo Signos entrada 2/10
oftalmo-ganglionar o signo de Romaña (20,21) y Derrame pleural 2/10
el chagoma de inoculación (4,9), pero en este Diarrea 2/10
informe solo se describió un caso con un posible Esplenomegalia 1/10
Adenopatías 1/10
signo de Romaña, probablemente como una

13
Nicholls R.S., Cucunubá Z.M., Knudson A. et al Biomédica 2007;27(supl. 1):8-17

presentaron franco taponamiento cardiaco, que presentó plaquetopenia y leucopenia importantes,


requirió tratamiento en unidad de cuidados que corrigieron sin otras complicaciones.
intensivos, y finalmente fallecieron (20). En la serie
Se ha propuesto la medición de algunos reactantes
que presentamos, el 30% de los pacientes
de fase aguda, tales como la velocidad de
presentaron miocarditis chagásica aguda; dos de
sedimentación globular y la proteína C reactiva,
ellos, un adulto y un niño, con manifestaciones
como marcadores de enfermedad aguda, pero
graves, a saber, falla cardiaca con cardiomegalia,
hasta el momento no se ha encontrado una clara
edemas, hepatomegalia y dificultad respiratoria. correlación (26,27). Un estudio realizado en una
En uno de estos casos se presentó taponamiento zona endémica de Bolivia encontró un importante
cardiaco que requirió cirugía (ventana pericárdica) incremento de alfa-2-microglobulina en niños con
y manejo en unidad de cuidado intensivo; el Chagas agudo (26, 28). En el actual informe, solo
electrocardiograma evidenció voltaje disminuido tres casos de los diez descritos tenían medición
y cambios de repolarización, tal como se ha de reactantes de fase aguda, y presentaban
descrito en otros informes (9,19). El otro paciente aumento en los valores de velocidad de
presentó cardiomegalia y derrame pericárdico leve sedimentación globular y, en el caso de mayor
sin evidenciar manifestaciones clínicas. Así, a gravedad, de la proteína C reactiva.
pesar de no evidenciarse clínicamente, la
miocarditis puede presentarse con una frecuencia Métodos diagnósticos
importante, tal como se informó en el reporte La parasitemia evidente es prácticamente
venezolano (18). exclusiva de la fase aguda y confirma el
Las reactivaciones en el contexto del sida, se diagnóstico, incluso sin necesidad de otros
acompañan de manifestaciones neurológicas en exámenes (29). Los métodos de concentración
75% a 90% de los casos, e incluso hacen parte como el Strout y el microhematocrito también se
de las patologías definitorias del sida (23,24). Se han utilizado, este último especialmente en recién
prevé que estas reactivaciones sean cada vez nacidos para diagnóstico de Chagas congénito,
más frecuentes por el aumento del sida en el pues al parecer aumenta la sensibilidad en la
mundo. El caso nueve presentó prueba visualización del parásito (4,30, Luquetti A. El
confirmatoria para VIH, lo cual sugiere que podría diagnóstico de la enfermedad de Chagas.
corresponder a una reactivación de una infección Diagnóstico serológico, xenodiagnóstico,
latente por T. cruzi adquirida previamente. Sin hemocultivo, PCR y examen directo”. P 227-30.
embargo, no presentó características clínicas En: Guhl F. Editor. Memorias. Primer Taller
propias de una reactivación, por lo cual Internacional sobre Control de la Enfermedad de
concluimos que más probablemente corresponde Chagas.Curso de Diagnóstico, Manejo y
a una primoinfección. Tratamiento de la Enfermedad de Chagas. Sexta
Reunión de la Iniciativa Andina para el Control de
Hallazgos paraclínicos la Enfermedad de Chagas. Bogotá D.C.: Ediciones
En este estudio sólo se logró obtener el Uniandes; 2005). El hemocultivo y el xeno-
electrocardiograma en cinco casos; tres de ellos diagnóstico, se usan generalmente en el contexto
fueron anormales; uno mostró bajo voltaje con de investigaciones (18). La PCR ha mostrado alta
sensibilidad pero, por su naturaleza, suele estar
trastornos de repolarización, otro signos de
disponible sólo en los laboratorios de referencia
hipertrofia ventricular izquierda y el último inversión
(31,32, Luquetti A. El diagnóstico de la
de la onda T en V4 a V6 ,aunque se trataba de un
enfermedad de Chagas. Diagnóstico serológico,
niño y este cambio no es necesariamente
xenodiagnóstico, hemocultivo, PCR y examen
patológico en ellos.
directo”. P 227-30. En: Guhl F. Editor. Memorias.
En el cuadro hemático se ha descrito la presencia Primer Taller Internacional sobre Control de la
de trombocitopenia leve en los casos de Chagas Enfermedad de Chagas.Curso de Diagnóstico,
agudo (25). En este reporte, solo uno de los casos Manejo y Tratamiento de la Enfermedad de

14
Biomédica 2007;27(supl. 1):8-17 Chagas agudo en Colombia 2002-2005

Chagas. Sexta Reunión de la Iniciativa Andina tiene una explicación, vale señalar que uno de
para el Control de la Enfermedad de Chagas. los pacientes en quien se comprobó el diagnóstico
Bogotá D.C.: Ediciones Uniandes; 2005). de Chagas agudo por medio de extendido de
sangre periférica, cultivo, isoenzimas y PCR,
En el 80% de los casos se realizó el diagnóstico
paradójicamente nunca presentó pruebas
por extendido de sangre periférica, observándose
serológicas positivas aún con tres mediciones
tripomastigotes de T. cruzi; inclusive en uno de
realizadas con un mes de intervalo entre cada
ellos se llegó al diagnóstico por examen en fresco
una de ellas.
de líquido pericárdico. Llama la atención que en
un caso se encontró parasitemia por gota gruesa En los cinco casos en que se obtuvo cultivo del
luego de cuatro meses de sintomatología. En el parásito, su caracterización molecular mediante
laboratorio se logró aislar y comprobar la presencia PCR permitió confirmar los aislamientos como T.
de la cepa de T. cruzi por medio de cultivo, cruzi y el análisis izoenzimático mostró que
inoculación en ratón, isoenzimas y PCR en seis correspondieron al grupo I, hallazgo esperado
casos. puesto que este es el grupo predominante en
Colombia (15,34).
Las pruebas serológicas son útiles especialmente
en las fases indeterminada y crónica, en las La enfermedad de Chagas aguda es un indicador
cuales se requieren dos pruebas positivas indirecto de la intensidad de transmisión en una
mediante técnicas de diferente principio para hacer zona. Teniendo en cuenta que el pronóstico y la
el diagnóstico (33,Luquetti A. El diagnóstico de la respuesta al tratamiento mejoran con un
enfermedad de Chagas. Diagnóstico serológico, diagnóstico oportuno, la detección de casos
xenodiagnóstico, hemocultivo, PCR y examen agudos es una estrategia para prevenir la fase
directo”. P 227-30. En: Guhl F. Editor. Memorias. crónica. Por esto, es de vital importancia la
Primer Taller Internacional sobre Control de la búsqueda de casos en todas sus presentaciones
Enfermedad de Chagas.Curso de Diagnóstico, tanto sintomáticas como asintomáticas. Por tal
Manejo y Tratamiento de la Enfermedad de razón, siempre debe realizarse una búsqueda
Chagas. Sexta Reunión de la Iniciativa Andina activa de casos de infección en los familiares o
para el Control de la Enfermedad de Chagas. convivientes con el caso índice.
Bogotá D.C.: Ediciones Uniandes; 2005). Las más Finalmente, es fundamental enfatizar en la calidad
frecuentemente utilizadas son Elisa, IFI y de historias clínicas y las muestras que son
hemaglutinación indirecta (8,33). La determinación enviadas al INS para confirmación diagnóstica,
de IgM por IFI se ha utilizado para definir la fase ya que esta es una fuente de información muy
aguda de la enfermedad de Chagas; su nivel de- importante que permite tomar decisiones en
tectable en sangre aparece a partir de los días 10 cuanto al manejo y seguimiento clínico de los
a 15 de sintomatología (4,30), con un pico entre pacientes, y constituye un elemento esencial para
los días 17 a 45 (34). Sin embargo, se sabe que la vigilancia en salud pública de este evento en
la IgG detectada por IFI puede positivizarse desde Colombia.
la fase aguda incluso en el primer mes, mientras
que por Elisa en general sólo se positivizan luego Adendo
de 30 días de sintomatología (4). Esto coincide En el período 1 de enero a 10 de octubre de 2006,
con los hallazgos en algunos de los casos se informaron cinco casos de enfermedad de
informados, pues se encontraron pruebas Chagas aguda en los departamentos de Vaupés
positivas de IFI para IgG en cinco de los (2), Casanare (2), y Putumayo. El primero fue una
pacientes. Este dato es de gran utilidad en nuestro niña de dos años procedente de Mitú, Vaupés,
medio, pues generalmente los Laboratorios quien presentó fiebre y signo de Romaña. El
Departamentales de Salud Pública cuentan con segundo, un soldado de 25 años procedente
la técnica de IFI para IgG más no para IgM. Como también de Mitú, quien presentó fiebre, astenia y
hallazgo llamativo, y para el cual todavía no se esplenomegalia. El tercero y cuarto casos se

15
Nicholls R.S., Cucunubá Z.M., Knudson A. et al Biomédica 2007;27(supl. 1):8-17

presentaron en dos hermanas de dos y cuatro años 6. Guhl F, Vallejo GA. Interruption of Chagas disease
transmission in the Andean Countries: Colombia. Mem
procedentes de Paz de Ariporo, Casanare, ambas
Inst Oswaldo Cruz 1999;94 (Suppl. 1):413-5.
presentaron mal estado nutricional, fiebre y
7. Rosas F, Guhl F, Velasco V, Jumbo L, Jaramillo C,
miocarditis con falla cardiaca grave. El quinto
Rodríguez D et al. Morbilidad de la enfermedad de
caso en una niña de 13 años procedente de zona Chagas en fase crónica en Colombia. Detección de
rural del municipio Puerto Asís, Putumayo, quien pacientes chagásicos con cardiopatía en un área
presentó fiebre asociada con anemia. Todos los endémica del departamento de Boyacá. Rev Col Cardiol
2002;9:349-58.
casos recibieron benzonidazol, evolucionando
satisfactoriamente. El diagnóstico se realizó en 8. Guhl F, Nicholls RS. Manual de procedimientos para
el diagnóstico de la enfermedad de Chagas. Bogotá
todos los casos por visualización del parásito en D.C.: Quebecor Impresores;2001.p.12-58.
sangre y las pruebas serológicas para IgG fueron
9. Sociedad Argentina de Cardiología. Consenso de
positivas. Los estudios de PCR fueron positivos enfermedad de Chagas. Rev Argent Cardiol 2002;70
para T. cruzi en los primeros cuatro casos. Hasta (Suppl. 1):13-39.
el momento no se ha logrado aislar ninguna de 10. Rodriques Coura J, de Castro SL. A critical review
estas cepas. Se realizó estudio de campo en los on Chagas disease chemotherapy. Mem Inst Oswaldo
casos de los niños, encontrando vectores en los Cruz 2002;97:3-24
hogares. 11. Kirchhoff LV. Chagas disease. American trypanoso-
miasis. Infect Dis Clin North Am 1993;7:487-502.
Conflicto de intereses
12. Cáceres D, Nicholls RS, Corredor A, Gualdrón L,
Los autores manifestamos expresamente que Slait E, Dib J et al. Investigación de un brote de
durante la realización del presente trabajo no síndrome febril con miocarditis aguda en Guamal,
Magdalena, 7 a 11 de junio de 1999. Inf Quinc Epidemiol
existió conflicto de interés alguno que pudiera Nac 1999;4:170-8.
afectar los resultados obtenidos.
13. Duque S, Pelaez D, Corredor A. Normas para cultivo
Financiación in vitro de parásitos de la familia Tripanosomatidae.
Manual de procedimientos. Bogotá: Instituto Nacional
Este trabajo fue financiado por el Instituto Nacional de Salud;1993. Cap VI.p.41.
de Salud. 14. Santana L, Montilla M, Nicholls S, Puerta C.
Variación antigénica de la cepa Munantá de Trypa-
Referencias nosoma cruzi después de pase por ratón. Biomédica
1. UNDP/ UNDP/World Bank/WHO Special Program for 1998;18:134-40.
Research and Training in Tropical Disease, 1997. 15. Montilla M, Guhl F, Jaramillo C, Nicholls S, Barnabe
Tropical Disease Research (TDR), Thirteenth Program C, Bosseno MF et al. Isoenzyme clustering of
Report. Geneve:WHO;1997.p.113-23. trypanosomatidae Colombian populations. Am J Trop
2. Guhl F, Restrepo M, Angulo VM, Antunes CM, Med Hyg 2002;66:394-400.
Campbell-Lendrum D, Davies CR. Lessons from a 16. Pavía P, Cuervo C, Montilla M, Nicholls S, Puerta,
national survey of Chagas disease transmission risk in C. Diseño y estandarización de una prueba de PCR
Colombia. Trends Parasitol 2005;21:259-62. para la detección específica de Trypanosoma cruzi .
3. Dias JC, Silveira AC, Schofield CJ. The impact of Infectio 2003;7:129-36.
Chagas disease control in Latin America: a review. Mem 17. Vallejo GA, Guhl F, Chiari E, Macedo AM. Species
Inst Oswaldo Cruz 2002;97:603-12. specific detection of Trypanosoma cruzi and Trypano-
soma rangeli in vector and mammalian hosts by poly-
4. Rassi A, Rassi AJ, Rassi G. Fase aguda. En: Brener
merase chain reaction amplification of kinetoplast
Z, Andrade ZA, Barral-Neto M, editors. Trypanosoma
minicircle DNA. Acta Trop 1999;72:203-12.
cruzi e doenca de Chagas. Second Edition. Rio de
Janeiro:Guanabara Koogan;2000.p.231-45. 18. Añez N, Carrasco H, Parada H, Crisante G, Rojas A,
Gonzalez N et al. Acute Chagas’ disease in western
5. Gurtler RE, Chuit R, Cecere MC, Castanera MB,
Venezuela: a clinical, seroparasitologic, and epidemio-
Cohen JE, Segura EL. Household prevalence of se-
logic study. Am J Trop Med Hyg 1999;60:215-22.
ropositivity for Trypanosoma cruzi in three rural vil-
lages in northwest Argentina: environmental, demo- 19. Carme B, Aune I, Nguyen G, Aznar C, Beaudet B.
graphic, and entomologic associations. Am J Trop Med Four cases of acute chagasic myocarditis in French
Hyg 1998;59:741-9. Guiana. Am J Trop Med Hyg 2001;64:162-3.

16
Biomédica 2007;27(supl. 1):8-17 Chagas agudo en Colombia 2002-2005

20. Pinto AY, Valente SA, Valente Vda C. Emerging acute 28. Medrano-Mercado N, Luz MR, Torrico F, Tapia G,
Chagas disease in Amazonian Brazil: case reports with Van Leuven F, Araujo-Jorge TC. Acute-phase pro-
serious cardiac involvement. Braz J Infect Dis 2004;8: teins and serologic profiles of chagasic children from
454-60. an endemic area in Bolivia. Am J Trop Med Hyg
1996;54:154-61.
21. Mazza S, Miiraya S, Jorg M. Naturaleza de la reacción
conjuntival en el primer periodo de la enfermedad de 29. Ministerio de Salud. Dirección General de Salud
Chagas. En: Investigaciones sobre la enfermedad de Pública. Grupo de Vigilancia en Salud Pública. Sistema
Chagas. Publicación número 69. Buenos Aires: de Vigilancia en Salud Pública - SIVIGILA. La Vigilancia
Universidad de Buenos Aires, Misión de Estudios de en Salud Pública de eventos transmisibles y de fuente
Patología Regional Argentina; 1945. común. Tripanosomiasis americana. Protocolos. Santa
Fe de Bogotá: Ministerio de Salud; 2000.p.1-9.
22. León-Sarmiento F, Prada D, Bayona J, Valderrama
V, García I, León M et al. Neurotripanosomiasis 30. Lorca M. La enfermedad de Chagas congénita, trans-
americana: aspectos clínicos de un problema básico. fusional y otras vías en el contexto de la interrupción
Biomédica 2003;23:462-75. vectorial. Rev Patol Trop 2002;31:86-9.

23. Vaidian AK, Weiss LM, Tanowitz HB. Chagas’ dis- 31. Olivares-Villagomez D, McCurley TL, Vnencak-
ease and AIDS. Kinetoplastid Biol Dis 2004;3:1-6. Jones CL, Correa-Oliveira R, Colley DG, Carter CE.
Polymerase chain reaction amplification of three differ-
24. Madalosso G, Pellini AC, Vasconcelos MJ, Ribeiro ent Trypanosoma cruzi DNA sequences from human
AF, Weissmann L, Oliveira Filho GS et al. Chagasic chagasic cardiac tissue. Am J Trop Med Hyg 1998;59:
meningoencephalitis: case report of a recently included 563-70.
AIDS-defining illness in Brazil. Rev Inst Med Trop Sao
Paulo 2004;46:199-202. 32. Antas PR, Medrano-Mercado N, Torrico F, Ugarte-
Fernandez R, Gomez F, Correa Oliveira R et al.
25. Tribulatti MV, Mucci J, Van Rooijen N, Leguizamon Early, intermediate, and late acute stages in Chagas’
MS, Campetella O. The trans-sialidase from Trypa- disease: a study combining anti-galactose IgG, spe-
nosoma cruzi induces thrombocytopenia during acute cific serodiagnosis, and polymerase chain reaction
Chagas’ disease by reducing the platelet sialic acid analysis. Am J Trop Med Hyg 1999;61:308-14.
contents. Infect Immun 2005;73:201-7.
33. Umezawa ES, Luquetti AO, Levitus G, Ponce C,
26. Medrano NM, Luz MR, Cabello PH, Tapia GT, Van Ponce E, Henriquez D et al. Serodiagnosis of chronic
Leuven F, Araujo-Jorge TC. Acute Chagas’ disease: and acute Chagas’ disease with Trypanosoma cruzi
plasma levels of alpha-2-macroglobulin and C-reactive recombinant proteins: results of a collaborative study
protein in children under 13 years in a high endemic in six Latin American countries. J Clin Microbiol
area of Bolivia. J Trop Pediat 1996;42:68-74. 2004;42:449-52.
27. Melo Coutinho CM, Cavalcanti GH, Bonaldo MC, 34. Devera R, Fernandes O, Coura JR. Should Trypano-
Mortensen RF, Araujo-Jorge TC. Trypanosoma cruzi: soma cruzi be called “cruzi” complex? A review of the
detection of a surface antigen cross-reactive to human parasite diversity and the potential of selecting popula-
C-reactive protein. Exp Parasitol 1998;90:143-53. tion after in vitro culturing and mice infection. Mem Inst
Oswaldo Cruz 2003;98:1-12.

17
Santander
Biomédica S.P., Cuéllar A.,
2007;27(supl. Thomas M.del C. et al
1):18-27 Biomédica 2007;27(supl. 1):18-27

ARTÍCULO ORIGINAL

Expresión de marcadores en células dendríticas de pacientes


chagásicos crónicos estimuladas con la proteína KMP-11 y el
péptido K1 de Trypanosoma cruzi
Sandra Paola Santander 1+, Adriana Cuéllar 2+, María del Carmen Thomas 3,
Fanny Guzmán 4, Alberto Gómez 5, Manuel Carlos López 3,
Concepción Puerta 1
1
Laboratorio de Parasitología Molecular, Departamento de Microbiología, Facultad de Ciencias, Pontificia
Universidad Javeriana, Bogotá, D.C., Colombia.
2
Laboratorio de Inmunobiología y Biología Celular, Departamento de Microbiología, Facultad de Ciencias,
Pontificia Universidad Javeriana, Bogotá, D.C., Colombia.
3
Departamento de Biología Molecular, Instituto de Parasitología y Biomedicina López Neyra, CSIC, Granada,
España.
4
Facultad de Medicina, Universidad Nacional de Colombia, Bogotá, D.C., Colombia.
5
Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana, Bogotá, D.C.,
Colombia.
+ Autores con participación equivalente en el trabajo.

Introducción. La proteína de membrana 11 de kinetoplástidos, KMP-11, de Trypanosoma


cruzi induce inmunidad humoral y celular en ratones capaz de conferir protección frente al reto
con el parásito.
Objetivo. Determinar la expresión de marcadores de maduración en las células dendríticas de
pacientes chagásicos crónicos e individuos sanos, estimuladas con la proteína KMP-11 y su
péptido amino terminal K1.
Materiales y métodos. Monocitos de siete pacientes chagásicos y siete individuos sanos
fueron diferenciados a células dendríticas y estimulados con la proteína KMP-11 y el péptido
K1, determinándose por citometría de flujo y tras 7 días de cultivo, la expresión de los marcadores
de superficie CD83, CD86 y HLA-DR y la producción de citocinas.
Resultados. La proteína KMP-11 y el péptido K1 no indujeron la expresión del marcador de
maduración CD83 en las células dendríticas de pacientes y controles. La exposición de células
dendríticas de pacientes chagásicos de forma simultánea al péptido K1 y LPS mostró una
disminución de la expresión de CD86 y CD83 con relación a la estimulación con LPS sólo, a
diferencia de las células de controles sanos. También se evidenció una disminución en la
producción de interleucina-12 en las células dendríticas de pacientes en relación a las de los
controles.
Conclusiones. La proteína KMP-11 no tiene un efecto significativo sobre la maduración de las
células dendríticas, pero su péptido K1 en presencia de LPS induce una disminución en la
expresión de CD86 y CD83 y en la producción de la interleucina-12 que podría modular la
respuesta inmune in vivo y en particular la estimulación de los linfocitos T.
Palabras clave: enfermedad de Chagas, interleucina-12, Trypanosoma cruzi
Expression of markers on dendritic cells from chronic chagasic patients stimulated with
the KMP-11 protein and the K1 peptide from Trypanosoma cruzi
Introduction. The kinetoplastid membrane protein 11, KMP-11, from Trypanosoma cruzi elicits
humoral and cellular immunity in mice that protects them from infection against further parasite
challenge.
Objective. To characterize the expression of surface markers on dendritic cells from chronic
chagasic patients and healthy individuals, in response to the KMP-11 protein from Trypanosoma
cruzi and its N-terminal peptide K1.

18
Biomédica 2007;27(supl. 1):18-27 Maduración de células dendríticas de pacientes chagásicos

Materials and methods. Monocyte-derived dendritic cells from seven chronic chagasic patients
and seven healthy individuals were stimulated with the KMP-11 protein and the K1 peptide.
Seven days after culturing, the CD83, CD86, and HLA-DR membrane expression as well as
the production of cytokines were evaluated by flow cytometry.
Results. Neither KMP-11 protein nor K1 peptide elicited the expression of the maturation
marker CD83 on dendritic cells of patients or healthy control individuals. Dendritic cells from
chronic chagasic patients exposed to K1 and LPS at the same time presented a significant
reduction in CD86 and CD83 membrane expression in contrast to the cells exposed to LPS
alone, whereas dendritic cells from healthy individuals did not show this behavior. The secretion
of interleukin-12 was decreased in the cultures of dendritic cells from chronic chagasic patients
but not from healthy controls.
Conclusions. KMP-11 protein does not affect the maturation of dendritic cells, but in the presence
of LPS the K1 peptide leads to a decreased expression of CD86 and CD83 as well as interleukin-
12 production, This phenomenon may be associated with an impaired T cell stimulation.
Key words: Chagas disease, Interleukin-12, Trypanosoma cruzi

Las células dendríticas estimulan linfocitos T La mayoría de humanos infectados por este
maduros que no han tenido contacto con el parásito sobreviven a la fase aguda inicial, pero
antígeno gracias a la alta expresión de moléculas algunos desarrollan enfermedad crónica, lo cual
del complejo mayor de histocompatibilidad, indica que la respuesta generada en estos
moléculas coestimuladoras como CD80 y CD86 individuos no es capaz de controlar la infección,
y moléculas de adhesión como ICAM-1 e ICAM-3 permitiendo la supervivencia del parásito en los
(1). En la periferia, las células dendríticas se tejidos y dando lugar al desarrollo de lesiones
especializan para capturar antígenos por focales inflamatorias, características de la fase
endocitosis mediada por receptor o macro- crónica de la enfermedad (6).
pinocitosis, y una vez activadas por antígenos, Varias líneas de evidencia sugieren que la función
migran a los órganos linfoides proximales (2). de las células dendríticas es alterada por T. cruzi.
Durante esta migración pierden capacidad Es así como células dendríticas derivadas de
fagocítica y aumentan la expresión de las monocitos pueden ser infectadas por el parásito,
moléculas relacionadas con la presentación permitiendo su multiplicación intracelular con
antigénica, proceso conocido como maduración. consecuencias funcionales en células dendríticas
Una vez en los órganos linfoides, las células inmaduras y alteración de su maduración inducida
dendríticas maduras tienen un papel importante por el lipopolisacárido (LPS) (7). Estas alteraciones
en la instrucción de las células T para definir su funcionales incluyen disminución de la producción
polarización hacia una respuesta Th1 o Th2 (3). de la interleucina-12 (IL-12), factor de necrosis
Trypanosoma cruzi es un parásito protozoo tumoral α (TNFα) y de la expresión de moléculas
hemoflagelado, agente causal de la enfermedad de superficie tales como HLA-DR y CD40. También
de Chagas, entidad que afecta a 18 millones de se ha visto que células dendríticas infectadas con
personas en 15 países endémicos, con una T. cruzi tienen poca capacidad para presentar
incidencia anual de 200.000 nuevos casos (4). péptidos antigénicos a células T CD8+ y, por lo
En Colombia, se estima que hay cerca de 700.000 tanto, inducen bajos niveles de interferón gamma
personas infectadas, un 23% de la población en (IFNγ), efecto probablemente relacionado con la
riesgo de contraer la enfermedad y entre 30 y 40 disminución en la expresión de moléculas de clase
mil nuevos casos anuales (5). I del sistema mayor de histocompatibilidad (8).

Correspondencia: Aunque diferentes antígenos del parásito han sido


Concepción Puerta caracterizados y examinados para estudiar su
Tel.:(+571) 3208320 ext 4024, Fax (571) 3208320, ext 4021 capacidad de estimulación de respuesta inmune,
cpuerta@javeriana.edu.co son pocos los que han demostrado capacidad para
Recibido: 19/08/05; aceptado: 27/12/05 inducir respuesta protectora (9-11). Así, la proteína

19
Santander S.P., Cuéllar A., Thomas M.del C. et al Biomédica 2007;27(supl. 1):18-27

11 de membrana de los cinetoplástidos, KMP-11, Síntesis del péptido K1 y obtención de la


fusionada a la proteína de choque térmico HSP70 proteína KMP-11
del parásito, induce tanto inmunidad humoral como
El péptido sintético K1 (TLEEFSAKL) de la
celular en ratones y también es capaz de proteger
proteína KMP-114-12 (9) fue sintetizado en fase
a los animales inmunizados frente a un posterior
sólida y purificado mediante cromatografía líquida
reto con el parásito (9,12). Adicionalmente, el
de alta presión (HPLC) (14). La proteína
péptido correspondiente a los aminoácidos 4 a 12
recombinante KMP-11 se obtuvo de acuerdo con
de la región N-terminal de la proteína KMP-11 de
lo reportado previamente (15). Brevemente, el
T. cruzi, denominado K1, es un epítope inmuno-
ADN correspondiente a la región codificante de la
dominante en la inducción de respuesta citotóxica
proteína fue digerido con las enzimas MscI y RsaI,
de células T CD8+ de ratones inmunizados con
subclonado en el vector de expresión pQE31 y
la proteína de fusión KMP-11/HSP70 (9). Así
expresado en células de Escherichia coli.
mismo, estudios recientes en pacientes
chagásicos demuestran que el péptido K1 no sólo Obtención de células dendríticas derivadas de
es reconocido y procesado de manera natural monocitos e inducción del proceso de
durante la infección, sino que induce la producción maduración
de IFNγ por parte de linfocitos T CD8+, los cuales A partir de 40 ml de sangre anticoagulada con
presentan, además, actividad citotóxica (13). heparina se obtuvieron células mononucleares de
Teniendo en cuenta la importancia de las células sangre periférica (CMSP) por gradientes de
dendríticas en la inducción de respuesta inmune densidad con Ficoll-Hypaque (Sigma, St Louis,
y el papel de la proteína KMP-11 en la inducción MO). Los monocitos fueron separados con
de inmunidad protectora en los modelos anticuerpos monoclonales anti-CD14 (BD
estudiados, en el presente estudio se evaluó el Pharmingen) acoplados a perlas magnéticas
potencial para inducir la maduración in vitro de utilizando el sistema de MiniMaCs (Miltenyi
células dendríticas derivadas de monocitos de Biotech GMBH, Bergisch, Gladbach, Germany).
pacientes chagásicos crónicos por parte de la Las células obtenidas fueron lavadas en medio
proteína KMP-11 y el péptido K1 de T. cruzi. base RPMI 1640 (Invitrogen, Life Tecnologies,
Carlsbad, CA) suplementado con 2% de suero fetal
Materiales y métodos bovino (SFB, Sigma, St Louis, MO). La viabilidad
Población en estudio y el número de las células se evaluaron por medio
de coloración con azul de tripán y conteo celular
Se seleccionaron siete pacientes con en cámara de Newbauer, respectivamente. La
cardiomiopatía chagásica crónica, con edades pureza de la población se evaluó por citometría
comprendidas entre 35 y 85 años, que acudieron de flujo utilizando el anticuerpo anti-CD14.PE (BD
a la consulta de Cardiología del Hospital San Pharmingen). Las células CD14+ así obtenidas
Ignacio, Bogotá, Colombia. Dichos pacientes fueron diferenciadas a células dendríticas
presentaron historia clínica, exámenes de inmaduras mediante incubación en medio RPMI
diagnóstico clínico (electrocardiograma), prueba 1640 completo (antibióticos, aminoácidos no
tamiz (Chagatek®) y pruebas confirmatorias esenciales, piruvato de sodio y 10% de SFB) en
(inmunofluorescencia indirecta y ELISA) placas de 48 pozos a una densidad de 5x105 por
compatibles con la enfermedad. Con el fin de ml en presencia de 1.000 U/ml de IL-4 y 50 ng/ml
comparar los resultados obtenidos, se incluyeron de GM-CSF (R&D system) durante 5 días de
siete individuos controles sanos del mismo grupo cultivo, verificándose su morfología por microscopía
de edad, que acudieron voluntariamente al de luz. En el día 5 se adicionaron 6 µg/ml de KMP-
Hospital San Ignacio, cuyas pruebas serológicas 11 en presencia o ausencia de 10 µg/ml de
para T. cruzi fueron negativas y el examen clínico, polimixina B durante 48 horas. Por otra parte, 10
normal. El presente estudio fue evaluado y µg/ml del péptido K1 fueron adicionados en
aprobado por el Comité de Ética de la Facultad presencia o ausencia de 1 µg/ml de LPS durante
de Ciencias de la Pontificia Universidad Javeriana. 48 horas. Cada ensayo se realizó por duplicado.

20
Biomédica 2007;27(supl. 1):18-27 Maduración de células dendríticas de pacientes chagásicos

Como control positivo de maduración se utilizó 1 marcadores de células dendríticas de pacientes


µg/ml de LPS. Como control negativo, se cultivaron con Chagas y controles sanos, se utilizaron
las células dendríticas inmaduras sin estímulo de células dendríticas diferenciadas a partir de
maduración durante 7 días. La presencia de monocitos de sangre periférica (células
marcadores de células dendríticas maduras se dendríticas inmaduras), las cuales fueron
evaluó por citometría de flujo (16). Todos los expuestas a la proteína KMP-11 en presencia o
reactivos fueron probados para la presencia de ausencia de polimixina B o al péptido K1 en
LPS mediante la prueba de amebocitos de presencia o ausencia de LPS. Aunque la prueba
Lymulus spp. (Bio Whittaker). para detección de LPS en todos los reactivos
Determinación de marcadores celulares por utilizados fue negativa, se utilizó polimixina B en
citometría de flujo los cultivos expuestos a la proteína KMP-11 como
inhibidor de la actividad de la endotoxina que
Los marcadores para células dendríticas se pudiera estar presente en niveles no detectables
evaluaron con anticuerpos anti CD14-APC, CD83- por la prueba de amebocitos de Lymulus spp.,
FITC, CD86-PE y HLA-DR-PerCP (BD Biosciences). con sensibilidad de 0,1 UE/ml.
La obtención de los datos se realizó usando un
citómetro de flujo FACSCalibur (BD Immunocyto- En todos los casos, la adición de IL-4 y GM-CSF
metry Systems). Los análisis se realizaron con el a los monocitos de sangre periférica indujo la
programa Cell Quest. pérdida en la expresión de la molécula CD14, lo
cual indica que los monocitos se diferenciaron a
Determinación de la producción de citocinas células dendríticas (datos no mostrados). Estas
La cuantificación de citocinas en los sobrenadantes células expresaron CD86 y HLA-DR y la
de cultivo de las células dendríticas se realizó el exposición al estímulo de maduración (LPS) indujo
día 7 con un estuche comercial de Cytometric un aumento en su expresión, así como la expresión
Bead Array (CBA, BD Biosciences), en el cual se del marcador de maduración CD83, sin diferencia
utilizan perlas de diferentes intensidades de entre pacientes y controles sanos (figura 1).
fluorescencia en FL3, cubiertas con anticuerpos Expresión de marcadores de células
de captura fluorescentes en FL2 para IL-8, IL-1β, dendríticas expuestas a la proteína KMP-11
IL-6, IL-10, TNFα e IL- 12p70. El cálculo de la con-
centración se realizó utilizando patrones de las La exposición de células dendríticas inmaduras
diferentes citocinas en concentraciones conocidas. de pacientes a la proteína KMP-11 de T. cruzi
La obtención de los datos se realizó usando un indujo una disminución no significativa del
citómetro de flujo FACSCalibur (BD Immunocy- marcador de coestimulación CD86 en comparación
tometry Systems). Para la adquisición y análisis con los controles sanos (figura 2A). En cuanto a
de los datos, se utilizó el programa Cell Quest. la expresión de HLA-DR, no se observaron
diferencias de expresión tras la adición de la
Análisis de los resultados proteína KMP-11 en las células dendríticas
Los resultados se muestran como el promedio y inmaduras procedentes de pacientes chagásicos
el error estándar de la media. Para establecer ni en las procedentes de controles sanos (figura
diferencias significativas, se utilizó la prueba no 2A). La adición de polimixina B no originó
paramétrica U de Mann-Withney con un nivel de modificación alguna del patrón de expresión
significación de 0,05. observado. La adición de la proteína KMP-11 a
células dendríticas inmaduras no indujo la
Resultados
expresión del marcador de maduración CD83.
El aislamiento de monocitos de sangre periférica
Expresión de marcadores de células
por selección positiva permitió obtener poblaciones
dendríticas expuestas al péptido K1
de células CD14+ con purezas mayores al 92%.
Con el fin de evaluar el efecto de la proteína KMP- Al igual que lo observado para la proteína KMP-
11 y el péptido K1 sobre la expresión de 11, la adición del péptido K1 a células dendríticas

21
Santander S.P., Cuéllar A., Thomas M.del C. et al Biomédica 2007;27(supl. 1):18-27

Figura 1. Expresión de marcadores en células dendríticas de 7 pacientes chagásicos (gris) y 7 controles sanos (blanco)
expuestas a LPS. Células dendríticas inmaduras (CDi) fueron diferenciadas a partir de monocitos CD14+ en presencia de
IL-4 y GM-CSF durante cinco días de cultivo. Para la obtención de células dendríticas maduras (CDm), las CDi previamente
obtenidas fueron expuestas durante 48 h a LPS. Los datos se muestran como promedio del porcentaje de células que
expresan los distintos marcadores analizados. Las barras sobre las columnas indican el error estándar de la media (ESM).
La significancia estadística de la diferencia de la expresión de los marcadores entre CDi y CDm fue de p = 0,007 para CD86
y CD83 en células de pacientes y controles, p = 0,02 para HLA-DR en las células de los pacientes y p = 0,007 en las de los
controles.

Figura 2. Expresión de marcadores en células dendríticas inmaduras de 7 pacientes chagásicos (gris) y 7 controles sanos
(blanco) estimuladas con la proteína KMP-11 (A) y el péptido K1 (B) el día 5 de cultivo durante 48 h. Los datos se muestran
como promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas
indican el error estándar de la media (ESM).

de pacientes chagásicos y controles sanos no las moléculas CD86 (p = 0,004) y CD83 (p = 0,003)
indujo la expresión del marcador de maduración frente a la que mostraron las células dendríticas
CD83. La adición del péptido K1 a células incubadas únicamente con LPS (figuras 3A y 3B).
dendríticas inmaduras indujo en las células de los Sin embargo, los resultados obtenidos no
pacientes chagásicos un incremento estadística- mostraron diferencias en la expresión de HLA-DR
mente no significativo en la expresión de CD86 y en las células de pacientes o individuos sanos
HLA-DR comparado con los niveles observados incubadas con K1 y LPS con respecto a lo
en controles sanos (figura 2B). observado en células dendríticas expuestas
únicamente a LPS (figura 3C).
Con el propósito de evaluar el efecto del péptido
K1 en la maduración de células dendríticas Determinación de las citocinas secretadas por
inducida por la adición de LPS, se expusieron las células dendríticas
células dendríticas inmaduras simultáneamente Con el fin de evaluar la actividad funcional de las
al péptido K1 y a LPS en el día 5 de cultivo. Los células dendríticas frente a los diferentes
resultados obtenidos mostraron que la adición del estímulos, se procedió a cuantificar la producción
péptido K1 dio lugar a una disminución de varias citocinas (IL-1β, TNF-α, IL-6, IL-8, IL-
estadísticamente significativa en la expresión de 10 e IL-12) en el sobrenadante de los cultivos. Al

22
Biomédica 2007;27(supl. 1):18-27 Maduración de células dendríticas de pacientes chagásicos

comparar las células dendríticas de pacientes y de moléculas en su superficie y de moléculas


controles en presencia de LPS con o sin el péptido secretadas que generan señales que influencian
K1, no se observaron diferencias significativas el crecimiento, la muerte y la diferenciación de la
en la producción de citocinas. Sin embargo, los célula T (17,18). Las células dendríticas tienen la
resultados mostraron un descenso estadística- capacidad de inducir la polarización de la
mente significativo (p = 0,02) en la secreción de respuesta linfoide hacia Th1 o Th2, dependiendo
IL-12 por parte de las células dendríticas de del patrón de moléculas que expresen o secreten.
pacientes chagásicos expuestas al péptido K1 y Por ejemplo, la secreción de IL-12 por células
LPS comparado con las células dendríticas de dendríticas induce la generación de células T de
controles sanos igualmente tratadas (figura 4A). tipo Th1 (19,20).
Además, se observó un aumento estadística-
Además de su papel inductor de la respuesta
mente no significativo en la secreción de IL-10
linfoide, recientemente han surgido algunas líneas
por parte de las mencionadas células dendríticas
de evidencia que sugieren que las células
de los pacientes chagásicos en comparación a
dendríticas pueden tener un papel regulador en la
los niveles observados en las células de controles
inducción de tolerancia periférica. Es así como
sanos (figura 4B). No se observaron diferencias
se ha mostrado que células dendríticas en estado
en los niveles de las citocinas IL-1β, TNF-α, IL-6
inmaduro o semimaduro pueden inducir la
e IL-8 de las células dendríticas de pacientes
activación de células T reguladoras (21).
chagásicos versus las de controles sanos
tratadas ambas con K1 y LPS (datos no En el caso de la respuesta inmune a agentes
mostrados). infecciosos es de particular interés el hecho de
que algunos patógenos pueden inducir la
Discusión
generación de células dendríticas reguladoras que
Las células dendríticas regulan la respuesta inhiben la inducción de respuesta inmune efectiva,
inmune local y sistémica mediante la expresión lo cual se relaciona con estrategias de evasión

Figura 3. Expresión de marcadores en células dendríticas


maduras de 7 pacientes (gris) y 7 controles sanos (blanco)
estimuladas con LPS o el péptido K1 y LPS (K1+LPS) el día
5 de cultivo durante 48 h. Los datos se muestran como
promedio del porcentaje de células que expresan los distintos
marcadores analizados. Las barras sobre las columnas
indican el error estándar de la media (ESM). La significación
estadística de la diferencia de la expresión de los marcadores
entre células dendríticas de pacientes estimuladas con LPS
o K1+LPS fue de p = 0,004 para CD86 y p = 0,03 para CD83.

23
Santander S.P., Cuéllar A., Thomas M.del C. et al Biomédica 2007;27(supl. 1):18-27

Figura 4. Cuantificación de citocinas por citometría de flujo de células dendríticas de 7 pacientes (gris) y 7 controles sanos
(blanco) expuestas a LPS o al péptido K1 y LPS (K1+LPS) el día 5 de cultivo durante 48 h. Los datos se muestran como
promedio del porcentaje de células que expresan los distintos marcadores analizados. Las barras sobre las columnas
indican el error estándar de la media (ESM). La significación estadística de la diferencia de la producción de IL-12 e IL 10
entre las células dendríticas de pacientes y controles estimuladas con K1 y LPS fue de p = 0,02 y p>0,05, repectivamente.

de la respuesta inmune por estos agentes y explica esta proteína se considera una estructura crítica
en parte la cronicidad de algunas enfermedades para la movilidad del parásito y para su unión a la
infecciosas (22,23). célula hospedera (27,28). La presencia de la KMP-
11 ha sido demostrada en varias especies de
Los estudios sobre la interacción de las células
leishmanias y tripanosomas, y no ha sido descrita
dendríticas y T. cruzi muestran que el parásito
en otros organismos diferentes a los cineto-
puede infectar dichas células y multiplicarse en
plástidos, lo cual respalda el concepto de un rol
su interior alterando el programa de maduración
específico en estos parásitos (28).
de la célula dendrítica mediante la inhibición de la
producción de citocinas, disminución de moléculas Con base en los estudios que demuestran la
coestimuladoras (7), disminución de la expresión importancia de la proteína KMP-11 y de su péptido
de moléculas de clase I y, por lo tanto, alteración K1 en la respuesta inmune frente a la infección
de la capacidad para presentar péptidos (9,12,13,15), en este trabajo se evaluó la
antigénicos a linfocitos T CD8+ (8). Algunas expresión de marcadores de maduración en
moléculas, como los glicoinositolfosfolípidos células dendríticas derivadas de monocitos de
(GIPL), han sido relacionadas con esta pacientes chagásicos crónicos e individuos sanos
hiporreactividad inmune del parásito (24). Sin estimuladas con la proteína KMP-11 y el péptido
embargo, otras moléculas como la proteína Tc52, K1 de T. cruzi. Vale la pena anotar que estudios
que es una oxidorreductasa necesaria para la preliminares realizados por nuestro grupo indican
supervivencia y la virulencia del parásito, induce que el péptido K1 induce una respuesta inmune
maduración de células dendríticas derivadas de humoral específica en pacientes infectados
monocitos y protege ratones in vivo frente a una independientemente de su tipo de HLA (29), a
infección letal con T. cruzi (25), lo cual indica que pesar de haber sido reportado como un epítope
aunque la infección de la célula dendrítica por T. restringido al HLA-A*0201 en trabajos previos
cruzi altera su actividad en términos de (9,13).
estimulación de células T, algunas moléculas
Los resultados obtenidos en este estudio
derivadas de éste podrían considerarse como
muestran que si bien la proteína KMP-11 no induce
buenos candidatos para la generación de vacunas
la maduración de células dendríticas, su péptido
específicas contra el parásito.
amino terminal K1 en presencia de LPS se asocia
La proteína 11 de membrana de cinetoplástidos con una menor expresión de los marcadores CD83
(KMP-11) fue descrita en Leishmania donovani y CD86 en las células dendríticas de los pacientes.
asociada al lipofosfoglicano (LPG) (26), localizada Por otra parte, la respuesta in vitro frente al péptido
en el bolsillo flagelar y asociada al citoesqueleto; K1 en presencia de LPS muestra niveles

24
Biomédica 2007;27(supl. 1):18-27 Maduración de células dendríticas de pacientes chagásicos

significativamente inferiores en la producción de presencia de LPS, es capaz de interactuar con


IL-12 por las células dendríticas de los pacientes. estos receptores, desencadenando una
Estos resultados sugieren que K1 en presencia disminución en la producción de IL-12.
de LPS tiene un efecto en el programa de
El hecho de que el efecto de K1 en presencia de
maduración de las células dendríticas que es
LPS sólo se observe en pacientes infectados y
característico de pacientes chagásicos, el cual
no en individuos sanos llama la atención por
podría afectar la estimulación de los linfocitos T, cuanto las células dendríticas hacen parte de la
así como también interferir con la polarización respuesta inmune innata y sugiere que de alguna
hacia una respuesta Th1, la cual se ha visto que manera el contacto previo con el parásito o algunas
es crucial para el control de la infección por T. de sus moléculas alteraría el programa de
cruzi, al menos en los modelos murinos (30-32). maduración de tales células.
Una posible explicación a esta disminución en la Por otra parte, es posible que la diferencia en el
expresión de marcadores de membrana podría comportamiento del péptido K1 en presencia de
deberse a un efecto tóxico de la proteína o del LPS y de la proteína KMP-11 se deba
péptido sobre las células. Sin embargo, el hecho esencialmente a la diferencia estructural y
de encontrar disminución en la expresión de las antigénica entre las dos moléculas, lo que
moléculas mencionadas en las células de los conllevaría a la activación de distintas vías de la
pacientes chagásicos y no en las de los controles respuesta inmune.
sanos parece indicar que éste no es el caso.
Además, el efecto de K1 y LPS se observa para Queda por determinar si el sistema de
la expresión de CD86 y CD83, mientras que la estimulación descrito en este trabajo es reprodu-
expresión de HLA-DR no se ve afectada. cible en pacientes infectados asintomáticos para
poder llegar a conclusiones sobre el papel del
Si bien el papel de antígenos específicos péptido K1 en la modulación de la respuesta
parasitarios en la maduración de células inmune específica in vivo.
dendríticas murinas ha sido descrito previamente,
como es el caso de la proteína HSP70 de T. cruzi Conflicto de intereses
(33), este es el primer reporte que involucra a un Los autores manifestamos expresamente que
péptido sintético derivado de una proteína del durante la realización del presente trabajo no
parásito en esta modulación. El mecanismo existió conflicto de interés alguno que pudiera
molecular mediante el cual K1 ejerce su acción afectar los resultados obtenidos.
es desconocido; sin embargo, llama la atención
que otros péptidos derivados de patógenos tales Agradecimientos
como el péptido sintético T20 del virus de Los autores expresan su agradecimiento a Miguel
inmunodeficiencia adquirida 1 (HIV-1) y el péptido Vacca del Hospital Universitario San Ignacio,
Hp(2-20) de Helicobacter pylori inhiben la PUJB, a Rubén Santiago Nicholls, a Marleny
producción de IL-12 por parte de monocitos Montilla y Astrid C. Flórez del Laboratorio de
humanos (34,35). Se ha visto que estos péptidos Parasitología del Instituto Nacional de Salud y a
son agonistas de la familia de receptores FPR Marcela Mercado del Grupo de Enfermedades
(formyl peptide receptor) (36-38). Así mismo, el Infecciosas, PUJB, por su colaboración en la
péptido sintético WKYMVm, agonista de FPR y evaluación clínica de los pacientes y la realización
FPRL2, inhibe tanto la maduración de células de las pruebas de laboratorio IFI, ELISA y
dendríticas humanas como la producción de IL- Chagatek®, respectivamente.
12 de las mismas (35). Adicionalmente, también
Financiación
se ha encontrado que el LPS es capaz de
aumentar la expresión de FPR y FPRL1 en Este estudio fue financiado por la Vicerrectoria
macrófagos y neutrófilos de ratones (39). Por lo Académica de la Pontificia Universidad Javeriana.
tanto, es de especial interés investigar si K1 en Registro de proyecto 1767.

25
Santander S.P., Cuéllar A., Thomas M.del C. et al Biomédica 2007;27(supl. 1):18-27

Referencias the KMP-11 protein elicits a cytotoxic and humoral


immune response against the antigen and leads to
1. Revy P, Sosperda M, Barbour B, Trautmann A. protection. Infect Immun 2001;69:6558-63.
Functional antigen-independent synapses formed
between T cells and dendritic cells. Nat Immunol 13. Diez H, López MC, Thomas MC, Guzman F, Rosas
2001;2:925-31. F, Velazco V. et al. Evaluation of IFNg production by
CD8+ T lymphocytes in response to the K1 peptide
2. Russo V, Tanzarella S, Dalerba P, Rigatti D, Rovere from KMP-11 protein in patients infected with
P, Villa A, et al. Dendritic cells acquire the MAGE-3 Trypanosoma cruzi. Parasite Immunol 2006;28:101-5.
human tumor antigen from apoptotic cells and induce a
class I restricted T cell response. Proc Natl Acad Sci 14. Chaves F, Calvo JC, Carvajal C, Rivera Z, Ramirez
USA 2000;97:2185-90. L, Pinto M, et al. Synthesis, isolation and
characterization of Plasmodium falciparum antigenic
3. Lanzavecchia A, Sallusto F. The instructive role of tetrabranched peptide dendrimers obtained by
dendritic cells on T cell responses: lineages, plasticity thiazolidine linkages. J Pept Res 2001;58:307-16.
and kinetics. Curr Opin Immunol 2001;13:291-8.
15. Thomas MC, Longobardo MV, Carmelo E, Maranon
4. World Health Organization. Control of Chagas C, Planelles L, Patarroyo ME, et al. Mapping of the
disease. Second report of the WHO Expert Committee, antigenic determinants of the T. cruzi kinetoplastid
Technical Report 2002, Series 905. Geneva: WHO; membrane protein-11. Identification of a linear epitope
2002. p.39-40. specifically recognized by human Chagasic sera. Clin
Exp Immunol 2001;123:465-71.
5. Moncayo A. Chagas disease: current epidemiological
trends after the interruption of vectorial and 16. Cuéllar A, Fonseca A, Gómez A. Efecto del
transfusional transmission in the Southern Cone lipopolisacárido en cultivos de células dendríticas
countries. Mem Inst Oswaldo Cruz 2003;98:577-91. humanas y su inhibición por la polimixina B. Biomédica
2004;24:413-22.
6. Tanowitz HB, Kirchhoff LV, Simon D, Morris SA,
Weiss LM, Wittner M. Chagas’ disease. Clin Microbiol 17. Modlin RL, Brightbill HD, Godowski PJ. The toll of
Rev 1992;5:400-19. innate immunity on microbial pathogens. N Engl J Med
1999;340:1834-5.
7. Van Overtvelt L, Vanderheyde N, Verhasselt V,
Ismaili J, De Vos L, Goldman M, et al. Trypanosoma 18. Lanzavecchia A, Sallusto F. Dynamics of T
cruzi infects human dendritic cells and prevents their lymphocyte responses: intermediates, effectors, and
maturation: inhibition of cytokines, HLA-DR, and memory cells. Science 2000;290:92-7.
costimulatory molecules. Infect Immun 1999;67:4033-40.
19. Moser M, Murphy KM. Dendritic cell regulation of TH1-
8. Van Overtvelt L, Andrieu M, Verhasselt V, Connan TH2 development. Nat Immunol 2000;1:199-205.
F, Choppin J, Vercruysse V, et al. Trypanosoma cruzi
down-regulates lipopolysaccharide-induced MHC class 20. Pearce EJ, Kane CM, Sun J. Regulation of dendritic
I on human dendritic cells and impairs antigen cell function by pathogen-derived molecules plays a
presentation to specific CD8(+) T lymphocytes. Int key role in dictating the outcome of the adaptive immune
Immunol 2002;14:1135-44. response. Chem Immunol Allergy 2006;90:82-90.

9. Marañon C, Thomas MC, Planelles L, Lopez MC. 21. Lutz MB, Schuler G. Immature, semi-mature and fully
The immunization of A2/K(b) transgenic mice with the mature dendritic cells: which signals induce tolerance
KMP-11-HSP70 fusion protein induces CTL response or immunity? Trends Immunol 2002;23:445-9.
against human cells expressing the T. cruzi KMP-11 22. Smits HH, Engering A, van der Kleij D, De Jong EC,
antigen: Identification of A2-restricted epitopes. Mol Schipper K, van Capel TM, et al. Selective probiotic
Immunol 2001;38:279-87. bacteria induce IL-10-producing regulatory T cells in
10. Rodrigues MM, Ribeirao M, Pereira-Chioccola V, vitro by modulating dendritic cell function through
Renia L, Costa F. Predominance of CD4 Th1 and dendritic cell-specific intercellular adhesion molecule
CD8 Tc1 cells revealed by characterization of the 3-grabbing nonintegrin. J Allergy Clin Immunol
cellular immune response generated by immunization 2005;115:1260-7.
with a DNA vaccine containing a Trypanosoma cruzi
23. Auffermann-Gretzinger S, Keeffe EB, Levy S.
gene. Infect Immun 1999;67:3855-63.
Impaired dendritic cell maturation in patients with
11. Villalta F, Lima MF, Howard SA, Zhou L, Ruíz-Ruano chronic, but not resolved, hepatitis C virus infection.
A. Purification of a Trypanosoma cruzi trypomastigote Blood 2001;97:3171-6.
60-Kilodalton surface glycoprotein that primes and
24. Brodskyn C, Patricio J, Oliveira R, Lobo L, Arnholdt
activates murine lymphocytes. Infect Immun
A, Mendonca-Previato L, et al. Glycoinositolphos-
1992;60:3025-32.
pholipids from Trypanosoma cruzi interfere with
12. Planelles L, Thomas MC, Alonso C, Lopez MC. DNA macrophages and dendritic cell responses. Infect
immunization with Trypanosoma cruzi HSP70 fused to Immun 2002;70:3736-43.

26
Biomédica 2007;27(supl. 1):18-27 Maduración de células dendríticas de pacientes chagásicos

25.Ouaissi A, Guilvard E, Delneste Y, Caron G, 33. Planelles L, Thomas M, Pulgar M, Marañon C,


Magistrelli G, Herbault N, et al. The Trypanosoma Grabbe S, López MC. Trypanosoma cruzi heat-shock
cruzi Tc52-released protein induces human dendritic protein-70 kDa, alone or fused to the parasite KMP-11
cell maturation, signals via toll-like receptor 2, and antigen, induces functional maturation of murine
confers protection against lethal infection. J Immunol dendritic cells. Immunol Cell Biol 2002;80:241-7.
2002;168:6366-74.
34. Braun MC, Wang JM, Lahey E, Rabin RL, Kelsall
26. Jardim A, Hanson S, Ullman B, McCubbin WD, Kay BL. Activation of the formyl peptide receptor by the
CM, Olafson RW. Cloning and structure-function HIV-derived peptide T-20 suppresses interleukin-12 p70
analysis of the Leishmania donovanni kinetoplastid production by human monocytes. Blood 2001;97:
membrane protein-11. Biochem J 1995;305:315-20. 3531-6.
27. Thomas MC, García-Pérez JL, Alonso C, López MC. 35. Kang HK, Lee HY, Kim MK, Park KS, Park YM, Kwak
Molecular characterization of KMP-11 from JY, et al. The synthetic peptide Trp-Lys-Tyr-Met-Val-
Trypanosoma cruzi: a cytoskeleton-associated protein D-Met inhibits human monocyte-derived dendritic cell
regulated at the translational level. DNA Cell Biol maturation via formyl peptide receptor and formyl
2000;19:47-57. peptide receptor-like 2. J Immunol 2005;175:685-92.
28. Stebeck CE, Baron GS, Beecroft RP, Pearson TW. 36. Betten A, Bylund J, Cristophe T, Boulay F, Romero
Molecular characterization of the kinetoplastid A, Hellstrand K, et al. A proinflammatory peptide from
membrane protein-11 from African trypanosomes. Mol Helicobacter pylori activates monocytes to induce
Biochem Parasitol 1996;81:81-8. lymphocyte dysfunction and apoptosis. J Clin Invest
2001;108:1221-8.
29. Diez H, López MC, Thomas MC, Guzman F, Rosas
F, Velasco V, et al. Respuesta inmune al péptido K1 37. Hartt JK, Liang T, Sahagun-Ruiz A, Wang JM, Gao
en pacientes infectados con Trypanosoma cruzi . JL, Murphy PM. The HIV-1 cell entry inhibitor T-20
Parasitol Latin 2005;60:208. potently chemoattracts neutrophils by specifically
activating the N-formylpeptide receptor. Biochem
30. Hoft DF, Eickhoff CS. Type 1 immunity provides Biophys Res Commun 2000;272:699-704.
optimal protection against both mucosal and systemic
Trypanosoma cruzi challenges. Infect Immun 38. Bylund J, Christophe T, Boulay F, Nystrom T,
2002;70:6715-25. Karlsson A, Dahlgren C. Proinflammatory activity of
a cecropin-like antibacterial peptide from Helicobacter
31. Kumar S, Tarleton RL. Antigen-specific Th1 but not pylori. Antimicrob Agents Chemother 2001;45:1700-4.
Th2 cells provide protection from lethal Trypanosoma
cruzi infection in mice. J Immunol 2001;166:4596-603. 39. Mandal P, Novotny M, Hamilton TA. Lipopolysac-
charide induces formyl peptide receptor 1 gene ex-
32. Planelles L, Thomas MC, Marañon C, Morell M, pression in macrophages and neutrophils via transcrip-
López MC. Differential CD86 and CD40 co-stimulatory tional and posttranscriptional mechanisms. J Immunol
molecules and cytokine expression pattern induced by 2005;175:6085-91.
Trypanosoma cruzi in APCs from resistant or
susceptible mice. Clin Exp Immunol 2003;131:41-7.

27
López D.C.,
Biomédica Jaramillo C.,
2007;27(supl. Guhl F.
1):28-39 Biomédica 2007;27(supl. 1):28-39

ARTÍCULO ORIGINAL

Estructura poblacional y variabilidad genética de Rhodnius


prolixus (Hemiptera: Reduviidae) procedente de diferentes
áreas geográficas de Colombia
Diana Carolina López, Carlos Jaramillo, Felipe Guhl
Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Facultad de Ciencias,
Universidad de los Andes, Bogotá D.C., Colombia.

Introducción. Rhodnius prolixus es el vector más importante de la enfermedad de Chagas en


Colombia. La caracterización genética de esta especie resulta útil para comprender su potencial
de dispersión. La distribución del vector y la estructura genética de sus poblaciones, son
factores importantes para implementar de manera adecuada las estrategias de control y
vigilancia epidemiológica de la enfermedad de Chagas.
Objetivo. Establecer relaciones genéticas entre poblaciones de R. prolixus capturadas en
diferentes hábitat y áreas geográficas de Colombia, para dilucidar la estructura genética y
dispersión del vector en el territorio colombiano.
Materiales y métodos. Se analizaron tres poblaciones domiciliadas de R. prolixus provenientes
de Tolima, Cundinamarca y la Sierra Nevada de Santa Marta; y una población silvestre
procedente de Casanare. Se emplearon dos técnicas moleculares para evaluar la estructura
genética de las poblaciones: análisis del ITS-2 del ADN ribosomal por PCR/RFLP y RAPDs.
Resultados. R. prolixus presenta variabilidad genética moderada (Fst 0,057-0,15), entre las
poblaciones domiciliadas se encontraron tasas de migración (Nm>1) que revelan flujo genético.
Se encontró diferenciación genética de moderada-alta entre la población silvestre de Casanare
y las poblaciones domésticas del centro del país (Tolima y Cundinamarca).
Conclusión. Las poblaciones domiciliadas de R. prolixus son homogéneas debido a que
existe flujo genético entre éstas; lo cual es favorable para el control químico, mientras que la
población silvestre agrupa aparte de las domiciliadas. Se evidencia la necesidad de estudiar
la estructura genética de los focos silvestres, sus posibles rutas de dispersión y el riesgo
epidemiológico que representan.
Palabras clave: enfermedad de Chagas, vigilancia epidemiológica, control vectorial, Rhodnius,
ADN espaciador ribosomal, reacción en cadena de la polimerasa, polimorfismo de longitud
del fragmento de restricción, técnica del ADN polimorfo amplificado aleatorio.
Population structure and genetic variability of Rhodnius prolixus (Hemiptera: Reduviidae)
from different geographic areas of Colombia.
Introduction. Rhodnius prolixus is the most important vector of Chagas disease in Colombia.
Genetic characterization of this species is useful to understand its potential of dispersion. The
distribution of the vector and the genetic population structure are important factors for the
adequate implementation of control programs and epidemiological surveillance of Chagas
disease.
Objective. Genetic relationships were established for populations of R. prolixus collected from
several habitat types and representative geographic areas of Colombia. A second aim was to
assess its population genetic structure and dispersion across Colombia.
Materials and methods. Genetic comparisons were made from three domestic populations of
R. prolixus from (1) Tolima Province, (2) Cundinamarca Province and (3) the Sierra Nevada of
Santa Marta in northern Colombia, and (4) one sylvatic population from Casanare. Two molecular
techniques were used to evaluate the genetic structure of these populations—analysis of the
ITS-2 of ribosomal DNA by PCR/RFLP and RAPDs.

28
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

Results. Rhodnius prolixus shows a moderate genetic variability (Fst 0.06–0.15). Among
domestic populations, the migration rates found were adequate (Nm>1) to maintain gene flow.
A moderate to large degree of genetic differentiation was observed between the sylvatic
population from Casanare and the domestic populations from the centre of the country (Tolima
and Cundinamarca).
Conclusion. The domestic populations of R. prolixus are homogeneous because genetic flow
exists between them, and this is favourable to chemical control, while the sylvatic population
clusters apart from the domestic populations. Hence the need to study the genetic structure of
the sylvatic foci, their possible dispersion routes and the epidemiological risk that they represents.
Key words. Chagas disease, epidemiologic surveillance, vector control, Rhodnius, DNA,
ribosomal spacer, polymerase chain reaction, polymorphism, restriction fragment length, random
amplified polymorphic DNA technique.

La enfermedad de Chagas, exclusiva del variedad Papúa, en plantaciones agroindustriales


continente americano, se extiende desde México de Villanueva, Casanare (Pinto et al.,
hasta Argentina y es considerada una de las Comprobación del ciclo silvestre de Rhodnius
enfermedades parasitarias de mayor impacto so- prolixus Stal en reductos de Attalea butyracea,
cial y económico (1). En Colombia constituye un en el departamento del Casanare. En: Memorias
problema de salud pública importante; se estima del XII Congreso Colombiano de Parasitología y
que la prevalencia de la infección en la población Medicina Tropical. Biomédica 2005;25(Suppl
es del 5% y que existen alrededor de 3,5 millones I):158-9). Reportes anteriores describen
de personas en riesgo de adquirir la enfermedad, poblaciones silvestres de R. prolixus en 13
dependiendo de la distribución geográfica de los especies de palmas en Venezuela (3).
insectos vectores (Hemiptera: Reduviidae)
La caracterización genética del vector con base
capaces de transmitir el parásito Trypanosoma
en el análisis de especímenes domiciliados y
cruzi (2).
silvestres provenientes de diferentes áreas del
El vector más importante de la enfermedad de territorio colombiano resulta importante para
Chagas en Colombia, al igual que en Venezuela y comprender su distribución geográfica, potencial
Centro América, es Rhodnius prolixus, debido a de dispersión y flujo genético, aspectos
su amplia distribución geográfica, sus hábitos importantes en la endemicidad de la enfermedad
domiciliarios, su alta frecuencia de dispersión y de Chagas en las zonas donde se puede llevar a
buena capacidad para infectarse y transmitir el cabo la transmisión vectorial de T. cruzi.
parásito.
Diversas técnicas moleculares como la
Estudios recientes reportan la presencia de R. amplificación aleatoria de ADN polimorfo (RAPD,
prolixus silvestre en el departamento de Casanare por sus siglas en inglés), la secuenciación de
en plantaciones agroindustriales de palma africana genes mitocondriales, microsatélites, y el análisis
( Elaeis guineensis ) y palma nativa ( Attalea de genes y espaciadores ribosomales se han
butyracea), con índices de infestación del 46,6 y utilizado ampliamente en el estudio de la
100% e índices de infección de 41,17 y 67,18%, estructura genética de varias especies de
respectivamente (Guhl et al., Primer reporte de triatominos para resolver relaciones filogenéticas
Rhodnius prolixus Stal, en Elaeis guineensis I, y evolutivas entre especies, complejos de
especies e incluso para la caracterización de
Correspondencia: poblaciones de una misma especie (4-7).
Felipe Guhl, CIMPAT, Departamento de Ciencias Biológicas,
Universidad de los Andes, bloque A, oficina 201. A.A. 4976. Algunas regiones del ADN ribosomal (rADN) han
Carrera 1ª N° 18A -10, Bogotá, Colombia. demostrado ser importantes marcadores
Tel/Fax: +57 1 3324540. moleculares en estudios sistemáticos y
fguhl@uniandes.edu.co
filogenéticos de triatominos, debido a que
Recibido: 16/12/05; aceptado: 14/03/06 presentan secuencias microsatélites útiles para

29
López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

la caracterización de poblaciones (8-10). El análisis Materiales y métodos


de estas regiones mediante la reacción en cadena
Insectos
de la polimerasa (PCR) en búsqueda de polimor-
fismos de longitud y polimorfismos de fragmentos Se analizaron en total 48 insectos adultos R.
de restricción (RFLP) ha probado que son prolixus, 12 por población (seis hembras y seis
eficientes en la diferenciación de especies de machos). Las poblaciones domiciliadas fueron
Anopheles sp y cepas de Angiostrongylus sp (11). capturadas en tres áreas geográficas endémicas
para la enfermedad de Chagas en Colombia: en
Los RAPDs se basan en la amplificación al azar los municipios de Fomeque y Ubaque en
de segmentos de ADN en búsqueda de poli- Cundinamarca, en el municipio de Coyaima,
morfismos, para así determinar relaciones Tolima, en el asentamiento indígena Kasakumake
genéticas entre individuos de una población o en- en la Sierra Nevada de Santa Marta, y en Dibuya,
tre diferentes poblaciones. Esta técnica se ha La Guajira; la población silvestre fue capturada
utilizado para análisis de la estructura poblacional en dos lotes de cultivos agroindustriales de palma
de varias especies de triatominos como Triatoma de aceite (Elaeis guineensis) en el municipio de
dimidiata, T. brasiliensis, R. prolixus, entre otras, Villanueva, Casanare (figura 1).
permitiendo estimar el flujo genético entre
poblaciones silvestres y domésticas de estos Adicionalmente, se incluyó un espécimen de R.
vectores (12-14). prolixus domiciliado de Maracaibo, Venezuela,
para compararlo con las poblaciones colombianas.
En este estudio se empleó la técnica RAPD y se Como grupos de exclusión se usaron un ejemplar
analizó el espaciador interno transcrito2 (ITS-2) de R. pallescens procedente de Vegachí,
del rADN por PCR/RFLP con el propósito de Antioquia, uno de R. colombiensis procedente de
evaluar la variabilidad intra-específica de R. Totarco, Tolima, y un individuo T. dimidiata de
prolixus a partir de cuatro poblaciones Soatá, Boyacá. Todos los insectos utilizados en
colombianas y determinar posibles relaciones el estudio fueron clasificados siguiendo las claves
genéticas entre ellas. de Lent & Wygodzinsky (15).

Figura 1. Ubicación geográfica de los sitios de captura de las poblaciones domiciliadas y silvestre de R. prolixus.

30
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

Extracción del ADN reconocimiento de 4 a 6 nucleótidos. La digestión


de los productos de PCR se realizó por separado
El ADN se obtuvo a partir de las seis patas de
con las enzimas Rsa I, Nhe I, Dde I y Hpy 188 I.
cada insecto, que fueron retiradas y conservadas
La enzima Rsa I tiene un sitio de corte sobre el
en alcohol en un tubo plástico de 1,5 ml. Las patas
ITS-2 de R. prolixus en la secuencia de
se lavaron con hipoclorito 1:50 y etanol al 70%
reconocimiento GTνAC; la enzima Nhe I tiene un
para evitar la contaminación con ADN foráneo.
sitio de corte sobre la secuencia G νCTAG ? C
Se empleó el estuche de extracción AquaPure
del ITS-2 de R. prolixus; Dde I realiza dos cortes
Genomic de BIORAD®. El ADN fue almacenado en el fragmento del rADN amplificado, uno sobre
a -20°C. el gen 5,8S y el otro sobre el gen 28S de R.
Cuantificación del ADN prolixus , en la secuencia de reconocimiento
C?TNA?G; la enzima Hpy 188 I presenta dos
La concentración de ADN se determinó por sitios de corte sobre el fragmento del rADN de R.
espectrofotometría (barrido de 234 a 320 nm). Se prolixus en la secuencia TC?N?GA. En las
cuantificó el ADN extraído (15 µg/ml en promedio) restricciones se siguió el protocolo sugerido por
y el ADN de los productos de PCR (329 µg/ml en Promega®: en un tubo plástico estéril de 1,5 ml
promedio) para los protocolos de restricción se mezcló agua destilada estéril, 2 ml del buffer
enzimática. de la enzima (10X) y 0,4 ml de BSA acetilada (5
Amplificación del ITS-2 por PCR mg/µl) (únicamente para las digestiones con Rsa
I y Nhe I); se adicionaron 3,5 µl ADN (0,3 µg/µl) y
Se emplearon los iniciadores 5,8T (5-CTA AGC cinco unidades de enzima (10 U/µl) para un
GGT GGA TCA CTC GG-3) y 28 T (5-GCA CTA volumen final de 20 µl. La digestión se realizó a
TCA AGC AAC ACG ACT C-3) (10), que amplifican 37°C durante 3 a 4 horas. Los patrones de
un fragmento de 127 pb del gen 5,8S, el ITS-2 restricción se visualizaron en geles de agarosa al
completo y un fragmento de 350 pb del gen 28S. 1,5 o 2%, dependiendo del tamaño de los
Se usó el estuche PCR Ready to go de fragmentos obtenidos. El producto se mezcló con
Pharmacia®; cada perla fue hidratada con 15,25 4µl de buffer de carga 6X y se sembraron 10 µl en
µl de agua destilada estéril, se adicionó 1 pmol cada pozo. La electroforesis, la digitalización de
de cada iniciador y 3,75 µl de MgCl2 (10 mM), así los geles y el cálculo del peso de los fragmentos
como 5 µl del ADN molde (15 ng/µl), para un volumen se realizaron tal como se describió para los
final de 25 µl. En todas las reacciones se incluyó productos de PCR. Como controles experimen-
un blanco de reacción sin ADN. El perfil térmico tales, paralelos a los ensayos de restricción, se
usado fue el descrito por Jaramillo et al. (13). La usaron el ADN no digerido y la reacción de
electroforesis se realizó en geles de agarosa al restricción sin enzima.
1,5%; en cada pozo se sembraron 6 ml de muestra
RAPD
previamente mezclada con 2 ml de buffer de carga.
Los geles se corrieron 100 minutos a 70 voltios y Se usó el estuche Ready To Go RAPD y los
luego fueron digitalizados en un documentador de iniciadores RTG 2 (5 -GTTTCGCTCC-3) ,3 (5 -
geles CHEMI-DOC SYSTEM y analizados con el GTAGACCCGT-3) y 4 (5-AAGAGCCCGT-3) de
software Quantity One 1D de BIORAD®. Pharmacia®; cada perla se hidrató con 19 µl de
agua destilada y se agregaron 5 µl de iniciador
Análisis de restricción por PCR/RFLP
(25 pmol) y posteriormente se adicionaron 4 µl
Para la elección de las enzimas se elaboró un del ADN molde (15 ng/µl) para un volumen final
mapa de restricción del ITS-2 de R. prolixus con de reacción de 28 µl. Como control de
el programa NEBcutter V2.0 de New England amplificación se utilizó ADN de E. coli BL21 y
Biolabs disponible en Internet a partir de como control negativo se realizó un blanco de
secuencias publicadas en Genbank (AJ286888, reacción sin ADN. El perfil térmico consistió en
AY345868). Se buscaron enzimas que tuvieran un paso inicial de denaturación a 95°C por cinco
uno o dos cortes sobre la secuencia y un sitio de minutos, seguido de 44 ciclos: a 95°C por 1

31
López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

minuto, a 36°C por 1 minuto y a 72°C por 2 generados con el programa NEIGHBOR de
minutos. Las reacciones se visualizaron en geles PHYLIP 3.5C.
de poliacrilamida al 6% con un tiempo de corrido
El estadístico F (Fst) y la tasa efectiva de
electroforético de 3 horas a 80 V. En cada pozo migración (Nm) entre poblaciones se estimaron
se sembraron 7 ml del producto previamente con RAPDFST mediante tres metodologías:
mezclado con 2 ml de buffer de carga. Los geles Wright (21), Weir & Cockerham (22) y Lynch &
fueron teñidos usando el estuche Silver Stain Plus Milligan (23). El Fst es la razón de la varianza
de Pharmacia®. observada en la frecuencia de un alelo en un lo-
Análisis de datos RAPD cus RAPD entre subpoblaciones y su máxima
varianza en la población total; el programa computa
El análisis se realiza bajo tres supuestos: a) las los valores Fst para cada locus RAPD asumiendo
poblaciones están en equilibrio de Hardy - que las subpoblaciones están en equilibrio de
Weinberg, o sea que se asume que no hay Hardy-Weinberg y la dominancia de cada loci.
presiones de selección que favorezcan a alguna
población; b) los marcadores RAPD segregan en Los valores Fst y Nm son estimaciones indirectas
forma mendeliana con tasas constantes de del flujo genético y la migración entre poblaciones,
evolución y sustitución, y c) los alelos recesivos en las cuales se asume que no hay selección, ya
son idénticos entre los individuos. que ésta puede incrementar o disminuir el Fst, y
que no hay mutaciones si la tasa de mutación es
Se elaboró una matriz binaria con la información alta en relación a la tasa de migración, como
genética obtenida de cada individuo bajo el criterio sucede con microsatélites o en ADN mitocondrial;
de presencia [1] y ausencia [0] de bandas de puede haber desviaciones en la estimación.
acuerdo con Welsh et al. (16). Teniendo en cuenta
Resultados
que en los marcadores RAPDs el fenotipo
dominante de un locus se considera como la Amplificación del ITS-2
presencia de una banda, y el fenotipo recesivo es
Todos los R. prolixus presentaron una única banda
la ausencia de esa banda, los individuos se
de 1.180 pb (figura 2A). Se analizaron también
comparan fenotípicamente en cada locus.
ejemplares de R. colombiensis, R. pallescens y
La matriz binaria se analizó con los programas T. dimidiata, usados como grupos de exclusión
RAPDPLOT (17) y SYNTAX 2000 (18). En en la técnica RAPD. R. colombiensis presentó
RAPDPLOT se generó una matriz de distancias una banda de 1.175 pb, R. pallescens una de 709
a partir de la matriz binaria usando el índice de pb y T. dimidiata una de 964 pb (figura 2B).
similitud de Nei y Li (19), y en SYNTAX se empleó Restricción con Rsa I
el índice de disimilitud de Jaccard para datos
binarios; en los dos programas se generaron Se encontró el mismo patrón de restricción en
dendrogramas con el algoritmo de agrupamiento todos los individuos de las poblaciones
UPGMA (unweighted pair-group method using an estudiadas, y dos fragmentos, uno de 833 y otro
arithmetic average). de 343 pb. El espécimen R. prolixus de Venezu-
ela mostró un patrón de restricción idéntico al de
Se usó el programa RAPDDIST para calcular las las poblaciones colombianas (figura 3A). T. dimidiata
distancias genéticas de Nei (20) entre las mostró un sitio de corte y generó dos fragmentos,
poblaciones y se realizó un análisis bootstrap de uno de 738 y otro de 239 pb; R. pallescens no fue
1000 réplicas, método estadístico que se usa para cortado por la enzima y R. colombiensis mostró
evaluar la confiabilidad de un árbol y permite un patrón de restricción con un fragmento de 804
examinar qué tan frecuentemente se forma un pb y otro de 362 pb (figura 3B).
conglomerado particular; el árbol consenso
Restricción con Nhe I
resultante se da por el número de veces que una
ramificación o nodo se presenta y esto es producto Todos los individuos R. prolixus analizados
de la proporción bootstrap. Los árboles fueron mostraron el mismo patrón de restricción

32
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

Figura 2. Amplificación del ITS-2 de R. prolixus (RP): A. 1. RP de Cundinamarca (CUN). 2. RP de Tolima (TOL). 3. RP de
Sierra Nevada de Santa Marta (SNSM). 4. RP de Casanare (CAS). 5-6. RP de Venezuela (VEN). 7. R. colombiensis. B. 1-
2. RP CAS. 3. T. dimidiata. 4. R. colombiensis. 5. R. pallescens. 6. RP CUN. MP: marcador de peso (100 pb); señalada
la banda de 500 pb. Geles de agarosa al 1,5%.

conformado por dos bandas de 1.030 y 153 pb sí tres bandas de 728, 320 y 136 pb. En T.
(figura 3C). También hay restricción en R. dimidiata se encontraron cuatro bandas producto
colombiensis, generando dos fragmentos de 1.020 de la restricción: de 707, 534, 306 y 143 pb. R.
y 153 pb; R. pallescens presenta un sitio de pallescens presentó tres bandas: de 430, 269 y
restricción para esta enzima generando fragmentos 125 pb (figura 3H).
de 647 pb y 71 pb. En T. dimidiata no hay
restricción (figura 3D). RAPD

Restricción con Dde I Con los iniciadores RTG 2,3 y 4 se visualizaron


un total de 71 bandas o marcadores que
Todos los R. prolixus evaluados presentaron dos representan cada uno un locus RAPD (figura 4).
sitios de corte y el mismo patrón de restricción, Los dendrogramas generados con los programas
una banda de 751 pb, una de 212 pb y una de 150 SYNTAX y RAPDPLOT muestran una distribución
pb (figura 3E). R. colombiensis presentó un patrón heterogénea de los individuos; no hay
igual al de R. prolixus con dos sitios de corte; T. agrupamientos definidos por lugar de origen,
dimidiata presentó tres sitios de corte, originando aunque se observan conglomerados discretos en-
cuatro fragmentos de 334, 218, 178 y 93 pb; R. tre individuos de Cundinamarca y Tolima. Todos
pallescens mostró dos sitios de corte generando los individuos R. prolixus del estudio se
tres fragmentos de 293, 238 y 178pb (figura 3F). encuentran por debajo de un valor de disimilitud
Restricción con Hpy 188 I de Jaccard de 0,475 (en una escala de 0 a 1). R.
colombiensis es el grupo de exclusión mas
Esta enzima teóricamente origina un patrón de cercano a R. prolixus, seguido por R. pallescens
restricción con tres fragmentos de aproximada- y T. dimidiata (figura 5).
mente 737, 323 y 120 pb; después de la digestión
se obtuvo un patrón homogéneo de cuatro bandas En el análisis con RAPDDIST se generaron
en todas las poblaciones: 915, 735, 314 y 125 pb árboles con diferentes grupos de exclusión que
(figura 3G); estos fragmentos podrían sugerir la muestran las relaciones genéticas entre las
existencia de un sitio de corte adicional; sin em- poblaciones. Se realizó un análisis bootstrap”de
bargo, la suma de los tamaños de las bandas 1.000 repeticiones para comprobar la consistencia
sobrepasa el tamaño del producto sin digerir. R. de los datos RAPD que soportan las relaciones
colombiensis no presentó la banda de 915 pb, pero representadas por las ramas del árbol.

33
López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

Figura 3. Resultados de PCR/RFLP. A. Restricción con Rsa I, bandas de 833 y 343 pb obtenidas para R. prolixus: 1. Control
ADN sin digerir, 2. RP TOL, 3. RP SNSM, 4. RP CUN, 5. RP CAS, 6. RP VEN. B. Restricción con Rsa I: 1. T. dimidiata
digerido (bandas de 738 y 239 pb), 2. T. dimidiata control sin digerir, 3. RP VEN digerido (bandas de 833 y 343 pb), 4. RP VEN
control, 5. RP TOL (bandas de 833 y 343 pb), digerido, 6. RP TOL control, Geles de agarosa al 2%. C. Restricción con Nhe
I, bandas de 1030 y 153 pb obtenidas para R. prolixus: 1. RP CAS, 2. RP SNSM, 3. RP TOL, 4. RP CUN, 5 y 6. RP VEN
(duplicado), 7. R. colombiensis (bandas de 1020 y 153 pb). D. Restricción con Nhe I: 1. R. pallescens digerido (bandas de
647 pb y 71 pb), 2. R. pallescens control, 4. T. dimidiata digerido (no hay restricción), 5. T.dimidiata control. Geles de
agarosa al 1,5%. E. Restricción con Dde I, bandas de 751 pb, 212 pb y 150 pb, obtenidas para R. prolixus: 1-2. RP CAS, 3-
4. RP CUN, 5. RP TOL. F. Restricción con Dde I: 1. T. dimidiata digerido (bandas de 334, 218, 178 y 93 pb), 2. T. dimidiata
control, 3. R. pallescens digerido (bandas de 293, 238 y 178 pb), 4. R. pallescens control, 6. R. colombiensis digerido (751
pb, 212 pb y 150 pb), 7. R. colombiensis control. Geles de agarosa al 2%. G. Restricción con Hpy 188 I, bandas de 915, 735,
314 y 125 pb obtenidas para R. prolixus: 1. RP SNSM control, 2. RP SNSM digerido, 3. RP CUN control, 4. RP CUN digerido,
5. RP TOL control, 6. RP TOL digerido. H. Restricción con Hpy 188 I: 1. RP SNSM digerido, 2. R. colombiensis digerido
(bandas de 728, 320 y 136 pb), 3. R. colombiensis control, 4. T. dimidiata digerido (bandas de 707, 534, 306 y 143 pb), 5. T.
dimidiata control, 6. R. pallescens digerido (bandas de 430, 269 y 125 pb), 7. R. pallescens control. Geles de agarosa al 2%.
Para todos los geles MP: marcador de peso (100 pb).

34
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

Se estimó el índice de fijación o estadístico F


(Fst), que mide el grado de diferenciación genética
entre poblaciones y la tasa efectiva de migración
(Nm) entre todas las poblaciones en conjunto y
por pares. Los valores Fst obtenidos en todos los
casos indican una diferenciación genética
moderada (Fst 0,05 a 0,15) y una tasa de migración
(Nm>1), suficiente para mantener homogeneidad
genética entre las poblaciones (cuadro 1).
El valor Fst más alto se encontró entre las
poblaciones de Tolima y Casanare (Fst 0,150)
siguiendo la metodología de Weir & Cockerham,
que realiza una corrección en muestras de tamaño
pequeño, e indicando una diferenciación genética
Figura 4. Patrones de bandas RAPD. Productos de
amplificación de R. prolixus con el iniciador RTG 4. 1: control grande; el siguiente valor Fst más alto se obtuvo
(E.coli), 2 y 3: RP CAS, 4 y 5: RP SNSM, 6 y 7: RP CUN, 8 entre Cundinamarca y Casanare (Fst 0,102). Las
y 9: RP TOL. Gel de acrilamida al 6%; teñido con plata. estimaciones del Fst y Nm concuerdan con lo
observado en el dendrograma de RAPDDIST, en
Las poblaciones de Tolima y Cundinamarca se el que la población de Casanare proveniente de
agrupan en un conglomerado con una distancia un hábitat silvestre se diferencia de las otras
genética de 0,03175, mientras que las poblaciones poblaciones.
de la Sierra Nevada y Casanare se encuentran Discusión
aparte, un poco más alejadas genéticamente de
No se detectaron polimorfismos de longitud en la
las dos primeras, con distancias de 0,03605 y
región del ITS-2; la digestión del fragmento
0,03733, respectivamente, siendo la población de
amplificado con las enzimas Nhe I, Rsa I, Dde I y
Casanare la más alejada (figura 6).
Hpy I mostró patrones de restricción homogéneos,
R. prolixus de Venezuela se encontró separado indicando que los individuos evaluados no difieren
de las poblaciones de Colombia, con una distancia en ninguno de los sitios de clivaje de las enzimas,
genética de 0,12521. Para R. colombiensis, usado y por lo tanto no se presentaron polimorfismos de
como grupo de exclusión, se obtuvo una distancia fragmentos de restricción; por ello no es posible,
de 0,19167; R. pallescens mostró una distancia usando estas enzimas, diferenciar a nivel
de 0,22180 y T. dimidiata enraizó el árbol a una molecular las poblaciones de R. prolixus con estos
distancia de 0,29351. marcadores.

Cuadro 1. Valores Fst y Nm entre las poblaciones de R. prolixus.

Comparaciones
Metodología TP Cun/Tol Cun/Cas Cun/SNS Tol /Cas Cas/SNS Tol/SNS

Wrigth Fst 0,107 0,071 0,074 0,075 0,102 0,062 0,074


Nm 2,1 3,3 3,1 3,1 2,2 3,8 3,1
Weir & Cockerham Fst 0,097 0,085 0,102 0,094 0,150 0,070 0,085
Nm 2,3 2,7 2,2 2,4 1,4 3,3 2,7
Lynch & Milligan Fst 0,097 0,074 0,080 0,075 0,134 0,057 0,067
Nm 2,3 3,1 2,9 3,1 1,6 5,1 3,5

TP: entre las 4 poblaciones. Cun: Cundinamarca, Tol: Tolima, SNS: Sierra Nevada, Cas: Casanare.
Nm > 1 indica homogeneidad genética, Nm < 1 no es suficiente para mantener homogeneidad genética.
Valores Fst de 0,05 a 0,15 indican poca diferenciación genética, de 0,05 a 0,15, diferenciación genética moderada, de 0,15
a 0,25, diferenciación genética grande, > 0,25, diferenciación genética muy grande.

35
López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

Figura 5. Dendrograma generado con SYNTAX para R. prolixus usando el coeficiente de disimilitud de Jaccard y el
algoritmo UPGMA. En la parte inferior aparece el código de cada insecto y su lugar de origen (Cun: Cundinamarca, Tol:
Tolima, Cas: Casanare, SNSM: Sierra Nevada, Ven: Venezuela). Grupos de exclusión: R. colombiensis, R. pallescens y
T.dimidiata.

El patrón de restricción obtenido con la enzima resultados mediante la secuenciación de dichos


Hpy I presentó una banda adicional que no fragmentos.
desapareció ni modificando el tiempo de
El marcador molecular ITS-2 presentó alta
incubación ni la cantidad de enzima, por lo que homogeneidad intra-específica, lo que concuerda
puede tratarse de un genotipo heterocigoto, en el con lo encontrado en otro estudio, en el cual
que se presenta el sitio de restricción en algunas secuencias del ITS-2 de dos individuos R. prolixus
de las cadenas y en otras no. El hecho de que el de Colombia fueron idénticas (Vergel C et al.
patrón se haya presentado en todos los individuos Marcadores especie-específicos para la
indicaría un alto porcentaje de heterocigocidad en diferenciación entre Rhodnius prolixus y Rhodnius
la población. Sería conveniente corroborar estos colombiensis . En: Memorias Curso Taller

36
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

fenotípica antenal de poblaciones domésticas de


Rhodnius prolixus (Hemiptera:Reduviidae) de
Colombia. En: Resúmenes del XXXII Congreso
Sociedad Colombiana de Entomología; 2005 Jul
27-29; Ibagué. Colombia. p.110).
Las estimaciones del índice de fijación (Fst) y la
tasa efectiva de migración (Nm) indican que entre
las poblaciones Tolima-Casanare y Cundinamarca-
Figura 6. Dendrograma generado con RAPDDIST para las Casanare existe una diferenciación genética
poblaciones de R. prolixus usando la distancia genética de moderada a grande. Sin embargo, a nivel general
Nei y aplicando bootstrap de 1.000 repeticiones . Cun:
Cundinamarca, Tol: Tolima, Cas: Casanare, SNS: Sierra se mantiene entre todas las poblaciones una
Nevada, Ven: Venezuela. Grupo de exclusión: R. diferenciación genética moderada, debida a tasas
colombiensis (Rco). de migración de por lo menos un individuo por
generación. Este movimiento de insectos entre
Internacional 2002: sistemas de información poblaciones separadas por grandes distancias y
geográfica, sensores remotos y genética barreras geográficas puede ser resultado del
poblacional de vectores y parásitos aplicados al transporte pasivo asociado a migraciones rural-
control de la enfermedad de Chagas; 2002 Dic 2- urbanas (24), por lo tanto, las migraciones
6; Universidad de los Andes, Bogotá. Colombia. humanas y barreras geográficas parecen haber
p. 45-64). influido en la dinámica de dispersión de las
poblaciones de R. prolixus, creando una
Algo similar fue reportado entre dos variedades diferenciación entre las poblaciones del oriente y
cromáticas de R. stali (8), por lo cual se sugiere el occidente del país.
usar otros marcadores moleculares de evolución
más rápida como lo son algunos genes Los resultados obtenidos por la técnica de RAPD
mitocondriales. para las poblaciones domiciliadas concuerdan con
lo reportado en estudios anteriores realizados por
Los dendrogramas obtenidos con RAPDDIST in- morfometría y patrones isoenzimáticos, en los
dican que las poblaciones de Tolima y
cuales se demuestra que aunque R. prolixus
Cundinamarca son las más cercanas genética-
presenta baja variabilidad genética, se observan
mente, probablemente debido a la cercanía
algunas diferencias significativas entre
geográfica, y un Fst de 0,071 muestra un flujo
poblaciones locales y otras variantes geográficas
genético de moderado a alto entre estas dos
(25-28); otros estudios realizados por medio de
poblaciones.
análisis de secuencias de ADN mitocondrial y
El conglomerado de Tolima y Cundinamarca se ADN nuclear reportan resultados similares a los
agrupa con la población de la Sierra Nevada, obtenidos por medio de las otras técnicas,
probablemente debido a un proceso de migración mostrando que R. prolixus es una especie muy
pasiva entre las cordilleras central y oriental a lo homogénea genéticamente (29-32); sin embargo
largo de todo el valle del Magdalena. en ninguno de estos estudios se incluyen las
poblaciones silvestres colombianas recientemente
La región del Casanare se encuentra separada
reportadas e incluidas en el presente estudio,
por la Cordillera Oriental de las otras áreas de
estudio; esta barrera geográfica al parecer ha razón por la cual encontramos una variabilidad
conllevado a un aislamiento geográfico entre las genética moderada entre las poblaciones
poblaciones del occidente y oriente del país, lo silvestres y las domiciliadas.
cual concuerda con lo reportado en otro estudio Por otro lado, la población silvestre de Casanare
realizado con patrones de sensilla entre parecer ser la menos relacionada con las otras
poblaciones de R. prolixus de la zona andina y poblaciones evaluadas y puede representar un
los llanos orientales (Esteban L et al. Variación riesgo epidemiológico para esa área. Estas

37
López D.C., Jaramillo C., Guhl F. Biomédica 2007;27(supl. 1):28-39

poblaciones silvestres han mostrado ser un riesgo Financiación


inminente en la transmisión de la enfermedad. Se
Este estudio se realizó con el apoyo financiero
ha reportado que el 3% de los niños infectados
del Fondo de Investigaciones y Posgrados de la
se debe a los insectos que están llegando de las
Facultad de Ciencias de la Universidad de los
palmas a las viviendas (Informe de la Secretaria
Andes y el CDIA-Chagas Disease Intervention
de Salud del Casanare. En: Memorias del Primer
Activities-EC Contract N° ICA4CT-2003-10049.
Taller Internacional sobre Control de la Enfermedad
de Chagas; 2005 Mayo 2-6; Universidad de los Referencias
Andes. Bogotá, Colombia, p. 245-9). 1. Moncayo A. Chagas disease: current epidemiological
trends after the interruption of vectorial and
Los hallazgos de R. prolixus en hábitats silvestres
transfusional transmission in the Southern cone
en el departamento de Casanare sugieren que en countries. Mem Inst Oswaldo Cruz 2003;98:577-91.
la región oriental del país el vector podría ser
2. Guhl F, Restrepo M, Angulo VM, Antunes CM,
autóctono, y que en las otras regiones fue Campbell-Lendrum D, Davies C. Lessons from a
introducido, encontrándose estrictamente national survey of Chagas disease transmission in
domiciliado. Colombia. Trends Parasitol 2005;21:259-62.

Es indispensable determinar la distribución y 3. Gamboa CJ. Dispersión de Rhodnius prolixus en


Venezuela. Bol Dir Malariol Saneam Ambient
variabilidad genética de las poblaciones que se 1962;3:262-72.
encuentran asociadas al domicilio y su relación
4. Garcia AL, Carrasco HJ, Shofield CJ, Stothard JR,
con las poblaciones silvestres, para establecer el Frame IA, Valente SA, et al. Random amplification of
riesgo que éstas representan y poder así realizar polymorphism DNA as a tool for taxonomics studies of
una adecuada vigilancia epidemiológica. triatomine bugs (Hemiptera: Reduviidae). J Med Entomol
1998;35:38-45.
Los resultados presentados en este estudio
5. Monteiro FA, Escalante AA, Beard CB. Molecular
constituyen una primera aproximación a la tools and triatomine systematics: a public health
estructura genética poblacional de R. prolixus en perspective. Trends Parasitol 2001;17:344-7.
Colombia y muestra datos importantes acerca de 6. Bargues MD, Marcilla A, Ramsey JM, Dujardin JP,
la dispersión en el país. Schofield CJ, Mas-Coma S. Nuclear rDNA-based
molecular clock of the evolution of triatominae
La variabilidad genética moderada detectada entre (Hemiptera: Reduviidae) vectors of Chagas disease.
las poblaciones domiciliadas es favorable para las Mem Inst Oswaldo Cruz 2000;95:567-73.
intervenciones de control químico y plantea que 7. Pacheco RS, Almeida CE, Costa J, Klisiowicz DR,
la eliminación del vector domiciliado es viable en Mas-Coma S, Bargues MD. RAPD analyses and rDNA
Colombia a pesar de la existencia de focos intergenic–spacer sequences discriminate Brazilian
populations of Triatoma rubrovaria . Ann Trop Med
silvestres, como se demostró en Venezuela (32),
Parasitol 2003;97:757-68.
y como se ha observado en Centro América con
el vector doméstico (33). 8. Bargues MD, Marcilla A, Dujardin JP, Mas-Coma S.
Triatominae vectors of Chagas disease: a molecular
Se puede concluir que las poblaciones domicilia- perspective based on nuclear ribosomal DNA markers.
Trans R Soc Trop Med Hyg 2002;96(Suppl 1):159-64.
das de R. prolixus son homogéneas debido a que
existe flujo genético entre ellas, mientras que la 9. García BA, Manfredi C, Fichera L, Segura EL.
Variation in mitochondrial 12S and 16S ribosomal DNA
población silvestre se encuentra separada de las
sequences in natural populations of Triatoma infestans
domiciliadas. Se evidencia la necesidad de (Hemiptera, Reduviidae). Am J Trop Med Hyg
estudiar la estructura genética de los focos 2003;68:692-4.
silvestres, sus posibles rutas de dispersión y el 10. Marcilla A, Bargues MD, Ramsey MJ, Magallon-
riesgo epidemiológico que representan. Gastelum E, Salazar-Schettino PM, Abad-Franch
F, et al. The ITS-2 of the nuclear rDNA as a molecular
Conflicto de intereses marker for populations, species, and phylogenetic
relationships in Triatominae (Hemiptera: Reduviidae)
Los autores declaran no tener conflicto de vectors of Chagas disease. Mol Phylogenet Evol
intereses con respecto al estudio. 2001;18:136-42.

38
Biomédica 2007;27(supl. 1):28-39 Estructura poblacional de R. prolixus en Colombia

11. Caldeira RL, Carvalho OS, Mendonça CL, Graeff- 22. Weir BS, Cockerham CC. Estimating F-statistics for
Teixeira C, Silva MC, Ben R, et al . Molecular the analysis of population’s structure. Evolution
differentiation of Angiostrongylus costaricensis , A. 1984;38:1358-70.
Cantonensis, and A. Vasorum by polymerase chain
23. Lynch M, Milligan BG. Analysis of population genetic
reaction-restriction fragment length polymorphism.
structure with RAPD markers. Mol Ecol 1994;3:91-9.
Mem Inst Oswaldo Cruz 2003;98:1039-43.
24. Dias JC. Rural resource development and its potential
12. Jaramillo C, Montaña MF, Castro LR, Vallejo GA,
to introduce domestic vectors into a new
Guhl F. Differentiation and genetic analysis of
epidemiological situation. Rev Argent Microbiol
Rhodnius prolixus and Rhodnius colombiensis by rDNA
1988;20(Suppl. 1):81-5.
and RAPD amplification. Mem Inst Oswaldo Cruz
2001;96:1043-8. 25. Harry M, Galindez I, Cariou ML. Isozyme variability
and differentiation between Rhodnius prolixus , R.
13. Ramírez CJ, Jaramillo CA, Delgado M, Pinto NA,
robustus and R. pictipes, vectors of Chagas disease in
Aguilera G, Guhl F. Genetic structure of sylvatic,
Venezuela. Med Vet Entomol 1992;6:37-3.
peridomestic and domestic populations of Triatoma
dimidiata (Hemiptera: Reduviidae) from an endemic 26. Harry M. Isozymic data question the specific status of
zone of Boyaca, Colombia. Acta Trop 2005;93:23-9. some blood-sucking bugs of the genus Rhodnius ,
vectors of Chagas disease. Trans R Soc Trop Med
14. Borges EC, Romanha AJ, Diotaiuti L. Uso do random Hyg 1993;87:492.
amplified polymorphic DNA (RAPD) no estudo
populacional do Triatoma brasiliensis Neiva, 1911. Cad 27. Harry M. Morphometric variability in the
Saúde Pública 2000;16:97-100. Chagas´disease vector Rhodnius prolixus. Jpn J Genet
1994;69:233-50.
15. Lent H, Wygodzinsky P. Revision of the Triatominae
(Hemiptera, Reduviidae) and their significance as 28. Monteiro FA, Lazoski C, Noireau F, Sole-Cava AM.
vectors of Chagas disease. Bull Am Mus Nat Hist Allozyme relationships among ten species of Rhodniini,
1979;163:175-499. showing paraphyly of Rhodnius including
Psammolestes. Med Vet Entomol 2002;16:83-90.
16. Welsh J, Pretzrnan C, Postic D, Girons IS, Baranton
G, McClelland M. Genomic fingerprinting by arbitrary 29. Monteiro FA, Wesson DM, Dotson EM, Schofield
primer polymerase chain reaction resolves Borrelia CJ, Beard CB. Phylogeny and molecular taxonomy of
burgeri into three distinct phylogenetic groups. Int J the Rhodniini derived from mitochondrial and nuclear
Syst Bacteriol 1992; 42:370-7. DNA sequences. Am J Trop Med Hyg 2000;62:460-5.

17. Kambhampati S, Black WC 4th, Rai KS. Random 30. Monteiro FA, Barrett TV, Fitzpatrick S, Cordon-
amplified polymorphic DNA of mosquito species and Rosales C, Feliciangeli D, Beard CB. Molecular
populations (Diptera: Culicidae): techniques, statistical phylogeography of the Amazonian Chagas disease
analysis, and applications. J Med Entomol 1992;29: vectors Rhodnius prolixus and R. robustus. Mol Ecol
939-45. 2003;12:997-1006.

18. Podani J. SYNTAX. Computer programs for 31. Abad-Franch F, Monteiro FA. Molecular research
multivariate data analysis in ecology and systematics. and the control of Chagas disease vectors. An Acad
Budapest: Scienta Publishing; 1993. Bras Cienc 2005;77:437-54

19. Nei M, Li WH. Mathematical model for studying genetic 32. Feliciangeli MD, Campbell-Lendrum D, Martinez C,
variation in terms of restriction endonucleases. Proc Gonzales D, Coleman P, Davies C. Chagas disease
Natl Acad Sci USA 1979;76:5269-73. control in Venezuela: lessons for the Andean region
and beyond. Trends Parasitol 2003;19:44-9.
20. Nei M. Genetic distance between populations. Am Nat
1972;106:283-92. 33. Zeledón R. Some historical facts and recent issues
related to the presence of Rhodnius prolixus (Stal, 1859)
21. Wright S. Evolution in Mendelian populations. Genetics (Hemiptera:Reduviidae) in Central America.
1931;16:97-159. Entomología y vectores 2004;11:233-46.

39
Rendón D.A.,
Biomédica Genes C.M., Triana O.
2007;27(supl.1):40-9 Biomédica 2007;27(supl.1):40-9

ARTÍCULO ORIGINAL

Lesión celular del miocardio y actividad de la ATPsintasa


mitocondrial en ratas infectadas con una cepa colombiana
de Trypanosoma cruzi
Dairo Alonso Rendón 1, Carlos M. Genes 2, Omar Triana 2

1
Facultad de Ciencias, Laboratorio de Biofísica, Universidad Nacional de Colombia sede Medellín,
Medellín, Colombia.
2
Grupo de Chagas, Instituto de Biología, Universidad de Antioquia, Medellín, Colombia.

Introducción. La enfermedad de Chagas es la principal causa de cardiomiopatía crónica en


regiones endémicas de Latinoamérica. Alteraciones en el metabolismo energético mitocondrial
cardiaco causadas por Trypanosoma cruzi pueden estar involucradas en el desarrollo de esta
cardiomiopatía.
Objetivo. En este trabajo se investigó la lesión celular del miocardio de ratas durante una
infección por la cepa colombiana Mg8 de Trypanosoma cruzi y la actividad de la ATPsintasa
mitocondrial para correlacionar el daño al miocardio con el metabolismo energético
mitocondrial.
Materiales y métodos. Se utilizaron grupos de cinco ratas, las cuales fueron infectadas con
tripomastigotes. El curso de la infección se evaluó a nivel parasitológico, histopatológico y
molecular. La actividad de la ATPsintasa mitocondrial del miocardio se evaluó tanto en las
ratas infectadas con parásitos como en ratas control no infectadas.
Resultados. Se determinaron los días 26 y 60 post-infección como el punto de máxima
parasitemia y como el punto de desaparición de los parásitos en sangre circulante,
respectivamente. Los resultados histopatológicos y moleculares muestran que la cepa Mg8
tiene tropismo por el tejido cardiaco y causa una considerable lesión celular del miocardio de
ratas tanto a 26 días (fase aguda) como a 60 días post-infección (fase crónica). A pesar de la
lesión observada, no se encontró diferencia estadísticamente significativa en la actividad de la
ATPsintasa de las ratas infectadas en estos días al comparar con sus respectivos controles.
Conclusión. Estos resultados sugieren que el metabolismo energético mitocondrial no está
alterado en la lesión celular del miocardio de las ratas, observada durante la infección con la
cepa colombiana Mg8 de T. cruzi.
Palabras clave: Trypanosoma cruzi, enfermedad de Chagas, miocardiopatía chagásica,
metabolismo energético, mitocondria.
Myocardial cellular damage and the activity of the mitochondrial ATP synthase in rats
infected with a Colombian strain of Trypanosoma cruzi
Introduction. Chagas disease is the main cause of cardiomyopathy in endemic regions of Latin
America. Alterations in the cardiac mitochondrial energy metabolism caused by Trypanosoma
cruzi can be involved in the development of this cardiomyopathy during the course of Chagas
disease.
Objective. The cellular injury of the rat myocardium was investigated in rats infected with the
Colombian Mg8 strain of Trypanosoma cruzi. The activity of mitochondrial ATP synthase was
measured to determine the relationship heart damage with the energy metabolism.
Materials and methods. Two groups of five rats each were infected with tripomastigotes, with
1 group of 6 rats serving as controls. The course of infection was characterized by parasitological,
histopathological and molecular studies. The mitochondrial ATP synthase activity of the
myocardium was evaluated in all rats.
Results. Peak parasitaemia (day 26 post infection) and the time of parasite clearance from
circulating blood (day 60 post infection) were determined for acute and chronic phase models.

40
Biomédica 2007;27(supl.1):40-9 Lesiones del miocardio durante la enfermedad de Chagas

The histopathological and molecular results showed that the Colombian Mg8 strain has tropism
to the cardiac tissue and causes considerable cellular injury of the myocardium in rats during
both phases. Despite the lesions observed in infected rats, no statistical difference in the
activity of the mitochondrial ATPsynthase was observed between them and the non-infected
rats.
Conclusion. Mitochondrial energy metabolism of the cardiomyocites does not appear to change
during cellular injury of rat myocardium associated with infection by the Colombian Mg8 T. cruzi
strain.
Key words: Trypanosoma cruzi, Chagas disease, Chagas cardiomyopathy, energy
metabolism, mitochondria.

Trypanosoma cruzi, agente causal de la producción de energía por parte de las mito-
enfermedad de Chagas, afecta aproximadamente condrias (síntesis del ATP), pueden desembocar
a 17 millones de personas de diferentes regiones en lesiones importantes del miocardio (6).
de Centro y Suramérica, de las cuales probable- En la producción de energía en los cardiomiocitos
mente entre el 20 y el 35% desarrolla la juega un gran papel la enzima ATPsintasa
enfermedad. En Colombia, la enfermedad de mitocondrial, la cual cataliza la síntesis de ATP
Chagas se encuentra ampliamente distribuída en utilizando la energía almacenada en el potencial
las zonas rurales y se estima que el 5% de la electroquímico de la membrana mitocondrial
población asentada en las zonas endémicas está interna. Por su importancia, esta enzima mito-
infectada (1). condrial se ha estudiado ampliamente en las
La cardiomiopatía es la afección más importante últimas tres décadas, tanto en condiciones
secundaria a esta enfermedad, ya que puede fisiológicas como patológicas (7-10). Uyemura et
producir muerte súbita o discapacidad física, lo al. (2) y Vyatkina et al. (3) mostraron una disfunción
que representa grandes costos socioculturales y en la síntesis de ATP por parte de la ATPsintasa
económicos. Para esclarecer la génesis de la mitocondrial del miocardio durante la infección con
cardiomiopatía chagásica se ha prestado gran Trypanosoma cruzi utilizando mitocondrias
atención a las alteraciones en el metabolismo aisladas.
energético mitocondrial del miocardio (2,3). Las Considerando que las cepas colombianas de T.
mitocondrias se consideran uno de los organelos cruzi tienen tropismo hacia el tejido cardiaco (11),
más importantes de los cardiomiocitos, ya que es importante evaluar la posible lesión celular del
en condiciones fisiológicas generan más del 90% miocardio durante una infección con estas cepas
de la energía necesaria para su funcionamiento y la asociación de tal lesión con el metabolismo
(4). Además, pueden ser blanco de múltiples energético mitocondrial. En el presente trabajo
daños, producto de la respuesta inmunológica del se determinó la lesión celular del miocardio de
hospedero a la infección (5). La importancia de ratas infectadas con una cepa colombiana de T.
las mitocondrias en el funcionamiento de las cruzi y se evaluó la actividad de la ATPsintasa
células cardiacas también se manifiesta en el mitocondrial en homogeneizados de este tejido.
hecho de que entre el 25 y 35% del volumen de Materiales y métodos
los cardiomiocitos está ocupado por ellas. Es así
como los eventos patofisiológicos que alteran la Animales de laboratorio e infección con el
parásito
Correspondencia: Se inocularon subcutáneamente ratas hembras
Omar Triana Chávez, Calle 67 N. 53-108, Instituto de Biología, de la cepa Wistar de aproximadamente 200
Universidad de Antioquia, Medellín, Colombia. Telefax: gramos con 2 x 105 tripomastigotes sanguíneos
2105622
obtenidos de ratones Balb/c previamente
otriana@matematicas.udea.edu.co
irradiados con 450 rad de rayos gamma en un
Recibido: 10/08/05; aceptado: 24/03/06 volumen total de sangre de entre 50 y 100 µl.

41
Rendón D.A., Genes C.M., Triana O. Biomédica 2007;27(supl.1):40-9

Para la infección se usó la cepa colombiana Mg8, 100%) y finalmente en xilol. Luego, los cortes se
perteneciente al grupo I de Trypanosoma cruzi. incluyeron en parafina y se cortaron con el
Esta cepa se aisló en el año 2003 a partir del micrótomo en secciones tisulares de tres a cinco
vector Triatoma dimidiata de origen silvestre micrómetros de espesor. Las muestras se tiñeron
procedente del departamento del Magdalena, y con hematoxilina-eosina para detectar la presencia
se mantuvo por repiques sucesivos cada siete del parásito y el nivel de inflamación del tejido, y
días en medio de cultivo líquido LIT a 28°C (12) y con coloración de tricrómico para determinar el
por infección en ratones Balb/c. Los ensayos grado de fibrosis del tejido cardiaco.
realizados en este estudio se iniciaron en el mismo
Extracción de ADN
año de aislamiento de la cepa, después de 18
pases por medio de cultivo y varios pases por El ADN se extrajo a partir de una preparación de
ratón. tejido cardiaco de animales infectados, utilizando
el método de Salting Out (14), y en algunos casos
Todos los animales se mantuvieron de acuerdo a
el método de fenol-cloroformo (15). Las muestras
la reglamentación establecida por el Comité de
de ADN se disolvieron en 50 ml de agua destilada
Ética para la Experimentación con Animales de
desionizada estéril a 37°C por cinco minutos (16)
la Universidad de Antioquia.
y se guardaron a -20°C.
Caracterización de la infección
Detección del parásito por PCR
Se utilizó un grupo de seis ratas para seguir el
Se utilizaron dos marcadores diferentes para
curso de la infección y determinar la fase aguda
detectar la presencia del parásito en los tejidos
(máxima parasitemia en sangre circulante) y
cardiacos a partir de una preparación de corazón
crónica de la enfermedad (desaparición de la
empleada en la determinación de la actividad de
parasitemia en sangre circulante). La evaluación
la ATPsintasa mitocondrial: el ADN del
de los animales infectados se realizó día por
cinetoplasto (kDNA) y el espaciador intergénico
medio haciendo conteo de tripomastigotes
de los genes mini-exón. Para la amplificación de
sanguíneos en placa en un microscopio óptico
la región variable del kDNA se utilizaron los
con objetivo de 40X (13). Adicionalmente, se
iniciadores S35 y S36, que amplifican un
inocularon dos grupos de cinco ratas cada uno
fragmento de 330 pb (17). La mezcla de reacción
para determinar la actividad de la ATPsintasa
para PCR se llevó a cabo en un volumen final de
mitocondrial y se hizo evaluación por reacción en
25 µl que contenían 2,5 µl de ADN molde a una
cadena de la polimerasa (PCR) en la fase aguda
concentración de 50ng/µl, 2mM MgCl2, 2mM
y crónica de la enfermedad; así mismo, se inoculó
dNTPs, 10 pmol/µl iniciadores, 0,05 unidades de
un grupo de dos animales, para realizar los
Taq ADN polimerasa (Fermentas), buffer 10X
estudios histopatológicos tanto en la fase aguda
(750mM Tris-HCl pH 8,8; 200mM (NH4)2SO4 y
como crónica de la enfermedad. Cada grupo de
0,1% Tween 20), y agua tridestilada estéril.
animales infectados tuvo un grupo control no
infectado de igual número de animales mantenido Los ciclos de la reacción se realizaron a una
en las mismas condiciones de laboratorio. temperatura inicial de 94°C por tres minutos,
seguida por 35 ciclos a 94°C por 45 segundos, a
Lesión celular del miocardio
63 °C por 45 segundos y a 72°C por 45 segundos,
Para determinar la lesión celular del miocardio, a y un último ciclo a 72°C por 10 minutos. El
dos grupos de animales infectados y a sus espaciador intergénico de los genes mini-exón se
respectivos controles se les extrajo el corazón a amplificó utilizando los iniciadores TC1, TC2 y
26 y 60 dpi., e inmediatamente se fijó en formol al TCC, los cuales amplifican un fragmento de 300
10%. Los corazones se seccionaron en su totalidad pb para el grupo T. cruzi II y un fragmento de 350
en cortes seriados transversales de 2 a 3 mm, y pb para el grupo T. cruzi I (18). La PCR se realizó
se deshidrataron empleando una serie de en un volumen final de 25 µl que contenían 2,5 µl
alcoholes de gradación ascendente (50, 70, 80 y de ADN molde a una concentración de 50ng/µl,

42
Biomédica 2007;27(supl.1):40-9 Lesiones del miocardio durante la enfermedad de Chagas

1,5mM MgCl2,10 pmol de cada iniciador, 2mM


dNTPs, 0,025 unidades de Taq DNA polimerasa,
buffer 10X (750mM Tris-HCl (pH 8,8); 200mM
(NH4)2SO4 y 0,1% Tween 20), y agua tridestilada
estéril. Los ciclos de amplificación se realizaron
a una temperatura inicial de 94°C durante un
minuto, seguida de 27 ciclos a 94°C por 30
segundos, a 55°C por 30 segundos, a 72°C por
30 segundos y un ciclo final a 72°C por 10 minutos.
Los productos amplificados se detectaron en geles
de agarosa al 1,5% teñidos con bromuro de etidio
a 0,5 mg/µl y se visualizaron con luz ultravioleta
(15).
Actividad de la ATPsintasa mitocondrial Figura 1. Curva típica en la determinación de la actividad de
la ATPsintasa mitocondrial. En orden secuencial se
Los corazones de ratas sacrificadas por adicionaron en los puntos indicados en las flechas 3,5 ml
medio de incubación, homogeneizado de corazón (1 mg de
dislocación cervical se extrajeron rápidamente y
proteína total), 5mM glutamato-malato, 500 mM de ADP, 0,8
se pusieron en solución de preparación del tejido mg oligomicina/mg de proteína total de homogeneizado, y por
a un pH de 7,5 entre 0 y 2°C (0,17 M KCl, 10 mM último, dos adiciones consecutivas de 200nmol de KH2PO4
EDTA, 0,1% suero de albúmina bovina, 10 mM cada una. Los homogeneizados de tejido cardiaco se
incubaron durante 1 min y 30 segundos con 5mM de
Tris-HCl) durante dos a tres minutos. Los glutamato-malato antes de adicionar ADP. El KH2PO4 se
corazones se pasaron por una prensa manual y adiciona para calibrar la señal de registro.
con el tamizado se obtuvo un homogeneizado de
tejido cardiaco (3,5 ml solución/1g de tejido)
utilizando un equipo Potter-Elvehjem a una adiciones: (i) 500µM ADP; (ii) oligomicina, 0,8 µg/g
velocidad angular de 700 rev/min durante dos a de proteína, y (iii) 200 nmol de fosfato inorgánico
tres minutos y a una temperatura entre 0 y 2°C. (KH2PO4) para calibrar la señal (figura 1). El alcohol
Finalmente, el homogeneizado obtenido se que se adicionó con la oligomicina no superó el
0,1%. La actividad de la ATPsintasa es equivalente
conservó entre 0 y 2°C hasta iniciar las
a la velocidad de cambio de pH después de la
mediciones. La actividad de la ATPsintasa
adición de ADP calibrada con respecto al fosfato
mitocondrial se estimó por medio de un método
inorgánico y a la cantidad de proteína total
potenciométrico (19), y se calculó según la
adicionada con la suspensión de tejido cardiaco.
siguiente fórmula: actividad de la ATPsintasa
El principio de este método potenciométrico radica
mitocondrial = 2 m x 200 nmol Pi / M x ( h1 + h2 ),
en que la desaparición del fosfato inorgánico
donde h1 y h2 (en unidades de mV) son las alturas
(H2PO4-) del medio debido a la síntesis de ATP
de los saltos en la señal de registro después de
por la ATPsintasa mitocondrial está asociada al
adicionar dos veces consecutivamente 200 nmol
cambio en el pH (∆pH) causado por la disociación
de fosfato inorgánico, m (en unidades de mV/min)
del H 2PO4 en HPO4 2 - y H + (ATP 4 -↔ ADP 3 - +
es la pendiente de la señal de registro después
H2PO4 -; H2PO4 - ↔ HPO4 2 - + H+). La solución para
de adicionar ADP, M (en unidades de mg) es la
la determinación de la actividad de la ATPsintasa
cantidad de proteína total adicionada con la
mitocondrial fue de 250 mM sacarosa, 5 mM
suspensión de tejido cardiaco; y Pi es fosfato
KH2PO4, 2 mM tris-HCl, y 0,1 mM EDTA; pH 7,4
inorgánico (figura 1).
(HCl/KOH a 37°C). Las mediciones se realizaron
Brevemente, los homogeneizados de corazón de en recipientes de vidrio bajo agitación magnética.
rata (1 mg de proteína total de homogeneizado de El cambio en el pH se midió a 25°C utilizando un
tejido cardiaco) fueron incubadas durante un potenciómetro Corning modelo 12 de alta
minuto y 30 segundos con 5 mM de glutamato- sensibilidad y rapidez conectado a un computador
malato; después se realizaron las siguientes tres que visualiza la cinética del proceso. Las

43
Rendón D.A., Genes C.M., Triana O. Biomédica 2007;27(supl.1):40-9

velocidades de síntesis del ATP se obtuvieron mililitro. La desaparición de la parasitemia fue


en nmol Pi/mg de proteína/min. La cuantificación estimada para el día 60 pi (60 dpi), que se consideró
de la proteína total en los homogeneizados de como el inicio de la fase crónica de la enfermedad
corazón se realizó por el método de Biuret (20), (datos no mostrados).
utilizando como patrón de calibración el suero de
Lesión celular del miocardio
albúmina bovina.
El análisis histopatológico se realizó en tejido
Análisis estadístico
cardiaco de dos animales sacrificados a los 26 y
Para el análisis de los valores obtenidos en la 60 dpi y de sus respectivos controles. En los
actividad de la ATPsintasa mitocondrial se animales control se observaron fibras ordenadas,
compararon cada uno de los grupos infectados distribución normal del núcleo en el miocito y las
con su respectivo control. Se utilizaron los células intersticiales se mostraban histológica-
programas Graph Pad Prism versión 2,0 y JMP mente sanas (figura 2A). En los animales
versión 3.2.6. Se usó el t-test y se consideró p < sacrificados a los 26 dpi se observó miocarditis y
0,05 como criterio de grupos significativamente no se encontró fibrosis (figura 2B). Se observó un
diferentes. Los datos se presentaron como importante infiltrado inflamatorio mononuclear,
promedios ± error estándar de la media (SEM). confluente con escasos seudoquistes (uno en un
Las mediciones se realizaron por triplicado para campo de alto poder) (figura 2C). En los animales
cada animal sacrificado y luego se obtuvo el sacrificados a los 60 dpi se observó infiltrado
promedio de estos datos. inflamatorio mononuclear a nivel intersticial
alrededor de las fibras cardiacas (figura 3A),
Resultados
seudoquistes (tres en un campo de alto poder)
Caracterización de la infección (figura 3B), miocarditis, miocitolisis focal y áreas
El desarrollo de la enfermedad en las ratas de fibrosis alrededor de algunas fibras cardiacas
infectadas con la cepa Mg8 estuvo marcado por degeneradas (figuras 3A y 3C).
la aparición de parásitos en sangre a los 11 días Dos de las seis ratas empleadas para la
después de la infección (11 dpi). Se observó la construcción de la curva de parasitemia murieron
presencia de dos picos de alta parasitemia: el en los días 28 y 30 posterios a la infección. En
primero en el día 26 (26 dpi), con estos animales se encontró un importante daño
aproximadamente 9,1x105 tripomastigotes por tisular en el tejido cardiaco. En el animal muerto
mililitro, y el segundo, en el día 40 pi, con a los 30 días pi se observaron abundantes fibras
aproximadamente 6,5 x105 tripomastigotes por miocárdicas parasitadas con formación de

Figura 2. Corte histológico de tejido cardiaco de ratas infectadas con la cepa Mg8.
⇒ ) e infiltrado
A. Rata control no infectada: no hay presencia de infiltrado inflamatorio, fibrosis o miocitolisis. B. Miocitólisis (⇒
inflamatorio mononuclear observado en ratas a los 26 días pi (40X) ( ). C. Seudoquiste de T. cruzi observado 26 días pi
→ ). La tinción de los cortes fue realizada con hematoxilina-eosina.
(40X) (→

44
Biomédica 2007;27(supl.1):40-9 Lesiones del miocardio durante la enfermedad de Chagas

→ ) e infiltrado
Figura 3. Corte de tejido cardiaco de rata infectada con la cepa Mg8 a los 60 días pi. A. Quiste de T. cruzi (→
inflamatorio mononuclear ( ) (10X). B. Nido de amastigotes (→→) (40X). C. Fibrosis (→
→ ) (40X). La tinción de los cortes
en las figuras 3A y 3B se realizó con hematoxilina-eosina. El corte de la figura 3C se tiñó con coloración de tricrómico.

seudoquistes intracelulares por la presencia de a los 26 pi no fue estadísticamente diferente a


formas amastigotas de T. cruzi, reacción inflamatoria aquella obtenida para su respectivo control (figura
focal consistente en cúmulos de mononucleares, 5A). De igual forma, cuando se compararon las
edema intersticial y fibrosis focal. En el animal velocidades de síntesis de ATP para esta enzima
muerto a los 28 días pi se encontró mayor reacción en los animales y en sus respectivos controles a
inflamatoria consistente en focos confluentes de
células mononucleares con algunos polimorfo-
nucleares neutrófilos alrededor de las fibras
cardíacas, miocitolisis y edema. Se identificaron
menos fibras cardiacas parasitadas, infiltrado
mononuclear en el epicardio y no se observó
fibrosis (datos no mostrados). En conclusión, los
resultados muestran una grave lesión celular del
miocardio en los corazones de estas ratas
muertas durante el establecimiento de la infección.
Análisis por PCR
En el corazón de todos los animales infectados
se observó la banda de 330 pb esperada para la
región variable del marcador k-DNA de T. cruzi
(figura 4A). De igual manera, se observó que todas
las muestras amplifican la banda de 350 pb para
el gen mini-exón, característica del grupo I de T.
cruzi (figura 4B).
Figura 4. Amplificación por PCR de la región variable del
Actividad de la ATPsintasa mitocondrial kDNA (A) y la región intergénica del gen mini-exón (B). Se
usó el ADN extraído de corazón de animales infectados a
La actividad de la ATPsintasa mitocondrial los días 26 y 60 después de la infección (pi). A. Carril 1:
durante la infección con T. cruzi se determinó en escalera de 100pb; carriles 2 a 6: muestras extraídas de
un grupo de cinco animales para el día 26 pi, que tejido cardiaco de ratas a los 60 días pi; carriles 7 a 11:
representa la fase aguda (figura 5A), y en otro muestras extraídas de tejido cardiaco de ratas a los 26 días
pi; carril 12: control positivo (ADN de cepa en cultivo); carril
grupo de cinco animales para el día 60 pi, que 13: control negativo. B. Carril 1: control negativo; carril 2:
representa el inicio de la fase crónica (figura 5B). escalera de 100pb; carril 3: control positivo (ADN de cepa
Cada grupo de animales infectados contaba con en cultivo); carril 4: control negativo (animal no infectado);
su respectivo grupo control (n = 5). La actividad carriles 5 a 9: muestras extraídas de tejido cardiaco de rata
a los 60 días pi.; carriles 10 a 14: muestras extraídas de
de la ATPsintasa mitocondrial durante la infección tejido cardiaco de rata a los 26 días pi. Gel de agarosa al
al miocardio por T. cruzi en animales observada 1,5% teñido con bromuro de etidio.

45
Rendón D.A., Genes C.M., Triana O. Biomédica 2007;27(supl.1):40-9

Figura 5. Actividad de la ATPsintasa mitocondrial en tejido cardiaco de rata a los 26 días pi (A) y 60 días pi (B) con T. cruzi.
Los datos son los promedios de cinco mediciones independientes ± SEM (n = 5); p < 0,05 fue el criterio de diferencias
estadísticamente significativas. Cada medición independiente se realizó tres veces.

los 60 pi, no se evidenciaron diferencias tejido cardiaco la presencia del parásito (ADN) o
estadísticamente significativas en la actividad de restos de éste, lo que garantiza que en todos los
la ATPsintasa mitocondrial (figura 5B). casos en que se evaluó la actividad de la
Discusión ATPsintasa mitocondrial del miocardio, el parásito
manifestó tropismo por el tejido cardiaco. Esto
La enfermedad de Chagas se presenta con una es importante ya que los tejidos de los animales
gran variedad de manifestaciones clínicas y es la infectados y usados para la determinación de la
mayor causa de miocarditis aguda y de actividad de la ATPsintasa mitocondrial del
cardiomiopatía crónica en las regiones endémicas miocardio no fueron sometidos a estudios
de Latinoamérica (21,22). Considerando que las histopatológicos debido a que todo el corazón se
cepas colombianas de T. cruzi muestran tropismo necesitó para preparar las suspensiones cardiacas.
hacia el tejido cardiaco (11), es importante
establecer si este tropismo está asociado con la Los resultados permiten concluir que la cepa Mg8
lesión celular del miocardio en el hospedero. Para de Colombia produce importantes lesiones
esto, la lesión celular del miocardio del hospedero celulares en el tejido cardiaco, activación de la
se estudió en ratas infectadas con la cepa respuesta inmunológica a nivel de este órgano y
colombiana Mg8 de Trypanosoma cruzi aislada presencia de las formas replicativas de T. cruzi,
del vector Triatoma dimidiata silvestre en el mismo tanto a los 26 dpi como a los 60 dpi. Además, la
año de inicio de este estudio, lo que implica que cepa Mg8 es una cepa virulenta y altamente
conserva sus características naturales de patogénica, hecho corroborado por la mortalidad
virulencia y patogenicidad. antes de los 20 dpi que presentaron los ratones
utilizados como fuente de tripomastigotes (50%
Los análisis histopatológicos (figuras 2 y 3) de mortalidad), y la presentada por las ratas
revelaron la capacidad de la cepa colombiana Mg8 utilizadas en la determinación de la curva de
para producir lesiones celulares en el miocardio parasitemia (30% de mortalidad). Ello permite
del hospedero, características de la cardiomiopatía concluir que esta cepa generó en los individuos
chagásica (22-25), lo que muestra que se está infectados un importante proceso degenerativo a
frente a una manifestación típica de la enfermedad nivel celular en el miocardio del hospedero,
de Chagas. Así, la presencia continua del parásito característico de la cardiopatía chagásica, lo que
en las zonas de lesión del corazón puede ser implica la presencia del parásito o de su ADN en
importante en el origen de la cardiomiopatía el tejido cardiaco o en las células inflamatorias
chagásica (26). como un factor que probablemente contribuye en
Los resultados moleculares permiten asegurar que la producción de las lesiones y en la mortalidad
todos los organismos infectados tenían en su observada en los hospederos estudiados (26). Es

46
Biomédica 2007;27(supl.1):40-9 Lesiones del miocardio durante la enfermedad de Chagas

importante destacar que se observaron adicionales de las mitocondrias en los estudios


considerables lesiones celulares del miocardio del del metabolismo energético mitocondrial durante
hospedero (figura 2) en un periodo relativamente diferentes lesiones celulares del miocardio es el
inicial en la curva de parasitemia (26 dpi de la uso de homogeneizados rápidamente preparados
fase aguda), lo que permite concluir que en este a partir del tejido cardiaco (35,36). En el presente
inicio de la infección ya hay una manifestación trabajo fue crucial buscar las condiciones
clara de lesiones del miocardio. experimentales que permitieran diferenciar, usando
homogeneizados de tejidos cardiacos infectados
Existen varias hipótesis sobre la patogénesis de
con parásitos, la actividad de la ATPsintasa
la cardiomiopatía chagásica, como la neurogénica,
mitocondrial tipo miocardio de la actividad de la
la autoimmunidad (27-30), los problemas en la
ATPsintasa mitocondrial tipo parásito. La clave
micro circulación del corazón (31,32) y las
que permitió usar homogeneizados de tejido
alteraciones en el metabolismo energético
cardiaco en el presente trabajo radica que en T.
mitocondrial del miocardio (2,3). Esta última
cruzi el complejo I de la cadena transportadora
adquiere gran interés en el estudio de todas las
de electrones no está funcionalmente presente
patologías cardiovasculares, ya que más del 90%
(37). De esta forma, si usamos como substrato
de la energía necesaria para el funcionamiento
de respiración glutamato/malato, que pone a
de los cardiomiocitos se produce en las
funcionar la cadena transportadora de electrones
mitocondrias. Por tal motivo era importante
a partir del complejo I, en presencia de ADP sólo
determinar si la lesión celular del miocardio
las mitocondrias que poseen este complejo
observada a los 26 y 60 dpi con la cepa colombiana
(mitocondrias del corazón) podrán sintetizar ATP.
Mg8 de T. cruzi compromete al metabolismo
Los resultados obtenidos (figura 5A y 5B) indican
energético mitocondrial del miocardio. En este
que durante el proceso de inicio de la enfermedad
proceso es crucial la actividad de la ATPsintasa
de Chagas no hay alteración en la actividad
mitocondrial, ya que esta enzima es en última
enzimática de la ATPsintasa mitocondrial ni en el
instancia la encargada de sintetizar el ATP
día 26 pi, fase aguda, ni en el día 60 pi, fase
mitocondrial necesario para el buen funcionamiento
crónica en comparación con los respectivos
de los cardiomiocitos. La actividad de la ATPsintasa
controles; esto quiere decir que por cada unidad
mitocondrial representa en esencia la cantidad de
(en nuestro caso 1 mg de proteína total de homo-
ATP sintetizado por las mitocondrias contenidas
geneizado de tejido cardiaco) de tejido cardiaco
en una unidad de tejido (en nuestro caso, 1 mg de
infectado con la cepa colombiana Mg8 no hay
proteína total del homogeneizado de tejido
déficit de cantidad de ATP mitocondrial (necesario
cardiaco) por unidad de tiempo. Por ello, la
para otras funciones celulares) por unidad de
actividad de la ATPsintasa mitocondrial es un
tiempo con respecto a los controles. Partiendo
criterio del funcionamiento del metabolismo
del hecho de que la actividad de la ATPsintasa
energético mitocondrial del miocardio. Lo más
mitocondrial es un criterio del metabolismo
usual es estudiar el metabolismo energético
energético mitocondrial, estos resultados (figura
mitocondrial del miocardio en mitocondrias
5A y 5B) permiten afirmar que el metabolismo
aisladas del tejido cardiaco o en partículas
energético mitocondrial no está comprometido
submitocondriales preparadas a partir de las
durante una infección con la cepa colombiana Mg8
mitocondrias aisladas. Sin embargo, se han
a los 26 y 60 días pi, a pesar de las considerables
reportado alteraciones estructurales y funcionales
lesiones celulares del miocardio observadas
adicionales en las mitocondrias cuando éstas se
(figuras 2 y 3).
aíslan de su ambiente natural (33). Dichas
alteraciones adicionales pueden ser más La no variación con respecto a cada control de la
marcadas cuando se usan tejidos isquémicos (34), actividad de la ATPsintasa mitocondrial observada
como es el caso del tejido del corazón durante la en homogeneizados de tejido cardiaco infectadas
infección con T. cruzi (28,29). Por lo tanto, lo más con la cepa colombiana Mg8 de T. cruzi no
conveniente para evitar estas posibles alteraciones significa que uno de los complejos mitocondriales,

47
Rendón D.A., Genes C.M., Triana O. Biomédica 2007;27(supl.1):40-9

o la fina sincronización entre estos, no se vea Financiación


afectado negativamente durante la infección. Es
Esta investigación fue financiada por el CODI,
posible que la cantidad de ATP mitocondrial
proyecto CPT 0321 de la Universidad de Antioquia
producido por una sola mitocondria en la unidad
y por el DIME, proyecto 030802601 de la
de tiempo disminuya con respecto a las muestras
Universidad Nacional de Colombia, sede Medellín.
no infectadas, pero que en un proceso de defensa
el tejido cardiaco genere más mitocondrias por Referencias
unidad de tejido infectado que su control para 1. Moncayo A. Chagas disease: current epidemiological
compensar la caída en la síntesis de ATP trends after the interruption of vectorial and
mitocondrial por una sola mitocondria. Este transfusional transmission in the Southern Cone
aspecto, por ahora simplemente especulativo, countries. Mem Inst Oswaldo Cruz 2003;98:577-91.
amerita futuras investigaciones. 2. Uyemura SA, Jordani MC, Polizello AC, Curti C.
Heart FoF1-ATPase changes during the acute phase of
Por último, es importante señalar que investigaciones Trypanosoma cruzi infection in rats. Mol Cell Biochem
previas reportan alteraciones en la actividad de la 1996;165:127-33.
ATPsintasa mitocondrial durante una infección con 3. Vyatkina G, Bhatia V, Gerstner A, Papaconstantinou
T. cruzi, y con base en esto se concluye que J, Garg N. Impaired mitochondrial respiratory chain
durante la infección hay compromiso del meta- and bioenergetics during chagasic cardiomyopathy
bolismo energético mitocondrial (2,3). Es plausible development. Biochim Biophys Acta 2004;1689:162-73.
que estas alteraciones negativas en la actividad 4. Harris DA, Das AM. Control of mitochondrial ATP
de la ATPsintasa mitocondrial durante una synthesis in the heart. Biochem J 1991;280:561-73.
infección del miocardio con T. cruzi sean producto 5. Garg N, Popov VL, Papaconstantinou J. Profiling
de diferentes mecanismos de lesión celular del gene transcription reveals a deficiency of mitochondrial
miocardio dependientes del tipo de cepa, o de oxidative phosphorylation in Trypanosoma cruzi -
infected murine hearts: implications in chagasic
alteraciones adicionales originadas durante la myocarditis development. Biochim Biophys Acta
manipulación de las muestras biológicas (33,34), 2003;1638:106-20.
dado que los investigadores utilizaron mitocondrias
6. Jennings RB, Hawkins HK, Lowe JE, Hill ML,
aisladas y partículas submitocondriales obtenidas Klotman S, Reimer KA. Relation between high energy
a partir de tejidos isquémicos, como es el caso phosphate and lethal injury in myocardial ischemia in
del tejido cardiaco durante una infección con T. the dog. Am J Pathol 1978; 92:187-214.
cruzi (28,29). 7. Boyer PD. The ATP synthase a splendid molecular
machine. Annu Rev Biochem 1997;66:717-49.
En conclusión, nuestros resultados sugieren que
el metabolismo energético mitocondrial no está 8. Das Anibh M. Regulation of mitochondrial ATP
synthase activity in human myocardium. Clin Sci
alterado en la lesión celular del miocardio de ratas
1998;94:499-504
infectadas con una cepa colombiana de T. cruzi
perteneciente al grupo T. cruzi I. Es necesario 9. Das Anibh M. Regulation of the mitochondrial ATP-
synthase activity in health and disease. Mol Genet Metab
realizar futuras investigaciones con cepas 2003;79:71-82.
pertenecientes a los dos grupos de este parásito
10. Senior AE, Nadanaciva S, Weber J. The molecular
para entender las manifestaciones clínicas de la
mechanism of ATP synthesis by Fo F1-ATP synthase.
enfermedad de Chagas. Biochim Biophys Acta 2002;1553:188-211.
Agradecimientos 11. Mejía AM, Triana O. Análisis por LSSP-PCR de la
variabilidad genética de Trypanosoma cruzi en sangre
Al Laboratorio de Chagas de la Universidad de y órganos de ratones. Biomédica 2005;25:76-86.
Antioquia y al Laboratorio de Biofísica de la
12. Camargo EP. Growth and differentiation in Trypanosoma
Universidad Nacional de Colombia sede Medellín. cruzi. Origin of metacyclic trypanosomes in liquid media.
Rev Inst Med Trop Sao Paulo 1964;12:93-100.
Conflicto de intereses
13. Brener Z. Therapeutic activity and criterion of cure on
Los autores declaramos que no existe ningún mice experimentally infected with Trypanosoma cruzi.
conflicto de intereses. Rev Inst Med Trop Sao Paulo 1962;4:389-96.

48
Biomédica 2007;27(supl.1):40-9 Lesiones del miocardio durante la enfermedad de Chagas

14. Miller SA, Dykes DD, Polesky HF. A simple salting out 26. Jones EM, Colley DG, Tostes S, Lopes ER, Vnencak-
procedure for extracting DNA from human nucleated Jones CL, McCurley TL. Amplification of a
cells. Nucleic Acids Res 1988;16:1215. Trypanosoma cruzi DNA sequence from inflammatory
lesions in human chagasic cardiomyopathy. Am J Trop
15. Sambrook J, Fritsch EF, Maniatis T. Molecular Med Hyg 1993;48:348-57.
cloning. A laboratory manual. 2 ed. Cold Spring Harbor,
New York: Cold Harbor Laboratory Press;1989. 27. Köberle F. Chagas´ disease and Chagas´ syndroms:
the pathology of American trypanosomiasis. Adv
16. Maniatis T, Fritsch EF, Sambrook J. Molecular Parasitol 1968;6:63-116.
cloning. A laboratory manual. Cold Spring Harbor, New
York: Cold Harbor Laboratory Press;1982. 28. Teixeira AR. Patogenia da doenςa de Chagas. J Bras
Med 1980;38:23-33.
17. Sturm N, Degrave W, Morel C, Simpson L. Sensitive
detection and schizodeme classification of 29. Oliveira JS. A natural human model for intrinsic heart
Trypanosoma cruzi cells by amplification of kinetoplast nervous system denervation: Chagas´ cardiopathy. Am
minicircle DNA sequences. Use in diagnosis of Chagas Heart J 1985;110:1092-8.
disease. Mol Biochem Parasitol 1989;33:205-14.
30. Junqueira Junior LF, Beraldo PS, Chapadeiro E,
18. Fernández O, Souto RP, Castro JA, Pereira JB, Jesus PC. Cardiac autonomic dysfunction and
Fernández NC, Junqueira AC, et al. Brazilian isolates neuroganglionitis in a rat model of chronic Chagas´
of Trypanosoma cruzi from humans and triatomines disease. Cardiovasc Res 1992;26:324-9.
classified into two lineages using mini-exon and
ribosomal RNA sequences. Am J Trop Med Hyg 31. Rossi MA, Carobrez SG. Experimental Trypanosoma
1998;58:807-11. cruzi cardiomyopathy in BALB/c mice histochemical
evidence of hypoxic changes in the myocardium. Br J
19. Nishimura M, Ito T, Change B. Studies on bacterial Exp Pathol 1985;66:155-60.
photophosphorylation. III. A sensitive and rapid method
of determination of photophosphorylation. Biochim 32. Rossi MA. Microvascular changes as a cause of
Biophys Acta 1962;59:177-82. chronic cardiomyopathy in Chagas´s disease. Am
Heart J 1990;20:233-6.
20. Gornall AG, Bardawill CJ, David MM. Determination
of serum proteins by means of the biuret reaction. J 33. Nohl H, Gille L, Stanick K. Intracellular generation of
Biol Chem 1949;177:751-66. reactive oxygen species by mitochondria. Biochem
Pharmacol 2005;69:719-23.
21. Chagas C. Estado sobre a morfologia e o ciclo evolutivo
do Schizotrypanum cruzi, n. gen. sp. agente etiológico 34. Veksler VI, Kuznetsov AV, Sharov VG, Kapelko VI,
de nova entidade mórbida do homen. Mem Inst Oswaldo Saks VA. Mitochondrial respiratory parameters in
Cruz 1909;1:159-219. cardiac tissue: a novel method of assessment by using
saponin-skinned fibers. Biochim Biophys Acta
22. Mukherjee S, Belbin TJ, Spray DC, Iacobas Da, 1987;892:191-6.
Weiss LM, Kitsis RN, et al. Microarray analysis of
changes in gene expression in a murine model of 35. Rendon DA, Lopez LF. Mitochondrial oligomycin-
c h r o n i c chagasic cardiomyopathy. Parasitol Res sensitive ATPase during isoproterenol-induced cell
2003;91:187-96. injury of myocardium. Arch Inst Cardiol Mex
2000;70:130-5.
23. Moreira da Silva A, Ramirez Le, Vargas M,
Chapadeiro E, Brener Z. Evaluation of the rabbit as a 36. Rendon DA, Lopez LF. Activation of mitochondrial
model for Chagas disease - II. Histopatologic studies oxidative phosphorylation during (+/-)-isoproterenol-
of the Herat, digestive tract and skeletal muscle. Mem induced cell injury of myocardium. Arch Cardiol Mex
Inst Oswaldo Cruz 1996;91:199-206. 2001;71:13-9.

24. de Oliveira JS, Bestetti RB, Soares EG, Marin Nieto 37. Denicola Seoane A, Rubbo H, Prodanov E, Turrens
JA. Ajmaline-induced electrocardiographic changes in J. Succinate-dependent metabolism in Trypanosoma
chronic Trypanosoma cruzi-infected rats. Trans R Soc cruzi epimastigotes. Mol Biochem Parasitol 1992;54:
Trop Med Hyg 1986;80:415-9. 43-50.

25. Acosta AM, Santos-Buch CA. Autoimmune


myocarditis induced by Trypanosoma cruzi. Circulation
1985;71:1255-61.

49
Rojas W., Caro
Biomédica M.A., Lopera
2007;27(supl. J.G. et al
1):50-63 Biomédica 2007;27(supl. 1):50-63

ARTÍCULO ORIGINAL

Análisis de polimorfismos en los genes tripanotión reductasa y


cruzipaína en cepas colombianas de Trypanosoma cruzi
Winston Rojas 1, Maria Antonieta Caro 1, Juan Guillermo Lopera 1, Omar Triana 2,
Juan Carlos Dib 2, Gabriel Bedoya 1
1
Genética Molecular, Universidad de Antioquia, Medellín, Colombia.
2
Grupo de Chagas, Universidad de Antioquia, Medellín, Colombia.

Introducción. Los estudios genéticos en Trypanosoma cruzi han buscado establecer


asociaciones de variantes genéticas del parásito con manifestaciones clínicas de la enfermedad,
origen biológico y geográfico de los aislamientos; sin embargo, los resultados de asociación
con los marcadores comúnmente usados en estos estudios han generado mucha controversia,
principalmente en la asociación de grupos con características clínicas y epidemiológicas de la
enfermedad.
Objetivo. Se planteó determinar la variabilidad de genes que codifican para las proteínas
tripanotión reductasa y cruzipaína, involucradas en mecanismos de infección y supervivencia
del parásito en el hospedador mamífero, y probar la asociación de variantes génicas con
origen biológico y geográfico de cepas colombianas de T. cruzi.
Materiales y métodos. Se tipificaron por reacción en cadena de la polimerasa- polimorfismo
de longitud del fragmento de restricción seis SNPs (Single Nucleotide Polymorphisms) en
tripanotión reductasa y ocho SNPs en cruzipaína en 36 cepas colombianas de T. cruzi de
diferentes regiones y origen biológico.
Resultados. Con las enzimas Acy I y Hae III se determinaron tres genotipos para tripanotión
reductasa. Para cruzipaína se identificaron seis genotipos con las enzimas Rsa I, Ban I y Bsu
36I.
Conclusiones. Para tripanotión reductasa no fue posible establecer una asociación con el
origen biológico o geográfico; sin embargo los alelos producidos en las posiciones 102 y 210,
permitieron discriminar los grupos tradicionales I y II. Con los genotipos obtenidos para
cruzipaína se establecieron relaciones a estos grupos, origen biológico y geográfico. Los
resultados sugieren la utilidad de estos genes como marcadores moleculares para determinar
y diferenciar variedades genéticas en T. cruzi.
Palabras clave: Trypanosoma cruzi, genes protozoarios, polimorfismo, polimorfismo de longitud
del fragmento de restricción, Colombia.
Analysis of polymorphisms in the trypanothione reductase and cruzipain genes in
Colombian strains of Trypanosoma cruzi
Introduction. Genetic studies of Trypanosoma cruzi have tried to establish relations between
genetic variants and their biological characteristics, such as clinical manifestations, host or
geographic origin. However, much controversy exists on the associations between the commonly
used DNA markers with group, clinical characteristics and disease epidemiology.
Objective. In this study determined the variability of the genes that code for the proteins
trypanothione reductase and cruzipain, both involved in the infection and survival of the parasite
in the mammalian host, was studied and the association between genetic polymorphism and
biological and geographic sources in Colombian T. cruzi strains was examined.
Materials and methods. The genotypes for each of six SNPs (single nucleotide polymorphisms)
for trypanothione reductase and eight SNPs for cruzipain genes were identified by polymerase
chain reaction-restriction fragment length polymorphism.in 36 T. cruzi Colombian stocks from
several regions and biological origins.

50
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Results. Three genotypes were identified for trypanothione reductase with Acy I and Hae III
enzymes and six genotypes for cruzipain with the Rsa I, Ban I and Bsu 36I enzymes.
Conclusions. For trypanothione reductase ,an association was not established with biological
or geographical origin; however, alleles at positions 102 and 210 allowed discrimination with
groups I and II. For cruzipain, specific genotypes were associated with group, biological and
geographic origin. The usefulness of molecular markers on these genes was demonstrated
for the determination and differentiation of genetic varieties in T. cruzi.
Key words: Trypanosoma cruzi, genes, protozoan polymorphism, restriction fragment length
polymorphism; Colombia.

Trypanosoma cruzi, el flagelado que causa la sería útil estudiar los genes involucrados en
enfermedad de Chagas, realiza su ciclo de vida procesos como la infección de la célula hospedera,
entre reservorios mamíferos e insectos de la la supervivencia y la progresión del ciclo de vida
familia Reduviidae. Para este protozoario se ha del parásito, así como aquellos útiles en evadir la
propuesto un modo de reproducción predominante- respuesta inmune del hospedero, podrían ser un
mente clonal (1), con lo cual se esperaría blanco importante.
encontrar una baja diversidad. Sin embargo, al
El genoma de T. cruzi consta de aproximada-
evaluar marcadores fenotípicos, morfológicos y
mente 22.570 genes, de los cuales casi el 50%
bioquímicos (2), muchos estudios muestran, por
conforma grupos parálogos. Entre ellos se
el contrario, una alta heterogeneidad. Es razonable
encuentra la cruzipaína (Crp), que pertenece a una
pensar que esta diversidad pueda estar influyendo,
familia de cisteín peptidasas compuesta por 20
por lo menos en parte, en el rango variable de las
miembros por genoma haploide (17). El porcentaje
manifestaciones clínicas de la enfermedad (2).
restante corresponde a genes de copia única como
Con este planteamiento se han emprendido
la tripanotión reductasa (TriR) (18).
estudios que buscan asociaciones entre la
heterogeneidad genética del parásito y la Los tripanosomátidos carecen de la enzima
heterogeneidad clínica de la enfermedad (3-9). glutatión peroxidasa y para defenderse del estrés
oxidativo utilizan el tripanotión reducido en un
Con el uso de marcadores de ADN anónimos
sistema propio de estos organismos (19). Esta
(Random Amplified Polymorphic DNA, RAPD) o
reducción es catalizada por la tripanotión
en los genes kADN, espaciadores intergénicos
reductasa, una flavoproteína dependiente de
del gen mini-exón, y en el ADN ribosomal se ha
NADPH, la cual además participa en el
logrado determinar grupos y subgrupos de T. cruzi
metabolismo y detoxificación de drogas y en la
e incluso establecer un patrón regional en relación
reducción de precursores para la síntesis de ADN
con estas divisiones (10-15). Sin embargo, hasta
(20,21). En Leishmania spp. este sistema está
la fecha existe mucha controversia sobre las
involucrado en la supervivencia intracelular del
reales asociaciones entre los grupos y las
parásito (22). El gen que codifica para esta enzima
características clínicas y epidemiológicas de la
también ha demostrado ser útil en la determinación
enfermedad, puesto que ambos grupos se han
de grupos dentro de T. cruzi, pues ha revelado la
encontrado en todos los estados de transmisión,
existencia de cuatro grupos principales en lugar
en diversas fases de la enfermedad y en sus
de las dos divisiones ya conocidas (18).
diferentes rasgos fenotípicos (16). Es también
razonable pensar que, de existir una asociación, La cruzipaína pertenece a la familia de las cisteín
proteinasas, y es codificada por un alto número
de genes organizados como grupos localizados
Correspondencia:
Winston Rojas, Calle 62 # 52-59, Sede de Investigación
en diferentes cromosomas (23,24). Por tener un
Universitaria (SIU), 4 piso- 430, Medellín, Colombia. Tel. (4) elevado número de copias se ha encontrado una
2106464, fax: (4) 210 64 69. variabilidad que va desde la ausencia de
winstonrojas@yahoo.com diferencias entre las copias (25) hasta formas muy
Recibido: 20/12/05; aceptado: 07/04/06 divergentes, como es el caso de la cruzipaína 2

51
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

(26,27). El dominio C terminal de la cruzipaína es (nueve de Crp1 y una de Crp2, cuadro 3), las
responsable del carácter inmunodominante cuales fueron alineadas usando el algoritmo Clustal
antigénico de esta proteína en infecciones W (39). Para Crp2 se cuenta con mayor número
humanas naturales (28), en las que la gran de caracteres y por ello se usó como referencia
mayoría de los anticuerpos detectados en el suero para el alineamiento. La identificación de sitios
de pacientes chagásicos crónicos está dirigida polimórficos y su posible discriminación en
contra este dominio (29). La cruzipaína y su ensayos de reacción en cadena de la polimerasa-
actividad como proteasa se ha implicado en polimorfismos de longitud de fragmentos de
funciones tan importantes como la supervivencia restricción (polymerase chain reaction-restriction
y la progresión en el ciclo de vida del parásito fragment lenght polymorphisms, PCR-RFLP) se
(30,31), la penetración e invasión del tripomastigote realizó usando los programas pDRAW32
en la célula hospedadora (32-34), la protección (www.acaclone.com), DAMBE (39) y DnaSP (40).
contra la respuesta inmune del hospedero (35) y Con las secuencias disponibles se diseñaron los
la diseminación del parásito (2). cebadores para el fragmento de TriR (TriR directo:
5´AGTGTTACTTTCGAGAGCG3´; TriR inverso:
El análisis de las secuencias disponibles en las
5´GTAGAAGTCGGATATTTTGG3´), los cuales
bases de datos para estos dos genes muestra un
amplifican una región de 564 pb, correspondiente
nivel de polimorfismo que no se ha evaluado en
a las posiciones 726 a 1.290 de la secuencia
cepas de Colombia. Dada la importancia de estos
AF359000, pero numeradas en el cuadro 2 como
genes en el ciclo de vida del parásito se propuso
posiciones 1 a 564 según el fragmento amplificado,
examinar la variabilidad genética de tripanotión
y para el fragmento del gen Crp (Crp directo:
reductasa (TriR) y cruzipaína (Crp) en relación con
5´GTTGAGTGCCAGTGGTTTC3´; Crp reverso:
el origen geográfico y biológico en cepas de T.
5´TGGTCAGGAGACACTGACC3´), los cuales
cruzi de Colombia. Conociendo la variabilidad de
producen un fragmento de 700 pb correspondiente
estos genes en cepas que circulan en nuestro
a las posiciones 1.346 a 2.046 de la secuencia
país, se podrá en el futuro proponer estudios de
M90067 (cuadro 3).
asociación entre esta variabilidad y la
enfermedad. Las reacciones de amplificación se realizaron en
un volumen de 25 µL (Tris-HCl 10mM, pH 8.0,
Materiales y métodos
KCl 50mM, MgCL2 2.4 mM, dNTP 0.1mM, 0.1 µM
Se analizaron 36 cepas colombianas de T. cruzi de cada cebador, 1 U Taq ADN polimerasa
y 7 clones de la cepa Cas15, provenientes de Promega® y 50 ng de ADN molde). El perfil térmico
diferentes hospederos, vectores y regiones de para ambos marcadores fue de un minuto de
Colombia (cuadro 1). Se incluyeron las cepas de desnaturalización a 94°C, un minuto de alinea-
referencia Tulahuen y CL clasificadas como T. miento a 54°C para Crp y 56°C para TriR y
cruzi II. Todas las cepas y los clones provinieron extensión del cebador por un minuto a 72°C, para
del banco de cepas del Laboratorio de Chagas de un total de 35 ciclos para Crp y 30 ciclos para
la Universidad de Antioquia, donde son TriR. Las reacciones de amplificación se
mantenidas en medio de cultivo LIT suplementado observaron en electroforesis en geles de agarosa
con suero bovino fetal a 27,5°C (36). El ADN del al 1,5% seguida de tinción con bromuro de etidio.
parásito se obtuvo por el método salting out (37)
Los fragmentos amplificados incluyen regiones
y su concentración se midió por densidad óptica
polimórficas que pueden ser resueltas con las
a 260 nm (38). El ADN se disolvió en 50 µl de H2O
enzimas mostradas en las cuadros 2 y 3. Para
dd y se almacenó a -20°C para su posterior
cruzipaína, las enzimas Rsa I, Bsu 36I y Ban I
genotipificación.
permiten la diferenciación de polimorfismos en
El diseño experimental incluyo un análisis de las tercera posición, mientras que Dra III permite la
secuencias disponibles en www.ncbi.nlm.nih.gov identificación de una transición A:G en la posición
y www.tigr.org. Para TriR se usaron 41 secuencias 457, la cual da lugar a un cambio de alanina por
de ADN (cuadro 2) y para Crp, 10 secuencias serina. Ambas formas de la cruzipaína poseen

52
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 1. Origen geográfico, biológico y clasificación previa de los aislamientos de Trypanosoma cruzi. ID se refiere al
código de identificación.

Cepa Origen geográfico Origen biológico ID internacional Grupo

AMP 07 Antioquia P. geniculatus IPANS/CO/1997/AMP07 I


AF 1 Antioquia P. geniculatus I-PANS/CO/93/Af1 IIb
Yg03 Antioquia P. geniculatus I-PANS/CO/97/YG 03 I
Cas 18 Casanare D. marsupialis M.DID/CO/02/CAS18 I
HA Casanare H. sapiens M-HUM/CO/97/HA I
Cas16 Casanare R. prolixus I.RHO/CO/00/CAS16 I
Cas 15 Casanare R. prolixus TPRX/CO/2000/CAS15 I
B138 Córdoba T. dimidiata I-TRI/CO/99B138 I
B114 Córdoba T. dimidiata I-TRI/CO/99/B114 I
B51 Córdoba R. pallescens TPAC/CO/1999/B51 I
Sb 1 Córdoba R. pallescens I-RHO/CO/98/Sb1 I
Ac17 Chocó R. pallescens I-RHO/CO/99/Ac17 I
Mag 11 Magdalena R. pallescens I:RHO/CO/03/MG11 I
Mag 1 Magdalena R. pallescens I.RHO/CO/01/MG1 I
Mag5 Magdalena E. cuspidatus TCUS/CO/2003/MG5 I
Mag 9 Magdalena T. dimidiata I.TRI/CO/03/MG9 I
Mag8 Magdalena T.dimidiata TDIM/CO/2003/MG8 I
Mag 10 Magdalena T.dimidiata TDIM/CO/2003/MG10 I
Putumayo4 Putumayo R. robustus I.RHO/CO/01/PUT-4 I
SN3 Sierra Nevada R. prolixus TPRX/CO/2003/SN3 I
SN 8 Sierra Nevada R. prolixus I.RHO/CO/03/SN-8 I
SN5 Sierra Nevada R. prolixus TPRX/CO/2003/SN5 I
SN6 Sierra Nevada R. prolixus TPRX/CO/2003/SN6 I
So 6 Sucre R. pallescens I.RHO/CO/94/SO6 I
OV 1 Sucre P. geniculatus I-PANS/CO/98/Ov1 I
G20 Sucre R. pallescens TPAC/CO/1997/G20 I
Gal 34 Sucre R. pallescens TPAC/CO/1991/Gal 34 I
W3534 Sucre H. sapiens M-HUM/CO/98/W3534 I
Gal 61 Sucre Ratón MMUS/CO/91/Gal61 I
Gal 52 Sucre D. marsupialis MDID/CO/1991/Gal 52 I
LB53 Sucre T. dimidiata TDIM/CO/1999/LB53 I
Ov17 Sucre P. geniculatus I.PANS/CO/98/OV17 I
So5 Sucre R. pallescens I.RHO/CO/94/SO5 I
So8 Sucre R. pallescens TPAC/CO/1995/So8 I
STP 2.2 Tolima R. prolixus I.RHO/CO/91/COY6 I
Coy8 Tolima D. marsupialis M.DID/CO/91/COY8 I
Tulahuen Chile T. infestans TINF/CH/1956/Tulahuen II
CL Brasil T. infestans TINF/BR/1963/CL II
Cas 15 cl 47 Casanare R. prolixus X I
Cas 15 cl 48 Casanare R. prolixus X I
Cas 15 cl 49 Casanare R. prolixus X I
Cas 15 cl 55 Casanare R. prolixus X I
Cas 15 cl 56 Casanare R. prolixus X I
Cas 15 cl 73 Casanare R. prolixus X I
Cas 15 cl 79 Casanare R. prolixus X I

los tres sitios de corte identificados para la enzima I, Hae III y Bsm AI - sólo identifican polimorfismos
Rsa I. Sin embargo, a diferencia de la Crp1, la en la tercera posición.
Crp2 carece de diana de corte en la posición 142 Para verificar la presencia de ambas formas de la
para la enzima Ban I (cuadro 3). Las enzimas Bsu cruzipaina se usó la enzima Apa I según el
36I y Dra III carecen de sitios de corte en esta protocolo descrito por Lima et al, 1994 (26);
isoforma (cuadro 3). Las enzimas utilizadas en el cruzipaína 2 cuenta con un sitio de corte en
análisis de RFLP de tripanotión reductasa - Acy la posición 298, distinguiendo el sitio variante

53
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

Cuadro 2. Posiciones evaluadas y enzimas que las reconocen en las secuencias disponibles en las bases de datos
públicas para el gen tripanotión reductasa.

59* 101 179 211 331 535


ID. Secuencia Grupo (HaeIII) † (Acy I/ 102) (Acy I) (HaeIII/ 210) (Bsm AI) (BsmAI/ 534)

TC10727 - G C A G A C
Z13958 I G C A G A C
AF358981 I G C A G A C
M38051 I G C A T A C
AF358975 I G C A G A C
AF358982 I G C A G A C
AF358987 I G C A G A C
AF358971 I G C A G A C
AF358973 I G C A G A C
AF358972, AF35976 I G C A G A C
AF358985,AF358984,
AF358983,AF358977, I G C A G A C
AF358979,AF358980
AF358978,AF358970, I G C A G A C
AF358969,AF358974
AF358989, AF358988 II G T A G A C
AF358986 II G C A G A A
M97953 II G C A G A C
AF359003,AF358997,
AF358994, AF358993, II G C A T A C
AF358992,AF359001,
AF358999,AF359005
AF359002,AF358996,
AF359000,AF358998, II G T A G A C
AF359004,AF358991
AF358990 II G T A G A C
AF358995 II G C A T A C

* Posición en la cual la enzima realiza el corte.


† Entre paréntesis se indica la enzima que realiza el corte y la posición del polimorfismo que identifica.

297 (cuadro 3) y generando fragmentos de 297 y Resultados


403 pb.
Los productos de amplificación obtenidos en los
Los productos de amplificación se sometieron a ensayos de PCR para TrR y Crp se muestran en
digestiones simples a un volumen final de 20 µl la figura 1. Algunos de los perfiles de las digestio-
con 1 U de enzima a 37°C por 16 horas. Una nes simples se muestran en las figuras 2 a 6.
alícuota de 12 µL se analizó en geles de agarosa Los resultados de las digestiones se representan
al 3% teñidos con bromuro de etidio. El resultado como genotipos compuestos de las digestiones
de la digestión fue registrado en un analizador de simples. De seis sitios evaluados para TriR, sólo
imágenes Gel Doc (BioRad, USA). Los patrones dos mostraron polimorfismo. Sólo la combinación
de bandas obtenidos fueron analizados con el de los genotipos obtenidos para las enzimas Hae
software Imagej 1.33 (http://rsb.info.nih.gov/ij) y III y Acy I muestran patrones polimórficos,
Quantity One (BioRad, USA). Para cada cepa y denominados TriR 1, 2 y 3 (cuadro 4). El genotipo
para cada gen se definieron los genotipos de TriR 3 puede definirse con certeza debido a que
acuerdo con los patrones observados en los el corte sólo se presenta ante la presencia de los
electroferogramas. alelos C y G para los sitios Acy I-102 y Hae III-

54
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 3. Posiciones evaluadas y enzimas que las reconocen en las secuencias disponibles en las bases de datos
públicas para el gen cruzipaína.

142* 151 222 226 257 299 430 461 613


Secuencia Grupo (BanI/ (RsaI) (DraIII/ (BanI/ (Bsu36I/ (ApaI/ (RsaI/ (DraIII/ (RsaI/
147)† 225) 231) 258) 297) 432) 462) 612)

M84342 II C T G C T T C G G
TC10685 I C T G C G T C G G
AF314930 II C T G C T T C G C
AF314929 II C T G C T T C G G
AY0317 II C T G C T T T G G
AF265227 I C T G T G T C T G
AF265226 I C T G C G T C G G
U41454 I C T G C G T C G G
AF004594 II C T T C T T C G G
M90067
(Cruzipaína2) I T T G C G G‡ C T G

* Posición en la cual la enzima realiza el corte.


† Entre paréntesis se indica la enzima que realiza el corte y la posición del polimorfismo que identifica.
‡ Sitio para distinguir las copias reportadas de cruzipaína.

210, respectivamente; este genotipo, presente en encontró en las dos cepas de referencia, de
35 de 38 cepas, se encuentra en las cepas acuerdo con lo reportado en las bases de datos
caracterizadas como T. cruzi I, en las cuales es (cuadro 2, identificaciones de acceso: AF358997
definido por la ausencia del alelo T en ambas y AF359002 para Tulahuen y AF358999 y
posiciones (cuadro 4). El genotipo TriR 1, AF358998 para CL), mientras que el genotipo TriR
heterocigótico para ambas posiciones, se 2 se encontró en la cepa AF1 proveniente de
Amalfi, Antioquia (cuadro 4). Para estos dos
genotipos se infiere el alelo T en ambas posiciones
debido a que es el polimorfismo alternativo
presente en las secuencias analizadas y a que
no se reporta otro sitio polimórfico alrededor de la
diana de reconocimiento de la enzima. La
distribución de estos genotipos no mostró ninguna
asociación con origen geográfico o biológico
(datos no mostrados).
En los ensayos de digestión para Crp, la enzima
Apa I permitió identificar la cruzipaína 2
diferenciada por el polimorfismo en la posición 297
(figura 3). La presencia de por lo menos dos copias
resulta en patrones de digestión complejos, en
los que es posible obtener más de dos alelos para
cada posición; para facilitar el análisis,
denominamos como genotipo “heterocigoto” a aquel
que poseía más de un alelo en un locus, lo cual
puede corresponder a diferencias entre copias de
Figura 1. Productos de amplificación obtenidos para Crp o a una condición heterocigótica en sentido
cruzipaína (izquierda) y tripanotión reductasa (derecha). Sólo estricto.
se muestra el producto para algunas cepas del grupo I
(Cas15) y grupo II (AF1, Tulahuen y CL). MP = marcador de Basados en las secuencias reportadas para Crp,
peso de 100 pb. los sitios 150 a 153 representan una diana de

55
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

Figura 2. Patrones RFLP para TriR con la enzima Acy I (A) y Hae III (B) en algunas cepas de los grupos I (Mag1, HA y
Mag5) y grupo II (CL, Tulahuen y AF1). MP = Marcador de peso de 50 pb. Los tamaños de los fragmentos se muestran en
los electroferogramas (A y B) y en los mapa de restricción (C y D), para cada una de las enzimas y su diana de
reconocimiento (y= Purina; r=Pirimidina). Sólo los perfiles para las enzimas que produjeron patrones polimórficos entre
cepas son mostrados.

Cuadro 4. Genotipos compuestos Tripanotión reductasa.

Cepa Acy I Hae III Genotipo


102 210

TUL, CL C/T* G/T† TriR 1


AF1 C/C T/T TriR 2
HA, Cas18, Mag5, SN5, SN8, OV1, Cas16, Mag10, LB53,
Cas15, Amp07, Yg03, B138, B114, B51, Sb1, Ac17, Mag1,
Mag8, Mag9, Mag11, Putumayo4, SN3, SN6, So6, G20, Gal34 C/C G/G TriR 3
W3534, Gal61, Gal52, Ov17, So5, So8, STP2.2, Coy8,
Clones Cas 15

*C corte en la posición 101 con la enzima Acy I


†G corte en la posición 211 con la enzima Hae III

56
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Figura 3. Digestión simple de cruzipaína con la enzima Apa Figura 4. Patrones RFLP para Crp con la enzima Bsu 36I
I en cepas del grupo I (Mag5) y del grupo II (Tulahuen) para en cepas del grupo I (Cas15) y II (Tulahuen). Los tamaños
distinguir la presencia de más de una copia del gen usando de los fragmentos se muestran en el electroferograma (A) y
el protocolo descrito por Lima et al., 1994. en el mapa de restricción (B).

reconocimiento para la enzima Rsa I con corte en 26 cepas clasificadas como T. cruzi I (cuadro 5).
la posición 151 (cuadro 3); estos sitios se reportan El genotipo Crp 1 se encontró en las cepas del
monomórficos en todas las secuencias (datos no grupo T. cruzi II y es diferenciado por la presencia
mostrados), pero en algunas cepas analizadas en del alelo T en la posición 258 (cuadro 5). Éste y el
este estudio dicha diana se perdió originando genotipo Crp 3 son los más polimórficos; los
genotipos heterocigotos; sus alelos se representan genotipos Crp 2, Crp 4 y Crp 6 mostraron
como 1/0 debido a que no se puede comprobar polimorfismo en la diana alrededor del sitio 151;
cuál es el sitio polimórfico dentro de la diana de adicionalmente, Crp 2 varió en la posición 432, y
reconocimiento de la enzima (cuadro 5). Los alelos Crp 4 y Crp 6 variaron en la posición 231 (cuadro 5).
Ban I-C y Rsa I-C en las posiciones 231 y 432,
Para Crp fue posible establecer algunas asociacio-
respectivamente, se definen con certeza porque
nes entre los genotipos y el origen geográfico y
la enzima sólo corta cuando éstos están
biológico de las cepas (cuadro 6). Cuando se
presentes. Los alelos Ban I-T, Bsu 36I-G y Rsa I-
consideró el origen geográfico, la región del oriente
T en las posiciones 231, 258 y 432 se infieren
(departamento de Casanare) mostró ser más
debido a que es el polimorfismo alternativo
diversa, con cuatro de los seis genotipos; dos de
reportado en las secuencias analizadas y a que
ellos, Crp 3 y Crp 6, son específicos de esta región
no se reporta otro polimorfismo alrededor de la
y son diferenciados por el alelo T en el sitio 231.
diana de reconocimiento para cada enzima. Los
El genotipo Crp 2 se encuentra en el noroccidente
sitios evaluados con la enzima Dra III fueron
(Sucre, Magdalena, Sierra Nevada) y oriente de
monomórficos y por esto no se consideran en los
Colombia (Casanare); este genotipo también se
genotipos compuestos.
encontró en aislamientos de Rhodnius prolixus,
A diferencia de TriR, y probablemente por la Pastrongylus geniculatus y Eratyrus cuspidatus;
presencia de más de una copia, para Crp se entre los hospedadores mamíferos este genotipo
obtuvieron seis genotipos compuestos represen- sólo se encontró en Didelphis marsupialis (cuadro
tados como Crp 1 a Crp 6 (cuadro 5). El genotipo 6). El genotipo Crp 4 tiene una distribución similar
Crp 5, homocigótico para todos los loci, agrupa al genotipo Crp 2, pero está ausente en la Sierra

57
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

Cuadro 5. Genotipos compuestos de cruzipaína.

Cepa Rsa I Ban I Bsu 36I Rsa I Genotipo


151 231* 258† 432‡

CL, Tulahuen, AF1 1/0§ C/C G/T C/T Crp 1


Cas18,Mag5, SN5,SN8,OV 1 1/0 C/C G/G C/T Crp 2
HA 1/0 C/T G/G C/T Crp 3
Cas16, Mag10,LB53 1/0 C/C G/G C/C Crp 4
Amp07, Yg03, B138, B114, B51, Sb1, Ac17, Mag1,
Mag8, Mag9, Mag11, Putumayo4, SN3, SN6, So6, 1/1 C/C G/G C/C Crp 5
G20, Gal34, W3534, Gal61, Gal52, Ov17, So5,
So8, STP2.2,Coy8,
Cas 15, Clones Cas 15 1/1 C/T G/G C/C Crp6
*
C corte en la posición 226
†G no corte en la posición 257
‡C corte en la posición 430
§1 = corte; 0 = no corte

Figura 6. Patrones RFLP para Crp con la enzima RsaI en


cepas del grupo I (Cas15 y HA) y II (Tulahuen). Los tamaños
Figura 5. Patrones RFLP para Crp con la enzima Ban I en de los fragmentos se muestran en el electroferograma (A) y
cepas del grupo I (Cas15) y II (Tulahuen). Los tamaños de en el mapa de restricción (B). La banda de 430 pb se explica
los fragmentos se muestran en el electroferograma (A) y en por la ausencia de corte en la posición 151; la banda de 462
el mapa de restricción (B). La banda de 558 pb se explica pb, por la ausencia de corte en la posición 430; la banda de
por la ausencia de corte en la posición 226 y la banda de 226 613 pb, por la ausencia simultánea de corte en las posiciones
pb, por ausencia de corte en la posición 142. 151 y 430.

58
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

Cuadro 6. Distribución de genotipos compuestos de acuerdo con el departamento o región de procedencia y con el
origen biológico de las cepas estudiadas.

Genotipo compuesto Departamento/Región Origen biológico


(No. de cepas) (No. de cepas)

Chile (1) T. infestans (1)


Crp 1 Brasil (1) T. infestans (1)
*1/0 C/C G/T C/T Antioquia (1) P. geniculatus (1)
Casanare (1) D. marsupialis (1)
Crp 2 Magdalena(1) E. cuspidatus (1)
1/0 C/C G/G C/T Sierra Nevada (2) R. prolixus (2)
Sucre (1) P. geniculatus (1)
Crp 3 Casanare (1) H. sapiens (1)
1/0 C/T G/G C/T
Crp 4 Casanare (1) R. prolixus (1)
1/0 C/C G/G C/C Magdalena (1) T. dimidiata (1)
Sucre (1) T. dimidiata (1)
Antioquia (2) P. geniculatus (2)
Córdoba (4) T. dimidiata (2)
R. pallescens (2)
Chocó (1) R. pallescens (1)
Crp 5 Magadalena (4) R. pallescens (2)
1/1 C/C G/G C/C T. dimidiata (2)
Sierra Nevada (2) R. prolixus (2)
Putumayo (1) R. robustus (1)
Sucre (9) R. pallescens (5)
P. geniculatus (1)
D. maruspialis (1)
H. sapiens (1)
Ratón (1)
Tolima (2) R. prolixus (1)
D. marsupialis (1)
Crp 6 Casanare (1) R. prolixus (1)
1/1 C/T G/G C/C

*1 = corte; 0 = no corte

Nevada de Santa Marta; este genotipo está previamente descritos con otros marcadores
asociado a R. prolixus y Triatoma dimidiata, moleculares. Las cepas del grupo T. cruzi I
principales vectores domiciliados. evaluadas en este estudio mostraron en las
posiciones 102 y 211 ausencia del alelo T (cuadro
El genotipo Crp 5 fue el más frecuente; se presentó
4). Al considerar las secuencias reportadas, el
en todas las regiones del occidente de la cordillera
alelo T en la posición 102 está ausente de todas
oriental, en la totalidad de los hospederos
las cepas del grupo I, como también en algunas
mamíferos y en la mayoría de los insectos
del grupo II; el alelo T en la posición 211 fue
vectores, a excepción de E. cuspidatus; es el
consistente con las cepas del grupo T. cruzi II en
único genotipo encontrado en los 10 aislamientos
nuestros ensayos; sin embargo, los datos de
de Rhodnius pallescens. En R. prolixus se
secuencias muestran que este alelo también
encontró el mayor número de genotipos (Crp 2,
puede estar presente en cepas de T. cruzi I
Crp 4, Crp 5 y Crp 6).
(cuadro 2), por lo que no puede considerársele un
Discusión alelo específico de grupo.
La evaluación de TriR con las enzimas Acy I y El gen TriR es codificado por un locus único en
Hae III permitió distinguir cepas de los grupos el genoma de T. cruzi (18) y la condición

59
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

heterocigótica observada en el genotipo a seis genotipos, en contraste con tres genotipos


compuesto TriR 1 (C/T y G/T) podría reflejar para TriR, lo cual concuerda con la presencia de
cualquiera de varias situaciones: una combinación más de una copia del gen. Desde este punto de
de clones en la cepa (41-43), o una heterocigosis vista, muchas cepas (genotipo Crp 5) podrían
“real” causada por mutación o intercambio genético representar eventos de concertación génica (50-
dentro del grupo T. cruzi II (18,44-47). Si se 52) en los que los loci de ambas copias son
considera la naturaleza heterogénea de los homocigóticos; pero esto requiere asumir hipótesis
aislamientos originales de cepas de T. cruzi (42), ad hoc de mutación para los mismos loci en otras
ello podría argumentarse a favor de la primera cepas (genotipos Crp 1 a 4).
situación. Sin embargo, no es posible descartar
Algunos estudios previos con cepas de Colombia
que los genotipos heterocigotos encontrados
han podido establecer relaciones entre genotipos
representen eventos antiguos de intercambio
de T. cruzi con ciclos de transmisión (53,54). En
génico (18,44-47), en particular en el sitio 210, el
este estudio no fue posible establecer relaciones
cual puede ser producto de intercambio entre
entre genotipos TriR y Crp y ciclos de transmisión,
genotipos homocigotos.
debido a que no se evaluaron cepas aisladas de
La evaluación del gen TriR en cepas de Colombia vectores domiciliados; las cepas SN se obtuvieron
mostró en nuestro análisis una baja diversidad de de R. prolixus al interior de las viviendas, pero su
genotipos. El cálculo del polimorfismo (θ) y ubicación dentro de un nicho selvático en la Sierra
diversidad nucleotídica (π) a partir de las Nevada de Santa Marta podría introducir errores
secuencias reportadas para este gen fue de en dichas comparaciones. Sin embargo, se pudo
0,0083+/-0,00186 y 0,011+/-0,00062, respectiva- evaluar la relación entre genotipos y el origen
mente. Una relación de menor polimorfismo con geográfico y biológico de las cepas, en particular
una mayor diversidad permite suponer que se trata con las especies de vectores.
de un gen sujeto a selección, o que efectivamente
En cuanto a Crp , se puede concluir que el
existe una estructura clonal en las cepas de
departamento del Casanare es la región con más
Colombia; sin embargo, esta afirmación requeriría
de confirmación, dado que los rangos de estos diversidad de genotipos (cuadro 6). De acuerdo
valores se superponen. Esta afirmación puede con esto, en estudios previos (53,55) se determinó
contradecirse si se considera que el polimorfismo que la región de los Llanos Orientales exhibió un
en dichas secuencias se localiza en terceras alto número de fenotipos isoenzimáticos. Dada la
posiciones del codón, dando lugar a cambios alta prevalencia de la enfermedad en esta región
neutros. La tripanotión reductasa cumple una (IV Reunión de la Comisión Intergubernamental
función en la detoxificación de productos de la Iniciativa Andina de Control de la
endógenos y exógenos en el ciclo de vida del Transmisión Vectorial y Transfusional de Chagas.
parásito y nuestros resultados no muestran una Guayaquil, 2003;56,57), valdría la pena formular
asociación con origen biológico; ello sugiere que, hipótesis sobre la diversidad de T. cruzi en relación
de estar sujeta a selección, su fuerza no ha con la eficacia biológica (58) y con la epidemiología
operado diferencialmente entre los distintos de la enfermedad.
orígenes biológicos y geográficos de donde En cuanto a las asociaciones con los vectores,
proceden las cepas. Por este bajo polimorfismo, también se puede concluir que en R. pallescens,
esta proteína podría constituirse en un blanco el vector/hospedero de donde proviene el mayor
adecuado para diseños terapéuticos (48,49). número de cepas en este estudio, se encontró
La presencia de por lo menos dos formas de Crp exclusivamente el genotipo compuesto Crp 5; vale
hace más complejo el análisis tanto de los la pena evaluar también una hipótesis de
genotipos como de su asociación con orígenes especificad parásito-vector ampliando los
geográficos y biológicos. El mayor polimorfismo marcadores en aislamientos de este vector. En
de este gen (cuatro sitios polimórficos de ocho contraste, en las demás especies de vectores se
sitios evaluados, excluido el sitio Apa I) dio lugar encontró más de un genotipo; en R. prolixus,

60
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

principal vector de la enfermedad de Chagas en 3. Brener Z. Biology of Trypanosoma cruzi. Annu Rev
el país, se encontró el mayor número de genotipos; Microbiol 1973;27:347-82.
éste es un insecto ampliamente distribuido en 4. Melo RC, Brener Z. Tissue tropism of different
regiones distantes de Colombia; la importancia Trypanosoma cruzi strains. J Parasitol 1978;64:475-
82.
de este aspecto también puede evaluarse en
relación con sus implicaciones por sus hábitos 5. Andrade Z, Brener ZE. Trypanosoma cruzi e Doença
de Chagas. Rio de Janeiro: Ed. Guanabar Koogan; 1979.
antropofílicos y su domiciliación. Las cepas
provenientes de P. geniculatus, aunque con una 6. Andrade SG, Andrade V, Brodskyn C, Magalhaes
distribución más restringida, también mostraron JB, Netto MB. Immunological response of Swiss mice
to infection with three different strains of Trypanosoma
tres de seis genotipos; esta diferencia en la cruzi. Ann Trop Med Parasitol 1985;79:397-407.
diversidad genotípica entre especies podría reflejar
7. de Castro SL, de Meirelles M de N. Effect of drugs on
el efecto de filtros biológicos selectivamente Trypanosoma cruzi and on its interaction with heart
diferentes (59,60). muscle cell in vitro . Mem Inst Oswaldo Cruz
1987;82:209-18.
Usando marcadores de isoenzimas, RAPDs y
ADNr, se ha podido demostrar la mayor prevalencia 8. Neal RA, van Bueren J. Comparative studies of drug
susceptibility of five strains of Trypanosoma cruzi in
del grupo T. cruzi I en el país (53-55,61). Con dos vivo and in vitro . Trans R Soc Trop Med Hyg
sistemas diferentes en genes codificadores de 1988;82:709-14.
proteínas también fue posible en este estudio
9. Vago AR, Andrade LO, Leite AA, d’Avila Reis D,
reproducir esta observación, agrupándose la Macedo AM, Adad SJ, et al. Genetic characterization
mayoría de cepas del grupo I dentro de los of Trypanosoma cruzi directly from tissues of patients
genotipos TriR 3 y Crp 5; esta consistencia de with chronic Chagas disease: differential distribution of
genetic types into diverse organs. Am J Pathol
agrupación con diferentes sistemas refuerza así
2000;156:1805-9.
la estructura clonal de las poblaciones de T. cruzi.
10. Morel C, Chiari E, Camargo EP, Mattei DM, Romanha
Los resultados de este estudio sugieren que estos AJ, Simpson L. Strains and clones of Trypanosoma
genes son útiles como posibles marcadores cruzi can be characterized by pattern of restriction
endonuclease products of kinetoplast DNA minicircles.
moleculares para determinar y diferenciar
Proc Natl Acad Sci USA 1980;77:6810-4.
variedades genéticas en T. cruzi, y permiten
plantear la futura evaluación de la hipótesis sobre 11. Souto RP, Zingales B. Sensitive detection and strain
classification of Trypanosoma cruzi by amplification of
la interacción parásito-hospedero. a ribosomal RNA sequence. Mol Biochem Parasitol
1993;62:45-52.
Conflicto de intereses
12. Tibayrenc M, Neubauer K, Barnabe C, Guerrini F,
Los autores declaramos que no existe ningún Skarecky D, Ayala FJ. Genetic characterization of six
conflicto de intereses. parasitic protozoa: parity between random-primer DNA
typing and multilocus enzyme electrophoresis. Proc
Financiación Natl Acad Sci USA 1993; 90:1335-9.

El estudio fue desarrollado como parte del 13. Souto RP, Fernandes O, Macedo AM, Campbell
proyecto 1115-04-14387 financiado por DA, Zingales B. DNA markers define two major
phylogenetic lineages of Trypanosoma cruzi . Mol
Conciencias. Biochem Parasitol 1996;83:141-52.
Referencias 14. Momen H. Taxonomy of Trypanosoma cruzi : a
commentary on characterization and nomenclature.
1. Tibayrenc M, Kjellberg F, Ayala FJ. A clonal theory
Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):181-4.
of parasitic protozoa: the population structures of
Entamoeba, Giardia, Leishmania, Naegleria, 15. Brisse S, Dujardin JC, Tibayrenc M. Identification of
Plasmodium, Trichomonas and Trypanosoma and their six Trypanosoma cruzi lineages by sequence-
medical and taxonomical consequences. Proc Natl characterized amplified region markers. Mol Biochem
Acad Sci USA 1990;87:2414-8. Parasitol 2000;111:95-105.
2. Scharfstein J, Morrot A. A role for extracellular 16. Brisse S, Barnabé C, Tibayrenc M. Trypanosoma
amastigotes in the immunopathology of Chagas disease. cruzi: How many relevant phylogenetic subdivisions
Mem Inst Oswaldo Cruz 1999;94(Suppl 1):51-63. are there? Parasitol Today 1998;14:178-9.

61
Rojas W., Caro M.A., Lopera J.G. et al Biomédica 2007;27(supl. 1):50-63

17. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson organization of the codifying genes. Medicina (B Aires)
D, Aggarwal G, Tran A, et al. The genome sequence 1999;59 (Suppl. 2):7-10.
of Trypanosoma cruzi , etiologic agent of Chagas
30. Engel JC, Doyle PS, Hsieh I, McKerrow JH. Cysteine
disease. Science 2005;309:409-15.
protease inhibitors cure an experimental Trypanosoma
18. Machado CA, Ayala FJ. Nucleotide sequences provide cruzi infection. J Exp Med 1998;188:725-34.
evidence of genetic exchange among distantly related
31. Klemba M, Goldberg DE. Biological roles of proteases
lineages of Trypanosoma cruzi. Proc Natl Acad Sci
in parasitic protozoa. Annu Rev Biochem 2002;71:275-305.
USA 2001;98:7396-401.
32. Del Nery E, Juliano MA, Lima AP, Schafstein J,
19. Krieger S, Schwarz W, Ariyanayagam MR, Fairlamb
Juliano L. Kininogenase activity by the major cysteinyl
AH, Krauth-Siegel RL, Clayton C. Trypanosomes
proteinase (cruzipain) from Trypanosoma cruzi. J Biol
lacking trypanothione reductase are avirulent and show
Chem 1997;272:25713-8.
increased sensitivity to oxidative stress. Mol Microbiol
2000;35:542-52. 33. Scharfstein J, Schmitz V, Morandi V, Capella MM,
Lima AP, Morrot A, et al. Host cell invasion by Trypa-
20.Schmidt A, Krauth-Siegel RL. Enzymes of the
nosoma cruzi is potentiated by activation of bradykinin
trypanothione metabolism as targets for
B(2) receptors. J Exp Med 2000;192:1289-300.
antitrypanosomal drug development. Curr Top Med
Chem 2002;11:1239-59. 34. Aparicio IM, Scharfstein J, Lima AP. A new cruzipain-
mediated pathway of human cell invasion by
21. Fairlamb AH, Cerami A. Metabolism and functions of Trypanosoma cruzi requires trypomastigote
trypanothione in the Kinetoplastida. Annu Rev Microbiol membranes. Infect Immun 2004;72:5892-902.
1992;46:695-729.
35. Berasain P, Carmona C, Frangione B, Cazzulo JJ,
22. Dumas C, Ouellette M, Tovar J, Cunningham ML, Goni F. Specific cleavage sites on human IgG
Fairlamb AH, Tamar S, et al . Disruption of the subclasses by cruzipain, the major cysteine proteinase
trypanothione reductase gene of Leishmania decreases from Trypanosoma cruzi . Mol Biochem Parasitol
its ability to survive oxidative stress in macrophages. 2003;130:23-9.
EMBO J 1997;16:2590-8.
36. Camargo EP. Growth and differentiation in Trypanosoma
23. Eakin AE, Mills AA, Harth G, McKerrow JH, Crack cruzi. I. Origin of metacyclic trypanosomes in liquid
CS. The sequence, organization, and expression of media. Rev Inst Med Trop Sao Paulo 1964;12:93-100.
the major cysteine protease (cruzain) from
Trypanosoma cruzi. J Biol Chem 1992;267:7411-20. 37. Miller SA, Dykes DD, Polesky HF. A simple salting out
procedure for extracting DNA from human nucleated
24. Campetella O, Henriksson J, Aslund A, Frasch AC, cells. Nucleic Acids Res 1988;16:1215.
Petterson U, Cazzulo JJ. The major cysteine
proteinase (cruzipain) from Trypanosoma cruzi is 38. Sambrook J, Fritsch EF, Maniatis T. Molecular
encoded by multiple polymorphic tandemly organized cloning. A laboratory manual. Second edition. Cold
genes located on different chromosomes. Mol Biochem Spring: Harbor Laboratory Press; 1989.
Parasitol 1992;50:225-34. 39. Xia X , Xie Z. DAMBE: software package for data
25. Tomas AM, Kelly JM. Stage-regulated expression of analysis in molecular biology and evolution. J Hered
cruzipain, the major cysteine protease of Trypanosoma 2001;92:371-3.
cruzi is independent of the level of RNA1. 40. Rozas J, Sanchez-DelBarrio JC, Messeguer X,
Mol Biochem Parasitol 1996;76:91-103. Rozas R. DnaSP, DNA polymorphism analyses by the
26. Lima AP, Tessier DC, Thomas DY, Scharfstein J, coalescent and other methods. Bioinformatics
Storrer AC, Vernet T. Identification of new cysteine 2003;19:2496-7.
protease gene isoforms in Trypanosoma cruzi . Mol 41. Carreño H, Rojas C, Aguilera X, Apt W, Miles MA,
Biochem Parasitol 1994;67:333-8. Solari A. Schizodeme analyses of Trypanosoma cruzi
27. Lima AP, dos Reis FC, Serveau C, Lalmanach, zymodemes from Chile. Exp Parasitol 1987;64:252-60.
Juliano L, Ménard R, et al. Cysteine protease isoforms 42. Macedo AM, Pena SD. Genetic variability of
from Trypanosoma cruzi , cruzipain 2 and cruzain, Trypanosoma cruzi: implications for the pathogenesis
present different substrate preference and susceptibility of Chagas disease. Parasitol Today 1998;14:119-23.
to inhibitor. Mol Biochem Parasitol 2001;114:41-52.
43. Solari A, Wallace A, Ortiz S, Venegas J, Sánchez G.
28. Cazzulo JJ, Stoka V, Turk V. Cruzipain, the major Biological characterization of Trypanosoma cruzi stocks
cysteine proteinase from the protozoan parasite from Chile. Exp Parasitol 1998;89:312-22.
Trypanosoma cruzi. Biol Chem 1997;378:1-10.
44. Bogliolo AR, Lauria-Pires L, Gibson W.
29. Cazzulo JJ. Cruzipain, major cysteine proteinase of Polymorphisms in Trypanosoma cruzi : evidence of
Trypanosoma cruzi : sequence and genomic genetic recombination. Acta Trop 1996;61:31-40.

62
Biomédica 2007;27(supl. 1):50-63 Tripanotión reductasa y cruzipaína en T. Cruzi de Colombia

45. Gaunt MW, Yeo M, Frame IA, Stothard JR, 54. Cuervo P, Cupolillo E, Segura I, Saravia N,
Carrascos HJ, Taylor MC, et al. Mechanism of genetic Fernandes O. Genetic diversity of Colombian sylvatic
exchange in American trypanosomes. Nature Trypanosoma cruzi isolates revealed by the ribosomal
2003;421:936-9. DNA. Mem Inst Oswaldo Cruz 2002;97:877-80.
46. Brisse S, Henriksson J, Bernabé C, Douzery EJ, 55. Jaramillo N, Moreno J, Triana O, Arcos-Burgos M,
Berkvens D, Serrano M, et al. Evidence for genetic Muñoz S, Solari A. Genetic structure and phylogenetic
exchange and hybridization in Trypanosoma cruzi base relationships of Colombian Trypanosoma cruzi
on nucleotide sequences and molecular karyotype. populations as determined by schizodeme and
Infect Genet Evol 2003;2:173-83. isoenzyme markers. Am J Trop Med Hyg 1999;61:
986-93.
47. Sturm NR, Vargas NS, Westenberger SJ, Zingales
B, Campbell DA. Evidence for multiple hybrid groups 56. Moncayo A. Chagas disease: current epidemiological
in Trypanosoma cruzi. Int J Parasitol 2003;33:269-79. trends after the interruption of vectorial and
transfusional transmission in the Southern Cone
48. Paulino M, Iribarne F, Dubin M, Aguilera-Morales countries. Mem Inst Oswaldo Cruz 2003;98:577-91.
S, Tapia O, Stoppani AO. The chemotherapy of
Chagas’ disease: an overview. Mini Rev Med Chem 57. Guhl F, Restrepo M, Angulo VM, Antunes CMF,
2005;5:499-519. Campbell-Lendrum D, Davies CR. Lessons from a
national survey of Chagas disease transmission risk in
49. Meiering S, Inhoff O, Mies J, Vincek A, Garcia G, Colombia. Trends Parasitol 2005;21:259-62.
Kramer B, et al . Inhibitors of Trypanosoma cruzi
trypanothione reductase revealed by virtual screening 58. Hartl CL, Clark AG. Principles of population genetics.
and parallel synthesis. J Med Chem 2005;48:4793-802. Sunderland, Massachusetts; Sinauer Associate: 1997.
50. Zimmer EA, Martin SL, Beverly SM, Kan YM, Wilson 59. Garcia ES, Gonzalez MS, Azambuja P. Biological
AC. Rapid duplication and loss of genes coding for the factors involving Trypanosoma cruzi life cycle in the
a chain of haemoglobin. Proc Natl Acad Sci USA invertebrate vector, Rhodnius prolixus . Mem Inst
1980;77:2158-62. Oswaldo Cruz 1999;94(Suppl. 1):213-6.
51. Lynch M, Conery LM. The evolutionary fate and 60. Azambuja P, Garcia ES, Ratcliffe NA. Gut microbiota
consequences of duplicate genes. Science and parasite transmission by insect vectors. Trends
2000;290:1151-5. Parasitol 2005;21:568-72.
52. Hurles M. Gene duplication: the genomic trade in spare 61. Rodríguez P, Escalante M, Díez H, Cuervo C,
parts. PloS Biol 2004;2:E206. Montilla M, Nicholls RS, et al. Estudio de la variabilidad
de seis cepas colombianas de Trypanosoma cruzi
53. Saravia NG, Holguín AF, Cibulskis RE, mediante polimorfismos de longitud de los fragmentos
D´Alessandro A. Divergent isoenzyme profiles of de restricción (RFLP) y amplificación aleatoria de ADN
sylvatic and domiciliary Trypanosoma cruzi in the polimórfico (RAPD). Biomédica 2002;22:263-71.
Eastern plains, piedmont, and highlands of Colombia.
Am J Trop Med Hyg 1987;36:59-69.

63
Botero L.A.,2007;27(supl.1):64-74
Biomédica Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

ARTÍCULO ORIGINAL

Caracterización biológica y genética de dos clones


pertenecientes a los grupos I y II de Trypanosoma cruzi
de Colombia
Luz Adriana Botero, Ana María Mejía, Omar Triana
Grupo de Chagas, Instituto de Biología, Universidad de Antioquia, Medellín, Colombia.

Introducción. T. cruzi I y T. cruzi II son grupos genéticamente diferentes y se cree que dicha
variabilidad es determinante del tropismo tisular en el hospedero vertebrado y responsable de
las diversas manifestaciones clínicas de la enfermedad de Chagas.
Objetivo. Caracterizar biológica y genéticamente dos clones colombianos de los grupos T.
cruzi I y II en el modelo murino.
Materiales y métodos. Las cepas CAS15 y AF1 pertenecientes a los grupos T. cruzi I y II
fueron clonadas en medio semisólido. Un clon de cada una de ellas y una mezcla de ambos se
utilizaron para infectar ratones, los cuales se sacrificaron a diferentes tiempos post-infección.
Para analizar la presencia del parásito en sangre y diferentes órganos, se utilizaron el
microhematocrito y la reacción en cadena de la polimerasa con los marcadores de la secuencia
satélite del ADN nuclear y con el espaciador intergénico del gen mini-exón.
Resultados. El clon T. cruzi I fue más infectivo, observándose un tropismo preferencial por
corazón, recto y músculo esquelético, mientras que el clon T. cruzi II presentó un tropismo
preferencial por bazo e hígado. Durante la infección con la mezcla de los clones, se observó
que el clon T. cruzi I predominó sobre el T. cruzi II tanto en sangre como en órganos.
Conclusiones. Los resultados confirman que las diferencias genéticas entre los grupos de T.
cruzi podrían estar determinando el tropismo tisular y de esta manera jugar un papel fundamental
en el entendimiento de las manifestaciones clínicas de la enfermedad de Chagas en Colombia.
Palabras claves: Trypanosoma cruzi, enfermedad de Chagas, variación (Genética), tropismo.
Biological and genetic characterization of two Colombian clones of Trypanosoma cruzi
groups I and II
Introduction. Genetic differences between T. cruzi I and T. cruzi II may determine differences in
their tissue tropism in the vertebrate host and may also be responsible for the differences in
clinical manifestations of Chagas disease.
Objective. Two Colombian clones of the T. cruzi groups I and II were characterized biologically
and genetically in a murine model.
Materials and methods. Strains Cas15 and AF1 belonging to the T. cruzi groups I and II were
cloned in semisolid medium. A clone of each strain and a mix of both were used to infect mice;
the mice were subsequently sacrificed at selected post-infection intervals. In order to identify
the parasite presence in blood and organs, two methods were used (a) microhematocrit and (b)
polymerase chain reaction with primers for satellite DNA and the intergenic region of mini-
exon.
Results. The T. cruzi I clone was more infectious, with a preferential tropism observed in heart,
rectum and skeletal muscle, whereas clone T. cruzi II exhibited a preferential tropism for spleen
and liver. During the infection with the clone mixture a predominance of the T. cruzi I clone over
clone II in blood as well as in organs was observed.
Conclusions. The results corroborate that the genetic differences between the T. cruzi groups
correlate with their tissue tropism, and can play an essential role in explaining the clinical
manifestations of Chagas disease observed in Colombia.
Key words: Trypanosoma cruzi, Chagas disease, variability (Genetics), tropism.

64
Biomédica 2007;27(supl.1):64-74 Caracterización de clones de Trypanosoma cruzi I y II

La enfermedad de Chagas, causada por el mientras que el grupo T. cruzi II predomina en los
parásito Trypanosoma cruzi , se encuentra países del sur y se encuentra asociado a los
ampliamente distribuida en países de Centro y humanos y, por ende, al ciclo doméstico de
Sur América, afectando aproximadamente a 20 transmisión (15). Por otra parte, se ha visto que
millones de individuos (1). En Colombia, afecta a áreas con gran morbilidad presentan la circulación
cerca del 5% de la población y aproximadamente del grupo T. cruzi II, mientras que en donde circula
el 11% está en riesgo de contraer la infección (2). el grupo T. cruzi I es poco frecuente la enfermedad
(7). Sin embargo, estudios recientes muestran que
La enfermedad presenta un curso clínico variable
los dos grupos están circulando en ambos
que inicia con una fase aguda asintomática,
ambientes (13-16); en Venezuela, por ejemplo, un
caracterizada por alta parasitemia y detección de
estudio realizado durante el año 2004 reveló un
T. cruzi prácticamente en todos los órganos del
mayor número de pacientes infectados con el
hospedero (3). La enfermedad avanza a una fase
grupo T. cruzi I que presentaban la fase aguda de
crónica, caracterizada por baja parasitemia y un
la enfermedad con manifestaciones clínicas
impredecible curso clínico que puede involucrar similares a las observadas en pacientes
problemas cardiacos o gastrointestinales (4). En infectados con el grupo T. cruzi II (16). Así mismo,
esta fase el parasitismo en tejidos es muy alto y en infecciones experimentales se ha encontrado
restringido a algunos órganos como corazón, que el grupo al que pertenecen los parásitos
músculo esquelético, hígado, esófago, bazo y determina el tropismo a tejidos, la parasitemia y
recto (5,6). La habilidad del parásito para sobrevivir la patogénesis de la enfermedad (1,7,17).
a la fase aguda y avanzar hacia la fase crónica e
invadir determinados órganos depende tanto de En Colombia también se ha reportado
factores genéticos del parásito como del hospedero recientemente la presencia simultánea de los dos
(7-11). Por esto, diversas investigaciones han grupos filogenéticos en varias de las cepas
estudiado la variabilidad genética del parásito y estudiadas, evidenciando una mezcla de ambos,
su posible relación con las manifestaciones pero con predominio del grupo I en medios de
clínicas de la enfermedad (7). En T. cruzi se han cultivo (18). Este resultado, junto con el hallazgo
utilizado diferentes marcadores bioquímicos y de los dos grupos de T. cruzi en las heces de
moleculares para tratar de correlacionar la vectores recolectados de poblaciones silvestres
diversidad genética del parásito con sus del norte de Colombia (datos no publicados),
características biológicas. El uso del espaciador sugiere la posibilidad de que ambos grupos
intergénico de los genes mini-exón genera dos circulan de manera simultánea en la naturaleza,
claras divisiones filogenéticas conocidas como generando una epidemiología más compleja, pues
T. cruzi I y T. cruzi II (12), las cuales permiten tanto vectores como hospederos podrían estar
establecer algunas asociaciones importantes entre infectados con los dos grupos y, en éstos últimos,
la taxonomía y la biología del parásito, el darse un tropismo diferencial a tejidos ocasionan-
desarrollo de la enfermedad y diferentes do manifestaciones clínicas diversas (1,18,19).
parámetros epidemiológicos, entre otros (13,14). Por lo anterior, y teniendo en cuenta que en Colombia
Tradicionalmente, el grupo T. cruzi I se ha se ha reportado la presencia de los dos grupos
asociado al ciclo selvático de transmisión y se de T. cruzi, el objetivo del presente trabajo fue
dice que predomina en los países ubicados al norte caracterizar biológica y genéticamente dos clones
de la cuenca amazónica, entre ellos Colombia, de T. cruzi aislados de cepas colombianas
pertenecientes a los grupos I y II. Para esto, se
evaluó el tropismo a órganos de ratones infectados
Correspondencia:
Omar Triana Chávez, Calle 62 N° 52-59, Sede de
individualmente con cada uno de ellos y durante
Investigación Universitaria SIU, U de A, Medellín, Antioquia, una infección mixta con ambos clones. Este
Colombia, teléfono 2106520, fax 2105622, aspecto es de gran importancia para entender
otriana@gmail.com las manifestaciones clínicas y la epidemiología
Recibido: 19/12/05; aceptado: 24/04/06 de la enfermedad de Chagas en Colombia.

65
Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

Materiales y métodos que se han encontrado en las cepas mezclas de


ambos grupos (18).
Parásitos
Para amplificar dicha región se utilizaron los
Se utilizaron las cepas colombianas I.RHO/CO/
iniciadores TC1 (5´-GTGTCCGCCACCT-CCT-
00/CAS-15.CAS (CAS15) y I·PANS/CO/93/AF-
TCGGGCC-3´), TC2 (5´-CCTGCAGGCACAC-
1.ANT (AF1) caracterizadas genéticamente por
GTGTGTGTG-3´) y TCC (5´-CCCCCCTCCCAG-
isoenzimas, por RAPD y con el marcador mini-
GCCACACTG-3´), los cuales amplifican un
exón como T. cruzi I y T. cruzi IIb, respectivamente
(datos no publicados). La cepa CAS15 se aisló fragmento de 350 pb para el grupo T. cruzi I y un
en el año 2000 del vector Rhodnius prolixus fragmento de 300 pb para el grupo T. cruzi II (13).
silvestre del departamento de Casanare y la cepa La PCR se hizo en un volumen final de 25 µl que
AF1 del vector Panstrongylus geniculatus silvestre contenían 2,5 µl de ADN molde, 50 mM KCl, 10mM
del municipio de Amalfi, departamento de Tris-HCl, 0,1% Triton X-100, 1,5mM MgCl2, 12,5
Antioquia. Las cepas se han mantenido en el pmol de cada iniciador, 200mM dNTPs y 0,625
laboratorio del Grupo de Chagas de la Universidad unidades de Taq ADN polimerasa. Los ciclos de
de Antioquia por repiques cada siete días en medio amplificación se realizaron a una temperatura
de cultivo LIT suplementado con suero bovino fetal inicial de 94°C por 3 minutos, seguida de 27 ciclos
al 10% y a una temperatura de 28°C (20). a 94°C por 30 segundos, 55°C por 30 segundos,
72°C por 30 segundos y un ciclo final de 72°C por
Clonación de las cepas 10 minutos.
Los clones para cada una de las cepas fueron Para determinar si los clones aislados eran
obtenidos a partir de epimastigotes cultivados en genéticamente diferentes se utilizó la técnica PCR
medio semisólido AGAR-LIT-BHI-sangre (21). de baja astringencia con un único iniciador
Para esto se mezclaron 50 ml de agar estéril con específico (LSSP-PCR), que requiere un primer
pH 7,2, 100ml de LIT con suero bovino fetal al paso de amplificación de la región variable del
10%, 100 ml de infusión de hígado y corazón (BHI) ADN del cinetoplasto (kADN). Para amplificar dicha
estéril y 6,25 ml de sangre desfibrinada. A región se utilizaron los iniciadores S35 (5´-
continuación, se vertieron 25 ml de esta mezcla AAATAATGTACGGGGAGATGCATGA-3´) y S36
en cajas de Petri de 95 mm de diámetro y, luego (5´-GGGTTCGATTGGGGTTGGTGT-3´), los
de comprobar la esterilidad del medio, se cuales amplifican un fragmento de 330 pb
sembraron 20 células por caja. Posteriormente se correspondiente a la región variable de los
envolvieron las cajas en papel estéril y se minicírculos (24). La PCR se llevó a cabo en un
incubaron aproximadamente 30 días a 28°C hasta volumen final de 50 µL de reacción que contenía
observar el crecimiento de colonias puntiformes 1 ml de ADN molde, 50 mM de KCl, 10 mM Tris-
transparentes. Se aislaron y cultivaron siete HCl, 0,1% Triton X-100, 1,5 mM de MgCl2, 10 pmol
clones para la cepa CAS15 y dos para la cepa de cada iniciador, 200 mM de dNTPs y 2,5
AF1 en medio LIT suplementado con suero bovino unidades de Taq ADN polimerasa. Los ciclos de
fetal al 10%, según lo reportado previamente (22). amplificación se realizaron a una temperatura
Extracción de ADN y caracterización genética inicial de 94°C por 3 minutos, seguida de 35 ciclos
de los clones en cultivo de 94°C por 45 segundos, 63°C por 45 segundos
y 72°C por 45 segundos, y un ciclo final de 72°C
El ADN de las cepas parentales y de sus
por 10 minutos.
respectivos clones se obtuvo por el método salting
out (23). Cada clon se caracterizó genéticamente La banda de 330 pb, obtenida del kADN, se purificó
por la técnica de reacción en cadena de la a partir de geles de agarosa de bajo punto de fusión
polimerasa (PCR) con el espaciador intergénico al 1,5% y se diluyó 10 veces en agua bidestilada.
de los genes del mini-exón para evaluar si Se usó 1 µl de la dilución como molde para la
efectivamente el grupo de T. cruzi encontrado reacción de LSSP-PCR (24), la cual se llevó a
correspondía al de su cepa de origen, debido a cabo en 25 µl de volumen final utilizando 50 mM

66
Biomédica 2007;27(supl.1):64-74 Caracterización de clones de Trypanosoma cruzi I y II

de KCl, 10 mM Tris-HCl, 0,1% Triton X-100, 1,5 cloroformo-alcohol isoamilico (25:24:1), previa
mM de MgCl2, 120 pmoles del iniciador S35, 200 homogenización en solución de digestión (SDS
mM de cada dNTP y 4 unidades de Taq 10%, NaCl 5 M, EDTA 0,5M, Tris-HCL 1M pH
polimerasa. Los ciclos de amplificación se 7,5) y proteinasa K (100mg/ml), con posterior
realizaron a una temperatura inicial a 94°C por 3 precipitación con etanol (27).
minutos, seguida de 35 ciclos a 94°C por 45
Detección del parásito por PCR
segundos, 30°C por 45 segundos y 72°C por 45
segundos y un ciclo final a 72°C por 10 minutos Para determinar si el parásito se encontraba
(5). Los productos amplificados se analizaron en presente en los diferentes órganos de los tres tipos
geles de poliacrilamida al 6% (25) teñidos con de infección se usó una secuencia satélite del
nitrato de plata (1). Este procedimiento se realizó ADN nuclear de T. cruzi (Sat-ADN).
por duplicado con el fin de evaluar la
Para amplificar el Sat-ADN se utilizaron los
reproducibilidad de la técnica.
iniciadores TcZI (5´-CGAGCTCTTGCCCACACG
Infección experimental de ratones GGTGCT-3´) y TcZII (5´-CCTCCAAGCAGCGG
ATAGTTCAGG-3´), los cuales amplifican un
Tres grupos de dieciocho ratones machos suizos
fragmento de 188 pb (28). La PCR se llevó a cabo
de 20 días de nacidos fueron inoculados
en un volumen final de 50 µL de reacción que
intraperitonealmente con tripomastigotes
contenía 1 µl de ADN molde, 50 mM de KCl, 10
obtenidos de medio de cultivo de cada clon y con
mM Tris-HCl, 0,1% Triton X-100, 1,5 mM de
una mezcla de ambos. El inoculo utilizado fue de
MgCl2, 20 pmol de cada iniciador, 200 mM de
800.000 tripomastigotes de cada clon, tanto en
dNTPs, y 2,5 unidades de Taq ADN polimerasa.
las infecciones individuales como en la mixta. Para
Los ciclos de amplificación se realizaron a una
determinar la presencia de parásitos en sangre,
temperatura inicial de 94°C por 3 minutos, seguida
al séptimo día de infección se revisaron los
de 35 ciclos de 94°C por 45 segundos, 60°C por
ratones por el método del microhematocrito y se
1 minuto y 72°C por 1 minuto, y un ciclo final de
tomó una muestra de sangre de la cola de los
72°C por 10 minutos.
ratones infectados con la mezcla de los clones
en un trozo de tela para su posterior análisis por Además, para determinar el grupo filogenético
PCR (26). Para determinar la presencia de los presente en las muestras de sangre y órganos de
clones en órganos, se sacrificaron grupos de tres la infección con la mezcla de los clones se utilizó
ratones de cada infección y se les extrajo el marcador mini-exón mediante el procedimiento
corazón, hígado, bazo, recto y músculo descrito anteriormente.
esquelético tomado del fémur de cada ratón. Estos
Los productos amplificados fueron analizados en
procedimientos se repitieron cada siete días hasta
geles de agarosa al 2%, teñidos con bromuro de
llegar al día 28 y luego se hicieron a los días 60 y
etidio y visualizados bajo un transiluminador UV
90 de la infección (pi). Como control negativo se
(29). Cada uno de estos ensayos se hizo por
utilizó un ratón macho suizo no infectado al que
duplicado.
se le tomaron las mismas muestras. El sacrificio
de los ratones se llevó a cabo por el método de Resultados
inhalación de CO2, el cual fue aprobado por el
Aislamiento y caracterización genética de los
Comité de Bioética de la Universidad de Antioquia.
clones
Extracción del ADN
Para la cepa CAS15 se aislaron 7 clones, los
La obtención del ADN de la tela impregnada con cuales se denominaron como CAS15 cl1 hasta
sangre de los ratones se hizo por el método de CAS15 cl7. Todos los clones amplificaron la
Chelex®, que consiste en adicionar a la sangre banda de 350 pb para el marcador del gen mini-
una resina y someterla a altas temperaturas que exón, característica del grupo T. cruzi I (figura 1).
liberan el ADN en el sobrenadante (26). El ADN Para la cepa AF1 se aislaron dos clones a los
de los órganos fue extraído por el método de fenol- que se les denominó AF1 cl1 y AF1 cl2, los cuales

67
Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

amplificaron la banda de 300 pb, característica positivas. A los días 21, 28 y 60 pi, todas las
del grupo T. cruzi II (figura 1). El análisis de los muestras analizadas para el clon CAS15 cl3
patrones electroforéticos con la técnica LSSP-PCR fueron positivas, mientras que para el clon AF1
indicó que los clones CAS15 cl1, CAS15 cl3, cl1 se encontró al día 21 pi un 41% de muestras
CAS15 cl4, CAS15 cl5 y CAS15 cl6 presentaron positivas y a los días 28 y 60 pi un 100%. Para la
un patrón de bandas idéntico, mientras que los infección con la mezcla de los clones se encontró
clones CAS15 cl2 y CAS15 cl7 presentaron que los parásitos aparecieron en sangre el mismo
perfiles únicos (figura 2). Debido al bajo número día que el clon CAS15 cl3, presentando un 100%
de clones obtenidos para la cepa AF1 no se de muestras positivas. Al día 90 pi se observó
realizó el análisis por LSSP-PCR. Para realizar la ausencia de parásitos en todas las muestras
caracte-rización biológica de los clones (cuadro 1).
pertenecientes a estos dos grupos de T. cruzi se
Detección del parásito por PCR en sangre y
seleccionaron al azar los clones CAS15 cl3 y AF1
órganos de ratones
cl1.
Las muestras de sangre positivas por PCR
Detección de parásitos en sangre por
amplificaron sólo la banda de 350 pb, indicando
microhematocrito
la predominancia del grupo T. cruzi I (figura 3).
Durante la infección individual con el clon Cas15 Con el marcador sat-ADN se observó que el
cl3 se observó que los parásitos en sangre porcentaje de órganos parasitados disminuyó con
comenzaron a aparecer al día 7 de la infección el transcurso de la infección, encontrándose a los
(pi), con un 78% de muestras positivas, mientras días 7, 14 y 21 pi un tropismo por casi todos los
que para la infección con el clon AF1 cl1 los órganos, tanto en infecciones individuales como
parásitos en sangre empezaron a aparecer al día en la mixta, mientras que a partir del día 28 pi se
14 pi, encontrándose sólo un 28% de muestras observó un histotropismo preferencial de cada
clon. En las infecciones individuales se encontró
la presencia del clon CAS15 cl3 en el 88,8% de
los corazones y en el 100% de los músculos
esqueléticos analizados, mientras que en recto,
hígado y bazo se observó el 66,6, 44,4 y 38,8%
de infección, respectivamente. Con el clon AF1
cl1 se observó un porcentaje de infección en bazo,
Figura 1. Amplificación por PCR de la región intergénica del hígado, músculo esquelético y recto del 83,3,
gen mini-exón para los clones aislados de las cepas CAS15 61,1, 50 y 27,7%, respectivamente, mientras que
y AF1. M: marcador de tamaño molecular, escalera de 100 el corazón de estos ratones no presentó infección.
pb. CN: control negativo. CAS15 y AF1: cepas parentales.
Con la infección mixta se encontró un porcentaje
Carriles 1 a 7: clones 1 al 7 de la cepa CAS 15. Carriles 8 a
9: clones 1 y 2 de la cepa AF1. de infección en corazón y músculo esquelético
del 100%, mientras que en recto, hígado y bazo
se encontró una infección del 94,4, 72,2 y 11,1%,
respectivamente (cuadro 2 y figuras 4a, 4b y 4c).
La caracterización molecular con el marcador mini-
exón de los parásitos presentes en órganos
durante la infección mixta reveló en todos los
órganos positivos un amplificado de 350 pb,
mostrando un 88,9% de corazones y un 66,7%
de músculos esqueléticos positivos, mientras que
Figura 2. LSSP-PCR de los siete clones aislados de la cepa
CAS15. M: marcador de tamaño molecular, escalera de 50
el recto e hígado mostraron un porcentaje de
pb. Carriles 1 a 7: clones 1 al 7 de la cepa CAS 15. infección del 44,4 y 11,1%, respectivamente. Sin
* Diferencias en el perfil de bandas. embargo, las muestras de bazo positivas con

68
Biomédica 2007;27(supl.1):64-74 Caracterización de clones de Trypanosoma cruzi I y II

Cuadro 1. Detección por microhematocrito del parásito en sangre de ratones infectados con los clones CAS15 cl3, AF1 cl1
y con la mezcla de ambos.

Ratones
Parásitos Día pi. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Clon 7 + + + + - + - + + - - + + + + + + +
CAS15 cl3 14 - - - - - - - - - - - - - - -
21 + + + + + + + + + + + +
28 + + + + + + + + +
60 + + + + + +
90 - - -
ClonAF1 cl1 7 - - - - - - - - - - - - - - - - - -
14 - - - - - - - + - + - + + - +
21 + - - - + - - + - + - +
28 + + + + + + + + +
60 + + + + + +
90 - - -
Mezcla 7 + + + + + + + + + + + + + + + + + +
14 - - - - - + - - + + - + + + -
21 + + + + + + + + + + + +
28 + + + + + + + + +
60 + + + + + +
90 - - -

+: Positivo; -: negativo. La región en blanco corresponde a ratones sacrificados el día indicado. pi: post-infección

diferencial por tejidos del hospedero durante la


fase crónica de la enfermedad (1).
Muchas de las cepas naturales de T. cruzi son
multiclonales y se encuentran compuestas de
poblaciones del parásito tanto del grupo T. cruzi I
Figura 3. Amplificación de la región intergénica del gen mini- como del grupo T. cruzi II. Sin embargo, este número
exón en el día 7 después de la infección en sangre de ratones
inoculados con la mezcla de los clones. M: marcador de
de clones puede cambiar drásticamente a medida
tamaño molecular, escalera de 100 pb. CN: control negativo. que trascurre el tiempo de infección, ya que en la
CAS15: cepa parental. Carriles 1 a 8: sangre de ratones. fase crónica de la enfermedad ciertos clones del
parásito son eliminados probablemente como
sat-ADN no amplificaron con el marcador mini- resultado de factores inmunológicos del hospedero
exón, imposibilitando determinar el grupo o debido a la capacidad de multiplicación o
requerimientos nutricionales de cada clon (30). En
filogenético presente en dicho órgano (figura 5).
el presente trabajo, mediante una infección mixta
Discusión de clones pertenecientes a los dos grupos de T.
La enfermedad de Chagas se considera un cruzi, se simularon las condiciones de una infección
natural en el modelo murino, permitiendo entender
problema de salud pública en muchos países por
varios aspectos de la enfermedad, entre ellos, cuál
la gran cantidad de personas afectadas y la
es el genotipo causante de un tropismo específico
variedad de manifestaciones clínicas con que se
y cuál de estos predomina en el hospedero
presenta. Muchos estudios han llevado a pensar
después de un largo periodo de infección.
que dicha variación está ligada directamente al
genotipo de los parásitos circulantes, ya que La clonación de las cepas de T. cruzi ha permitido
diferencias genéticas en las poblaciones del establecer la homogeneidad o heterogeneidad
parásito hacen que estos presenten un tropismo genética y el comportamiento biológico y

69
Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

Figura 4. Amplificación de la secuencia satélite del ADN nuclear de T. cruzi en órganos de ratones inoculados con los
clones CAS15 cl3 (a), AF1 cl1 (b), con la mezcla de ambos, y de ratón negativo no infectado (c). M: marcador de tamaño
molecular, escalera de 100 pb. CN: control negativo. CAS 15 y AF1: cepas parentales. Ratones 1 y 10: sacrificados a los
días 7 y 60 después de la infección, respectivamente. c: corazón. h: hígado. b: bazo. r: recto. m: músculo esquelético.

Cuadro 2. Detección del parásito por PCR en órganos de ratones infectados con los clones CAS15 cl3, AF1 cl1 (marcador
Sat-ADN) y con la mezcla de ambos.

Parásitos Día post-infección Corazón Hígado Bazo Recto Músculo esquelético

Clon CAS15.3 7 2 3 3 3 3
14 3 3 2 3 3
21 3 2 1 1 3
28 2 0 1 2 3
60 3 0 0 2 3
90 3 0 0 1 3
Clon AF1.1 7 0 3 3 3 0
14 0 0 1 2 1
21 0 2 2 0 2
28 0 2 3 0 2
60 0 2 3 0 2
90 0 2 3 0 2

Mezcla 7 3/3 3/1 1/0 2/2 3/1


14 3/2 3/1 1/0 3/2 3/1
21 3/2 3/0 0/0 3/1 3/1
28 3/3 2/0 0/0 3/1 3/3
60 3/3 1/0 0/0 3/1 3/3
90 3/3 1/0 0/0 3/1 3/3

Órganos de ratones inoculados con la mezcla que amplificaron por mini-exón la banda de 350 pb correspondiente al grupo
T. cruzi I. Número de ratones positivos con Sat-ADN/número de ratones positivos con mini-exón.

70
Biomédica 2007;27(supl.1):64-74 Caracterización de clones de Trypanosoma cruzi I y II

infección de cada clon, encontrándose un genotipo


más infectivo en el clon CAS15 cl3.
Reportes previos han encontrado en suero de
humanos provenientes de Argentina, Chile y Brasil
anticuerpos contra los dos grupos de T. cruzi (32),
indicando infección con ambos grupos. Los
resultados obtenidos en este estudio con el
Figura 5. Amplificación de la región intergénica del gen mini- marcador mini-exón nos permiten inferir que
exón en órganos de ratones inoculados con la mezcla de probablemente haya en la sangre de los ratones
los clones. M: marcador de tamaño molecular, escalera de inoculados con la mezcla de los clones un
100 pb. CN: control negativo. AF1: cepa parental. Ratón
negativo: control no infectado con T. cruzi; ratones 7 y 10:
predominio del clon CAS15 cl3 con respecto al
sacrificados a los días 28 y 60 después de la infección, clon AF1 cl1, ya que las pocas muestras que se
respectivamente. c: corazón. h: hígado. b: bazo. r: recto. m: encontraron positivas amplificaron la banda de 350
músculo esquelético. pb. Sin embargo, podría pensarse también que
en sangre había muy pocos parásitos pertenecien-
bioquímico de las poblaciones del parásito que
tes a ambos clones, principalmente al clon AF1
las componen. Campos y Andrade (31) encontraron
cl1, y que éstos fueron escasamente detectados
que la cepa 21SF, aislada de un paciente en la
por la PCR con dicho marcador. Por otra parte,
fase aguda de la enfermedad, presentó
numerosos estudios han mostrado que durante la
homogeneidad en cuanto a parámetros biológicos
fase crónica de la enfermedad los parásitos ya
y bioquímicos entre los clones y subclones que
han invadido y colonizado órganos y, por tanto,
la componen, sugiriendo la presencia de un clon
principal representante del comportamiento no están circulando en sangre, lo que se verificó
biológico de dicha cepa. Los resultados encon- en este estudio, pues se encontró una ausencia
trados en este estudio, específicamente durante total de parásitos en sangre a los tres meses
la clonación de la cepa CAS15, nos permiten después de la infección, tanto en las infecciones
sugerir que también se observa la predominancia individuales como en la mixta.
de un clon, ya que los perfiles de bandas obtenidos Trabajos previos en ratones machos BALB/c han
con la LSSP-PCR son iguales para cinco de los demostrado que luego de tres meses de infección,
siete clones aislados. Por otra parte, se podría periodo correspondiente a la fase crónica de la
pensar que muchos de los resultados encontrados enfermedad en dicho modelo experimental,
en este trabajo son consecuencia del clon diferentes clones de T. cruzi presentan distribu-
seleccionado, pues al ser uno de los ciones titulares diferenciales (9). Así mismo, otros
predominantes en la cepa CAS15 puede sobresalir autores han mostrado un tropismo preferencial de
frente al clon de AF1 debido a una mayor la cepa CAS15 por corazón (18) y de la cepa AF1
capacidad de replicación, favoreciendo su por bazo e hígado (33). Nuestro estudio apoya
presencia en el transcurso de la infección como tales resultados, al ser el corazón uno de los
se observó en el presente estudio. órganos que más se encontró parasitado con el
En cuanto a la cinética de aparición de los clones clon CAS15 cl3, y el hígado y el bazo con el clon
en sangre de los ratones en los diferentes cortes AF1 cl1 en la fase crónica de la infección. Esta
de tiempo pi, se encontró que los dos clones idea nos permite sugerir que la variabilidad genética
presentaron diferentes tiempos de aparición. El de los parásitos es uno de los factores
determinantes de la distribución diferencial en los
clon CAS15 cl3 apareció en sangre en el día 7 pi
tejidos y, probablemente, de las manifestaciones
y el clon AF1 cl1, en el día 14. Además, la cantidad
clínicas de la enfermedad de Chagas.
de muestras de sangre de ratones que fueron
positivas en todos los tiempos de infección fue Por otro lado, se ha encontrado que tanto en Chile
mayor para el clon CAS15 cl3 que para el AF1 como en otros países del Cono Sur, donde se
cl1. Estos resultados evidencian la capacidad de sabe que prevalece el grupo T. cruzi II, predominan

71
Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

las formas digestivas de la enfermedad (7), hígado fueron muy interesantes, ya que a pesar
mientras que en Colombia la manifestación clínica de que el parasitismo en dichos órganos se
más frecuente es la cardiaca. Nuestros resultados observó en las dos infecciones individuales,
aportan evidencia que confirma que la forma durante la infección mixta sólo se encontró la
cardiaca de la enfermedad en Colombia puede ser presencia del grupo T. cruzi I (clon CAS15 cl3).
causada por T. cruzi I, puesto que el clon AF1 Esto podría explicarse por diferencias entre los
cl1, representante de T. cruzi II en Colombia, no dos clones en la cinética de la fase aguda, ya
invadió corazón, mientras que el clon del grupo I que las respuestas inmunes estimuladas por una
se encontró en la mayoría de los corazones. Sin población de T. cruzi podrían favorecer la invasión
embargo, es necesario que en futuros estudios y colonización tisular de la otra (16). Además,
se evalúe el tropismo tisular de un mayor número como se ha informado anteriormente, algunos
de clones pertenecientes a T. cruzi II para verificar clones pueden ser eliminados por su inhabilidad
lo anterior. para competir y propagarse en el hospedero, o
por la acción de sus mecanismos de defensa (36).
Nuestros resultados concuerdan con lo planteado Se podría pensar también en la posibilidad de que
por N. Añez y col (16), quienes encontraron que ambos grupos lleguen a infectar los órganos, pero
la infección con T. cruzi I presenta parasitemias al igual que ocurre con las cepas, T. cruzi II no se
mucho más altas que las causadas por T. cruzi II puede detectar por estar presente en menor
y que, además, T. cruzi I genera en pacientes proporción. A pesar de que el mini-exón es un
durante la fase crónica un alto grado de daño en buen marcador para diferenciar los dos grupos de
miocardio y músculo esquelético (34). Por el T. cruzi, los resultados obtenidos mostraron que
contrario, otros autores han encontrado que las no fue muy sensible en la detección del parásito,
infecciones con T. cruzi II son bastante graves y posiblemente por su bajo número de copias
que comprometen algunos tejidos como recto y comparado con el marcador sat-ADN.
esófago (1,16,31). Los resultados encontrados en
este estudio muestran que la parasitemia y el Finalmente, nuestro trabajo aporta evidencia que
tropismo por órganos de parásitos pertenecientes sugiere que en Colombia el grupo T. cruzi I es
al grupo T. cruzi II es menor que la de parásitos más virulento que T. cruzi II y probablemente por
del grupo T. cruzi I, con tropismo preferencial por ello es que predomina en las infecciones. Además,
bazo e hígado. Consideramos que estas se comprueba que el polimorfismo genético de
diferencias pueden deberse al alto polimorfismo las poblaciones de T. cruzi puede ejercer influencia
encontrado en parásitos pertenecientes al grupo sobre el tropismo tisular y consecuentemente
T. cruzi II, ya que se ha comprobado que los sobre las manifestaciones clínicas de la
diferentes subgrupos en los que se encuentra enfermedad. Estos aspectos son de gran
dividido difieren en su infectividad, virulencia y importancia para una mejor comprensión de la
patogenicidad. Como ejemplo está el clon CL- epidemiología de la enfermedad de Chagas.
Brener, perteneciente al grupo T. cruzi IIe, que Agradecimientos
después de ser inoculado en ratas presentó una
alta tasa de mortalidad al sobrevivir a la fase Luz Adriana Botero recibió apoyo del CODI–
aguda de la infección (31). Universidad de Antioquia a través del programa
de jóvenes investigadores.
Es importante destacar que diversos estudios han
reportado el músculo esquelético como uno de Conflicto de intereses
los órganos que más se encuentra parasitado con Los autores declaramos que no existe ningún
T. cruzi tanto en la fase aguda como en la fase conflicto de intereses.
crónica de la enfermedad (35). Lo encontrado en
este estudio corrobora lo anterior, pues en las Financiación
infecciones individuales ambos clones se Este proyecto fue financiado por el programa de
encuentran parasitando dicho músculo. Además, sostenibilidad 2005–2006 del CODI, Universidad
los resultados obtenidos en este órgano y en el de Antioquia.

72
Biomédica 2007;27(supl.1):64-74 Caracterización de clones de Trypanosoma cruzi I y II

Referencias classified into two lineages using mini-exon and


ribosomal RNA sequences. Am J Trop Med Hyg
1. Andrade LO, Machado CR, Chiari E, Pena SD, 1998;58:807-11.
Macedo AM. Differential tissue distribution of diverse
clones of Trypanosoma cruzi in infected mice. Mol 14. Fernandes O, Mangia RH, Lisboa CV, Pinho AP,
Biochem Parasitol 1999;100:269-75. Morel CM, Zingales B, et al. The complexity of the
sylvatic cycle of Trypanosoma cruzi in Rio de Janeiro
2. Moncayo A. Chagas disease: current epidemiological state (Brazil) revealed by the non-transcribed spacer
trends after the interruption of vectorial and of the mini-exon gene. Parasitology 1999;118:161-6.
transfusional transmission in the Southern Cone
countries. Mem Inst Oswaldo Cruz 2003;98:577-91. 15. Miles MA, Feliciangeli MD, de Arias AR. American
trypanosomiasis (Chagas disease) and the role of
3. Lenzi HL, Oliveira DN, Lima MT, Gatas CR. molecular epidemiology in guiding control strategies.
Trypanosoma cruzi: paninfectivity of CL strain during BMJ 2003;326:1444-8.
murine acute infection. Exp Parasitol 1996;84:16-27.
16. Añez N, Crisante G, da Silva FM, Rojas A, Carrasco
4. Prata A. Clinical and epidemiological aspects of Chagas H, Umezawa E, et al. Predominance of lineage I among
disease. Lancet Infect Dis 2001;1:92-100. Trypanosoma cruzi isolates from Venezuelan patients
5. Vago AR, Macedo AM, Oliveira RP, Andrade LO, with different clinical profiles of acute Chagas disease.
Chiari E, Galvao LM, et al. Kinetoplast DNA signatures Trop Med Int Health 2004;9:1319-26.
of Trypanosoma cruzi strains obtained directly from 17. Magalhães-Santos IF, Souza MM, Lima CS, Andrade
infected tissues. Am J Pathol 1996;149:2153-9. S. Infection of Calomys callosus (Rodentia Cricetidae)
6. Vago AR, Andrade LO, Leite AA, d’Avila Reis D, with strains of different Trypanosoma cruzi biodemes:
Macedo AM, Adad SJ, et al. Genetic characterization Pathogenicity, histotropism, and fibrosis induction. Mem
of Trypanosoma cruzi directly from tissues of patients Inst Oswaldo Cruz 2004;99:407-13.
with chronic Chagas disease: differential distribution of 18. Mejía AM, Triana O. Análisis por LSSP-PCR de la
genetic types into diverse organs. Am J Pathol variabilidad genética de Trypanosoma cruzi en sangre
2000;156:1805-9. y órganos de ratones. Biomédica 2005;25:76-86.
7. Macedo AM, Machado CR, Oliveira RP, Pena SD. 19. Freitas JM, Lages-Silva E, Crema E, Pena SD,
Trypanosoma cruzi: genetic structure of populations and Macedo AM. Real time PCR strategy for the
relevant of genetic variability to the pathogenesis of identification of major lineages of Trypanosoma cruzi
Chagas disease. Mem Inst Oswaldo Cruz 2004;99:1-12. directly in chronically infected human tissues. Int J
8. Oliveira RP, Broude NF, Macedo AM, Cantor CR, Parasitol 2005;35:411-7.
Smith CL, Pena SD. Probing the genetic population 20. Bernabé C, Tibayrenc M. Trypanosoma cruzi: long-
structure of Trypanosoma cruzi with polymorphic micro- term sub-cultures in two different culture media do not
satellites. Proc Natl Acad Sci USA 1998;95:3776-80. confirm the existence of highly versatile multilocus
genotypes. Int J Parasitol 2004;34:779-84.
9. Andrade LO, Machado CR, Chiari E, Pena SD,
Macedo AM. Trypanosoma cruzi: role of host genetic 21. Goldberg SS, Chiari E. Growth and isolation of single
background in the differential tissue distribution of parasite colonies of Trypanosoma cruzi on solid medium. J
clonal populations. Exp Parasitol 2002;100:269-75. Parasitol 1980;66:677-9.
10. Macedo AM, Martins MS, Chiari E, Pena SD. DNA 22. Camargo EP. Growth and differentiation in Trypanosoma
fingerprinting of Trypanosoma cruzi : a new tool for cruzi. Origin of metacyclic trypanosomes in liquid media.
characterization of strains and clones. Mol Biochem Rev Inst Med Trop São Paulo 1964;12:93-100.
Parasitol 1992;55:147-53.
23. Miller SA, Dykes DD, Polesky HF. A simple salting out
11. Tibayrenc M, Neubauer K, Barnabé C, Guerrini F, procedure for extracting DNA from human nucleated
Skarecky D, Ayala FJ. Genetic characterization of six cells. Nucleic Acids Res 1988;16:1215.
parasitic protozoa: parity betweem random-primer DNA
typing and multilocus enzyme electrophoresis. Proc 24. Sturm N, Degrave W, Morel C, Simpson L. Sensitive
Natl Acad Sci USA 1993;90:1335-9. detection and schizodeme classification of
Trypanosoma cruzi cells by amplification of kinetoplast
12. Souto RP, Fernandes O, Macedo AM, Campbell DA, minicircle DNA sequences. Use in diagnosis of Chagas
Zingales B. DNA markers define two major disease. Mol Biochem Parasitol 1989;33:205-14.
phylogenetic lineages of Trypanosoma cruzi . Mol
Biochem Parasitol 1996;83:141-52. 25. Pena SD, Barreto G, Vago AR, De Marco L, Reinach
F, Dias Neto E, et al. Sequence-specific gene
13. Fernandes O, Souto RP, Castro JA, Pereira JB, signatures can be obtained by PCR with single specific
Fernandes NC, Junqueira AC, et al. Brazilian isolates primers at low stringency. Proc Natl Acad Sci USA
of Trypanosoma cruzi from humans and triatomines 1994;91:1946-9.

73
Botero L.A., Mejía A.M., Triana O. Biomédica 2007;27(supl.1):64-74

26. Campos RF, Goncalves MS, dos Reis EA, dos Reis strain of Trypanosoma cruzi after long lasting
MG, Andrade SG. Comparative analysis by maintenance in the laboratory. Mem Inst Oswaldo Cruz
polymerase chain reaction amplified minicircles of 1996;91:795-800.
kinetoplast DNA of a stable strain of Trypanosoma cruzi
32. Di Noia JM, Buscaglia CA, De Marchi CR, Almeida
from Sao Felipe, Bahia, its clones and subclones:
IC, Frasch CC. A Trypanosoma cruzi small surface
possibility of predominance of a principal clone in this
molecule provides the first immunological evidence that
area. Mem Inst Oswaldo Cruz 1999;94:23-9.
Chagas disease is due to a single parasite lineage. J
27. Walsh PS, Metzger DA, Higuchi R. Chelex® 100 as a Exp Med 2002;195:401-13.
medium for simple extraction of DNA for PCR-based
33. Rios JF. Estudio del tropismo tisular de dos cepas
typing from forensic material. Biotechniques
colombianas de Trypanosoma cruzi (Tesis). Medellín:
1991;10:506-13.
Universidad de Antioquia; 1995.
28. Sambrook J, Fritsch EF, Maniatis T. Molecular
34. Camandaroba EL, Campos RF, Magalhaes JB,
cloning. A laboratory manual. Second edition. Cold
Andrade SG. Clonal structure of Trypanosoma cruzi
Spring: Harbor Laboratory Press; 1989.
Colombian strain (biodeme type III): biological,
29. Virreira M, Torrico F, Truyens C, Alonso-Vega C, isoenzymic and histopathological analysis of seven
Solano M, Carlier Y, et al. Comparison of polymerase isolated clones. Rev Soc Bras Med Trop 2001;34:
chain reaction methods for reliable and easy detection 151-7.
of congenital Trypanosoma cruzi infection. Am J Trop
35. Cummings KL, Tarleton RL. Rapid quantitation of
Med Hyg 2003;68:574-82.
Trypanosoma cruzi in host tissue by real-time PCR.
30. Franco DJ, Vago AR, Chiari E, Meira FC, Galvao LM, Mol Biochem Parasitol 2003;129:53-9.
Machado CR. Trypanosoma cruzi : mixture of two
36. Macedo AM, Pena SD. Genetic variability of
populations can modify virulence and tissue tropism in
Trypanosoma cruzi: implications for the pathogenesis
rat. Exp Parasitol 2003;104:54-61.
of Chagas disease. Parasitol Today 1998;14:119-23.
31. Campos RM, Andrade SG. Characterization of
subpopulations (clones and subclones) of the 21 SF

74
Biomédica 2007;27(supl.1):75-82 Efecto tóxico de insecticidas en T. dimidiata y T. maculata

ARTÍCULO ORIGINAL

Efecto tóxico de β-cipermetrina, deltametrina y fenitrotión


en cepas de Triatoma dimidiata (Latreille, 1811) y Triatoma
maculata (Erichson, 1848) (Hemiptera, Reduviidae)
Marlene Reyes 1, Víctor Manuel Angulo 2, Claudia Magaly Sandoval 2

1
Escuela de Biología, Facultad de Ciencias, Universidad Industrial de Santander, Piedecuesta, Santander,
Colombia.
2
Centro de Investigaciones en Enfermedades Tropicales de la Universidad Industrial de Santander,
CINTROP-UIS, Piedecuesta, Santander, Colombia.

Introducción. La evaluación de la susceptibilidad a insecticidas de las diferentes especies de


triatominos, involucrados en la transmisión de la enfermedad de Chagas de cada región, es
indispensable para el éxito de las campañas de control.
Objetivo. Determinar la línea base de susceptibilidad para los principios activos deltametrina,
β-cipermetrina y fenitrotión en ninfas de primer y quinto estadio de Triatoma dimidiata y en
ninfas de primer estadio de Triatoma maculata.
Materiales y métodos. Se utilizó el protocolo de evaluación de la actividad insecticida en
triatominos (técnica de aplicación tópica) para las especies en estudio.
Resultados. Los valores de DL50 en ninfas de primer estadio de T. maculata expresados en
nanogramos/insecto (ng/i) fueron de: 0,07, 0,05 y 4,12. Las DL99 fueron de: 1,08, 0,37 y 17,89
para deltametrina, β- cipermetrina y fenitrotión respectivamente. En T. dimidiata los valores de
DL 50 fueron de: 0,44, 0,46 y 16,45. Las DL99 obtenidas fueron de: 2,22, 1,97 y 36,07 ng/i para
deltametrina, β- cipermetrina y fenitrotión respectivamente. En ninfas de quinto estadio de T.
dimidiata las DL50 fueron de: 510,72, 1623,59 y 838,91. Las DL99 fueron de: 9607,50, 11717,91
y 1525 para deltametrina, β- cipermetrina y fenitrotión respectivamente.
Conclusión. En ninfas de primer estadio de T. dimidiata y T. maculata los insecticidas piretroides
fueron mas efectivos; en ninfas de quinto estadio de T. dimidiata la efectividad de los piretroides
y del organofosforado fue diferente con las DL50; las ninfas de este estadio requirieron dosis
altas comparadas con las utilizadas para otros triatominos, lo cual sugiere una baja
susceptibilidad. La DL99 para el organofosforado fue significativamente menor, lo que podría
indicar una mayor efectividad en campo. Es importante realizar estudios de efectos sinergistas
para mostrar el posible rol de mecanismos bioquímicos que determine su tolerancia a los
piretroides, esto representa un nuevo reto para las campañas de control en los países andinos
y centroamericanos donde esta especie es endémica.
Palabras clave: Triatominae, Triatoma, enfermedad de Chagas, insecticidas organofosforados,
piretroides.
Toxic effect of β -cipermethrin, deltamethrin and fenitrothion in colonies of Triatoma
dimidiata (Latreille, 1811) and Triatoma maculata (Erichson, 1848) (Hemiptera, Reduviidae)
Introduction. The susceptibility to insecticides of triatomine species must be evaluated because
of their involvement in the transmission of the Chagas disease. In each region with Chagas
endemicity, evaluation of insecticide response is necessary to predict the success of the control
campaigns.
Objective. The baseline susceptibility was determined for the active principles deltamethrin,
β-cypermethrin and fenitrothion in nymphs of first and fifth instar of Triatoma dimidiata and
nymphs of first instar of Triatoma maculata.
Materials and methods. The insecticide activity in triatomines was evaluated by the technique
of topical application.

75
Reyes M., Angulo V.M., Sandoval C.M. Biomédica 2007;27(supl.1):75-82

Results. The values of the LD50 in nymphs of first instar for T. maculata, expressed in nanograms
per insect (ng/i), were 0.07, 0.05 and 4.12 for deltamethrin, β-cypermethrin and fenitrothion
respectively. The corresponding LD99 values were 1.08, 0.37 and 17.89 ng/i. In T. dimidiata,
the LD50 values were 0.44, 0.46 and 16.45 ng/i; the LD99 values were 2.22, 1.97 and 36.07
ng/i. In nymphs of fifth instar T. dimidiata, the LD50 values were 510.7, 1,623.6 and 838.9 ng/i;
the LD99 values were 9,607.5, 11,717.9 and 1,525.0 ng/i, respectively.
Conclusion. In first instar nymphs of T. dimidiata and T. maculata, the pyrethroid insecticides
were more effective; in fifth instar nymphs of T. dimidiata, the effectiveness of the pyrethroids
and the organophosphate differed in the LD50 comparison—the nymphs required much higher
doses compared with the other triatomines and suggested a low susceptibility. The LD99 for
the organophosphate (fenitrothion) was significantly lower and may indicate its greater
effectiveness in field. Studies of synergistic effects amonst insecticides are important to clarify
the role of biochemical mechanisms that determine tolerance to the pyrethroids. Insecticide
tolerance represents a new challenge for control campaigns in the Andean and Central American
countries where Chagas disease is endemic.
Key words: Triatominae, Triatoma, Chagas disease, insecticides, organophosphate, pyrethrins,

La enfermedad de Chagas afecta a una población Las experiencias de control vectorial en América
de 16 a 18 millones de personas, y más de 100 Central, los países Andinos y del Cono Sur han
millones se encuentran en riesgo de infección en demostrado que una de las pocas alternativas
21 países (1). En Latinoamérica las especies prácticas para controlar la enfermedad de Chagas
domiciliadas más importantes implicadas en la es a través del control de los triatominos
transmisión de Trypanosoma cruzi son Triatoma domiciliarios (10,11). En 1996 se creó en Colombia
infestans, en los países del Cono sur, Rhodnius el Programa Nacional de Control Vectorial de la
prolixus, en Centro América y el Norte de Sur enfermedad de Chagas (12); en su marco se han
América, y Triatoma dimidiata, que se extiende a iniciado actividades de aspersión de insecticidas
lo largo de la costa Pacífica desde México hasta piretroides y organofosforados y políticas de
el Ecuador y el norte de Perú (2-4). En Colombia, mejoramiento de vivienda en Boyacá, Casanare,
durante los últimos 20 años, T. dimidiata ha Santander, Norte de Santander y Arauca (12,13).
ocupado hábitats domiciliarios, peridomiciliarios, Dichos departamentos forman parte de las zonas
silvestres y viviendas de buena construcción en catalogadas como de alto y mediano riesgo de
cabeceras municipales. Este fenómeno ha infección, donde el uso de la deltametrina se ha
ocurrido también en algunas ciudades de hecho extensivo como medida de control (14).
Centroamérica (4-8).
Algunos países de Centroamérica han tenido éxito
Triatoma maculata se distribuye en la zona utilizando piretroides en la eliminación de colonias
nororiental de Sur América, colonizando de T. dimidiata intradomiciliarias (15-7). Sin
ambientes domésticos, peridomésticos, silvestres embargo, las zonas infestadas con triatominos
y urbanos del país con altos niveles de infestación de algunos países de Suramérica han mostrado
(2,9) Mojíca MT, Cuervo LA, Ariza K, Chacón E, diferencias en la susceptibilidad y la resistencia
Chacón R, Dib JC, et al. Distribución de Triatoma a insecticidas en poblaciones de T. infestans de
maculata e infestación domiciliaria en Santa Brasil y Argentina, así como en una población de
Marta, Colombia. Biomédica 2003;23:96). R. prolixus en Carabobo, Venezuela (18-21). En
Correspondencia:
Colombia, estudios recientes muestran altos
Marlene Reyes Jerez, Laboratorio de Entomología, niveles de infestación postratamiento; una de las
Centro de Investigaciones en Enfermedades Tropicales de causas sugeridas por los investigadores es la
la Universidad Industrial de Santander, Km 2 vía El Refugio, presencia de poblaciones de esta especie con
Piedecuesta, Santander, Colombia.
Tel: 6563971, fax: 6540177.
menor susceptibilidad al piretroide usado (5).
marejez1@hotmail.com Teniendo en cuenta que en la actual situación
Recibido: 22/08/05; aceptado: 02/06/06 colombiana una de las estrategias que hacen parte

76
Biomédica 2007;27(supl.1):75-82 Efecto tóxico de insecticidas en T. dimidiata y T. maculata

del control integrado de los triatominos es el uso y T. maculata; las ninfas I tenían entre 24 y 36
de sustancias químicas insecticidas, se hace horas (24), con un peso entre 1,4±2,1mg y
necesario evaluar el efecto triatomicida en el 0,6±1,1mg, respectivamente, y las ninfas de
laboratorio con el fin de monitorizar la quinto estadio de T. dimidiata tenían 10 a 12 días
susceptibilidad y la resistencia de las poblaciones de edad, no recibieron alimento y su peso era de
blanco a los insecticidas en uso. 97± 30 mg (datos no publicados, CINTROP-UIS).
En el país son pocos los estudios sobre este tema Insecticidas
que se reportan en la literatura, y todos han estado
Los insecticidas (grado técnico) utilizados en este
dirigidos a evaluar la susceptibilidad y resistencia
estudio fueron deltametrina al 99,1% (Agrevo S.A,
en R. prolixus (22,23).
Argentina), β-cipermetrina al 99,4% (Chemotecnica
Si el conocimiento de T. dimidiata en este aspecto Sintyal, Argentina), y fenitrotión al 98,5% (Lab
es escaso, también lo es en cuanto a la determi- Dr.Ehrenstorfer-Schafers,Germany). Las
nación de factores que influyen en la respuesta a diluciones seriales de insecticidas se prepararon
los insecticidas como por ejemplo el estado en acetona (JT Baker, México).
nutricional; las observaciones sobre la actividad
Ensayos biológicos
insecticida con β-cipermetrina aplicada por vía
tópica en ninfas de V estadio muestran diferencias Evaluación del efecto insecticida. Las ninfas de
que indican una muy baja absorción insecticida primer estadio de T. dimidiata y T. maculata y las
asociada con mecanismos de detoxificación de quinto estadio de T. dimidiata se trataron con
(datos no publicados, CINTROP-UIS). aplicación tópica de principios activos (fenitrotión,
β-cipermetrina y deltametrina) diluidos y aplicados
En este estudio se propuso establecer la línea de
con microjeringas Hamilton de 5 y 25 µl provistas
base de susceptibilidad en T. dimidiata y T. de descargador repetitivo. En la región dorsal del
maculata con dos piretroides y un organofosforado abdomen de cada ninfa en estadios I y V se
como inicio de los estudios de monitorización de aplicaron 0,1 y 0,5 µl de la solución, respectiva
la susceptibilidad y la resistencia a insecticidas mente. En los ensayos biológicos se seleccionaron
en poblaciones de campo, ante todo para orientar cuatro niveles de dosis que registraron entre 10 y
las políticas de control en el país y, además, para 90% de mortalidad; se utilizaron 10 ninfas por
contribuir a la extensión de los protocolos de dosis con mínimo tres réplicas en diferentes días;
evaluación de la actividad insecticida de los como grupo control se utilizaron 10 insectos en
triatominos en Latinoamérica. cada réplica con igual volumen de acetona.
Materiales y métodos Después del tratamiento, los insectos se colocaron
en frascos plásticos y se mantuvieron en una
Material biológico incubadora bajo condiciones ambientales
Se utilizaron cepas de T. dimidiata y T. maculata constantes a 25 ± 2°C, 70 a 80% de HR. La lectura
provenientes de San Joaquín y San José de de mortalidad para el insecticida organofosforado
Miranda, municipios del departamento de fenitrotión se realizó a las 48 horas y para los
Santander, áreas éstas sin tratamiento piretroides β-cipermetrina y deltametrina a las 72
sistemático de control estatal en el momento de horas de aplicación del tratamiento.
la recolección. La cría de las cepas se inició en Criterio de muerte. Se consideró muerto el insecto
1998, manteniéndolas sin aporte de material que colocado sobre un papel de filtro no tuviera
externo en condiciones ambientales constantes
actividad locomotora propia, ya fuera en forma
de laboratorio a 25 ± 2°C, 70 a 80% de HR y
espontánea o al ser estimulado con un pincel o
fotoperíodo de 12:12, y alimentándolas cada 15
una pinza según lo establecido por el protocolo
días con sangre de gallina.
de evaluación de la actividad insecticida en
En los ensayos biológicos con insecticidas se triatominos de la Organización Mundial de la
utilizaron ninfas de primer estadio de T. dimidiata Salud (24).

77
Reyes M., Angulo V.M., Sandoval C.M. Biomédica 2007;27(supl.1):75-82

Análisis de datos respuesta de la cepa fue heterogénea para deltame-


trina (3,3) y β-cipermetrina (3,6), a diferencia de
Los valores obtenidos de la dosis-respuesta en los
la respuesta homogénea (6,8) del fenitrotión (p <
ensayos biológicos fueron sometidos al análisis
0,05) que sí presentó diferencias estadísticas.
EPA PROBIT versión 1.5 de 1999 para determinar
los valores estadísticos DL50 y DL 99. Se aplicó Los valores obtenidos de DL50 en ninfas de primer
una prueba de ji2 según el caso para comparar los estadio de T. maculata (cuadro 1) muestran un
niveles de significación. El potencial insecticida efecto tóxico similar de la β-cipermetrina y la
de la β-cipermetrina y el fenitrotión se calculó deltametrina (p = 0,34), sin presentar diferencias
tomando como referencia la deltametrina: DL50 significativas. Los valores de DL50 y DL99
de deltametrina/DL50 de β-cipermetrina o fenitrotión obtenidos en ambos piretroides indican (p < 0,05)
x 100. Se utilizó la deltametrina como referencia que son significativamente menores (mayor
por su comprobado efecto triatomicida (25) toxicidad) que los determinados en fenitrotión.
Resultados Los valores de las pendientes en ninfas de primer
Mediante un análisis estadístico de los valores estadio de T. maculata para deltametrina (1,9) y
de DL50 por aplicación tópica de ambos piretroides β-cipermetrina (2,7) sugieren que la respuesta es
en ninfas de primer estadio de T. dimidiata, en el heterogénea para los insecticidas piretroides
cuadro 1 se indica que los parámetros DL50 de la comparados con el fenitrotión (3,6) (p < 0,05),
deltametrina y la β-cipermetrina son similares (p presentando diferencias significativas.
= 0,82) y no presentan diferencias estadísticas. Los valores DL 50 y DL 99 por aplicación tópica
Se evidenció una mayor toxicidad de la en ninfas de quinto estadio de T. dimidiata de los
deltametrina (p < 0,05) y la β-cipermetrina (p < tres insecticidas se muestran en el cuadro 1. Es
0,05) con diferencias significativas respecto al sorprendente la baja toxicidad de los insecticidas
fenitrotión. En este estadio, la DL99 también estudiados en ninfas V de esta especie. En este
mostró una mayor toxicidad de los piretroides contexto de marcada tolerancia, y tomando como
deltametrina y β-cipermetrina (p < 0,05), con parámetro la DL50, se observa que la deltametrina
diferencias significativas respecto al y el fenitrotión son más activos que la β-cipermetrina
organofosforado fenitrotión. (p < 0,05) con diferencias significativas. Con el
Los valores de las pendientes de los insecticidas parámetro estadístico DL99 encontramos mayor
deltametrina, β-cipermetrina y fenitrotión en ninfas efectividad del fenitrotión frente a los piretroides
de primer estadio de T. dimidiata indican que la (p < 0,05), siendo la diferencia significativa.

Cuadro 1. Nivel de susceptibilidad en ninfas de estadios I y V sin alimentar de Triatoma dimidiata y Triatoma maculata, cepa
referencial susceptible a la aplicación tópica de los principios activos deltametrina, β-cipermetrina y fenitrotión.

Especie Estadio Insecticida DL50 ng/i IC 95% DL99ng/i IC95% b±DE n

Triatoma dimidiata I deltametrina 0,44 0,38-0,51 2,22 1,69-3,75 3,3±0,4 240


I β-cipermetrina 0,46 0,39-0,52 1,97 1,42-3,44 3,6±0,8 250
I fenitrotión 16,45 15,22-17,64 36,07 31,24-44,86 6,8±0,5 200
V deltametrina 510,72 279,49-706,23 9607,50 3819,48-170498 1,8±0,4 180
V β-cipermetrina 1623,59 1322,36-1894,34 11717,91 6767,58-42048,42 2,7±0,5 200
V fenitrotión 838,91 791,36-887,51 1525 1277,69-2302,04 8,9±1,8 220
Triatoma maculata I deltametrina 0,07 0,05-0,09 1,08 0,46-7,67 1,9±0,5 102
I β-cipermetrina 0,05 0,05-0,07 0,37 0,21-1,45 2,7±0,4 151
I fenitrotión 4,12 3,56-4,78 17,89 11,89-41,64 3,6±0,7 150

DL50 = dosis que ocasiona el 50% de mortalidad de los insectos expuestos, expresada en nanogramos por insecto;
DL99 = dosis que ocasiona el 99% de la mortalidad de los insectos expuestos, expresada en nanogramos por insecto.
b = pendiente de la recta; DE = desviación estándar; n = número total de insectos.

78
Biomédica 2007;27(supl.1):75-82 Efecto tóxico de insecticidas en T. dimidiata y T. maculata

En ninfas de quinto estadio de T. dimidiata, los las diferencias de efectividad entre los insecticidas
valores de las pendientes encontrados (cuadro 1) piretroides y el organofosforado en estudio, lo que
muestran que la respuesta de la población fue se asemeja a lo reportado en ninfas I de T.
heterogénea para la deltametrina (1,8) y para la β- infestans susceptibles (deltametrina 0,13 ng/i; β-
cipermetrina (2,7). En cambio se observó una cipermetrina 0,24 ng/i, y fenitrotión 21,6 ng/i) (20),
respuesta homogénea (8,9) para el fenitrotión con y concuerda con la reconocida acción triatomicida
diferencias significativas (p < 0,05) respecto a los de los piretroides (25). Todos los insecticidas
piretroides. mostraron mayor toxicidad en ninfas de primer
estadio que en ninfas de quinto estadio; estas
La efectividad insecticida, medida por el potencial
diferencias de toxicidad pueden ser atribuidas a
insecticida, se muestra en el cuadro 2. En ninfas
diferencias en los procesos de toxicocinética en
de primer estadio de T. dimidiata, la toxicidad
cada uno de los estadios (26). Considerando las
intrínseca de la deltametrina fue similar a la de la
dos especies y todos los insecticidas estudiados
β-cipermetrina, pues sólo fue 1,02 veces más
en ninfas de primer estadio, T. maculata es más
efectiva, pero respecto al fenitrotión mostró una
susceptible que T. dimidiata en cuanto a los
efectividad 37,1 veces mayor. En ninfas de quinto
parámetros de toxicidad expresados en peso de
estadio, y en el marco de la acentuada tolerancia
ingrediente activo por insecticida con relación al
observada a los insecticidas estudiados, la
peso del insecto vivo; esta condición fue
toxicidad intrínseca de la deltametrina sólo fue
observada por Oliveira Filho para R. prolixus al
3,2 veces mayor que la de la β-cipermetrina y
compararlo con T. infestans y Panstrongylus
1,6 veces mayor que la del fenitrotión. En ninfas
megistus (21).
I de T. maculata, la β-cipermetrina presentó 1,2
veces más potencial insecticida que la Los resultados obtenidos en ninfas de quinto
deltametrina; la deltametrina fue 63 veces más estadio de T. dimidiata mostraron su sorprendente
efectiva que el fenitrotión. tolerancia a los insecticidas estudiados,
particularmente a la deltametrina, aunque si bien
Discusión
éste fue el insecticida más efectivo, las dosis
El análisis de los valores de DL50 obtenidos para necesarias para causar volteo al 50% de los
cada insecticida en ninfas de primer estadio de insectos tratados fueron altas en comparación con
T. dimidiata y T. maculata muestra claramente las requeridas en otras especies (27). En este

Cuadro 2. Potencial insecticida por aplicación tópica de la β-cipermetrina y fenitrotión versus deltametrina en ninfas I de
Triatoma dimidiata y Triatoma maculata y ninfa V de Triatoma dimidiata.

Especie Insecticida Estadio Potencial insecticida

Triatoma dimidiata deltametrina I 100


β-cipermetrina I 98,31
fenitrotión I 2,69
deltametrina V 100
fenitrotión V 60,87
β-cipermetrina V 31,45
Triatoma maculata deltametrina I 100
β-cipermetrina I 122
fenitrotión I 1,57

DL50 o CL 50 deltametrina
Potencial insecticida= X100
DL50 o CL50 β-cipermetrina o fenitrotión
DL: dosis letal
CL: concentración letal

79
Reyes M., Angulo V.M., Sandoval C.M. Biomédica 2007;27(supl.1):75-82

estudio se reportó una DL50 de 510 ng/i para esta dimidiata y T. maculata la intoxicación producida
especie; con T. infestans se presentó una DL50 por piretroides se manifiesta por incoordinación,
de 215 ng/i (25). Es posible plantearse la pregunta parálisis del tercer par de patas y convulsiones.
sobre qué mecanismos enzimáticos con rol clave
Al analizar los resultados obtenidos a través del
en la detoxificación de insecticidas, particular-
cálculo del potencial insecticida en ninfas de
mente de los piretroides, podrían tener una
primer estadio de T. dimidiata y T. maculata, se
actividad marcada en ninfas V de T. dimidiata
observa nuevamente una mayor efectividad
como para conferirles tolerancia frente a la acción
insecticida de los piretroides frente al organo-
triatomicida.
fosforado. En las ninfas de quinto estadio de T.
Al comparar los valores estadísticos DL50 1623,59 dimidiata, la toxicidad intrínseca de la deltametrina
ng/i en ninfas V de T. dimidiata sin alimentar con fue mayor comparada con la β-cipermetrina. Con
los DL50 432,57 ng/i en ninfas V alimentadas se las DL50 se observaron diferencias entre los
observa una menor respuesta tóxica a la β- piretroides y el fenitrotión; sin embargo, con la
cipermetrina en las ninfas de V estadio sin DL99 se encontró una mayor efectividad del
alimentar que en las alimentadas, lo cual evidencia organofosforado. Si bien este resultado hace
mayor susceptibilidad de las ninfas V alimentadas pensar en una mayor efectividad del fosforado en
y sugiere una baja absorción de este insecticida condiciones de campo, es necesario plantear que
en ninfas sin alimentar. Este hallazgo es similar la tolerancia de las ninfas V de T. dimidiata a
a lo reportado en ninfas de segundo estadio de T. piretroides y fenitrotión representa un problema
infestans, en las cuales se encontró un importante para las campañas de control de vectores de la
incremento en la penetración y mortalidad con DDT enfermedad de Chagas en los países andinos y
en insectos tratados después de la alimentación centroamericanos.
(28); estas diferencias de penetración en ninfas
Recientemente, en Colombia se han reportado
sin alimentar sugieren baja absorción del
altas prevalencias de infestación intradomiciliarias
insecticida, lo que asociado a los caminos
y peridomiciliarias desde los primeros meses
metabólicos de desintoxicación ya establecidos,
postratamiento por parte de adultos y ninfas de
podrían explicar la muy baja actividad del
cuarto y quinto estadio de T. dimidiata, con un
insecticida.
aumento creciente del número de triatominos
Una población de insectos susceptible a capturados por mes de vigilancia en zonas
insecticidas presenta valores elevados de rociadas con deltametrina (5) (Turriago BC,
pendiente (población homogénea), que van Pinto N, Guhl F. Evaluación de deltametrina K-
disminuyendo cuando la respuesta se hace más Othrine SC50 y K-Othrine WP 50 como alternativa
heterogénea (29). Esta homogeneidad de de control de Triatoma dimidiata. Biomédica
respuesta de una población susceptible concuerda 2005;25:195).
con los resultados obtenidos para el fenitrotión
Nuevos estudios con sinergistas podrían
en ninfas de primer y quinto estadio de T.
demostrar algún mecanismo que justifique esta
dimidiata y ninfas de primer estadio de T.
tolerancia, lo cual ayudaría a mejorar las
maculata. Sin embargo, no concuerda con la
formulaciones de los insecticidas que se destinan
respuesta heterogénea detectada para los
al control de T. dimidiata.
insecticidas β-cipermetrina y deltametrina en las
dos especies. Probablemente esta heterogeneidad Este estudio contribuye a la extensión del
de respuesta en las especies estudiadas podría protocolo, evaluación de la actividad insecticida
atribuirse al particular modo de acción de los de los triatominos en Latinoamérica y permite el
piretroides en triatominos, en los que el efecto desarrollo de estudios en la siguiente etapa, es
letal no tiene una muy clara manifestación y puede decir, comparar la línea de base de susceptibilidad
superponerse con un volteo prolongado, tal como con poblaciones de campo que hayan sido
se ha encontrado en R. prolixus (28). En T. sometidas a control con los insecticidas probados.

80
Biomédica 2007;27(supl.1):75-82 Efecto tóxico de insecticidas en T. dimidiata y T. maculata

Todo esto en el marco de un seguimiento 9. Corredor A, Santacruz M, Paez S, Guatame LA.


Distribución de los triatominos domiciliados en Colombia.
entomológico de las acciones de control químico
Bogotá: Ministerio de Salud-Instituto Nacional de Salud;
en el país. 1990 p.144.
Agradecimientos 10. Zerba EN. Susceptibility and resistance to insecticides
of Chagas disease vectors. Medicina (B Aires)
A Eduardo Zerba y al CIPEIN por su asesoría y 1999;59:41-6.
revisión de este manuscrito.
11. Dias J, Schofield CJ. The evolution of Chagas disease
Conflicto de interés (American trypanosomiasis) control after 90 years
since Carlos Chagas discovery. Mem Inst Oswaldo
No hay conflicto de intereses. Cruz 1999;94(Suppl. 1):103-21.

Financiación 12. Guhl F, Vallejo GA. Interruption of Chagas disease


transmission in the Andean countries: Colombia. Mem
Este estudio fue financiado por UNDP/ World Inst Oswaldo Cruz 1999;94(Suppl. 1):413-5.
Bank/ WHO Special Programme for Research & 13. Angulo VM, Sandoval CM. Triatominos y Programa
Training in Tropical Diseases (TDR), proyecto ID: Nacional de Control en Colombia. Monitoreo de la
990163. resistencia a insecticidas en triatominos en América
Latina, Buenos Aires: Fundación Mundo Sano, Red
Referencias Latinoamericana de Control de Triatominos RELCOT;
2001. p.21-6.
1. World Health Organization. Infectious diseases
home. Specific information: disease. 2004. [Consultado: 14. Sánchez JF. Informe comportamiento del programa de
abril 27 de 2005]. Disponible en: http://www.who.int/ Chagas, Cundinamarca años 2002-2005. Secretaría
ctd/chagas/burdens.htm. de Salud de Cundinamarca. En: Guhl F, editor. Primer
Taller Internacional Sobre Control de la Enfermedad de
2. Dujardin JP,Schofield CJ, Panzera F. Les vecteurs Chagas. Curso de Diagnóstico, Manejo y Tratamiento
de la maladie de Chagas. Recherches taxonomiques, de la Enfermedad de Chagas. VI Reunión de la Iniciativa
biologiques et génétiques. Bruxelles: Academie Royale Andina para el control de la Enfermedad de Chagas.
des Sciences d’Outre Mer; 2000. p.162. Bogotá D.C: Ediciones Uniandes; 2005. p.135-40.
3. Aguilar M H, Abad Franch F, Racines VJ, Paucar 15. Nakagagua J, Cordón-Rosales C, Juárez J, Itzep C,
CA. Epidemiology of Chagas disease in Ecuador. A Nonami T. Impact of residual spraying on Rhodnius
brief review. Mem Inst Oswaldo Cruz 1999;94 prolixus and Triatoma dimidiata in the department of
(Suppl. 1):387-93. Zacapa in Guatemala. Mem Inst Oswaldo Cruz
4. Schofield CJ. Challenges of Chagas disease vector 2003;98:277-81.
control in Central America. Geneva: WHO;2000. p.36. 16. Ceceré MC, Gurtler RE, Canale DM, Chuit R, Cohen
5. Angulo VM. Ensayo de estrategias de control y JE. Effects of partial housing improvement and
vigilancia de Triatoma dimidiata en Colombia. En: Guhl insecticide spraying on the reinfestation dynamics of
F, editor. Primer Taller Internacional Sobre Control de Triatoma infestans in rural northwestern Argentina. Acta
la Enfermedad de Chagas; Curso de Diagnóstico, Trop 2002;84:101-16.
Manejo y Tratamiento de la Enfermedad de Chagas. VI 17. Tabarú Y, Monroy C, Rodas A, Mejia M, Rosales R.
Reunión de la Iniciativa Andina para el control de la Chemical control of Triatoma dimidiata and Rhodnius
Enfermedad de Chagas. Bogotá D.C.: Ediciones prolixus (Reduviidae:Triatominae), the principal vectors
Uniandes; 2005. p.91-102. of Chagas disease in Guatemala. Med Entomol Zool
6. Guhl F, Angulo VM, Restrepo M, Nicholls S, Montoya 1998;49:87-92.
R. Estado del arte de la enfermedad de Chagas en 18. Vassena CV, Piccollo MI, Zerba EN. Insecticide
Colombia y estrategias de control. Biomédica resistance in Brazilian Triatoma infestans and
2003;23:31-4. Venezuelan Rhodnius prolixus . Med Vet Entomol
7. Molina JA, Gualdrón LE, Brochero HL, Olano VA, 2000;14:51-5.
Barrios D, Guhl F. Distribución actual e importancia 19. Vassena CV, Piccollo MI. Monitoreo de resistencia a
epidemiológica de las especies de triatominos insecticidas en poblaciones de campo en Triatoma
(Reduviidae:Triatominae) en Colombia. Biomédica infestans y Rhodnius prolixus, insectos vectores de la
2000;20:344-60. enfermedad de Chagas. Boletín Electrónico Mensual
8. Zeledón R, Montenegro VM, Zeledón O. Evidence del Servicio de Toxicología del Sanatorio de Niños de
of colonization of man-made ecotopes by Triatoma Rosario 2003:13. [Consultado: abril 5 de 2004].
dimidiata (Latreille,1811) in Costa Rica. Mem Inst Disponible en: http://www.sertox.com.ar/retel/n03/
Oswaldo Cruz 2001;96:659-60. 004.htm.

81
Reyes M., Angulo V.M., Sandoval C.M. Biomédica 2007;27(supl.1):75-82

20. Piccollo MI, Vassena C, Santo Orihuela P, Barrios 24. WHO. Protocolo de evaluación de efecto insecticida
S, Zaidemberg M, Zerba E. High resistance to sobre triatominos. Acta Toxicol Arg 1994;2:29-32.
pyrethroid insecticides associated with ineffective field
25. Zerba EN. Evolución del control químico de los insectos
treatments in Triatoma infestans (Hemiptera:
vectores de la enfermedad de Chagas. Anales de la
Reduviidae) from Northern Argentina. J Med Entomol
Sociedad Científica Argentina 1997;227:35-9.
2005; 42:637-42.
26. Alzogaray RA, Zerba EN. Third instar nymphs of
21. Oliveira Filho AM. Differences of susceptibility of five
Rhodnius prolixus exposed to α-cyanopyrethroids: from
Triatomine species to pyrethroid insecticides -implica-
hyperactivity to death. Arch Insect Biochem Physiol
tions for Chagas disease vector control. Mem Inst
2001;46:119-26.
Oswaldo Cruz 1999;94(Suppl. 1):425-8.
27. Kostaropoulos I, Papadopoulos AI, Metaxakis A,
22. Fox I, Bayona IG. Toxicity of DDT, dieldrin, mlathion
Boukouvala E, Papadopoulou-Mourkidou E.
and fenthion to Rhodnius prolixus in the laboratory.
Glutathione S-transferase in the defence against
Bull World Health Organ 1966;35:974-6.
pyrethroids in insects. Insect Biochem Mol Biol
23. Sandoval CM. Actividad insecticida del malatión y la 2001;31:313-9.
deltametrina en una cepa colombiana de Rhodnius
28. Fontán A, Zerba EN. Influence of the nutritional state
prolixus (Hemiptera:Rudiviidae). Monitoreo de la
of Triatoma infestans over the insecticidal activity of
resistencia a insecticidas en triatominos en América
DDT. Comp Biochem Physiol C 1992;101:589-91.
Latina. Buenos Aires: Fundación Mundo Sano, Red
Latinoamericana de Control de Triatominos RELCOT; 29. Georghiou G. Insecticide resistance and prospects
2001. p.27-33. for its management. Residue Rev 1980;76:131-45.

82
Biomédica 2007;27(supl. 1):83-91 PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

ARTÍCULO ORIGINAL

Comparación de una prueba de PCR basada en los genes


codificantes para la histona H2A/SIRE con pruebas serológicas
convencionales para el diagnóstico de la enfermedad de
Chagas crónica en pacientes colombianos
Juliana Gil 1, Paula Pavía 1, Marleny Montilla 2, Astrid C. Florez 2, Claudia Quintero 3,
Marcela Mercado 1, Miguel Vacca 4, Santiago Nicholls 2, Concepción Puerta 1
1
Laboratorio de Parasitología Molecular, Departamento de Microbiología, Facultad de Ciencias, Pontificia
Universidad Javeriana, Bogotá D.C., Colombia.
2
Laboratorio de Parasitología, Instituto Nacional de Salud, Bogotá D.C., Colombia.
3
Unidad de Epidemiología, Departamento de Microbiología, Pontificia Universidad Javeriana, Bogotá D.C.,
Colombia.
4
Unidad de Cardiología, Hospital Universitario San Ignacio, Pontificia Universidad Javeriana, Bogotá D.C.,
Colombia.
Introducción. El diagnóstico de la enfermedad de Chagas en sus fases latente y crónica se
dificulta por la baja parasitemia, razón por la cual se recurre a métodos serológicos y
moleculares.
Objetivo. Comparar la prueba de reacción en cadena de la polimerasa basada en la
amplificación del elemento SIRE insertado en el gen que codifica para la histona H2A con las
pruebas serológicas convencionales para el diagnóstico de la enfermedad de Chagas en
pacientes colombianos.
Materiales y métodos. Se realizó un estudio de concordancia comparando la PCR TcH2AF/
R con las pruebas de inmunoensayo enzimático e inmunofluorescencia indirecta,
determinándose además la sensibilidad y especificidad de la prueba. Se clasificaron y
examinaron 156 individuos según los hallazgos clínicos y epidemiológicos y los resultados de
las pruebas serológicas. Adicionalmente, 97 de las 156 muestras fueron comparadas con la
PCR S35/S36.
Resultados. De 156 muestras, 89 (57%) fueron positivas por IFI y ELISA, y 84 (53,8%)
presentaron el perfil de amplificación correspondiente a la banda esperada de 234 pb,
obteniéndose una sensibilidad de 88% (I.C. 95%: 75% - 95%) y especificidad de 92,5% (I.C.
95%: 87,7% - 97,2%). El índice kappa, indicador de concordancia entre las pruebas serológicas
y TcH2AF/R fue de 0,8 (I.C. 95%: 73% - 86%), en tanto entre las PCR TcH2AF/R y S35/S36 fue
de 0,9 (I.C. 95%: 84% - 96%), interpretados como una concordancia buena y casi perfecta,
respectivamente.
Conclusiones. La PCR TcH2AF/R es una prueba diagnóstica promisoria complementaria a
las pruebas serológicas, para la detección de Trypanosoma cruzi.
Palabras clave: reacción en cadena de la polimerasa, histonas, miocardiopatía chagásica,
Trypanosoma cruzi.
Comparison of a PCR test based on the histone H2A/SIRE genes with classical serological
tests for the diagnosis of chronic Chagas disease in Colombian patients
Introduction. Diagnosis of Chagas disease in its latent and chronic phase is difficult because
of the low parasitemia levels. Therefore, serological and molecular techniques are necessary
to achieve an appropriate diagnosis.
Objective. The polymerase chain reaction based on the amplification of the SIRE element
inserted into H2A encoding genes was compared with classical serological tests for the diagnosis
of Chagas disease in Colombian patients.

83
Gil J., Pavía P., Montilla M. et al Biomédica 2007;27(supl. 1):83-91

Materials and methods. An agreement study was carried out by comparing the PCR with
ELISA (enzyme linked immuno sorbent assay) and IFAT (indirect immunofluorescence) tests.
In addition, the PCR sensitivity and specificity were determined. A sample of 156 individuals
was tested with the H2A PCR primers after a Chagas disease classification based on clinical,
epidemiological and serological data associated with each patient. In addition, 97 out of 156
samples were also compared with the S35/S36 PCR primers.
Results. Eighty-nine of 156 samples (57%) were positive by both IFAT and ELISA and 84
(53.8%) presented the expected 234 bp amplification fragment. The sensitivity of the TcH2AF/
R PCR was 88% (95% C.I.: 75%--95%) and its specificity 92.5% (95% C.I.: 87.7%--97.2%). The
kappa index for concordance between serological tests and TcH2AF/R PCR was 0.8 (95% C.I.:
73%--86%), and between the TcH2AF/R and S35/S36 PCR primers was 0.9 (95% C.I.: 84%--
96%). These indices indicated a “good” and “almost perfect” agreement, respectively.
Conclusions. The TcH2AF/R PCR is a promising diagnostic tool for the detection of T. cruzi and
is suggested as a tool complementary to the classical serological tests.
Key words: polymerase chain reaction, histones, Chagas myocardiopathy, Trypanosoma cruzi

Trypanosoma cruzi es un parásito protozoo ciclo de transmisión (7, Dib J, Restrepo M, Parra
hemoflagelado, agente causal de la enfermedad G, Tibayrenc M, Barnabe C, Triana O. Definición
de Chagas, entidad que afecta a 18 millones de de dos poblaciones de Trypanosoma cruzi I en el
personas en 15 países endémicos, con una norte de Colombia mediante análisis de RAPD y
incidencia anual de 200.000 nuevos casos (1). el gen de la proteína flagelar. Memorias XII
En Colombia se estima que hay cerca de 700.000 Congreso Colombiano de Parasitología y Medicina
personas infectadas con un 23% de la población Tropical. Biomédica 2005;25:207-8.). Por otra
en riesgo de contraer la enfermedad y entre 30 y parte, T. cruzi presenta morfología similar y
40 mil nuevos casos anuales (2). reacción inmunológica cruzada con Trypanosoma
rangeli, parásito con el cual también comparte
T. cruzi se distribuye ampliamente en Sur América,
zonas endémicas, vectores y reservorios (14,15).
presentando un amplio rango de vectores,
Debido a lo anterior, se hace necesario el
hospederos y reservorios, así como un amplio
desarrollo de pruebas específicas que disminuyan
pleomorfismo genético y biológico (3-6). En
o eliminen el riesgo de falsos negativos por
Colombia se ha visto que aun cuando la mayoría
variabilidad intra-cepa y falsos positivos por la
de las cepas del parásito pertenecen al grupo T.
presencia de T. rangeli.
cruzi I o zimodema Z1 (7-13, Dib J, Restrepo M,
Parra G, Tibayrenc M, Barnabe C, Triana O. Algunos estudios han demostrado la utilidad y el
Definición de dos poblaciones de Trypanosoma alto potencial de la prueba de reacción en cadena
cruzi I en el norte de Colombia mediante análisis de la polimerasa (PCR) para el diagnóstico de la
de RAPD y el gen de la proteína flagelar. enfermedad de Chagas, tanto en su etapa aguda
Memorias XII Congreso Colombiano de como en la crónica (16,17). Una de las pruebas
Parasitología y Medicina Tropical. Biomédica más usadas es la PCR basada en los iniciadores
2005;25:207-8.), éstas varían en sus caracterís- S35/S36, los cuales amplifican los minicírculos
ticas genéticas dependiendo especialmente de su del ADN del cinetoplasto (kADN) del parásito (18).
Sin embargo, estos iniciadores también amplifican
Correspondencia: el kADN de T. rangeli, presentándose perfiles que
Concepción Puerta, Laboratorio de Parasitología Molecular, sólo pueden ser distinguidos en geles de
Departamento de Microbiología, Facultad de Ciencias, poliacrilamida y que, en caso de infecciones
Pontificia Universidad Javeriana, Bogotá
D.C., Colombia.
mixtas por ambos tripanosomas, pueden
Teléfono:(+571) 3208320 ext. 4024, fax (571) 3208320 ext. enmascarar la presencia de T. rangeli haciéndolo
4021 pasar por T. cruzi (19). Además, recientemente
cpuerta@javeriana.edu.co se ha visto que el kADN es capaz de integrarse
Recibido: 15/02/06; aceptado: 09/06/06 al ADN de la célula hospedera, de manera que

84
Biomédica 2007;27(supl. 1):83-91 PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

existe la posibilidad de amplificación de las Universitario San Ignacio de la Pontificia


bandas esperadas en ausencia de infección (20). Universidad Javeriana y del Instituto Nacional de
Por estas razones se requiere explorar el uso de Salud.
otras pruebas para la identificación específica de
Extracción de ADN a partir de sangre
T. cruzi.
A partir de una muestra de 5 ml de de sangre
Teniendo en cuenta lo anterior, en este trabajo se
anticoagulada con EDTA se realizó la extracción
propuso la evaluación de la prueba de PCR
de ADN utilizando una alícuota de 0,5 ml mediante
basada en la amplificación del gen que codifica
el estuche comercial “GFX™ Genomic Blood DNA
para la histona H2A en pacientes colombianos
Purification Kit” (Amersham Pharmacia) y el
para la detección de T. cruzi y su comparación
método fenol-cloroformo-alcohol isoamílico según
con los métodos serológicos convencionales de
el protocolo descrito por Vallejo y colaboradores
inmunofluorescencia indirecta (IFI) e inmuno-
(18), realizando el paso de extracción con fenol-
ensayo enzimático (Elisa) (21).
cloroformo-alcohol isoamílico tres veces. El ADN
Materiales y métodos obtenido fue resuspendido en 10 mM de Tris y 1
mM de EDTA, pH 8,0 (TE) estéril.
Pacientes y grupos de estudio
Extracción de ADN del parásito
En este estudio participaron 156 individuos entre
los 18 y 65 años, de quienes se obtuvo Se trabajó con formas epimastigotas de las cepas
consentimiento informado. Dichos individuos de T. cruzi, D.A. (MHOM/CO/01/DA) y Munantá
fueron clasificados de acuerdo con el cuadro (IRHO/CO/98/MTA). El cultivo en masa de los
clínico, las variables epidemiológicas y el resultado parásitos en fase logarítmica se centrifugó a 4.000
de las pruebas serológicas IFI y Elisa (22) en 4 r.p.m. durante una hora. El precipitado obtenido
grupos: grupo control (A), conformado por 55 se lavó tres veces con 1 ml de solución salina
(35,3%) individuos sin riesgo epidemiológico, amortiguada con fosfatos (PBS); se centrifugó
examen físico y electrocardiograma normal y nuevamente a 6.000 r.p.m. durante 10 min a 4°C
resultados de IFI y Elisa negativos; grupo de y se resuspendió en 1 ml de PBS y 100 µl de
pacientes infectados sin cardiopatía (B), NP40 al 10% en agua; se mezcló, centrifugó a
conformado por 16 (10,2%) individuos 10.000 r.p.m. por 5 min y se resuspendió en 2 ml
asintomáticos, con riesgo epidemiológico, examen de PBS y SDS al 10%. El ADN se extrajo según
físico y electrocardiograma normales y pruebas el método de fenol-cloroformo-alcohol isoamílico,
serológicas positivas; grupo de pacientes seguido de precipitación con etanol. Finalmente,
infectados con cardiopatía (C), constituído por 73 se midió la concentración del ADN por
(46,8%) individuos sintomáticos con riesgo espectrofotometría a 260/280 nm y se evaluó en
epidemiológico, examen físico y electrocardio- geles de agarosa al 1% coloreados con bromuro
grama anormales con síntomas cardiovasculares de etidio (23).
clínicamente significativos y pruebas serológicas Pruebas de PCR
positivas, y grupo control de individuos no
infectados con cardiopatía (D), conformado por Para la reacción de PCR TcH2AF/R se utilizaron
los oligonucleótidos TcH2AF (5´- AGT GGC AGA
12 (7,7%) individuos con examen físico y
CTT TGG GGT C -3´) y TcH2AR (5´- GAG AGT
electrocardiograma anormales, con cardiopatía
GAT GGG AGA GC -3´), los cuales anillan en el
dilatada de origen no chagásico y pruebas
elemento SIRE insertado en la región no
serológicas negativas.
codificante de la unidad de 1,2 kb del gen de la
Este estudio corresponde a una investigación con histona H2A de T. cruzi (24). La reacción de PCR
riesgo mínimo, de acuerdo con la resolución No. se llevó a cabo de acuerdo con lo descrito por
08430 del Ministerio de Salud de Colombia, y fue Pavia y colaboradores (21), utilizando el siguiente
aprobado por el Comité de Investigación y Ética programa en un termociclador PTC -100 MJ
de la Facultad de Ciencias y del Hospital Research®: denaturación inicial a 95°C por 5 min,

85
Gil J., Pavía P., Montilla M. et al Biomédica 2007;27(supl. 1):83-91

15 ciclos con el siguiente perfil: denaturación a PCR. Ambos ensayos se realizaron tres veces
95°C por 30 segundos, anillaje y extensión a 72°C para asegurar la reproducibilidad de los resultados.
por 30 segundos cada uno. Luego, se realizaron
Análisis estadístico
30 ciclos con denaturación a 95°C por 30
segundos, anillaje a 65°C por 30 segundos y Los datos fueron consignados en una base de
extensión a 72°C por 30 segundos, seguidos de datos elaborada con el paquete estadístico EPI-
la extensión final a 72°C por 5 min. Como blanco INFO 6.0. El análisis estadístico descriptivo de
de reacción se reemplazó el ADN de la muestra las pruebas diagnósticas se realizó a través del
por agua o por TE; como control negativo se utilizó paquete estadístico Stata 6.0. Se analizaron las
ADN humano y como positivo ADN de la cepa características operativas de la prueba
Munantá (IRHO/CO/98/MTA) del parásito. Los (sensibilidad y especificidad) y se realizó el cálculo
productos de amplificación fueron analizados del índice de concordancia kappa con sus
mediante electroforesis en gel de agarosa al 1,5% respectivos intervalos de confianza (25).
teñido con bromuro de etidio (23). La prueba de Resultados
PCR S35/S36 se realizó de acuerdo a lo descrito
por Vallejo y colaboradores (18). Con el fin de Determinación de la capacidad de detección
eliminar la posibilidad de inhibición de la reacción de la prueba de PCR TcH2AF/R
de PCR en las muestras negativas, éstas fueron Se observó el producto de amplificación esperado
amplificadas nuevamente tras la adición de 50 ng de 234 pb con la PCR TcH2AF/R hasta con una
ADN de la cepa Munantá (IRHO/CO/98/MTA) del forma del parásito en ambas cepas a partir del
parásito. ADN extraído por el método de triple extracción
con fenol-cloroformo-alcohol isoamílico en tres
Determinación del poder de detección de la
réplicas del experimento (figura 1). Igualmente,
PCR
con la PCR S35/S36 se pudo detectar hasta un
Se determinó la cantidad mínima de parásitos a parásito utilizando el método de extracción de
detectar por ambas reacciones de PCR mezclando triple fenol-cloroformo-alcohol isoamílico,
cantidades en base 10 de formas epimastigotas independientemente de la cepa empleada. No
del parásito con sangre humana libre de infección, obstante, con el estuche comercial disminuyó el
seguida de la extracción de ADN y ensayos de poder de detección de ambas pruebas de PCR de

Figura 1. Prueba de PCR basada en los iniciadores TcH2AF/R a partir de epimastigotes de la cepa Munanta de T. cruzi
mezclados con sangre humana libre de infección y extracción de ADN por el método triple fenol: cloroformo: alcohol
isoamílico. Gel de agarosa al 1,5%, teñido con bromuro de etidio: marcador de peso molecular 100 pb (Promega) (1); 10 2
parásitos (2); 102 parásitos diluidos 1/5 (3); 102 parásitos diluidos 1/10 (4); 101 parásitos (5); 101 parásitos diluidos 1/5 (6); 101
parásitos diluidos 1/10 (7); 100 parásitos (8); 100 parásitos diluidos 1/5 (9); 100 parásitos diluidos 1/10 (10); agua milli-Q como
blanco de reacción (11) y ADN de la cepa Munantá de T. cruzi como control positivo (12).

86
Biomédica 2007;27(supl. 1):83-91 PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

1 a 100 parásitos en el caso de la cepa D.A. y de enfermedad de Chagas, utilizando cepas nativas
1 a 10 parásitos en el caso de la PCR S35/S36 colombianas (22). Ambas pruebas serológicas en
usando el ADN de la cepa Munantá como blanco este estudio arrojaron resultados idénticos.
de amplificación.
Del total de 156 muestras, 89 (57%) fueron
Con el fin de corroborar los resultados anteriores, positivas por IFI y Elisa y 84 (53,8%) presentaron
se realizó una prueba piloto con 31 muestras de el perfil de amplificación correspondiente a la
pacientes chagásicos y 26 de individuos sanos, banda esperada de 234 pb, presentándose 79
en la cual se observó que de 57 muestras a las muestras positivas por ambos métodos (figura 2).
cuales se les realizó la prueba de PCR TcH2AF/ Por su parte, de las 67 muestras negativas por
R a partir del ADN extraído con ambos métodos ambas pruebas serológicas, 62 de ellas también
de extracción, 18 (31,5%) fueron positivas para fueron negativas por la prueba de PCR TcH2AF/
ambos métodos, dos (3,5%) fueron positivas R (figura 2).
únicamente para el estuche comercial y 13 (22,8%)
para el de triple extracción con fenol-cloroformo- Se obtuvo una sensibilidad de 88% (IC 95%: 75 -
alcohol isoamílico. Se obtuvo un índice de 95%) y especificidad de 92,5% (IC 95%: 87,7 -
concordancia kappa de 0,49 (IC 95%: 36 - 62%), 97,2%) al comparar la prueba de PCR TcH2AF/R
interpretado como una concordancia moderada con las pruebas serológicas.
entre estos dos métodos de extracción. Con base El índice de concordancia kappa entre la prueba
en estos resultados, se seleccionó el método de de PCR TcH2AF/R y ambas pruebas serológicas
triple extracción con fenol-cloroformo-alcohol fue de 0,8 (IC 95%: 73 - 86%), interpretado como
isoamílico para la extracción del ADN de las una buena concordancia.
muestras a analizar.
El análisis del desempeño de la PCR TcH2AF/R
Comparación de la prueba de PCR TcH2AF/R en cada grupo de estudio fue el siguiente: en el
con las pruebas serológicas y la PCR S35/S36 grupo control de pacientes no infectados (A), de
Se realizó un estudio de concordancia en donde un total de 55 muestras, cuatro (7,3%) fueron
se comparó la PCR TcH2AF/R con las pruebas positivas por PCR y 51 (92,7%) fueron negativas.
serológicas de IFI y Elisa, técnicas utilizadas en En el grupo de pacientes infectados asintomáticos
el Instituto Nacional de Salud como referencia (B), de un total de 16 muestras, 15 (93,7%) fueron
para el diagnóstico y confirmación de la positivas por la PCR TcH2AF/R. En el grupo de

Figura 2. Detección de T. cruzi en sangre total de pacientes colombianos mediante la PCR TcH2AF/R. Gel de agarosa al
1,5%, teñido con bromuro de etidio: marcador de peso molecular de 100 pb (Promega) (1); muestra 085, negativa (2); muestra
085 diluida 1/5 (3); muestra 085 diluida 1/10 (4); muestra 079, positiva (5); muestra 079 diluida 1/5, (6); muestra 079 diluida
1/10 (7); muestra 074, positiva (8); muestra 074 diluida 1/5 (9), muestra 074 diluida 1/10 (10); ADN de la cepa Munantá de T.
cruzi como control positivo (11); ADN humano como control negativo (12) y agua Milli-Q estéril como blanco de reacción (13).

87
Gil J., Pavía P., Montilla M. et al Biomédica 2007;27(supl. 1):83-91

pacientes sintomáticos (C), de un total de 73 pacientes chagásicos indeterminados y crónicos


muestras, 64 (87,6%) fueron positivas por PCR y con miras a su utilización como una prueba de
9 (12,3%) fueron negativas. En el grupo de apoyo en el diagnóstico de esta enfermedad.
individuos control con cardiopatía (D), de un total
El poder de detección de la prueba TcH2AF/R,
de 12 muestras, 11 (91,7%) fueron negativas por
evidenciada por la detección de hasta una forma
la PCR TcH2AF/R y una fue positiva.
parasitaria en los ensayos de infección artificial,
Considerando los individuos seropositivos (grupos se explica por la abundancia de los genes H2A
B y C) o seronegativos (grupos A y D), se tiene (24,27) y por que el elemento SIRE short
que en los primeros la PCR TcH2AF/R detectó interspersed repetitive element, con 2.000 a 3.000
como positivos al 88,7% (79 de 89), en tanto que copias por genoma, se encuentra integrado en el
en los segundos, de 67 muestras, 5 (7,5%) de extremo 3’ no traducido (UTR) de los genes
ellas fueron positivas por la prueba de PCR. codificantes para la histona H2A del parásito y
sus nucleótidos 16 a 248 (no. de acceso al
Por otra parte, de las 156 muestras, 96 de ellas
GenBank, AF098063) corresponden al fragmento
también fueron analizadas mediante la PCR S35/
amplificado con los cebadores TcH2AF/R
S36, encontrando un índice kappa de 0,9 (IC 95%:
(27,28).
84 -96%), interpretado como una concordancia
casi perfecta. Los resultados obtenidos en este trabajo se
apoyan en la especificidad de la prueba TcH2AF/
Discusión
R reportada por Pavía y colaboradores, según la
El diagnóstico de la enfermedad de Chagas cual los iniciadores TcH2AF/R amplifican
depende de la etapa de la enfermedad en la que exclusivamente el ADN de cepas de T. cruzi
se encuentre el paciente y se debe apoyar en la pertenecientes a los grupos I y II hasta ahora
información tanto epidemiológica como clínica descritos del parásito (29), en tanto que no
del paciente, así como en las pruebas de amplifican el ADN de otros tripanosomátidos que
laboratorio. circulan en Colombia, como T. rangeli tanto de
cepas KP 1(+) como KP 1(-), representantes de
Mientras en la etapa aguda de la enfermedad el
los linajes de este parásito (30) ni de Leishmania
diagnóstico no presenta problemas debido a la
spp. y Crithidia spp., entre otros (21).
elevada parasitemia, en las etapas indeterminada
y crónica, el diagnóstico es muy complejo y Es así como la PCR TcH2AF/R fue capaz de
requiere de varias pruebas de laboratorio para su detectar el 88% de los individuos serológicamente
confirmación (1,17,22). Entre las pruebas de positivos, porcentaje similar al 84,8% descrito por
laboratorio disponibles para el diagnóstico en las Gutiérrez y colaboradores en un estudio llevado a
etapas indeterminada y crónica de la enfermedad, cabo en 79 individuos seropositivos en Santander
actualmente se encuentran las pruebas (Colombia) utilizando como blanco el ADN del
serológicas y el diagnóstico molecular directo por cinetoplasto del parásito (31). Resultados
PCR. Mientras las primeras son pruebas indirectas similares de 83,5 y 90% de positividad fueron
que se basan en la detección de anticuerpos contra reportados por Gomes y colaboradores en 79
el parásito y dependen del estado inmunológico pacientes seropositivos y por Britto y
del paciente, de los antígenos, de la fase de colaboradores en 61 en Brasil (32,33). Porcentajes
desarrollo del parásito empleado en la prueba y superiores de positividad por PCR en pacientes
del tiempo transcurrido desde la infección, los crónicos han sido descritos con un número menor
segundos se basan en la detección directa del de pacientes (34) o sometiendo los productos de
ADN del parásito y no dependen del estado amplificación a un paso posterior de hibridación
inmunológico del paciente ni del tiempo de con un cebador interno dentro de la secuencia
adquisición de la infección (16,26). amplificada (35).
En este trabajo se comparó el desempeño de la En este estudio, el 12% de los individuos
prueba de PCR TcH2AF/R para el diagnóstico de seropositivos no fue detectado a pesar de que se

88
Biomédica 2007;27(supl. 1):83-91 PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

descartó la presencia de inhibición de la PCR. material anti-aerosol, blancos de reacción y


Estos resultados pueden deberse a alguna de las controles negativos.
siguientes razones o a una combinación de las
Es de especial interés el buen desempeño presen-
mismas: (i) niveles escasos de parasitemia, de
tado por la prueba de PCR TcH2AF/R en el grupo
forma que en los 500 µl de la muestra no estuviera
de pacientes crónicos asintomáticos, en los cuales
presente ningún parásito (36); (ii) intermitencia en
no se dispone de la ayuda que brinda la sintomato-
la parasitemia (37), o (iii) presencia de falsos
logía para el diagnóstico basado en la tríada pruebas
positivos en las pruebas serológicas posiblemente
de laboratorio, sintomatología y epidemiología. Así
por reacción cruzada con otros tripanosomátidos
mismo, en pacientes cardiópatas con síntomas
como Leishmania y T. rangeli (38).
compatibles con la enfermedad de Chagas, la PCR
En el caso de los cinco pacientes positivos por TcH2AF/R puede constituir una herramienta
PCR y negativos por serología, en primer lugar valiosa para descartar la infección por T. cruzi.
llama la atención cómo estos pacientes fueron
Teniendo en cuenta los resultados de este trabajo
positivos tanto por la prueba TcH2AF/R, que
y las deficiencias de las pruebas serológicas
amplifica blancos nucleares (21), como por la
convencionales en cuanto a la posibilidad de
prueba S35/S36, que amplifica blancos
reacción cruzada con otros tripanosomátidos, lo
mitocondriales (18), lo cual apoya la presencia de
que da lugar a falsos positivos y también a falsos
infección. Se ha reportado que pacientes
negativos en casos de infección reciente o estado
chagásicos pueden presentar pruebas de
inmunológico comprometido, la PCR TcH2AF/R
xenodiagnóstico positivas y serologías negativas
se perfila como una prueba diagnóstica promisoria
en algunos momentos de la enfermedad,
de apoyo para la detección de T. cruz i en
especialmente en individuos recién infectados o
pacientes crónicos.
con estado inmunológico comprometido (39),
situación que puede explicar la presencia de PCR Con el fin de aumentar el poder de detección de
positiva en ausencia de anticuerpos IgG anti- la prueba de PCR se proponen las siguientes estrate-
T.cruzi. Este hallazgo también fue observado en gias: (i) aumentar el volumen de sangre a analizar
el estudio reportado por Gutiérrez y colaboradores, a una alícuota de 0,7-1 ml; (ii) preservar la muestra
en el que uno de los 25 individuos serológicamente de sangre en clorhidrato de guanidina; (iii) tomar
negativos (4%) fue positivo por PCR (31); por muestras seriadas con intervalos mínimos de dos
Salomone y colaboradores, quienes encontraron a tres meses, e (iv) hibridar el producto de
que de 80 individuos seronegativos, 12 (15%) amplificación obtenido con un iniciador interno.
tenían PCR positiva y tres de éstos presentaban
A pesar de los resultados prometedores de las
síntomas clínicos compatibles con la enfermedad
pruebas de PCR, se requiere de un mayor número
de Chagas (40); por Gomes y colaboradores,
de estudios sobre consistencia y conformidad con
quienes reportaron que 10 de 21 (47,6%) pacientes
la PCR TcH2AF/R y otras pruebas de PCR que
con serología negativa presentaron PCR y ensayos
utilizan blancos diferentes de amplificación, para
de lisis mediada por el complemento positivas (32),
postular su uso como patrón de oro en el
y por Avila y colaboradores, quienes encontraron
diagnóstico de la enfermedad de Chagas.
PCR positiva en tres de cuatro pacientes
Adicionalmente, el requerimiento de equipo
seronegativos (35).
especializado y elevado costo de las pruebas de
Adicionalmente, analizando los posibles factores PCR hace difícil su uso común y de rutina,
de riesgo de contaminación durante el proceso característica primordial de todo patrón de oro.
de manipulación, extracción y amplificación del No obstante, estudios paralelos del grupo de
ADN, se tiene que cada uno de los pasos de las investigación proponen el uso de un “constructo”
pruebas de PCR (extracción del ADN, reacción como patrón de oro, utilizando la PCR como
de pre-PCR, amplificación y electroforesis) se prueba diagnóstica, además de los hallazgos
realizó en áreas diferentes y separadas, utilizando clínicos y epidemiológicos (41).

89
Gil J., Pavía P., Montilla M. et al Biomédica 2007;27(supl. 1):83-91

Agradecimientos strains of Trypanosoma cruzi. Mem Inst Oswaldo Cruz


1998;93:739-40.
Los autores expresan su agradecimiento a la
9. Marquez E, Arcos-Burgos M, Triana O, Moreno J,
Unidad de Electrofisiología y Cardiología del Jaramillo N. Clonal population structure of Colombian
Hospital Universitario San Ignacio (HUSI), a la sylvatic Trypanosoma cruzi . J Parasitol 1998;84:
Clínica Shaio y al Centro de Salud del municipio 1143-9.
de Santana, departamento de Boyacá. 10. Triana O, Jaramillo N, Moreno J. Genetic variability
of Colombian populations of Trypanosoma cruzi and
Conflicto de intereses Trypanosoma rangeli. Biol Res 1999;32:1-10.
Los autores manifestamos expresamente que 11. Montilla MM, Guhl F, Jaramillo C, Nicholls S,
durante la realización del presente trabajo no Barnabe C, Bosseno MF, et al. Isoenzyme clustering
existió conflicto de intereses que pudiera afectar of Trypanosomatidae Colombian populations. Am J
Trop Med Hyg 2002;66:394-400.
los resultados obtenidos.
12. Rodríguez P, Escalante M, Díez H, Cuervo C,
Financiación Montilla M, Nicholls RS, et al. Estudio de la variabilidad
de seis cepas colombianas de Trypanosoma cruzi
Este estudio fue financiado por la Vicerrectoría mediante polimorfismos de longitud de fragmentos de
Académica de la Pontificia Universidad Javeriana. restricción (RFLP) y amplificación aleatoria de ADN
Registro de proyecto 1702. polimórfico (RAPD). Biomédica 2002;22:263-71.
13. Mejia AM, Triana O. Análisis por LSSP-PCR de la
Referencias
variabilidad genética de Trypanosoma cruzi en sangre
1. World Health Organization. Control of Chagas y órganos de ratones infectados. Biomédica
Disease. Second report of the WHO Expert Committee. 2005;25:76-86.
Technical Report 2002. Series 905. Geneva:
14. D’Alessandro A, Saravia N. Trypanosoma rangeli. En:
WHO;2002. p.39-40.
Gilles HM, editor. Protozoal diseases. London: Arnold
2. Moncayo A. Chagas disease: current epidemiological Press;1999. p.398-412.
trends after the interruption of vectorial and
15. Guhl F, Vallejo GA. Trypanosoma ( Herpetosom a)
transfusional transmission in the Southern Cone
rangeli Tejera, 1920: an updated review. Mem Inst
countries. Mem Inst Oswaldo Cruz 2003;98:577-91.
Oswaldo Cruz 2003;98:435-42.
3. Macedo AM, Machado CR, Oliveira RP, Pena SD.
16. Vallejo GA. Estudios comparativos entre las
Trypanosoma cruzi : genetic structure of populations
secuencias de kDNA de Trypanosoma cruzi y
and relevance of genetic variability to the pathogenesis
Trypanosoma rangeli y su aplicación en el diagnóstico
of Chagas disease. Mem Inst Oswaldo Cruz 2004;99:1-
molecular de la tripanosomiasis americana. Actual Biol
12.
1998;20:43-56.
4. Huete-Perez JA, Flores-Obando RE, Ghedin E,
17. Guhl F, Jaramillo C, Carranza JC, Vallejo GA.
Caffrey CR. Genomic and proteomic approaches for
Molecular characterization and diagnosis of
Chagas’ disease: critical analysis of diagnostic methods.
Trypanosoma cruzi and Trypanosoma rangeli. Arch
Expert Rev Mol Diagn 2005;5:521-30.
Med Res 2002;33:362-70.
5. D’Avila DA, Gontijo ED, Lages-Silva E, Meira WS,
18. Vallejo GA, Gulh F, Chiari E, Macedo AM. Species
Chiari E, Galvao LM. Random amplified polymorphic
specific detection of Trypanosoma cruzi and
DNA profiles of Trypanosoma cruzi isolates from
Trypanosoma rangeli in vector and mammalian hosts
chagasic patients with different clinical forms. Parasitol
by polymerase chain reaction amplification of kinetoplast
Res 2006;98:455-61.
minicircle DNA. Acta Trop 1999;72:203-12.
6. Machado CR, Augusto-Pinto L, McCulloch R,
19. Vargas N, Souto RP, Carranza JC, Vallejo GA,
Teixeira SM. DNA metabolism and genetic diversity in
Zingales B. Amplification of a specific repetitive DNA
Trypanosomes. Mutat Res 2006;612:40-57.
sequence for Trypanosoma rangeli identification and
7. Saravia NG, Holguin AF, Cibulskis RE, its potential application in epidemiological investigations.
D’Alessandro A. Divergent isoenzyme profiles of Exp Parasitol 2000;96:147-59.
sylvatic and domiciliary Trypanosoma cruzi in the
20. Nitz N, Gomes C, de Cassia Rosa A, D’Souza-Ault
eastern plains, piedmont, and highlands of Colombia.
MR, Moreno F, Lauria-Pires L, et al . Heritable
Am J Trop Med Hyg 1987;36:59-69.
integration of kDNA minicircle sequences from
8. Rodríguez P, Montilla M, Nicholls RS, Zarante I, Trypanosoma cruzi into the avian genome: insights into
Puerta, C. Isoenzymatic characterization of Colombian human Chagas disease. Cell 2004;118:175-86.

90
Biomédica 2007;27(supl. 1):83-91 PCR TCH2AF/R vs. IFI y Elisa para diagnóstico de Chagas

21. Pavía P, Cuervo C, Montilla M, Nicholls S, Puerta C. 32. Gomes ML, Galvao LM, Macedo AM, Pena SD,
Diseño y estandarización de una prueba de PCR para Chiari E. Chagas’ disease diagnosis: comparative
la detección específica de Trypanosoma cruzi. Infectio analysis of parasitologic, molecular, and serologic
2003;7:129-36. methods. Am J Trop Med Hyg 1999;60:205-10.
22. Beltrán M, Duque S, Guhl F, Herrera CP, López MC, 33. Britto C, Cardoso MA, Vanni CM, Hasslocher-
Moreno AL, et al. Prueba de ELISA y prueba de Moreno A, Xavier SS, Oelemann W, et al. Polymerase
inmunofluorescencia indirecta (IFI). En: Guhl F, Nicholls chain reaction detection of Trypanosoma cruzi in human
RS, editores. Manual de procedimientos para el blood samples as a tool for diagnosis and treatment
diagnóstico de la enfermedad de Chagas. Bogotá: evaluation. Parasitology 1995;110:241-7.
Ministerio de Salud; 2001. p.32-48.
34. Wincker P, Bosseno MF, Britto C, Yaksic N, Cardoso
23. Sambrook JF, Russell DW. Gel electrophoresis of MA, Morel CM, et al. High correlation between Chagas’
DNA. En: Molecular cloning A laboratory manual. disease serology and PCR-based detection of
Tercera edición. Cold Spring Harbor, New York: Cold Trypanosoma cruzi kinetoplast DNA in Bolivian children
Spring Harbor Laboratory Press; 2001.p.5.1-17. living in an endemic area. FEMS Microbiol Lett
1994;124:419-23.
24. Puerta C, Martin J, Alonso C, Lopez MC. Isolation
and characterization of the gene encoding histone H2A 35. Avila HA, Pereira JB, Thiemann O, De Paiva E,
from Trypanosoma cruzi . Mol Biochem Parasitol DeGrave W, Morel CM, et al . Detection of
1994;64:1-10. Trypanosoma cruzi in blood specimens of chronic
chagasic patients by polymerase chain reaction
25. Sackett D, Haynes R, Guyatt G, Tugwell P. Selección amplification of kinetoplast minicircle DNA: comparison
de pruebas diagnosticas. En: Epidemiologia Clínica. with serology and xenodiagnosis. J Clin Microbiol
Segunda Edición. México, D.F.: Editorial Médica 1993;31:2421-6.
Panamericana; 1998. p.64-7.
36. Junqueira AC, Chiari E, Wincker P. Comparison of
26. Wincker P, Britto C, Pereira JB, Cardoso MA, the polymerase chain reaction with two classical
Oelemann W, Morel CM. Use of a simplified polymerase parasitological methods for the diagnosis of Chagas
chain reaction procedure to detect Trypanosoma cruzi disease in an endemic region of north-eastern Brazil.
in blood samples from chronic chagasic patients in a Trans R Soc Trop Med Hyg 1996;90:129-32.
rural endemic area. Am J Trop Med Hyg 1994;51:771-7.
37. Castro AM, Luquetti AO, Rassi A, Rassi GG, Chiari
27. Thomas MC, Olivares M, Escalante M, Maranon C, E, Galvao LM. Blood culture and polymerase chain
Montilla M, Nicholls S, et al. Plasticity of the histone reaction for the diagnosis of the chronic phase of human
H2A genes in a Brazilian and six Colombian strains of infection with Trypanosoma cruzi . Parasitol Res
Trypanosoma cruzi. Acta Trop 2000;75:203-10. 2002;88:894-900.
28. Vázquez MP, Schijman AG, Levin MJ. A short 38. Marcon GE, Andrade PD, de Albuquerque DM,
interspersed repetitive element provides a new 3’ Wanderley Jda S, de Almeida EA, Guariento ME, et
acceptor site for trans-splicing in certain ribosomal P2 al. Use of a nested polymerase chain reaction (N-PCR)
beta protein genes of Trypanosoma cruzi. Mol Biochem to detect Trypanosoma cruzi in blood samples from
Parasitol 1994;64:327-36. chronic chagasic patients and patients with doubtful
serologies. Diagn Microbiol Infect Dis 2002;43:39-43.
29. Brisse S, Verhoef J, Tibayrenc M. Characterisation
of large and small subunit rRNA and miniexon genes 39. Luquetti AO. Megaesofago e anticorpos anti–
further support the distinction of six Trypanosoma cruzi Trypanosoma cruzi . Rev Goiana Med 1987;33:1-16.
lineages. Int J Parasitol 2001;31:1218-26.
40. Salomone OA, Basquiera AL, Sembaj A, Aguerri
30. Urrea DA, Carranza JC, Cuba CA, Gurgel- AM, Reyes ME, Omelianuk M, et al . Trypanosoma
Goncalves R, Guhl F, Schofield CJ, et al. Molecular cruzi in persons without serologic evidence of disease,
characterisation of Trypanosoma rangeli strains Argentina. Emerg Infect Dis 2003;9:1558-62.
isolated from Rhodnius ecuadoriensis in Peru, R.
41. Vacca M, Mercado M. Determinación de las
colombiensis in Colombia and R. pallescens in Panama,
características operativas de las pruebas serológicas
supports a co-evolutionary association between
con cepas colombianas de Trypanosoma cruz i
parasites and vectors. Infect Genet Evol 2005;5:123-9.
utilizadas para el diagnóstico de la enfermedad de
31. Gutierrez R, Angulo VM, Tarazona Z, Britto C, Chagas. (Tesis de Maestría en Epidemiología Clínica).
Fernandes O. Comparison of four serological tests for Bogotá D.C.: Unidad de Epidemiología Clínica, Hospital
the diagnosis of Chagas disease in a Colombian Universitario San Ignacio, Pontificia Universidad
endemic area. Parasitology 2004;129:439-44. Javeriana; 2006.

91
Arroyo
Biomédica
C.M.,
2007;27(Supl.
Esteban L.,1):92-100
Catalá S., Angulo V.M. Biomédica 2007;27(supl. 1):92-100

ARTÍCULO ORIGINAL

Variación del fenotipo antenal de poblaciones del domicilio,


peridomicilio y silvestres de Triatoma dimidiata
(Hemiptera: Reduviidae) en Santander, Colombia
Corina María Arroyo 1, Lyda Esteban 1, Silvia Catalá 2, Víctor Manuel Angulo 1

1
Centro de Investigaciones en Enfermedades Tropicales (CINTROP), Universidad Industrial de Santander,
Piedecuesta, Santander, Colombia.
2
Centro Regional de Investigaciones Científicas y Transferencia Tecnológica (CRILAR) Anillaco, La Rioja,
Argentina.
Introducción. Triatoma dimidiata es uno de los triatominos más ampliamente distribuidos en
Colombia, la caracterización fenotípica antenal de poblaciones de diferentes hábitats
proporcionaran conocimientos sobre su biología y comportamiento que podrán ser utilizados
en nuevas propuestas metodológicas para su control.
Objetivo. Estudiar el comportamiento de poblaciones de Triatoma dimidiata en diferentes
hábitats utilizando el fenotipo antenal.
Materiales y métodos. Se analizaron un mecanorreceptor y tres quimiorreceptores antenales
de 60 individuos de Triatoma dimidiata provenientes de diferentes hábitats en Santander
utilizando análisis univariados y multivariados.
Resultados. Los análisis multivariados diferenciaron significativamente las poblaciones de
las hembras, estas diferencias estuvieron asociadas a variaciones en el número de tricoides
de pared gruesa, con aumento de los tricoides de pared fina en hábitats cercanos al domicilio
humano. Los machos con mayor número de sensilla y de tricoides de pared fina, no se
diferenciaron, sin embargo tendencias similares fueron apreciadas. Se observó dimorfismo
sexual entre todas las poblaciones y fue menor en el del domicilio.
Conclusiones. El fenotipo de sensilla antenal fue útil en la diferenciación intraespecífica de
Triatoma dimidiata en diferentes hábitats. Las diferencias en hembras ponen de manifiesto
nuevos arreglos sensoriales para la explotación del hábitat a diferencia de los machos, que
por su mayor capacidad de dispersión, no se diferenciaron entre los ecotopos. La similitud
entre hembras de zona urbana, con hembras de peridomicilio rural permite proponer al fenotipo
antenal como un sencillo y eficiente indicador para la determinación del origen de triatominos
que intentan colonizar nuevos hábitats.
Palabras claves: Triatoma, Triatominae, hábitat, enfermedad de Chagas, Colombia.
Antennal phenotype variation in sylvatic, peridomestic and domestic populations of
Triatoma dimidiata (Hemiptera: Reduviidae) from Santander, Colombia.
Introduction. Triatoma dimidiata is one of the widely distributed triatomines in Colombia. The
phenotype of the antenna is a characteristic of populations that can differ among habitats and
can give information concerning its biology and behavior. This information in turn can be used
in the development of new methodological proposals for its control.
Objective. The behavior of populations of Triatoma dimidiate was studied in several different
habitats, using the antennal phenotype.
Materials and methods. A mechanoreceptor and three chemoreceptors were compared in the
antennae of 60 Triatoma dimidiata adults from several defined habitats in Santander, using
unvariate and multivariate analyses.
Results. The multivariate analysis differentiated the female populations significantly. These
differences were associated with variations in the number of thick-walled trichoids and with the
numerical increase of the thin walled trichoids in habitats close to human housing. The males,
with a larger number of sensilla and thin walled trichoids, were not differentiated significantly,
although, similar tendencies were observed. Sexual dimorphism was clear in these characters

92
Biomédica 2007;27(supl. 1):92-100 Fenotipo antenal de Triatoma dimidiata

in the total population, but less pronounced in the domestic populations.


Conclusions. The antennal sensilla patterns were useful in the intraspecific differentiation of
Triatoma dimidiata in different habitats. The differences in the female population shed light on
new sensorial arrangements for the exploration of the habitat, in contrast with the male
populations that, because of their great capacity for dispersion, were not differentiated in the
distinct habitats. The differences in sensilla patterns between females from urban areas and
those from rural surroundings may be a simple and efficient marker of the origin of individual
Triatominae attempting to colonize new habitats.
Key words: Triatoma dimidiata, Triatominae, habitat, Chagas disease, Colombia.

La enfermedad de Chagas afecta a una población dimidiata se convierte en una especie cuya
de entre 16 y 18 millones de personas en 21 países erradicación no puede realizarse utilizando los
de América (1); su agente causal es Trypanosoma métodos disponibles (12, Schofield CJ. Evolución
cruzi , protozoo transmitido por insectos y control del Triatoma dimidiata. Taller para el
hematófagos de las subfamilia Triatominae establecimiento de pautas técnicas en el control
(Hemiptera: Reduviidae) (2); las especies de mayor de Triatoma dimidiata. San Salvador; 2002. OPS/
importancia epidemiológica debido a su adaptación HCD/HCT/214/02. p.12-8).
en el ambiente domiciliario son Triatoma infestans,
Rhodnius prolixus y Triatoma dimidiata. El estudio de la estructura poblacional y el uso de
marcadores fenéticos y genéticos de las
Esta última especie está distribuida en Centro poblaciones de este vector es indispensable para
América y Colombia, en donde ocupa una gran obtener información sobre su biología y
diversidad de hábitats: domicilio, peridomicilio y comportamiento y puede contribuir a una mejor
silvestres en áreas rurales y urbanas (3-5). Por planificación de la acciones de control vectorial,
otra parte, en regiones costeras de Ecuador y norte como se ha demostrado con esta especie y R.
de Perú se ha encontrado sólo en el domicilio prolixus (13,14). El análisis de la estructura
humano (6). genética de T. dimidiata con RAPDS realizado en
En Colombia ha aumentado su distribución de 4 a Boavita, Colombia, sugiere una baja diferenciación
13 departamentos en las últimas décadas (7), y genética, indicando que las poblaciones extradomi-
al igual que en Centro América, se ha detectado ciliarias representan un riesgo epidemiológico en
en viviendas de zonas urbanas con buena la transmisión de la enfermedad de Chagas (15).
construcción. Esta distribución y su gran capacidad En triatominos, el fenotipo antenal refleja
para colonizar varios hábitats han favorecido las modificaciones de los patrones ancestrales por
reinfestaciones observadas después de la la adaptación a diferentes hábitats y hospederos
aplicación de insecticidas piretroides (8-11)
(16-18) y es útil en la diferenciación intra-
(Turriago B, Pinto N, Ghul F. Evaluación de
específica, Este estudio, primero en poblaciones
deltametrina (K-Otrine SC 50® y K-Otrine WP 50®)
de T. dimidiata de Colombia, se realizó para
como alternativa de control de Triatoma dimidiata.
detectar variaciones en cuatro receptores
Biomédica 2005;25(Suppl.1): 195). Estas pobla-
antenales en los diferentes hábitats conocidos
ciones reinfestantes probablemente no fueron
de una misma área geográfica y como contribu-
alcanzadas por la acción insecticida y constituyen
ción al conocimiento de la bioecología y
poblaciones peridomiciliarias o silvestres que
ecoepidemiología de esta especie, y como
incursionan en el domicilio humano; por ello, T.
orientación para metodologías de control vectorial
en la zona endémica.
Correspondencia:
Corina María Arroyo, CINTROP, Universidad Industrial de Materiales y métodos
Santander, Km 2 vía Guatiguará, Piedecuesta, Santander,
Colombia. Teléfono: (57) 76563971, fax (57)76540177. Área de estudio
corina_arroyo@yahoo.com
El estudio se realizó en los años 2003 y 2004 en
Recibido: 20/10/05; aceptado: 13/07/06 áreas rurales de los municipios de Macaravita y

93
Arroyo C.M., Esteban L., Catalá S., Angulo V.M. Biomédica 2007;27(supl. 1):92-100

Capitanejo del departamento de Santander, seleccionó un total de 60 individuos adultos de T.


ubicados sobre la cordillera oriental colombiana. dimidiata de ambos sexos con sus antenas
El área está localizada entre los 1.090 y 2.500 completas. En cada hábitat, se incluyeron 10
msnm, 6°31’ a 6°27’ de latitud norte y 72°35’ a machos y 10 hembras en los análisis univariados
72°42’ de longitud oeste, con temperaturas entre y multivariados. Adicionalmente, se analizaron
12 y 25 °C, en la zona de influencia del Cañón del cuatro hembras capturadas en una vivienda urbana
Chicamocha y los ríos Nevado, Servitá y otras (VU) del municipio de Macaravita.
corrientes menores. Las zonas de vida
Preparación de la antena para el estudio del
predominante son bosque seco premontano y
fenotipo antenal
bosque húmedo montano bajo con precipitación
promedio anual de 731-1058 mm (19). El paisaje Una antena por insecto se cortó a nivel del escapo
se caracteriza por el relieve montañoso quebrado (segmento basal o primero) y se almacenó en
y escarpado, con parches de bosque secundario, alcohol al 70%. Para su diafanización, la cutícula
y por la presencia de formaciones rocosas de se sumergió en hidróxido de sodio al 4% durante
piedra caliza y vegetación xerofítica hacia la parte 6 horas a 60°C, se neutralizó con ácido acético al
baja del cañón. Las actividades económicas de 5% por 2 minutos, y finalmente se montó en
mayor importancia son la agricultura y la lámina portaobjetos con glicerina al 87%.
ganadería, principalmente cultivos de tabaco, la
Identificación y conteo de sensilias
cría de cabras y animales de pastoreo. La mayoría
de las viviendas en esta zona están construidas El procedimiento se realizó en la cara ventral de
con paredes y pisos en tierra o ladrillo, techos de los tres segmentos distales de la antena, pedicelo
teja de barro sostenidos en entramado de caña- (P) y flagelos 1 y 2 (F1 y F2), utilizando un
barro, poca iluminación y presencia de animales microscopio (Nikon E400, 40X) conectado a la
domésticos. cámara lúcida (Nikon y-IDT). Se analizaron tres
quimiorreceptores: tricoide de pared fina (TPF),
Búsqueda de los insectos
tricoide de pared gruesa (TPG) y basicónico (BA),
Se recolectaron en los dormitorios (D) y y un mecanorreceptor Bristles (BR) de acuerdo al
peridomicilios (P) de las viviendas rurales y protocolo de Catalá et al. 1994 (20) y Catalá et al.
biotopos silvestres (S) localizados hasta 400 mts 2005 (16).
alrededor de las viviendas. Se consideró
peridomicilio (P) el área que circunda a la vivienda
Medición de los segmentos antenales y conteo
humana y en el cual el hombre desarrolla sus
de sensilias
actividades domésticas y productivas. Se Se midió la longitud de cada uno de los segmentos
tomaron muestras en corrales de animales, hornos antenales y se contaron las sensilias que cubrían
de barro y pequeñas construcciones abiertas de estos segmentos. Las medidas se tomaron con
bahareque y caña (caney) utilizadas para estereoscopio (Olympus SZ40, 2X) previamente
almacenar tabaco, elementos de trabajo y como calibrado con micrómetro ocular de 1cm y 100
lugares de reposo para gallinas, cabras y ganado graduaciones.
vacuno. Las capturas en el domicilio y
Análisis estadístico
peridomicilio se hicieron a través de la búsqueda
activa hora/hombre y con material que la Se hizo análisis de correlación entre el número
comunidad envió al laboratorio de entomología. de sensilias y la longitud total de la antena.
Para la captura de los triatominos silvestres (S) Mediante el test de Levene se determinó la
se utilizaron trampas diseñadas en el laboratorio homogeneidad de las varianzas y posteriormente
de entomología, (Angulo VM, datos sin publicar), se aplicó un ANOVA para la comparación entre
que se colocaron en cuevas por un periodo de 12 grupos y una prueba de t para la comparación
horas/noche. Los insectos recolectados fueron entre sexos, con previa transformación de los
almacenados en tarros plásticos y etiquetados con datos en logaritmo natural. Se utilizaron pruebas
datos de localidad, fecha y lugar de captura. Se no paramétricas de Kruskall Wallis y U Mann

94
Biomédica 2007;27(supl. 1):92-100 Fenotipo antenal de Triatoma dimidiata

Withney (21) cuando las variables mostraron y el mayor número de sensilias se presentó en el
heterocedasticidad. Para reducir el error flagelo en hembras y en el pedicelo en machos.
experimental, se corrigió el valor de significación
Dimorfismo sexual
usando el método secuencial de Bonferroni (21).
Se encontró un significativo dimorfismo sexual
Se realizó un análisis discriminante para cada en patrón de sensilias antenales de T. dimidiata,
sexo y segmento antenal usando el programa diferenciación que se debió a la variación del
Statistica versión 6. Este análisis se hizo con base número de TPF del pedicelo, el cual fue mayor en
en el modelo discriminante forward stepwise, en los machos (p < 0,0317). El dimorfismo entre
el cual todas las variables se incluyeron en el hábitats varió según las distancias de Mahanalobis
modelo y en cada paso se eliminó la variable que así: domicilio (d2 = 24,56), silvestre (d2 = 73,62) y
menos contribuyó a la predicción de los miembros peridomicilio (d2 = 361,06).
del grupo. La significación de las distancias de
Mahalanobis (d2) se demostró utilizando los Comparación entre hábitats
programas PADwin versión 65 (después de 1.000 Debido al dimorfismo sexual de T. dimidiata los
permutaciones) y NTSYS versión 2.02. análisis se hicieron por separado para cada sexo.
Resultados Análisis univariado. El ANOVA entre las hembras
Características generales de la antena mostró diferencias significativas (p = 0,0046) en
los TPG del flagelo uno; en los machos no se
Los promedios y la desviación estándar de la observaron variaciones signficativas en ningún
longitud de cada segmento se muestran en el receptor (figura 1).
cuadro 1.
Análisis multivariado. Para resolver el problema
Los machos presentaron antenas más largas y de multicolinealidad, las variables se agruparon
con mayor cantidad de sensilias que las hembras, en 12 componentes principales obtenidos a partir
con un promedio de 12,04 mm, 1170,77 y 11,85mm de una matriz de covarianza. Estas 12 nuevas
922,07, respectivamente. Las hembras se diferen- variables con independencia lineal se usaron en
ciaron significativamente según la longitud de la el análisis discriminante. En hembras, el modelo
antena en cada hábitat (p = 0,0014). No se observó excluyó la variable PBR con un Partial λ = 0,946.
correlación del número de quimiorreceptores con Las variables que contribuyeron significativamente
la longitud total de la antena (n = 60, r = 0,05, al análisis (Wilks λ = 0,006; F (22.34) = 3,432; p ‹ 0,006)
p = 0,701). El segmento más largo fue el pedicelo produjeron dos funciones discriminantes (FD1 =

Cuadro 1. Media y desviación estándar del número de sensilias y la longitud de cada segmento antenal de T. dimidiata.

Longitud Pedicelo Flagelo 1 Flagelo 2


Sensilias
Hábitat Sexo p f1 f2 pRB pTPF pTPG pBS f1RB f1TPF f1TPG f1BS f2RB f2TPF f2TPG f2BS totales

Domicilio 4,6 4,0 3,3 67,0 170,0 62,2 8,9 16,6 71,7 250,2 42,2 11,0 20,2 188,8 36,7 945,5
0,2 0,2 0,2 5,7 49,5 21,0 3,0 3,2 22,9 32,2 12,3 3,0 6,3 59,5 10,6 141,3
4,6 3,9 3,3 68,3 302,6 56,9 10,0 19,2 113,5 231,2 47,7 11,8 28,4 218,9 45,5 1154,0
0,3 0,3 0,2 12,0 78,0 12,5 2,2 4,5 24,1 38,5 13,8 2,9 5,7 30,1 11,4 171,3
Peridomicilio 4,4 3,8 3,2 71,2 146,7 47,6 8,3 19,1 57,5 262,3 34,2 11,8 20,0 227,0 42,2 947,9
0,2 0,2 0,3 8,3 27,9 14,0 2,4 3,1 11,5 30,7 9,6 2,1 5,8 22,7 13,5 56,5
4,6 3,9 3,4 65,5 363,0 69,5 8,9 17,3 104,7 231,4 39,3 11,7 28,9 213,8 42,0 1196,0
0,2 0,2 0,2 11,5 50,3 14,5 2,6 4,6 38,9 34,5 14,6 2,2 8,0 41,5 6,7 146,9
Silvestre 4,6 3,9 3,5 71,1 164,4 58,2 8,7 15,6 54,6 216,8 28,8 10,6 21,1 186,5 36,4 872,8
0,2 0,2 0,3 8,3 39,5 21,7 3,4 2,0 9,1 25,0 9,1 2,0 5,3 29,4 6,0 106,2
4,7 4,0 3,5 67,9 345,1 61,3 9,6 16,8 119,9 218,4 37,7 10,4 27,0 205,7 43,3 1163,1
0,2 0,2 0,4 9,5 63,8 26,0 2,5 3,9 40,5 57,3 12,7 3,0 9,9 38,0 11,4 125,9

95
Arroyo C.M., Esteban L., Catalá S., Angulo V.M. Biomédica 2007;27(supl. 1):92-100

Figura 1. Análisis discriminante de hembras de T. dimidiata Figura 2. Análisis discriminante de hembras de T. dimidiata
recolectadas en D: domicilio, P: peridomicilio, S: silvestre incluidos individuos de vivienda urbana (VU). D: domicilio, P:
(cueva). DF1 y DF2, función discriminante 1 y 2, peridomicilio, S: silvestre (cueva). DF1 y DF2, función
respectivamente. discriminante 1 y 2, respectivamente.

0,0004; FD2 = 0,0137) con una asignación correcta contribuyeron significativamente en este análisis
al grupo de origen de 96,67%, indicando que los produjeron dos funciones discriminantes con 80%
caracteres estudiados fueron altamente de asignación a cada grupo (Wilks λ = 0,29521;
discriminantes entre las tres poblaciones. La F (6.50) = 7,0041; p ‹ 0,0000.), las cuales se
discriminación de las poblaciones se relacionó con relacionaron con las siguientes variables: F1BR,
las siguientes variables: PTPF + F1TPF (parcial PTPF, F2BA + F2TPG + F1TPG con un Partial
λ = 0,505), F1BA + F1BR (Partial λ = 0,684), λ = 0,599, 0,640 y 0,665, respectivamente, donde
F1TPG (Partial λ = 0,686), F2BA (Partial λ = F2BA + F2TPG + F1TPG se combinaron en una
0,651), PTPF (Partial λ = 0,666), F1BA (Partial λ función matemática (combinación lineal) (cuadro 2c).
= 0,689), F2BR (Partial λ = 0,718), PTPG (Partial El análisis multivariado entre los machos no
λ = 0,856), F1BR (Partial λ = 0870), PTPG + PBA diferenció significativamente las poblaciones; sin
+ F1BA (Partial λ = 0,874) (en orden decreciente embargo, se observó una tendencia similar a las
de Wilks λ ). Las distancias de Mahalanobis hembras (Wilks λ = 0,3511; F(16.42) = 1,8047; p ‹
diferenciaron significativamente cada uno de los 0,0636, figura 3).
hábitats (cuadro 2a), donde PTPF + F1TPF; F1BA
+ F1BR; PTPG + PBA + F1BA se combinaron Cuadro 2. Distancia de Mahalanobis (d2) y valores de
dentro de una función matemática. significación (p) obtenidos del análisis discriminante de
hembras de T. dimidiata en: a. las poblaciones de estudio,
Un nuevo análisis discriminante entre las hembras b. individuos de zona urbana y c. en el primer segmento
antenal.
se realizó incluyendo a los individuos de viviendas
urbanas (Wilks λ = 0,7493; F(30.62)= 2,9446; p ‹ a. d2 p
0,0002). El 85,29% de estos individuos fue peridomicilio-silvestre 16,21 0,0043
asignado correctamente a su grupo de origen y domicilio-peridomicilio 13,52 0,0105
agrupado en el peridomicilio (figura 2); además domicilio-silvestre 10,95 0,0269
se observó una leve asociación con el hábitat b. d2 p
silvestre (cuadro 2b). domicilio-VU 16,23 0,0336
silvestre-VU 13,96 0,0617
Al utilizar en los análisis multivariados solamente peridomicilio-VU 6,48 0,4596
las sensilias del flagelo 1 en hembras, las c. d2 p
distancias de Mahalanobis concordaron con las peridomicilio-silvestre 6,86 0,0002
obtenidas cuando se utilizaron todos los domicilio-silvestre 5,11 0,0013
domicilio-peridomicilio 3,63 0,0073
segmentos antenales. Las variables que

96
Biomédica 2007;27(supl. 1):92-100 Fenotipo antenal de Triatoma dimidiata

en el hábitat (24,25). El aumento significativo de


los tricoides de pared fina en las antenas de los
machos de T. dimidiata, observado también por
Catala et al. 2005 (16), podría estar asociado a la
captación de feromonas de hospederos
vertebrados y a la percepción de moléculas
relacionadas con el comportamiento sexual como
sucede en otras especies de triatominos (16-
18,26) (Esteban L, Sandoval CM, Angulo VM,
Catalá S. Estudio morfológico de los patrones
sensoriales en adultos y ninfas de Belminus herreri
(Reduviidae: Triatominae). Biomédica 2002;22
(Suppl. 1):113) y especies de Noctuidae ,
Acrididae y Dyctioptera (27,28). Adicionalmente,
Figura 3. Análisis discriminante (no significativo) de machos el aumento de este receptor multiporoso ha sido
de T. dimidiata recolectados en D: domicilio, P: peridomicilio,
S: silvestre (cueva). DF1 y DF2, función discriminante 1 y 2, relacionado con la variabilidad intraespecífica y
respectivamente. el polimorfismo alar del género Mepraia (29).
Los estudios de Monroy et al. 2003 (30) y Tabaru
Discusión et al. 1996 (31) sugieren que los machos de T.
T. dimidiata del área estudiada, al igual que las dimidiata tienen mayor probabilidad de
poblaciones de Guatemala y de otras especies dispersión a través del vuelo que las hembras, lo
de triatominos, presentó los tres tipos de quimio- que les permite incursionar en diferentes hábitats
rreceptores en el pedicelo, lo que sugiere una y al mismo tiempo incrementar su sistema de
capacidad para la invasión y dispersión en reconocimiento sexual, facilitando el encuentro
diferentes hábitats (17,22, Catalá S, Carbajal AL, entre adultos dispersos. En general, en los
Torres M, Moreno M, Ordoñez R, Montaña MF, et triatominos los machos son más pequeños, y, en
al. La antena de los Triatominae: características consecuencia, menos pesados y más hábiles para
ancestrales y marcadores funcionales. En: Guhl desplazarse a través del vuelo en búsqueda de
F. editor. Proceedings of the Fourth International alimento. El aumento de estos receptores
Workshop on Population and Control of Triatominae. relacionados con la capacidad de dispersión es
Cartagena de Indias, 2000. p.125-32), lo cual un factor clave en la invasión de nuevos
demuestra que el sistema sensorial de los hábitats; quizás por esta razón no observamos
insectos ha evolucionado hacia numerosas diferencias entre ecotopos en machos, a pesar
especializaciones que les permiten detectar de que presentaron tendencias similares a las
características del ambiente externo y monitorizar hembras.
constantemente el estado de interacción del Los basicónicos también fueron abundantes,
organismo. especialmente en el flagelo uno, como se ha
T. dimidiata presentó mayor densidad de sensilias observado en T. sordida (17); estos receptores
en el pedicelo que en el flagelo uno, a diferencia han sido implicados en la recepción de moléculas
de otras especies de Triatoma (22,23), lo que NH 3 y ácidos grasos (32) como termo-
probablemente muestra una característica de la higrorreceptores y son similares a los receptores
especie. “C” de Cimex lecticularius (22). En mosquitos de
la familia Psychodidae se ha observado función
Dimorfismo sexual
olfatoria en el hallazgo del hospedero (33), y en
Las variaciones en el número de sensilias insectos como Locusta migratoria, Schistocerca
antenales entre hembras y machos en insectos gregaria , Hylobus habiteis y Leptinotarsa
podría ser una respuesta a la atracción del macho decemlineata este receptor es responsable del
por las feromonas de la hembra o por variaciones dimorfismo sexual (27,34-37).

97
Arroyo C.M., Esteban L., Catalá S., Angulo V.M. Biomédica 2007;27(supl. 1):92-100

Entre ecotopos, el dimorfismo sexual fue menor asociarse, además, con la presencia de cabras y
para la población del domicilio, seguida por la animales de pastoreo en la región. Por otra parte,
silvestre. Los machos de estos hábitats presen- el aumento de los BR en hembras del peridomicilio
taron menor cantidad de tricoides de pared fina podría relacionarse con la alta densidad de
en el pedicelo, lo cual tiene relación con especies insectos observada en campo, ya que estas
adaptados a un rango limitado de hábitats como sensilias han mostrado ser susceptibles a la
T. infestans (18). La reducción del número de densidad poblacional (23), perciben estímulos
receptores que intervienen en la reproducción mecánicos relacionados con el micro hábitat (18)
podría ser consecuencia de la domiciliación (38). y se han asociado con la selección del hábitat
Por el contrario, en la población peridomiciliada, más que con la del huésped (20).
el aumento de estos sensilias podría involucrar la
La asociación entre las hembras domiciliadas de
necesidad de detectar olores para identificar
T. dimidiata de la zona urbana con el peridomicilio
nuevos hábitats y compañero sexual.
rural podría explicarse por el transporte e
Variación entre hábitats intercambio que hace el hombre de animales desde
En los triatominos una serie de cambios una zona a otra en los días de mercado. Otros
morfológicos y genéticos se han asociado a la estudios sugieren que insectos del peridomicilio
adaptación a hábitats domésticos, y se ha y silvestres de T. dimidiata vuelan estacional-
señalado que la densidad de sensilias antenales mente hacia las viviendas debido a cambios en
disminuye progresivamente en el pedicelo y sobre la disponibilidad de alimento (39).
el total de la antena en especies que viven en Las poblaciones peridomiciliadas y silvestres de
“hábitats estables” como la vivienda humana (16- T. dimidiata representan un riesgo epidemiológico
18,22,23); sin embargo, este término puede usarse para la población humana debido a su dispersión
de manera ambigua, puesto que, además de las pasiva o activa hacia las viviendas rurales y
fluctuaciones ambientales, en un hábitat urbanas en esta zona del país. El control de estas
intervienen la explotación de diferentes recursos poblaciones es actualmente un reto para los
tróficos, espaciales y reproductivos, los cuales programas de control vectorial (12).
podrían modificar en forma particular el fenotipo
de las sensilias antenales. Finalmente, el fenotipo antenal de las sensilias
fue útil en la diferenciación intraespecífica de T.
Las variaciones observadas en hembras se dimidiata según el hábitat. El estudio de los nichos
asociaron con los TPG y BR; una reducción de dentro de los hábitats es escaso y su estructura,
los primeros se observó a medida que disminuía junto con factores bióticos y abióticos, debe
la amplitud del nicho y se incrementaba la estudiarse en profundidad para el conocimiento
estabilidad del hábitat, lo que podría indicar una de la relación del sistema sensorial y la explotación
reducción de la sensibilidad y superficie del área del hábitat.
para la captura de moléculas olorosas.
Las diferencias del fenotipo antenal observado en
En el domicilio humano y en las cuevas las hembras revelan una mayor plasticidad fenotípica
variaciones climáticas son pocas, y la ausencia en la diferenciación y adaptación a diferentes
de luz es característica, por lo que insectos que hábitats, como también se observó en estudios
ocupan estos hábitats podrían tener una selección de morfometría de la cabeza de T. dimidiata y T.
más acusada de sensilias olfatorias que de infestans (40,41). La rápida adaptación de las
mecanorreceptores y quimiorreceptores de hembras a las nuevas condiciones ecológicas
contacto. pone de manifiesto nuevos arreglos sensoriales
En el peridomicilio, el incremento espacial del característicos de ese hábitat; por otra parte, la
hábitat podría generar un comportamiento ausencia de diferenciación en el fenotipo antenal
exploratorio con una selección menos de machos podría ser un indicador de mayor
especializada de sus hospederos, lo que puede dispersión entre hábitats.

98
Biomédica 2007;27(supl. 1):92-100 Fenotipo antenal de Triatoma dimidiata

La similitud entre las hembras de zona urbana y resistencia a insecticidas en triatominos en América
las hembras de peridomicilio rural permite proponer Latina. Serie enfermedades transmisibles. Buenos
Aires: Fundación Mundo Sano; 2001. p.21-6.
el fenotipo antenal como un sencillo y eficiente
indicador para el reconocimiento del origen de 8. Dumonteil E, Ruiz- Piña H, Rodríguez Félix E,
Barrera Pérez M, Ramírez Sierra MJ, Rabinovich
triatominos que intentan colonizar nuevos hábitats. JE, et al. Re-infestation of houses by Triatoma dimidiata
Estas metodologías podrían utilizarse en los after intra domicile insecticide application in the Yucatán
programas de vigilancia entomológica. Peninsula, México. Mem Inst Oswaldo Cruz
2004;99:253-6.
Agradecimientos
9. Schofield CJ. Challenges of Chagas disease vector
A Jean Pierre Dujardin por su asesoría y control in Central America: Global collaboration for
colaboración en el análisis de datos; a development of pesticides for public health. Geneva:
World Health Organization (WHO/CDS/WHOPES/
COLCIENCIAS por el apoyo financiero; a las GCDPP/2000.1); 2000.
comunidades de Macaravita y Capitanejo, y a los
10. Marinkelle CJ. Colombian Triatominae and their
técnicos de la Secretaria de Salud de Santander
infestation with trypanosomatid flagellates. Mitt Inst
por la colaboración en el trabajo de campo. Colombo Alemán Invest Cient 1972;6:13-29.
Conflicto de interés 11. Angulo VM. Ensayo de estrategias de control y
vigilancia de Triatoma dimidiata en Colombia. En: Guhl
Los autores declaramos que no existe ningún F editor. Primer Taller Internacional sobre Control de
conflicto de intereses en este trabajo. la Enfermedad de Chagas. Bogotá: Universidad de los
Andes; 2005. p.91-102
Financiación
12. Schofield CJ. Propuestas de estrategias para el control
Financiado por Colciencias, proyectos códigos de Triatoma dimidiata en Colombia. En: Guhl F editor.
1102-04-13009, 1102-04-13010 y 1102-04-13029. Primer Taller Internacional sobre Control de la
Enfermedad de Chagas. Bogotá: Universidad de los
Referencias Andes; 2005. p.55-61.

1. World Health Organization. Chagas. [Consultado: 27 13. Panzera F, Ferrandis I, Ramsey J, Ordóñez R.
de abril de 2005]. Disponible en: http://www.who.int/ Salazar-Schettino PM, Cabrera M, et al .
ctd/chagas/burdens.htm. Chromosomal variation and genome size support the
existence of cryptic species of Triatoma dimidiata with
2. Galvao C, Carcavallo R, Da Silva Rocha D, Jurberg different epidemiological importance as Chagas disease
J. A checklist of the current valid species of the subfamily
vectors. Trop Med Int Health 2006;2:1092-103.
Triatominae Jeannel, 1919 (Hemiptera, Reduviidae) and
their geographical distribution, with nomenclatural and 14. Esteban L, Angulo VM, Feliciangeli MD, Catala S.
taxonomic notes. Zootaxa 2003;202:1-36. Analysis of antennal sensilla patterns of Rhodnius
prolixus from Colombia and Venezuela. Mem Inst
3. Lent H, Wygodzinsky P. Revision of the Triatominae
Oswaldo Cruz 2005;100:909-14.
(Hemiptera, Reduviidae), and their significance as
vectors of Chagas disease. Bull Am Mus Nat Hist 15. Ramirez CJ, Jaramillo CA, Delgado MP, Pinto NA,
1979;163:123-520. Aguilera G, Guhl F. Genetic structure of sylvatic,
4. Tabarú Y, Monroy C, Rodas A, Mejía M, Rosales R. peridomestic and domestic populations of Triatoma
Chemical control of Triatoma dimidiata and Rhodnius dimidiata (Hemiptera: Reduviidae) from an endemic
prolixus (Reduviidae: Triatominae), the principal vectors zone of Boyaca, Colombia. Acta Trop 2005;93:23-9.
of Chagas disease in Guatemala. Med Entomol Zool 16. Catalá S, Sachetto C, Moreno M, Rosales R, Salazar-
1998;49:87-92. Schettino PM, Gorla D. The antennal phenotype of
5. Zeledon R, Calvo N, Montenegro VM, Lorosa ES, Triatoma dimidiata populations and its relationship with
Arévalo C. A survey on Triatoma dimidiata in an urban species of the phyllosoma and protracta complexes. J
area of the province of Heredia, Costa Rica. Mem Inst Med Entomol 2005;42:719–25.
Oswaldo Cruz 2005;100:507-12. 17. Catalá S. Antennal sensilla of Triatominae (Hemiptera:
6. Aguilar VH, Abad Franch F, Racines J, Paucar A. Reduviidae): a comparative study of five genera. Int J
Epidemiology of Chagas disease in Ecuador. A brief Insect Morphol Embryol 1997;26:67-73.
review. Mem Inst Oswaldo Cruz 1999;94(Suppl. 1):
18. Catalá S, Dujardin JP. Antennal sensilla patterns
387-93.
indicate geographic and ecotopic variability among
7. Angulo VM, Sandoval CM. Triatominos y Programa Triatoma infestans (Hemiptera: Reduviidae)
Nacional de Control en Colombia. Monitoreo de la populations. J Med Entomol 2001;38:423-8.

99
Arroyo C.M., Esteban L., Catalá S., Angulo V.M. Biomédica 2007;27(supl. 1):92-100

19. Álvarez LS, García A, Gómez J, González LH, 31. Tabaru Y, Rodas A, Mejía M, Monroy C, Hashimoto
Guerrero AA, Porras H, et al . Santander nuestro T. Producción masiva y comportamiento de Triatoma
departamento. Bucaramanga: CER; 1999. dimidiata y Rhodnius prolixus . En: Tabarú Y editor.
Informe Anual N.4 (GJET-72), Proyecto de Cooperación
20. Catalá S, Schofield CJ. Antennal sensilla of Rhodnius. Guatemala-Japón para la Investigación de
J Morphol 1994;219:193-204. enfermedades tropicales. Guatemala: JICA 1996.
21. Sokal R, Rohlf J. Biometry. The principles and practice p.120-5.
of statistics in (biological. OJO, revisar esta palabra 32. Taneja J, Guerin PM. Ammonia attract Triatoma :
en el título a ver si se trata de "biology". Nota behavioral and neurophysiological data on nymphs. J
correctora). 3d ed. New York: Freeman and Company; Comp Physiol 1997;181:21-34.
1997.
33. Zayed AB, Hassan MI, Mohammed H, Fares A.
22. Gracco M, Catalá S. Inter-specific and developmental Antennal sensilla of the sandflies, Phlebotomus papatasi
differences on the array of antennal chemoreceptors and Phlebotomus bergeroti (Diptera:Psichodidae). Exp
in four species of Triatominae (Hemiptera: Reduviidae). Patol Parasitol 2002;5:10-20.
Mem Inst Oswaldo Cruz 2000;95:67-74.
34. Ameismeier F. Ultrastructure of the chemosensitive
23. Catalá S, Maida DM, Caro-Riaño H, Jaramillo N, basiconic single-walled walled-pore sensilla on the
Moreno J. Changes associated with laboratory rearing antennae in adults and embryonic stages of Locusta
in antennal sensilla patterns of Triatoma infestans , migratoria L (Insecta, Orthoptera). Cell Tissue Res
Rhodnius prolixus , and Rhodnius pallescens 1987;247:605-12.
(Hemiptera, Reduviidae, Triatominae). Mem Inst
Oswaldo Cruz 2004;99:25-30. 35. Ma WC, Visser JH. Single unit analysis of odor quality
coding by the olfactory antennal receptor system of
24. Chapman RF. Chemoreception: The significance of Colorado beetle. Entomol Exp Appl 1987;24:520-33.
receptors numbers. Adv Insect Physiol 1982;16:
247-333. 36. Mustaparta H. Responses of single olfactory cells in
the pine weevil Hylobius abietis L: (Col: Curculionidae).
25. Bland RG. Antennal sensilla of Acrididae (Orthoptera) J Comp Physiol 1975;97:271-90.
in relation to subfamily and food preference. Ann Entomol
Soc Am 1989;82:368-84. 37. Ocheing SA, Hallberg E, Hansson BS. Fine structure
and distribution of antennal sensilla of the desert locust,
26. Carbajal de la Fuente AL, Catalá S. Relationship Schistocerca gregaria (Orthoptera: Acrididae). Cell
between antennal sensilla pattern and habitat in six Tissue Res 1998;291:525-36.
species of Triatominae . Mem Inst Oswaldo Cruz
2002;97:1121-5. 38. Schofield CJ. Biosystematics of the Triatominae. En:
Service M editor. Biosystematics of Haematophagous
27. Chen HH, Zhao YX, Kang L. Antennal sensilla of insects. Vol 37. Oxford: Clarendon Press; 1998.p.284-312.
grasshoppers (Orthoptera: Acrididae) in relation to
preferences and habits. J Biosci 2003;28:743-52. 39. Dumontiel E, Gourbiere S, Barrera-Pérez M,
Rodriguez-Félix E, Ruíz-Piña H, Baños-López O,
28. Castrejón-Gómez VR, Valdez-Carrasco J, Cibrian- et al. Geographic distribution of Triatoma dimidiata and
Tovar J, Camino-Lavin M, Osorio O. Morphology transmission dynamics of Trypanosoma cruzi in the
and distribution of the sense organs of the antennae of Yucatan Peninsula of Mexico. Am J Trop Med Hyg
Copitarsia consueta (Lepidoptera: Noctuidae). Fla 2002;67:176-83.
Entomol 1999;82:546-55.
40. Dujardin JP, Bermudez H, Casini C, Schofield CJ,
29. Moreno ML, Gorla D, Catalá S. Association between Tibayrenc M. Metric differences between sylvatic and
antennal phenotype, wing polymorphism and sex the domestic Triatoma infestans (Heteroptera:Reduviidae)
genus Mepraia (Reduviidae: Triatominae). Infect Genet in Bolivia. J Med Entomol 1997;34:544-51.
Evol 2006;6:228-34.
41. Bustamante DM, Monroy C, Menes M, Rodas A,
30. Monroy MC, Bustamante DM, Rodas AG, Enriquez Salazar-Schettino PM, Rojas G, et al. Metric variation
ME, Rosales RG. Habitats, dispersion and invasion of among geographic populations of the Chagas vector
sylvatic Triatoma dimidiata (Hemiptera: Reduviidae) in Triatoma dimidiata (Hemiptera:Reduviidae: Triatominae)
Petén, Guatemala. J Med Entomol 2003;40:800-6. and some related species. J Med Entomol 2004;41:
296-301.

100
Biomédica 2007;27(supl.1):101-9 Patrones de alimentación y defecación de Rhodnius

ARTÍCULO ORIGINAL

Comparación de los patrones de alimentación y defecación de


Rhodnius colombiensis y Rhodnius prolixus (Hemiptera,
Reduviidae, Triatominae) en condiciones de laboratorio
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Jairo A. Clavijo 3,
Gustavo Adolfo Vallejo 1
1
Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima,
Ibagué, Colombia.
2
Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá
D.C., Colombia.
3
Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué,
Colombia.

Introducción. Rhodnius colombiensis ocasionalmente ingresa a las viviendas humanas por lo


cual se ha sugerido que podría desempeñar un importante papel en la transmisión de la
tripanosomiasis americana.
Objetivo. Definir el desempeño de R. colombiensis como vector, comparando los patrones de
alimentación y defecación con los de R. prolixus, el principal vector domiciliado de Trypanosoma
cruzi en Colombia.
Materiales y métodos. Para cada estadio de R. colombiensis y R. prolixus se estudió el tiempo
promedio para iniciar la picada, el tiempo para alcanzar la repleción, el número de interrupciones
y defecaciones durante la comida, el tiempo transcurrido entre el fin de la alimentación y la
primera defecación, el número de defecaciones durante 10, 60 y 95 min después de la comida
y la cantidad de sangre ingerida.
Resultados. El tiempo promedio para iniciar la picada de las ninfas N5, machos y hembras
presentaron diferencias significativas entre las dos especies. El promedio de defecaciones
por insecto durante los 10 min después de la alimentación fue mayor para cada estadio de R.
prolixus y presentó diferencias significativas con R. colombiensis. Por otro lado, el peso
promedio de sangre ingerida por R. colombiensis y R. prolixus en cada estadio presentó
diferencias significativas en N1, N2, N5 y hembras.
Conclusión. R. colombiensis presenta menor número de defecaciones que R. prolixus durante
la comida. Un mayor porcentaje de R. prolixus defecan durante los 10, 60 y 95 min después de
la alimentación. Sin embargo, R. colombiensis permanece mayor tiempo asociado al hospedero
vertebrado, lo cual aumentaría la probabilidad de transmisión teniendo en cuenta el ingreso
ocasional de los adultos a las viviendas humanas y sus elevadas prevalencias con T. cruzi y T.
rangeli.
Palabras clave: Rhodnius/fisiología, defecación, crecimiento y desarrollo, Trypanosoma,
enfermedad de Chagas.
Comparison of feeding and defecation patterns of Rhodnius colombiensis and Rhodnius
prolixus (Hemiptera, Reduviidae, Triatominae) under laboratory conditions.
Introduction. Rhodnius colombiensis occasionally comes into human dwellings and
consequently its role as an important potential vector in the transmission of American
trypanosomiasis has been suggested.
Objective. The potential role of R. colombiensis as vector was defined by comparing the feeding
and defecation patterns between R. colombiensis and R. prolixus, the main domiciliary vector
of Trypanosoma cruzi in Colombia.
Materials and methods. For each developmental stage of R. colombiensis and R. prolixus the
following data were collected: (1) time of feeding initiation, (2) the time for reaching the repletion,

101
Arévalo A., Carranza J.C., Guhl F. Biomédica 2007;27(supl.1):101-9

(3) the number of interruptions and defecations during the feeding, (4) the time between the
end of the feeding and the first defecation, (5) the number of defecations during 10, 60 and 95
minutes of observation after feeding, and (6) the quantity of blood ingested.
Results. The mean time of feeding initiation of the fifth instar nymphs, males and females,
showed significant differences between the two species. The average of insects that defecated
within 10 minutes after feeding was higher for each successive stage of R. prolixus and showed
significant differences with Rhodnius colombiensis . In contrast, the mean weight of blood
ingested by each stage of R. colombiensis and R. prolixus was significantly different between
the N1, N2, N5 and females of these species.
Conclusion. Rhodnius colombiensis produced fewer defecations than R. prolixus during feeding.
A higher percentage of R. prolixus defecated within 10, 60 and 95 minutes after feeding.
However, R. colombiensis remains a longer time in contact with the vertebrate host, thus raising
the probability of its role in transmission considering its occasional entry to human dwellings
and its higher prevalences of infection withT. cruzi and T. rangeli.
Key words: Rhodnius, physiology, defecation, growth and development, Trypanosoma, Chagas
disease.
El género Rhodnius incluye 16 especies, en gran importancia para comprender la dinámica de
algunas de las cuales se han descrito las transmisión de T. cruzi. Varios autores han demos-
características biológicas, bioquímicas y trado que algunas especies de triatominos no
moleculares (1). R. colombiensis es una especie defecan durante, ni tampoco inmediatamente
recientemente descrita, que con R. pallescens y después de la comida, mientras que otras especies
R. ecuadoriensis conforman el grupo “pallescens” son muy eficientes en la transmisión de T. cruzi
de la cordillera de los Andes en el noroeste de debido a las altas tasas de defecación durante el
América del Sur (2). Por otro lado, R. colombiensis alimento y durante los primeros minutos después
se ha encontrado asociada a las palmas de vino de la alimentación (4). Estas diferencias en los
(Attalea butyraceae) en la cuenca alta del valle patrones de alimentación y de defecación podrían
del río Magdalena en la región central de Colombia explicar, al menos en parte, las diferencias en las
(3), constituyendo un posible riesgo en la prevalencias de T. cruzi en humanos y en reservorios
transmisión de la enfermedad de Chagas, pues en diferentes regiones de América Latina.
esta especie ocasionalmente ingresa a las
viviendas, presentando elevadas prevalencias de Para contribuir al conocimiento de la biología y el
T. cruzi y T. rangeli (Vallejo GA, Lozano LE, papel de R. colombiensis en la transmisión de la
Carranza JC, Sánchez JL, Jaramillo JC, Guhl F, enfermedad de Chagas en la región central de
et al. Ecología de los triatominos no domiciliados Colombia, se estudió para cada estadio de
en Colombia con especial referencia a Rhodnius desarrollo el tiempo promedio para iniciar la picada,
colombiensis en el departamento del Tolima. En: el tiempo de alimentación hasta la repleción, el
Vallejo GA, Carranza JC y Jaramillo JC editores. número de interrupciones y defecaciones durante
Curso Taller Internacional: Biología, Epidemiología la comida, el intervalo entre el fin de la alimentación
y Control de la Tripanosomosis Americana y y la primera defecación, el número de defeca-
Leishmaniosis. Ibagué, Colombia 2000; p.1-134). ciones durante 10, 60 y 95 minutos de observación
después de la comida y la cantidad de sangre
Los estudios sobre el comportamiento de los ingerida. Con fines comparativos, estos mismos
triatominos durante la toma del alimento son de parámetros se estudiaron en los diferentes
estadios de desarrollo de R. prolixus, especie
Correspondencia:
Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en domiciliada que se encuentra en simpatría con R.
Parasitología Tropical, Facultad de Ciencias, Universidad colombiensis en la cuenca alta del río Magdalena.
del Tolima, A.A. 546, Ibagué, Colombia. Fax (+57-8)
2669176. Materiales y métodos
gvallejo@ut.edu.co R. colombiensis fueron capturados en palmas de
Recibido: 14/03/06; aceptado: 19/05/06 Attalea butyracea y R. prolixus domiciliados

102
Biomédica 2007;27(supl.1):101-9 Patrones de alimentación y defecación de Rhodnius

fueron capturados en la vereda Totarco-Tamarindo repleción se cronometró, se calculó el promedio


en el municipio de Coyaima, departamento del de defecaciones durante la comida, así mismo,
Tolima (Colombia central). Las colonias de ambas se contaron las interrupciones y las defecaciones
especies se mantuvieron a una temperatura de durante y después de la comida.
28 ± 1°C, humedad relativa de 75 a 80% y
Cantidad de sangre ingerida
fotoperiodicidad de 12/12 horas en una incubadora
automática B.O.D. Lab-Line. Los insectos fueron En un experimento independiente se calculó la
alimentados con sangre de gallina semanalmente. cantidad de sangre ingerida, para lo cual se
utilizaron 210 R. colombiensis y 210 R. prolixus
Se compararon las variables sobre alimentación
y defecación de R. colombiernsis y R. prolixus en (30 por cada estadio de desarrollo). Los insectos
tres etapas experimentales. En la primera etapa fueron sometidos a 15 días de ayuno, pesados
se estudió el comportamiento de los insectos antes y después de la alimentación en una balanza
durante el tiempo en que permanecieron tomando analítica y alimentados con sangre de gallina.
el alimento sobre ratones ICR, para lo cual se Cada individuo se colocó en un vial previamente
midió el tiempo promedio de picada, el tiempo marcado para llevar el correspondiente registro.
promedio para alcanzar la repleción, el promedio Análisis estadístico
de interrupciones por insecto y el promedio de
defecaciones durante la comida. En la segunda Para cada variable se calcularon las medias con
etapa se estudiaron los patrones de defecación los respectivos intervalos de 95% de confianza.
después de la comida, calculándose el tiempo Se utilizó análisis multivariado de varianza
promedio para defecar por primera vez después (MANOVA) para comparar los promedios de las
de la comida y el promedio de defecaciones durante variables en cada estadio de desarrollo de las dos
10, 60 y 95 min. En la tercera etapa se calculó el especies. Para los patrones de alimentación, de
peso y volumen de sangre ingerida en promedio defecación y la cantidad de sangre ingerida de
por cada estadio de R. colombiensis y R. prolixus las ninfas se usó un diseño factorial 5x2
y se estimó el número de veces que cada estadio balanceado con 30 réplicas. Para los patrones
aumentó su peso después de la comida. de alimentación y defecación de los adultos, el
diseño factorial fue 2x2 desbalanceado. Para la
Patrones de alimentación y defecación cantidad de sangre ingerida por los adultos se
Para R. colombiensis se utilizaron 30 individuos utilizó un diseño factorial 2x2 balanceado. Para
de cada estadio, incluidos machos y hembras, las comparaciones se realizó la prueba de Duncan.
para un total de 210 insectos. Para R. prolixus, El software utilizado fue SAS versión 8.2.
se utilizaron 203 insectos (30 N1; 30 N2; 30 N3; Resultados
30 N4; 30 N5; 30 machos y 23 hembras). Cada
individuo fue identificado con marcas de tinta
Patrones de alimentación y defecación durante
la comida
blanca en el dorso para facilitar la observación.
En el cuadro 1 se presentan los resultados del
Grupos de tres a seis insectos fueron alimentados
comportamiento de R. colombiensis y R. prolixus
hasta la repleción sobre ratones ICR sedados con
durante la comida. Se observó que los tiempos
maleato de acepromacina e inmovilizados con una
promedios antes de iniciar la picada (tiempo de
malla de nylon. Cada ratón fue puesto en un
ataque), no presentaron diferencias significativas
recipiente transparente y sujeto con cinta de
entre las dos especies cuando se compararon las
enmascarar para evitar movimientos bruscos. Los
N1, N2, N3 y N4; sin embargo, el tiempo promedio
insectos se dejaron en el contenedor entre 60 y
de ataque de N5, machos y hembras, en R.
180 minutos en un cuarto ligeramente oscuro con
colombiensis fue mayor que en R. prolixus, con
una temperatura promedio de 28°C y un mismo
diferencias significativas entre las dos especies.
observador los monitorizó continuamente sin
mover el recipiente durante el experimento. Los El tiempo promedio para alcanzar la repleción
tiempos para iniciar la picada y para alcanzar la fue mayor en N2 y N5 R. colombiensis, con

103
Arévalo A., Carranza J.C., Guhl F. Biomédica 2007;27(supl.1):101-9

Cuadro 1. Comparación del tiempo para iniciar la comida (tiempo de ataque), tiempo de comida hasta repleción, interrupciones y defecaciones
durante la alimentación de Rhodnius colombiensis y Rhodnius prolixus sobre ratón Mus musculus. El tiempo está expresado en minutos:segundos.

Tiempo de ataque Tiempo para comer hasta repleción Interrupciones por insecto Defecaciones durante la comida
Estadio (intervalo de confianza del 95%) (intervalo de confianza del 95%) (intervalo de confianza del 95%) (intervalo de confianza del 95%)

Rhodnius Rhodnius Valores Rhodnius Rhodnius Valores Rhodnius Rhodnius Valores Rhodnius Rhodnius Valores
colombiensis prolixus p colombiensis prolixus p colombiensis prolixus p colombiensis prolixus p

N1 0:10,5 0:7 13:3 12:31,8 0,07 0,3


(0* - 0:27,7) (0:2,8 – 0:11,2) 0,6867 (10:6,3 – 15:59,7) (10:0,9 – 15:2,7) 0,7851 0 0,3 (0,02 – 0,6) 0,0324 (0 – 0,2) (0,03 – 0,5) 0,1169

N2 0:7,1 0:1,7 13:57 10:11,2 0,2


(0:0,5 – 0:13,7) (0:1,1 – 0:2,4) 0,1025 (10:39,4 – 17:14,5) (9:1,8 – 11: 20,5) 0,0315 0,3 (0* - 0,7) 0,3 (0,02 – 0,6) 0,9018 0 (0,04 – 0,4) 0,0139

N3 0:4,4 0:4,9 13: 56,4 14:51 0,4


(0:1,4 – 0:7,4) (0:1,8- 0:8,1) 0,8144 (11:31,6 – 16:21,2) (12:29 -17:13,3) 0,5854 0,2 (0* - 0,4) 0,8 (0,4 – 1,3) 0,0145 0 (0,2 – 0,6) 0,0006

N4 1:8,1 0:23 22:12 18:44,4 0,8


(0:25,2 – 1: 50,9) (0:4,1 – 0:41,9) 0,0538 (18:8- 26:16) (15:21- 22: 7,8) 0,1866 0,3 (0,05 - 0,5) 0,5 (0,2 – 0,9) 0,2148 0 (0,1 – 1,4) 0,0214

N5 3:33,4 1:39 30:48 23:13,3 0,4


(2:13,1- 4: 53,8) (0:35,1 – 2: 42,1) 0,0255 (25:35 – 36:1) (18:48,3 – 27:38,3) 0,0271 1,5 (0,4 - 2,6) 0,9 (0,4 – 1,5) 0,4045 0 (0,04 – 0,8) 0,0274

Hembras 1:56 0:14,9 20:21,3 19:13 0,3


(0:49,1 – 3:2,8) (0* - 0:38,6) 0,0118 (14:21,1 – 26:21,4) (13:20,1 – 25:5) 0,7847 1,5 (0,8 - 2,1) 1,5 (0,9 – 2,1) 0.9785 0 (0 – 0,8) 0,1034

Machos 1:48 0:8,2 19:23,1 13:36 0,03


(0:7,1- 3:29) (0:0,05 – 0:16,3) 0,0484 (13:30,3 – 25:16) (10:51- 16:21,2) 0,0736 1,1 (0,3 – 1,9) 0,7 (0,4 – 0,9) 0,3032 (0 – 0,1) 0 0,3215

diferencias significativas entre las dos especies durante los primeros 10 minutos fue mayor en
(cuadro 1). todos los estadios de R. prolixus, presentando
diferencias significativas con los estadios de R.
De acuerdo a las observaciones realizadas, la
colombiensis . Así mismo, el promedio de
mayoría de los estadios de desarrollo de R.
defecaciones acumuladas por insecto durante 60
colombiensis y R. prolixus interrumpieron la toma
minutos de observación fue mayor en R. prolixus,
del alimento; la única excepción fue N1 de R.
presentando diferencias significativas con las N1,
colombiensis, pues ningún insecto de este estadio
N3, N4, N5 y hembras de R. colombiensis. De
interrumpió su alimentación. El promedio de
igual manera, después de 95 minutos de
interrupciones por insecto entre R. colombiensis
observación, el promedio de defecaciones
y R. prolixus presentó diferencias significativas
acumuladas por insecto fue mayor en R. prolixus,
en N1 y N3.
presentando diferencias significativas con N1, N3,
Por otro lado, el promedio de defecaciones por N4, N5, hembras y machos de R. colombiensis
insecto durante la comida fue mayor en R. prolixus, (cuadro 2).
presentando diferencias significativas con los
Cantidad de sangre ingerida
mismos estadios de R. colombiensis; los N1, las
hembras y los machos no presentaron diferencias La comparación de la sangre ingerida por los
significativas al comparar el promedio de defeca- distintos estadios de R. colombiensis y de R.
ciones durante la comida en las dos especies. prolixus se muestra en el cuadro 3. El peso
promedio y el volumen promedio de sangre ingerida
Patrones de defecación después de la comida
presentó diferencias significativas entre N1, N2,
El cuadro 2 presenta los patrones de defecación N5 y hembras de las dos especies; las ninfas N3,
de R. colombiensis y R. prolixus después de la N4 y los machos no presentaron diferencias
toma del alimento. El tiempo promedio para significativas en el peso y volumen de sangre
defecar por primera vez después de la toma del ingerida. Con relación al número de veces que
alimento fue mayor en todos los estadios de R. cada estadio aumentó su peso inicial después de
colombiensis , presentando diferencias la comida, se observaron diferencias significativas
significativas con los estadios de R. prolixus. Por entre las N2, N5 y hembras; los demás estadios
otro lado, el promedio de defecaciones por insecto no presentaron diferencias significativas. Las N5

104
Biomédica 2007;27(supl.1):101-9 Patrones de alimentación y defecación de Rhodnius

Cuadro 2. Comparación del tiempo para defecar por primera vez después de la comida; defecaciones después de diez
minutos, una hora y noventa y cinco minutos entre Rhodnius colombiensis y R. prolixus. El tiempo está expresado en
minutos:segundos. Las diferencias fueron significativas cuando p < 0,05.

Tiempo para defecar por primera vez Defecaciones por insecto durante Defecaciones por insecto durante Defecaciones por insecto durante
después de la comida. los primeros 10 minutos la primera hora durante los 95 minutos
(intervalo de confianza del 95%) (intervalo de confianza del 95%) (intervalo de confianza del 95%) (intervalo de confianza del 95%)

Estadio Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius


colombiensis prolixus Valores p colombiensis prolixus Valores p colombiensis prolixus Valores p colombiensis prolixus Valores p

N1 38:12,6 11:10,8 0,07 0,8 2,3 3,7 3,7 5,5


(29:23 – 47:2,6) (7:4,2 – 15:17,4) 0,0001 (0 – 0,2) (0,5 – 1,0) 0,0001 (1,6 – 2,9) (2,8 – 4,4) 0,0109 (2,8-4,5) (4,6-6,5) 0,0044

N2 30:32,4 11:37,2 0,07 0,9 2,3 3,2 4,2 4,8


(23:0,8 – 38:3,9) (5:54,9 – 17:19,5) 0,0001 (0 – 0,2) (0,6 – 1,1) 0,0001 (1,8 – 2,9) (2,3 – 4) 0,0897 (3,4-5,1) (3,7-5,8) 0,4329

N3 33:48 11:46 0,1 0,9 1 2,1 3,8 3,8 5,7


(26:16,5 – 41:20) (6:22,9 – 17:8,3) 0,0001 (0 – 0,2) (0,2 – 0,6) 0.0001 (1,5 – 2,6) (3,6 – 4,5) 0,0001 (3,1-4,4) (4,9-6,6) 0,0004

N4 54:46 9:54,8 0,03 0,8 1 3,0 2,1 4,1


(43:13,4 – 66:18,2) (3:7 – 16:42,5) 0.0001 (0 – 0,1) (0,6 – 1,1) 0,0001 0,6 – 1,4) (2,4 – 3,5) 0,0001 (1,4-2,7) (3,4-4,8) 0,0001

N5 53:43,5 12:3,6 0,07 0,8 0,7 4,6 1,7 6,4


(42:0,7 – 65:26,2) (4:58,6 – 19:8,7) 0.0001 (0 – 0,2) (0,5 – 1,1) 0,0001 (0,4 – 1) (3,6 – 5,7) 0,0001 (1,2-2,2) (5,0-7,7) 0,0001

Hembras 58:27,1 22:22 0,07 0,9 0,7 3,7 1,5 5,5


(48:22,1 – 68:32) (7:7 – 37:37) 0,0001 (0 – 0,2) (0,6 – 1,2) 0.0001 (0,3 – 0,9) (2,5 – 5) 0,0001 (1,0-2,0) (3,9-7,0) 0,0001

Machos 68:28,2 47:34 0,03 0,4 0,7 1,5 1,3 2,6


(57:24,4 – 79:32) (33:32 – 61:35) 0,0199 (0 – 0,1) (0,1 – 0,6) 0,0108 (0,3 – 1,1) (0,8 – 2,1) 0,0501 (0,7-1,9) (1,7-3,5) 0,0240

Cuadro 3. Comparación de la cantidad de sangre ingerida por cada estadio de desarrollo de Rhodnius colombiensis y
Rhodnius prolixus. El nivel de significación es de 0,05. Las diferencias fueron significativas cuando p < 0,05.

Estadios Promedio de sangre ingerida (mg) Volumen de sangre ingerida (µl) Número de veces que aumenta su
Variables (Intervalo de confianza del 95%) (Intervalo de confianza del 95%) peso inicial después de la comida
(Intervalo de confianza del 95%

Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius Rhodnius


colombiensis prolixus Valores p colombiensis prolixus Valores p colombiensis prolixus Valores p

N1 3,3 2,9 3,1 2,8 7,7 7,7


(3,0 - 3,5) (2,9 - 3,1) 0,0339 (2,8 – 3,3) (2,7 – 2,9) 0,0338 (6,6 – 8,7) (6,9 – 8,4) 0,9842

N2 9,4 10,6 8,7 10,1 7 8,9


(8,6 - 10,2) (9,7 - 11,5) 0,0445 (7,7 – 9,6) (9,3 – 11) 0,0205 (6,4 – 7,7) (8,0 – 9,7) 0.0009

N3 27,8 30,1 26,7 28,9 8,8 8,4


(24,8 - 30,8) (27,3 - 32,9) 0,2425 (23,8 – 29,5) (26,3 – 31,6) 0,2387 (7,8 – 9,7) (7,7 – 9,0) 0,4424

N4 74,3 77,6 71,5 74,6 8,5 8,2


(64,4 - 84,2) (70,8 - 84,4) 0,5789 (62 - 81) (68,1 – 81,2) 0,58 (7,4 – 9,6) (7,3 – 9,0) 0,6386
N5 237,9 207 228,9 199,2 8,6 7,4
(215,7 - 260,2) (188,4 - 225,6) 0,0332 (207,6 – 250,4)(181,3 – 217,1) 0,0332 (7,6 - 9,6) (6,7 – 8,1) 0,0444

Hembras 99,6 122,8 95,8 118,2 2,2 2,9


(82,6 - 116,6) (110,4 - 135,2) 0,0281 (79,4 – 112,2) (106,2 – 130,1) 0,0280 (1,9 – 2,6) (2,6 – 3,2) 0,0054

Machos 65,4 69,4 62,9 66,7 2 2,2


(57,6 - 73,3) (60 - 78,7) 0,5137 (55,4 – 70,5) (57,7 – 75,7) 0,5147 (1,9 – 2,2) (2 – 2,5) 0,1249

de las dos especies fueron los estadios con mayor Discusión


avidez por el alimento, pues ingirieron entre dos y
Patrones de alimentación y defecación durante
tres veces más sangre que el promedio de los
la comida
adultos. En los adultos de ambas especies, los
machos ingirieron menos sangre que las hembras La comparación entre R. colombiensis y R.
(cuadro 3). prolixus mostró evidentes diferencias en los

105
Arévalo A., Carranza J.C., Guhl F. Biomédica 2007;27(supl.1):101-9

patrones de alimentación y defecación entre las difícil debido a las diferencias en variables
dos especies y entre los diferentes estadios dentro experimentales como la temperatura ambiente,
de cada especie. Una interesante observación fue humedad relativa y fuente de alimento, o al uso
que las ninfas N1, N2, N3 y N4 de R. colombiensis de pequeños números de insectos, entre otras.
y R. prolixus no presentaron diferencias Adicionalmente, existen variaciones inter e
significativas en el tiempo promedio para iniciar intraespecíficas en el comportamiento de
la picada sobre ratones ICR, mostrando el mismo triatominos como Triatoma dimidiata, en la que
grado de avidez por la toma del alimento en las se observó que las ninfas de primer estadio son
condiciones experimentales utilizadas. Por otro más tímidas para iniciar la picada que los
lado, las N5, los machos y las hembras de R. restantes estadios (4). Por otro lado, Rocha da
prolixus iniciaron más rápido la toma del alimento Silva D. et al mostraron que los adultos de R.
que los mismos estadios de R. colombiensis pictipes presentan mayor timidez y que, por lo
(cuadro 1). Aunque los adultos de R. colombiensis tanto, en ellos transcurre mayor tiempo entre el
son más tímidos para la toma del alimento, ofrecimiento de la comida y la picada (6).
ingresan a las viviendas atraídos por la luz o por Igualmente se observó en los adultos de T.
diferentes fuentes de alimento. La frecuencia con brasilensis un mayor tiempo entre el ofrecimiento
que los adultos de R. colombiensis ingresan a las de la comida y la picada que en los demás estados
viviendas fue confirmada en la encuesta ninfales; en T. pseudomaculata las N4 fueron más
entomológica realizada en el departamento del tímidas para la toma del alimento que los demás
Tolima en el año 2000, en la cual se capturaron estadios ninfales (7). Una posible causa de esta
adultos de R. colombiensis en el interior de las variabilidad en el comportamiento de los
viviendas de los municipios de Alvarado, Carmen triatominos con relación al tiempo transcurrido
de Apicalá, Coyaima, Coello, Guamo, Ibagué, entre el ofrecimiento de la comida y la picada
Icononzo, Lérida, Libano, Ortega, Prado, podría ser la fuente de alimento, como fue sugerido
Purificación, Santa Isabel y San Luis, los cuales por Martínez-Ibarra et al., quienes observaron que
constituían el 33% de los municipios encuestados cuando Meccus picturatus es alimentado sobre
(Guhl F et al. Implementación de la Etapa III del gallinas, los adultos son más tímidos para iniciar
Programa Nacional de Prevención y Control de la la picada que los restantes estadios ninfales, pero
Enfermedad de Chagas y la Cardiopatía Infantil. cuando esta misma especie es alimentada sobre
Región Centro Oriental: Departamento del Tolima. conejos, las N4 son las más tímidas (8).
Informe Final. Universidad de los Andes). Previas
observaciones en el municipio de Coyaima, El tiempo desde la picada hasta la repleción total
Tolima, mostraron que en R. colombiensis adultos del insecto fue mayor en R. colombiensis, que
capturados en el interior de las viviendas y en presentó diferencias significativas con las N2 y
adultos capturados en las palmas aledañas a las N5 de R. prolixus; en los demás estadios de
viviendas, la infección por T. cruzi alcanzó una desarrollo no se presentaron diferencias
prevalencia del 98% (datos no publicados). Por significativas. En el presente trabajo se destaca
otro lado, el examen de 396 R. prolixus el hecho de que las N5 de R. colombiensis y de
domiciliados en la misma área geográfica mostró R. prolixus presentaron el mayor tiempo para
una prevalencia general del 3,03% de T. cruzi (5). obtener la repleción; otros autores también han
reportado que las N5 de diferentes especies gastan
De conformidad con lo anterior se podría esperar mayor tiempo para la repleción, como fue
que cualquier adulto de R. colombiensis que logre observado en N5 de T. dimidata y R. prolixus (4),
picar y defecar sobre un vertebrado del domicilio N5 de T. brasiliensis y T. seudomaculata (7) y N5
humano presentaría mayor probabilidad para la de M. picturatus (8). Una explicación a este
transmisión de T. cruzi que las ninfas y los adultos especial comportamiento de las N5 estaría
de R. prolixus domiciliados en esta región. relacionada con que precisamente las N5 son los
La comparación de los datos obtenidos en el estadios que mayor cantidad de sangre ingieren
presente estudio con datos de otros autores es con relación a todos los demás estadios de

106
Biomédica 2007;27(supl.1):101-9 Patrones de alimentación y defecación de Rhodnius

desarrollo, lo que a su vez demanda mayor tiempo machos. Así mismo, el mayor promedio de
para alcanzar la repleción, pues las N5 requieren interrupciones durante la comida lo exhibieron las
una suficiente cantidad de alimento para la N5 y las hembras, pero en estos estadios no se
adquisición de nuevas estructuras anatómicas llevó a cabo ninguna defecación durante la toma
durante la muda al estado adulto. Los tiempos del alimento (cuadro 1). El patrón descrito mostró
para alcanzar la repleción disminuyeron en los que no existe una relación directa entre el número
adultos de ambos sexos de R. colombiensis y R. de interrupciones y el número de defecaciones
prolixus; de igual manera, se observó disminución durante la comida en R. colombiensis, es decir
en los adultos de T. dimidiata, T. infestans y R. que existieron individuos que defecaron durante
prolixus (4), T. brasiliensis y T. pseudomaculata (7). la alimentación sin interrumpir tal proceso, o que
Trabajos previos también mostraron una extensa lo interrumpieron sin efectuar ninguna defecación
variación, puesto que el tiempo hasta la repleción durante éste. En R. prolixus se observó que el
se ve afectado por el tipo de alimento y por el promedio de defecaciones durante la toma del
tamaño de la especie del insecto, entre otras alimento fue mayor y presentó diferencias
variables. En este orden de ideas, Zeledón et al. significativas con N2, N3, N4 y N5 de R.
(4) mostraron que los promedios generales del cololombiensis . Por otro lado, en todos los
tiempo para alcanzar la repleción son mayores estadios de R. prolixus se presentaron
en T. dimidiata y T. infestans que en R. prolixus. interrupciones durante la comida, indicando una
posible relación entre las interrupciones y las
Algunos autores plantean una relación directa
defecaciones durante la comida. Esta diferencia
entre los patrones de defecación antes de finalizar
entre R. prolixus y R. colombiensis en relación
la comida y las frecuentes interrupciones durante
ésta, como sucede con T. dimidiata (4). Por otro con el número de defecaciones durante la toma
lado, se pueden presentar variaciones en las del alimento indica que durante la toma del
interrupciones durante el proceso de alimentación, alimento R. prolixus tiene mayor probabilidad de
incluso entre las mismas especies, posiblemente transmisión de T. cruzi que R. colombiensis.
por el origen de la cepa o por la temperatura bajo Patrones de defecación después de la comida
la cual se realizan las observaciones (4,9). Para
explicar la razón de las interrupciones se han Como se observó en el cuadro 2, el promedio de
observado las señales eléctricas de la bomba defecaciones por insecto durante los primeros 10,
cibarial de varias especies de Rhodnius cuando 60 y 95 minutos después de la comida fue mayor
ésta se contrae para succionar la sangre. Se en R. prolixus y presentó diferencias significativas
concluyó que las interrupciones probablemente se con R. colombiensis. Por otro lado, al igual que
deben al hallazgo de otro vaso sanguíneo por parte en otros estudios, se observó que los patrones
del vector, ya que en muchas ocasiones el proceso más bajos de defecación los presentaron los
de alimentación fue interrumpido aun sin retirar el machos en las dos especies estudiadas (4,10-12).
rostro del huésped, lo cual se verificó por señales Sin embargo, el comportamiento de las dos
eléctricas irregulares en la bomba cibarial (Viana especies después de la toma del alimento puede
Sant’ Anna MR, Diotaiuti L, Figueiredo Gontijo A, afectar la eficiencia de la transmisión de T. cruzi.
Figueiredo Gontijo N, Pereira MH. Feeding Se observó que independientemente del estadio,
behaviour of morphologically similar Rhodnius cuando R. prolixus finaliza la toma del alimento
species (Hemiptera: Reduviidae): influence of
huye velozmente, pues está adaptado para
mechanical characteristics and salivary function.
refugiarse en grietas o en estructuras anexas al
En: Guhl F, Schofield CJ, editors. Cuarto Taller
domicilio, de manera que las defecaciones
Internacional sobre Genética Poblacional y Control
después de la toma del alimento son depositadas
de Triatominos (ECLAT 4). Punta Iguana,
lejos del huésped vertebrado, principalmente en
Cartagena, Colombia, 2002. p. 139-50).
paredes y techos de palma. Por el contrario,
Los únicos estadios de R. colombiensis que cuando R. colombiensis finaliza la toma del
defecaron durante la comida fueron las N1 y los alimento, permanece junto al huésped. Este

107
Arévalo A., Carranza J.C., Guhl F. Biomédica 2007;27(supl.1):101-9

comportamiento podría explicarse porque en de la cantidad de sangre ingerida llegaron a


condiciones naturales vive estrechamente duplicar la cantidad ingerida por las hembras y a
asociado a nidos de Didelphis marsupialis, en triplicar la ingerida por los machos.
espacios muy reducidos conformados por las
La cantidad de sangre que ingiere R. colombiensis
brácteas de las palmas de vino A. butyraceae, y
es similar a la que ingieren otras especies
permanece y defeca muy cerca o sobre el huésped
selváticas como R. pictipes alimentado
vertebrado. De esta manera, R. colombiensis
artificialmente y sobre ratón (13) y R. brethesi (17).
compensaría la falta de defecación durante el
alimento, asegurando una eficiente transmisión Cuando se comparan los patrones de alimentación
para D. marsupialis, en la que se han observado y defecación de R. colombiensis con los de R.
prevalencias del 89% de T. cruzi en individuos prolixus, se observa que esta última especie
capturados en Coyaima (Tolima) (datos no presenta un comportamiento que favorece la
publicados). transmisión de T. cruzi, por cuanto R. prolixus
presenta mayor número de defecaciones durante
Como se mencionó anteriormente, el promedio de la comida y un mayor porcentaje de insectos que
defecaciones durante la toma del alimento defecan durante los primeros 10, 60 y 95 minutos
promueve la transmisión de T. cruzi directamente después la alimentación. Aunque R. colombiensis
sobre el vertebrado por parte de R. prolixus, pero presenta menor número de defecaciones que R.
en menor grado por R. colombiensis. Sin embargo, prolixus, es necesario tener en cuenta que R.
aunque el promedio de defecaciones después de colombiensis permanece mayor tiempo cerca del
10, 60 y 95 minutos es mayor en R. prolixus que hospedero vertebrado, aumentando así la
en R. colombiensis, las diferencias en el compor- probabilidad de transmitir T. cruzi al vertebrado.
tamiento entre las dos especies podrían afectar
la eficiencia de la transmisión, pues como se De las 15 especies de Rhodnius descritas, tres
mencionó, R. prolixus huye del huésped y R. de ellas se encuentran comúnmente en ambientes
colombiensis permanece cerca de él, de manera domésticos (R. prolixus , R. pallescens y R.
que después de la toma del alimento compensaría ecuadoriensis); las demás especies se registran
su eficiencia para la transmisión del parásito. principalmente en ambientes arbóreos como las
Aunque no existen datos sobre la relación de R. brácteas de las palmas y las bromelias. Sin
colombiensis y los vertebrados domésticos, embargo, desde hace varias décadas, en varios
asumimos que cuando adultos de R. colombiensis países de América Latina se ha señalado el
ingresan esporádicamente al interior de las comportamiento de varias especies de Rhodnius
viviendas humanas, podrían permanecer cerca de que ingresan a las viviendas con frecuencias
progresivas, entre las que se destacan R.
los vertebrados, aumentando así la probabilidad
neglectus, R. pictipes y R. nasutus (18). Más
de transmisión de T. cruzi.
recientemente se presentaron evidencias sobre
Cantidad de sangre ingerida el papel putativo de R. robustus como vector
La cantidad y calidad del alimento ingerido es extradomiciliario de la enfermedad de Chagas en
importante en el desarrollo de los triatominos el occidente de Venezuela, pues esta especie es
atraída por la luz artificial, y la transmisión de T.
debido a que el número de huevos producidos por
las hembras está directamente relacionado con
cruzi podría ocurrir cuando se alimenta sobre las
personas de las viviendas (19).
la cantidad de sangre ingerida (13-16). El peso
promedio de la cantidad de sangre ingerida varía Hasta el momento no se conoce el papel de R.
de una especie a otra, llegando a ser diferente en colombiensis en la transmisión de T. cruzi en áreas
muchos casos dentro de la misma especie, en donde esta especie existe en cercanías al
inclusive cuando se utiliza la misma fuente de peridomicilio humano. Se ha comprobado que los
alimento (13). Las N5 necesitan obtener suficientes adultos R. colombiensis invaden con frecuencia
reservas energéticas para efectuar la última muda el domicilio humano, presentando elevadas
hacia el estadio adulto; por tal razón, los promedios prevalencias de T. cruzi, lo que aumentaría la

108
Biomédica 2007;27(supl.1):101-9 Patrones de alimentación y defecación de Rhodnius

probabilidad de transmisión al hombre y a los main vectors of Chagas disease in northeastern Brazil.
animales domésticos. De conformidad con lo Mem Inst Oswaldo Cruz 2000;95:151-5.
anterior, es de gran importancia estudiar el posible 8. Martínez-Ibarra JA, Novelo López M, Hernández
papel de R. colombiensis en la transmisión de T. Robles MR, Grant Guillén Y. Influence of the blood
meal source on the biology of Meccus picturatus Usinger
cruzi, especialmente en aquellas áreas en donde 1939 (Hemiptera: Reduviidae:Triatominae) under
R. prolixus se ha controlado. laboratory conditions. Mem Inst Oswaldo Cruz
2003;98:227-32.
Conflicto de intereses
9. Wood SF. Importance of feeding and defecation times
Los autores del presente artículo declaramos que of insect vectors in transmission of Chagas’ desease.
no teníamos conflictos de intereses de orden J Econ Entomol 1951; 44: 52-54.
académico, institucional u operacional en el 10. Dias E. Obsevações sôbre eliminação de dejeções e
momento de realización de la investigación. tempo de sucção em alguns triatomineos
sulamericanos. Mem Inst Oswaldo Cruz 1956;54:115-
Financiación 24.

Este trabajo recibió financiación del Instituto 11. Pipkin AC Sr. Domiciliary reduviid bugs and the
Colombiano "Francisco José de Caldas" epidemiology of Chagas’ disease in Panama
(Hemiptera: Reduviidae: Triatominae). J Med Entomol
(Colciencias), proyecto 105-05-279-99, y del Fondo 1968;5:107-24.
de Investigaciones de la Universidad del Tolima.
12. Pippin WF. The biology and vector capability of
También recibió apoyo internacional de la red Triatoma sanguisuga texana Usinger and Triatoma
ECLAT (European Community–Latin-American gerstaeckeri (Stal) compared with Rhodnius prolixus
Network for Research on the Biology and Control (Stal) (Hemiptera: Triatominae). J Med Entomol
of Triatominae). 1970;7:30-45.
13. Rocha DS, Fonseca AH, Costa FA, Jurberg J, Galvâo
Referencias C. Desenvolvimento de Rhodnius pictipes Stal, 1872
1. Galvão C, Carcavallo R, Silva RD, Jurberg J. A alimentado através de membrana de silicone e em
checklist of the current valid species of the subfamily camundongos (Hemiptera, Reduviidae, Triatominae).
Triatominae Jeannel, 1919 (Hemiptera, Reduviidae) and Mem Inst Oswaldo Cruz 1997;92:553-8.
their geographical distribution, with nomenclatural and 14. Buxton PA. The biology of a blood sucking bug
taxonomic notes. Zootaxa 2003;202:1-36. Rhodnius prolixus . Trans Ent Sco Soc London
2. Schofield CJ, Dujardin JP. Theories on the evolution 1930;78:227-36.
of Rhodnius. Actual Biol 1999;21:183-97. 15. Friend WG, Choy CT, Cartwright E. The effect of
3. Moreno MJ, Galvão C, Jurberg J. Rhodnius nutrient intake on the development and the egg prodution
colombiensis sp. n. da Colômbia com quadros of Rhodnius prolixus Stal (Hemiptera: Reduviidae). Can
comparativos entre estructuras fálicas do género J Zool 1965;43:891-904.
Rhodnius Stal, 1859 (Hemiptera, Reduviidae, 16. Regis L. The role of the blood meal in egg-laying
Triatominae). Entomol Vect 1999;6:601-17. periodicity and fecundity in Triatoma infestans. Internat
4. Zeledón R, Alvarado R, Jirón LF. Observations on J Inver Reprod 1979;1:187-95.
the feeding and defecation patterns of three triatomine 17. Rocha DS, dos Santos CM, Cunha V, Jurberg J,
species (Hemiptera: Reduviidae). Acta Trop Galvao C. Life cycle of Rhodnius brethesi Matta, 1919
1977;34:65-77. (Hemiptera, Reduviidae, Triatominae), a potential vector
5. Monroy E, Susunaga G. Caracterización biológica de of Chagas disease in the Amazon region. Mem Inst
las cepas de Trypanosoma cruzi aisladas de Rhodnius Oswaldo Cruz 2004;99:591-5.
prolixus en el departamento del Tolima. (Tesis, 18. Dujardin JP, García-Zapata MT, Jurberg J, Roelants
biología). Ibagué: Universidad del Tolima; 1990. p.151. P, Cardozo L, Panzera F, et al. Which species of
6. Richa DS, Galvão C, Jurberg J. Biología do Rhodnius Rhodnius is invading houses in Brazil?. Trans R Soc
pictipes Stal, 1872 em Condições de Laboratório Trop Med Hyg 1991;85:679-80.
(Hemiptera, Reduviidae, Triatominae). Mem Inst
19. Feliciengeli MD, Dujardin JP, Bastrenta B, Mazzarri
Oswaldo Cruz 1994;89:265-70.
M, Villegas J, Flores M, et al. Is Rhodnius robustus
7. Soares RP, das Graças Evangelista L, Laranja LS, (Hemiptera: Reduviidae) responsible for Chagas
Diotaiuti L. Population dynamics and feeding behavior disease transmission in Western Venezuela? Trop Med
of Triatoma brasiliensis and Triatoma pseudomaculata, Int Health 2002;7:280-7.

109
Vallejo G.A.,
Biomédica Guhl F., Carranza
2007;27(Supl. J.C. et al
1):110-8 Biomédica 2007;27(supl. 1):110-8

ARTÍCULO ORIGINAL

Interacción tripanosoma-vector-vertebrado y su relación con la


sistemática y la epidemiología de la tripanosomiasis americana
Gustavo Adolfo Vallejo 1, Felipe Guhl 2, Julio César Carranza 1, Omar Triana 3, Gerardo Pérez 4,
Paola Andrea Ortiz 1, Dairo Humberto Marín 1, Lina Marcela Villa 1, Jazmín Suárez 1,
Isaura Pilar Sánchez 1, Ximena Pulido 1, Ingrid Bibiana Rodríguez 1, Leyder Elena Lozano 1,
Daniel Alfonso Urrea 1, Fredy Arvey Rivera 1, César Cuba-Cuba 5, Jairo Alfonso Clavijo 6
1
Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima,
Ibagué, Colombia.
2
Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Universidad de los
Andes, Bogotá D.C., Colombia.
3
Laboratorio de Chagas, Instituto de Biología, Facultad de Ciencias Exactas y Naturales, Universidad de
Antioquia, Medellín, Colombia.
4
Grupo de Investigación en Química de Proteínas, Departamento de Química, Universidad Nacional de
Colombia, Bogotá D.C., Colombia.
5
Unidade de Parasitologia Médica e Biología de Vetores, Facultade de Medicina, Universidade de Brasilia,
Brasilia, DF, Brasil.
6
Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué,
Colombia.

Introducción. Trypanosoma rangeli es la segunda especie de tripanosoma que infecta al


hombre en América Latina. Se ha observado variabilidad en las características biológicas,
bioquímicas y moleculares en diferentes aislamientos de este parásito.
Objetivo. Estudiar las características morfológicas y moleculares de cepas de T. rangeli aisladas
de diferentes especies de Rhodnius e inoculadas en diferentes especies de vertebrados.
Materiales y métodos. Se utilizaron 19 cepas de T. rangeli aisladas de R. prolixus, R. pallescens
y R. colombiensis en Colombia, R. ecuadoriensis en Perú y R. pallescens en Panamá. Se
evaluó el polimorfismo de los tripomastigotes sanguíneos en ratones ICR y se estudió el
pleomorfismo de la cepa P53 de T. rangeli KP1(-) inoculada en ratón, marsupial y canino. Se
efectuó análisis de ADN polimorfo amplificado aleatorio en 12 cepas aisladas de cuatro
especies de Rhodnius.
Resultados. Se observaron tres grupos discretos en la longitud total de los tripomastigotes
sanguíneos y la cepa P53 presentó diferencias significativas en el tamaño de los tripomastigotes
sanguíneos en ratón, marsupial y canino. El análisis de ADN polimorfo amplificado aleatorio
mostró segregación de las cepas en dos ramas correspondientes a las cepas de T. rangeli
KP1(+) y T. rangeli KP1(-). De otra parte todos las cepas de T. rangeli KP1(-) se agruparon de
acuerdo con las especies de Rhodnius de las cuales fueron aisladas.
Conclusión. Este es el primer estudio que revela una estrecha asociación entre cepas de T.
rangeli y las especies de Rhodnius, confirmando que cada especie de Rhodnius transmite al
hospedero vertebrado poblaciones del parásito con claras diferencias fenotípicas y genotípicas,
lo cual soporta la evolución clonal de estas poblaciones.
Palabras clave: Trypanosoma, Rhodnius, tripanosomiasis/epidemiología, técnica del ADN
polimorfo amplificado aleatorio (RAPD), enfermedad de Chagas.
Trypanosoma rangeli parasite-vector-vertebrate interactions and their relationship to the
systematics and epidemiology of American trypanosomiasis
Introduction. Trypanosoma rangeli is a species of trypanosome second to T. cruzi, that is
infective to humans in Latin America. Variability in the biological, biochemical and molecular
characteristics between different isolates isolates of this parasite have been recorded.
Objective. Morphological and molecular characteristics were recorded from strains of T. rangeli

110
Biomédica 2007;27(supl. 1):110-8 Interacción tripanosoma-vector-vertebrado

that were isolated from different species of Rhodnius and maintained in different vertebrate
species.
Materials and methods. Nineteen strains of T. rangeli were isolated from R. prolixus, R.
pallescens and R. colombiensis in Colombia, R. ecuadoriensis in Peru and R. pallescens in
Panama. Polymorphism of blood trypomastigotes in ICR mice was evaluated and pleomorphism
of P53 strain of T. rangeli KP1(-) inoculated in mouse, marsupial and canine was studied.
RAPD analysis (randomly amplified polymorphic DNA analysis) of 12 strains isolated from four
species of Rhodnius was performed.
Result. Based on the total length of blood trypomastigotes, three discrete groups were observed.
The P53 strain showed significant differences in the size of blood trypomastigotes in mouse,
marsupial and canine. RAPD analysis showed that the strains segregated into two branches
corresponding to strains of T. rangeli KP1(+) and T. rangeli KP1(-). All strains of T. rangeli KP1
(-) clustered according to the species of Rhodnius from which they were isolated .
Conclusion. These data reveal, for the first time, a close association amongst T. rangeli strains
and Rhodnius species, confirming that each species of Rhodnius transmits to vertebrate hosts
a parasite population with clear phenotypic and genotypic differences. This is further evidence
that supports the concept of clonal evolution of these parasites.
Key words: Trypanosoma , Rhodnius , trypanosomiasis/epidemiology, random amplified
polymorphic DNA technique, Chagas disease.

Trypanosoma rangeli es un interesante parásito dos especies (10) o en el diagnóstico serológico


no patógeno para el hombre, que exhibe de la infección en los vertebrados (6,7,11).
particulares características biológicas, entre las
La variabilidad de las poblaciones de T. rangeli
cuales se destacan la patogenicidad del parásito
se ha demostrado en las últimas décadas mediante
para el vector (1-3), la susceptibilidad de las
estudios de minisatélites de ADN, los cuales
especies de Rhodnius a cepas de T. rangeli del
mostraron diferencias genéticas entre las cepas
mismo origen geográfico (4,5), la reacción
de Santa Catarina y las aisladas en Honduras,
serológica cruzada de T. rangeli con T. cruzi (6,7)
Colombia y Venezuela (12). El análisis de polimor-
y la resistencia de los flagelados a la lisis mediada
fismos del ADN mitocondrial mostró que el
por el complemento (8), entre otras. Por ello, du-
minicírculo de kDNA denominado KP1 se encontró
rante las últimas décadas, T. rangeli ha sido objeto
asociado con las cepas de T. rangeli aisladas en
de estudio por parte de varios grupos de
Colombia, Honduras y Venezuela, pero no en las
investigación que han encontrado en este parásito
cepas aisladas en Santa Catarina al sureste de
un importante modelo para conocer los procesos
Brasil (13). Una divergencia genética similar entre
coevolutivos entre parásito-vector y para estudiar
estos dos grupos se demostró usando
la dinámica de la transmisión de subpoblaciones
electroforesis de isoenzimas y AP-PCR (14). Una
de T. rangeli al hospedero vertebrado (9). De otra
parte, existe interés en desarrollar métodos para conclusión similar se obtuvo con el análisis del
diferenciar T. cruzi de T. rangeli, debido a que en cariotipo molecular de varias cepas de T. rangeli,
la mayoría de los países de América Latina estas revelando la existencia de polimorfismo
dos especies se encuentran infectando los cromosómico (15).
mismos vertebrados y vectores, generando Utilizando amplificación del kDNA, en Colombia
dificultades en el diagnóstico morfológico de las y en otros países de América Latina se han detec-
tado dos grupos de T. rangeli molecularmente
Correspondencia: diferentes. Un grupo de cepas aisladas de Rhodnius
Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en
Parasitología Tropical, Facultad de Ciencias, Universidad
prolixus presentan tres clases de minicírculos de
del Tolima, Ibagué, Tolima, Colombia. A.A. No. 546. Telfax kDNA denominados KP1, KP2 y KP3 (T. rangeli
+(57) 8 2669176. KP1+), mientras que las cepas aisladas de R.
gvallejo@ut.edu.co colombiensis presentan solamente dos clases deno-
Recibido: 23/06/06; aceptado: 14/07/06 minadas KP2 y KP3 (T. rangeli KP1-) (9,16-18).

111
Vallejo G.A., Guhl F., Carranza J.C. et al Biomédica 2007;27(supl. 1):110-8

Recientemente se caracterizaron 18 cepas de T. ecuadoriensis domiciliado en el departamento de


rangeli aisladas de glándulas salivares de R. la Libertad en el norte del Perú; las cepas P53,
colombiensis, R. pallescens y R. prolixus (18) Trs, Rcol, 2715 y 044 se aislaron de R.
utilizando dos marcadores independientes: kDNA colombiensis silvestre en el departamento del
(17) y el espaciador intergénico del gen mini-exón Tolima, región central de Colombia; las cepas Gal
(19). Los autores observaron que el producto de 47, Gal 57, SO28, SO48 se aislaron de R.
380 pb de amplificación del mini-exón siempre se pallescens silvestre en el departamento de Sucre,
presentó asociado con los productos obtenidos norte de Colombia; la cepa 0401 se aisló de R.
de los minicírculos KP2 Y KP3 de kDNA y el pallescens silvestre en el departamento del
producto de 340 pb del mini-exón siempre se Tolima, Colombia; la cepa GMLLC se aisló de R.
presentó asociado con los productos de los pallescens en Panamá; las cepas 444, 1545, 3123
minicírculos KP1, KP2 Y KP3. Existen dos se aislaron de R. prolixus domiciliado en el
hipótesis alternativas sobre el origen de los dos departamento de Boyacá, Colombia, y las cepas
grupos de T. rangeli; por un lado podría tratarse P19 y Choachí se aislaron de R. prolixus
de grupos con evolución clonal, en la cual la domiciliado en los departamentos de Norte de
reproducción sexual sería rara o inexistente, o se Santander y Cundinamarca, Colombia. Los
trataría de un proceso de especiación críptica. tripomastigotes metacíclicos de las glándulas
salivares de cada vector se inocularon intraperito-
Se encontró asociación coevolutiva entre las nealmente en ratones ICR. Se efectuaron
cepas de T. rangeli KP1(-), las cuales circulan en hemocultivos a partir de los ratones positivos en
la cordillera de los Andes en los vectores del grupo el quinto día posinoculación y las cepas aisladas
“pallescens”, representados por R. pallescens, R. se mantuvieron a 28°C mediante pasajes
colombiensis y R. ecuadoriensis, y las cepas de semanales en medio NNN con LIT suplementado
T. rangeli KP1(+), las cuales circulan al oriente con 10% de suero fetal bovino inactivado. Todas
de la cordillera de los Andes en los vectores del las cepas aisladas de R. ecuadoriensis , R.
grupo “prolixus”, representados por R. prolixus y colombiensis y R. pallescens se caracterizaron
R. neglectus (9). como T. rangeli KP1(-), y las cepas aisladas de
Nuestro interés fue conocer el grado de R. prolixus como T. rangeli KP1(+) mediante la
divergencia genética existente entre los grupos amplificación de kDNA y del espaciador intergénico
de T. rangeli KP1(+) y T. rangeli KP1(-). Por del gen min-iexón (17,19).
esta razón, en el presente trabajo se analizaron Estudio morfológico de los tripomastigotes
las características morfológicas de los tripo- sanguíneos en ratones ICR
mastigotes sanguíneos y las características
genéticas mediante análisis de RAPD en cepas Grupos de tres ratones ICR machos de ±20
gramos se inocularon con 5x106 epimastigotes de
de T. rangeli aisladas de R. pallescens, R.
las cepas de cultivo de T. rangeli KP1(-). Otros
colombiensis, R. ecudoriensis y R. prolixus para
grupos de tres ratones ICR machos se inocularon
verificar si los polimorfismos observados en las
con 400.000 tripomastigotes metacíclicos de cada
poblaciones de este parásito están asociados con
cepa de T. rangeli KP1(+). Los ratones se
los vectores que las transmiten, de manera que
examinaron a partir del tercer día de inoculación,
estos actuarían como filtros biológicos
se observó la parasitemia y se dibujaron en
seleccionando las diferentes poblaciones del
cámara lúcida 30 formas sanguíneas circulantes
parásito.
de cada una de las cepas en el quinto día
Materiales y métodos posinoculación. En cada una de las formas
dibujadas se midió la longitud total, la longitud del
Aislamiento y cultivo de los parásitos
flagelo, las distancias del núcleo al extremo pos-
Se utilizaron 19 cepas de T. rangeli. Las cepas terior y al extremo anterior, los índices nucleares
Perú 1, Perú 1A y Perú 2A se aislaron de las y los índices del cinetoplasto (20,21). Se realizaron
glándulas salivares naturalmente infectadas de R. estimaciones de las medias de la longitud total

112
Biomédica 2007;27(supl. 1):110-8 Interacción tripanosoma-vector-vertebrado

de los tripomastigotes sanguíneos de las cepas de dNTPs 200 mM dNTPs, MgCl2 3,5 mM,, KCL
de T. rangeli en el quinto día posinfección con los 25 mM y 25 mM del iniciador ,1 unidad de Taq
respectivos intervalos de 95% de confianza y se DNA polimerasa (INVITROGEN) y 10 ng de ADN.
efectuó análisis multivariado de varianza (MANOVA) La reacción en cadena de la polimerasa (PCR) se
utilizando el programa STATISTICA V4.5. corrió en una termociclador M.J. Research PTC-
150-16 y se sometió a 35 ciclos de amplificación.
Estudio morfológico de Trypanosoma rangeli
Los perfiles de temperatura para denaturación del
en diferentes hospederos vertebrados
ADN, hibridación y extensión del iniciador fueron
Para evaluar pleomorfismos de las formas 95°C por un minuto (con un tiempo inicial de 5
sanguíneas se seleccionó la cepa P53 de T. min), 30°C por un minuto y 72°C por un minuto,
rangeli KP1(-) para infectar dos individuos de Mus respectivamente, y una extensión final de 5
musculus, Didelphis marsupialis y Canis minutos. Los productos amplificados fueron
familiaris, a los que se les inocularon formas de separados en geles de poliacrilamida al 6% y
cultivo que contenían 2x106 parásitos por gramo coloreados con nitrato de plata (22). Los perfiles
de peso corporal. Los tripomastigotes sanguíneos de RAPD se usaron para la construcción de una
se aislaron de la sangre de cada uno de los matriz binaria de acuerdo con la presencia (1) o
mamíferos, concentrándolos por centrifugación en ausencia (0) de las bandas. El análisis se efectuó
tubo capilar, extendiéndolos y coloreándolos con con el programa RAPDPLOT versión 3.0 y se
Giemsa. Se dibujaron 30 tripomastigotes calculó la matriz de distancias a partir del índice
sanguíneos circulantes en ratón, canino y didélfido de bandas compartidas (1-MATCH). El índice de
durante el tercer día posinoculación. A cada una bandas compartidas (M) se calculó usando la for-
de las formas dibujadas se les efectuó la toma de mula: M = NAB/NT, donde NAB es el número to-
las medidas morfométricas y se realizaron tal de apareamientos entre los individuos A y B y
estimaciones de las medias de la longitud total NT es el número total de loci registrados (23).
de los tripomastigotes sanguíneos de la cepa P53 Con base en los resultados de los perfiles de RAPD
de T. rangeli en el tercer día posinfección en cada se construyó un dendrograma por el método
uno de los mamíferos utilizados con los respec- UPGMA (Unweighted Pair-Group Method with
tivos intervalos de 95% de confianza; se efectuó Arithmetic Means) utilizando un bootstrap con 100
análisis multivariado de varianza (MANOVA) pseudoréplicas. Las distancias entre los grupos
utilizando el programa STATISTICA V4.5. de parásitos se obtuvieron con el programa
RAPDIST, con el cual se compararon las
Purificación de ADN y obtención de RAPD distancias genéticas de Nei (24), y se comprobó
El ADN genómico se extrajo de los cultivos de la consistencia de los datos de RAPD que
parásitos mediante el método de fenol-cloroformo soportan las ramas del dendrograma usando
seguido de precipitación con etanol y acetato de análisis de bootstrap con 100 pseudoréplicas.
sodio. La concentración del ADN se determinó Resultados
por electroforesis mediante comparación con
Morfología de los tripomastigotes sanguíneos
patrones de concentración conocidos. Para la
en ratones ICR
obtención del ADN polimorfo amplificado aleatorio
(RAPD) se ensayaron 12 iniciadores a partir de Los resultados del estudio morfológico de 10 cepas
los cuales se seleccionaron OPBG-02 (5´- de los tripomastigotes sanguíneos de T. rangeli
GGAAAGCCCA-3´) y OPBG-013 (5´-GGTTGGGC en la sangre de ratones infectados experimental-
CA-3´) (Operon Technologies, Inc.), los que mente mostró un elevado grado de polimorfismo
permitieron obtener los patrones más discrimi- de los parásitos en el quinto día de infección. Se
nantes para analizar todas las cepas. Para las observaron promedios en las longitudes totales
amplificaciones se utilizó un volumen final de de los tripomastigotes desde 32 hasta 39 µm
reacción de 20 µl que contenía 2 ml de buffer de mostrando diferencias significativas entre las
Taq Polimerasa 10X (INVITROGEN), una mezcla diferentes cepas analizadas (figura 1).

113
Vallejo G.A., Guhl F., Carranza J.C. et al Biomédica 2007;27(supl. 1):110-8

Morfología de Trypanosoma rangeli en Obtención y análisis de RAPD


diferentes hospederos vertebrados
La figura 3 muestra uno de los geles de
Se observó que la cepa P53 de T. rangeli poliacrilamida al 6% con los productos
presentó diferencias estadísticamente signi- amplificados y coloreados con nitrato de plata.
ficativas entre las tres especies de mamíferos. Con base en los resultados de los perfiles de RAPD
Los tripomastigotes sanguíneos fueron más se construyó un dendrograma por el método
cortos en ratón que en sangre de Didelphis y aun UPGMA (Unweighted Pair-Group Method with
más cortos que los observados en sangre de perro Arithmetic Means) utilizando un bootstrap con 100
(figura 2). pseudoréplicas (figura 4). De acuerdo con el

Figura 1. Comparación de las medias de la longitud total de Figura 2. Comparación de las medias de la longitud total de
30 tripomastigotes sanguíneos de cada una de cuatro cepas 30 tripomastigotes snaguíneos de la cepa de T. rangeli P53
estudiadas en ratones ICR en el quinto día posinoculación. detectada en el tercer día posinoculación en ratón, zarigüeya
Se compararon las cepas Gal 57, aislada de R. pallescens, y perro.
P53, aislada de R. colombiensis, Perú 1, aislada de R.
ecuadoriensis, y P19, aislada de R. prolixus.

Figura 3. Perfiles de RAPD obtenidos a


partir de 12 cepas de T. rangeli con el primer
OPBG13. M corresponde al marcador de
peso molecular. Las canaletas 1, 2 y 3
corresponden a las cepas de T. rangeli
444, 1545, 3123, respectivamente, aisladas
de R. prolixus. Las canaletas 4, 5 y 6,
corresponden a las cepas de T. rangeli
Gal47, SO28 y SO48, respectivamente,
aisladas de R. pallescens. Las canaletas
7, 8 y 9 corresponden a las cepas de T.
rangeli Perú1, Perú1A y Perú2A,
respectivamente, aisladas de R.
ecuadoriensis. Las canaletas 10, 11 y 12
corresponden a las cepas de T. rangeli
P53, TrS y Rcol, respectivamente, aisladas
de R. colombiensis . La canaleta 13
corresponde a una cepa de T. cruzi I y la
canaleta 14 corresponde a una cepa de T.
cruzi II.

114
Biomédica 2007;27(supl. 1):110-8 Interacción tripanosoma-vector-vertebrado

dendrograma, las doce cepas de T. rangeli se


agruparon en dos ramas. Las cepas 3123, 444, y
1545 aisladas de R. prolixus, caracterizadas como
T. rangeli KP1(+), formaron una rama y las otras
nueve cepas aisladas de las glándulas salivares
del grupo “pallescens”, conformado por R.
pallescens (SO28, Gal 47, SO48), R.
colombiensis (Rcol, P53, Trs) y R. ecuadoriensis
(Perú 2A, Perú 1A, Perú 1), caracterizadas como
T. rangeli KP1(-), formaron una segunda rama con
tres subramas que correspondieron exactamente
a cada una a las cepas aisladas de R. pallescens,
R. colombiensis y R. ecuadoriensis. La figura 5
muestra las distancias de Nei entre los grupos de
Figura 5. Dendrograma generado por RAPDDIST que
parásitos obtenidas con el programa RAPDIST. muestra las distancias genéticas de Nei entre las cepas de
T. rangeli aisladas de R. prolixus, R. pallescens, R.
Discusión colombiensis y R. ecuadoriensis usando el algoritmo UPGMA
La interacción entre las subpoblaciones de y bootstrap de 100 seudoréplicas.
tripanosomas con diferentes especies de
triatominos, así como los mecanismos que acerca de la filogenia y dispersión de los parásitos
regulan la transmisión, son importantes elementos y de los vectores, contribuyendo así a aclarar la
para la documentación de la epidemiología de la posición taxonómica de las especies semejantes
tripanosomiasis americana. A partir de este a T. cruzi o a T. rangeli en América.
enfoque será posible establecer cuáles Se ha demostrado que las cepas de T. rangeli
subpoblaciones de tripanosomas son transmitidas aisladas de las especies de Rhodnius del grupo
por los vectores en una determinada área «pallescens» (R. pallescens, R. colombiensis y
geográfica. De otra parte será igualmente posible R. ecuadoriensis) denominadas (KP1-) son
conocer si existen diferencias en la susceptibilidad genéticamente divergentes de las cepas aisladas
a la infección de los hospederos vertebrados. del grupo «prolixus» (prolixus, neglectus)
Adicionalmente, los estudios de la interacción denominadas (KP1+) (9,17,18), lo que indica una
tripanosoma-triatomino permitirán identificar posible asociación evolutiva entre las
procesos coevolutivos para fortalecer las hipótesis subpoblaciones de T. rangeli y los grupos de
especies de Rhodnius.
La relación entre la diversidad genética del
parásito y su transmisibilidad vectorial no está
completamente entendida, pues se ha mostrado
que las poblaciones de T. cruzi y T. rangeli
difieren en su habilidad para sobrevivir,
multiplicarse y diferenciarse en el insecto vector.
También se ha mostrado que en una misma área
geográfica existen diferencias significativas en-
tre la proporción de genotipos de T. cruzi y T.
rangeli detectados en los vectores y en los
Figura 4. Fenograma generado por UPGMA basado en los mamíferos. Estas diferencias podrían explicarse
perfiles de RAPD de 12 cepas de Trypanosoma rangeli por la transmisión selectiva de algunos genotipos
aisladas de Rhodnius prolixus (Rpro), R. pallescens (Rpall),
por parte de los vectores locales, que actuarían
R. colombiensis (Rcol) y R. ecuadoriensis (Recu) . Los
números de la escala horizontal fueron derivados de la como filtros biológicos del parásito. Se ha
distancia calculada con el programa RAPDPLOT. demostrado que en Colombia R. colombiensis

115
Vallejo G.A., Guhl F., Carranza J.C. et al Biomédica 2007;27(supl. 1):110-8

puede infectarse con T. rangeli KP1(-) y KP1(+), rangeli cuando se infectan diferentes vertebrados
pero sólo transmite a KP1(-) a través de la picadura con un mismo aislamiento. El pleomorfismo de
y que R. prolixus se infecta con T. rangeli KP1(-) los tripomastigotes sanguíneos detectado en el
y KP1(+), pero solo transmite por picadura a la presente trabajo en ratón, Didelphis y perro al
subpoblación KP1(+) (17,18). Estos resultados tercer día posinoculación revela que la longitud
demuestran que R. prolixus es susceptible a la total de estas formas de T. rangeli sería
infección de T. rangeli KP1(+), pero presenta una dependiente del vertebrado en el cual se examina
respuesta refractaria a la invasión de cepas de T. (figura 2). Estos resultados preliminares indican
rangeli KP1(-) aisladas de R. pallescens, R. que probablemente el vertebrado también
colombiensis y R. ecuadoriensis. El compor- selecciona diferentes subpoblaciones del parásito,
tamiento diferencial en la transmisión de estas o que la morfología de T. rangeli sería dependiente
dos subpoblaciones se relaciona con la activación de la respuesta inmune del hospedero vertebrado.
de la respuesta inmune del vector, en la que El hallazgo de este carácter pleomorfico en T.
factores intrínsecos como la producción de rangeli podría contribuir a aclarar la posición
hemocitos, nódulos y factores tripanolíticos limitan taxonómica de los tripanosomas semejantes a T.
la infección parasitaria (25). Recientemente se rangeli, tales como T. (H.) mesnilbrimontí, T. (H.)
detectó en la hemolinfa de R. prolixus un factor preguici, T. (H.) myrmecophague, T. (H.) mycetae,
tripanolítico contra las cepas de T. rangeli KP1(-) T. (H.) diasi, T, (H.) cebus, T. (H.) saimiri, y T.
que corresponde a una proteína termolábil, la cual (H.) advieri, entre otros, pues como se sabe, estos
sería un factor inmunológico para que R. prolixus parásitos fueron clasificados como especies
actúe como filtro biológico de subpoblaciones de diferentes con base en diferencias de tamaño al
T. rangeli KP1(-) (datos no publicados). ser comparados con cepas de T. rangeli aisladas
En el presente trabajo se detectó un elevado de R. prolixus.
polimorfismo de los tripomastigotes sanguíneos Los resultados de la caracterización molecular
medidos en el quinto día posinoculación. El preliminar mediante RAPD de las cepas de T.
tamaño promedio de las cepas varió entre 32 y rangeli (figura 4) muestran una clara divergencia
39 µm, mostrando en general la existencia de entre el grupo de cepas KP1(+) y KP1(-), indicando
grupos discretos (figura 1). Es interesante el hecho la existencia de cuatro grupos de T. rangeli
de que tres cepas aisladas de R. pallescens genéticamente divergentes y asociados con R.
mostraron siempre tamaños promedios muy prolixus, R. pallescens, R. colombiensis y R.
cercanos a los 40 µm (datos no mostrados), ecuadoriensis. Estos grupos difieren de los cuatro
mientras que las cepas asiladas de R. grupos de T. rangeli previamente detectados por
colombiensis, R. ecuadoriensis y R. prolixus Maia da Silva et al. (26), quienes utilizando
mostraron tamaños variables entre 32 y 39 µm. análisis de RAPD encontraron un grupo formado
Esta observación sugiere la existencia de por lo por cepas de T. rangeli de Colombia, Venezuela,
menos dos grupos morfológicos de T. rangeli. Por Honduras, la Isla de Marajó, Pará y Rondonia en
otro lado, estos polimorfismos podrían ser el Brasil, un segundo grupo formado por las cepas
resultado de la transmisión selectiva de aisladas en Acre y Pará (Brasil), un tercer grupo
subpoblaciones del parásito, de manera que en formado por cepas aisladas en Panamá y el Sal-
las glándulas salivares del vector se desarrollaría vador y un cuarto grupo formado por la cepa SC58
cada vez una subpoblación con características aislada en Santa Catarina (Brasil). Los resultados
morfológicas diferentes. del presente trabajo, en conjunto con los de otros
Dentro de una misma especie de tripanosoma autores (26), indican que T. rangeli está formado
pueden encontrarse variaciones morfológicas por varios grupos genéticamente divergentes,
significativas que pueden conducir a la separación probablemente asociados a diferentes especies
de una misma especie en dos o más especies de Rhodnius. Posteriores estudios filogenéticos
diferentes (21). Varios autores han señalado en el grupo de cepas KP1(-), utilizando otros
pleomorfismos o variaciones morfológicas de T. marcadores moleculares, podrían indicar si estas

116
Biomédica 2007;27(supl. 1):110-8 Interacción tripanosoma-vector-vertebrado

cepas evolucionaron de norte a sur en el mismo Financiación


sentido que se propone la evolución del cline
El presente trabajo recibió financiación de las
conformado por las especies de vectores del grupo
siguientes instituciones: Instituto Colombiano
“pallescens”. Por otro lado, los estudios
"Francisco José de Caldas" (Colciencias),
filogenéticos en el grupo de T. rangeli KP1(+)
proyecto 1105-05-16919; Chagas Disease Inter-
podrían arrojar información sobre la evolución de
vention Activities-European Community (CDIA-
los parásitos y sus vectores.
EC), contrato No. ICA4-CT-2003-10049; SSA-EC:
Las distancias genéticas de Nei observadas por Trypanosomiasis Update y Fondo de Investigaciones
medio del análisis de isoenzimas en especies de la Universidad del Tolima.
diferentes de un mismo género varían entre 0,162
Referencias
y 0,3 en la mayoría de las especies (27). Las
distancias obtenidas entre las subpoblaciones de 1. Marinkelle CJ. Pathogenicity of Trypanosoma rangeli
for Rhodnius prolixus Stal in nature. J Med Entomol
T.rangeli en el presente trabajo (figura 5) indicaron
1968;5:497-9.
que los grupos más próximos constituídos por las
cepas aisladas de R. pallescens y R. colombiensis 2. Watkins R. Trypanosoma rangeli: effect on excretion
in Rhodnius prolixus. J Invertebr Pathol 1971;17:67-71.
presentaron una distancia genética de Nei de
0,11110; sin embargo, las cepas aisladas de R. 3. Watkins R. Histology of Rhodnius prolixus infected
with Trypanosoma rangeli . J Invertebr Pathol
ecuadoriensis presentaron una distancia genética 1971;17:59-66.
de 0,19955 con relación al grupo R.pallescens-R.
colombiensis; por otro lado, el cálculo de la 4. D’Alessandro-Bacigalupo A, Gore-Saravia N.
Trypanosoma rangeli. En: Kreier JP, editor. Parasitic
distancia genética de Nei entre poblaciones de T. protozoa. London: Academic Press; 1992.p.1-54.
rangeli con el empleo de RAPDIST mostró que
5. D’Alessandro-Bacigalupo A, Gore-Saravia N.
las distancias entre T. rangeli KP1(-) y T. rangeli Trypanosoma rangeli. En: Gilles HM, editor. Protozoal
KP1(+) fueron de 0,30435, lo cual indica una gran diseases. Oxford: Oxford University Press; 1999.
divergencia genética entre estos dos grupos, p.398-412.
semejante a la observada en especies diferentes 6. GuhI F, Hudson L, Marinkelle CJ, Morgan S,
de otros organismos (27). Jaramillo C. Antibody response to experimental
Trypanosoma rangeli infection and its implications for
Los resultados de la presente investigación immunodiagnosis of South American trypanosomiasis.
señalan que la interacción T. rangeli-vector es un Acta Trop 1985;42:311-8.
importante modelo, en el cual cada vector del 7. Guhl F, Hudson L, Marinkelle CJ, Jaramillo CA,
género Rhodnius transmite subpoblaciones del Bridge D. Clinical Trypanosoma rangeli infection as a
parásito fenotípica y genotípicamente divergentes complication of Chagas’ disease. Parasitology
y que, por lo tanto, los vectores actuarían como 1987;94:475-84.
filtros biológicos de dichas subpoblaciones. Es 8. Guhl F, Vallejo GA. Trypanosoma (Herpetosoma)
posible que ocurran fenómenos semejantes en la rangeli Tejera, 1920: an updated review. Mem Inst
Oswaldo Cruz 2003;98:435-42.
transmisión del agente causal de la enfermedad
de Chagas, pues recientemente se han descrito 9. Urrea DA, Carranza JC, Cuba CA, Gurgel-
seis subpoblaciones de T. cruzi (T. cruzi I, T. cruzi Gonçalves R, Guhl F, Schofield CJ, et al. Molecular
characterisation of Trypanosoma rangeli strains
IIa, IIb, IIc, IId y IIe) (28,29), que interactúan con isolated from Rhodnius ecuadoriensis in Peru, R.
más de 100 especies de triatominos en diferentes colombiensis in Colombia and R. pallescens in
regiones de América Latina. Panama, supports a co-evolutionary association
between parasites and vectors. Infect Genet Evol
Conflicto de intereses 2005;5:123-9.

Los autores del presente artículo declaramos que 10. Vallejo GA, Marinkelle CJ, Guhl F, De Sánchez N.
no teníamos conflictos de intereses de orden Comportamiento de la infección y diferenciación
morfológica entre Trypanosoma cruzi y T. rangeli en el
académico, institucional u operacional en el intestino del vector Rhodnius prolixus. Rev Bras Biol
momento de realización de la investigación. 1988;48:577-87.

117
Vallejo G.A., Guhl F., Carranza J.C. et al Biomédica 2007;27(supl. 1):110-8

11. Guhl F, Jaramillo C, Carranza JC, Vallejo GA. monograph. Oxford: Blackwell Scientific Publications;
Molecular characterization and diagnosis of 1972.p.288-314
Trypanosoma cruzi and T. rangeli. Arch Med Res
2002;33:362-70. 21. Ziccardi M, Lourenco-de-Oliveira R. Polymorphism
in trypomastigotes of Trypanosoma (Megatrypanum )
12. Macedo AM, Vallejo GA, Chiari E, Pena SD. DNA minasense in the blood of experimentally infected
fingerprinting reveals relationships between strains of squirrel monkey and marmosets. Mem Inst Oswaldo
Trypanosoma rangeli and Trypanosoma cruzi. En: Pena Cruz 1999;94:649-53.
SD, Chakraborty R, Epplen JT, Jeffreys AJ, editors.
DNA fingerprinting: state of the Science . Basel, 22. Sanguinetti CJ, Dias-Neto E, Simpson AJ. Rapid
Switzerland: Birkhauser Verlag: 1993. p.321-9. silver staining and recovery of PCR products
separated on polyacrylamide gels. Biotechniques
13. Vallejo GA, Macedo AM, Chiari E, Pena SD. 1994;17:914-21.
Kinetoplast DNA from Trypanosoma rangeli contains
two distinct classes of minicircle with different size and 23. Black WC. Statistical analysis of arbitrarily primed PCR
molecular organization. Mol Biochem Parasitol patterns in molecular taxonomic studies. En: Clap CL,
1994;67:245-53. editor. Methods in molecular biology. Species
diagnostics protocols: PCR and other nucleic acid
14. Steindel M, Dias-Neto E, Pinto CJ, Grisard E, methods. Vol. 50. Totowa, NJ: Humana Press; 1995.
Menezes C, Murta SM, et al . Randomly amplified p.39-55.
polymorphic DNA (RAPD) and isoenzyme analysis of
Trypanosoma rangeli strains. J Eukaryot Microbiol 24. Nei M. Estimation of average heterozygocity and genetic
1994;41:261-7. distance from a small number of individuals. Genetics
1978;89:583-90.
15. Toaldo CB, Steindel M, Sousa MA, Tavares CC.
Molecular karyotype and chromosomal localization of 25. Sánchez IP, Pulido XC, Carranza JC, Triana O,
genes encoding 0-tubulina, cisteina proteinase, HSP Vallejo GA. Inmunidad natural de Rhodnius prolixus
70 and actin in Trypanosoma rangeli. Mem Inst Oswaldo (Hemiptera: Reduviidae: Triatominae) frente a la
Cruz 2001;96:113-21. infección con Trypanosoma ( Herpetosoma ) rangeli
KP1(-) aislados de Rhodnius pallescens , R.
16. Vallejo GA, Guhl F, Chiari E, Macedo AM. Specie colombiensis y R. ecuadoriensis . Revista de la
specific detection of Trypanosoma cruzi and Asociación Colombiana de Ciencias Biológicas
Trypansoma rangeli in vector and mammalian hosts 2005;17:108-18.
by polymerase chain reaction amplification of kinetoplast
minicircle DNA. Acta Trop 1999;72:203-12. 26. Maia da Silva F, Rodrigues AC, Campaner M, Takata
CS, Brigido MC, Junqueira AC, et al . Randomly
17. Vallejo GA, Guhl F, Carranza JC, Lozano LE, amplified polymorphic DNA analysis of Trypanosoma
Sánchez JL, Jaramillo JC, et al. kDNA markers define rangeli and allied species from human, monkeys and
two major Trypanosoma rangeli lineages in Latin other sylvatic mammals of the Brazilian Amazon
America. Acta Trop 2002;81:77-82. disclosed a new group and a species-specific marker.
Parasitology 2004;128:283-94.
18. Vallejo GA, Guhl F, Carranza JC, Moreno J, Triana
O, Grisard EC. Parity between kinetoplast DNA and 27. Thorpe JP, Solé-Cava AM. The use of allozyme
miniexon gene sequences supports either clonal electrophoresis in invertebrate systematics. Zool Scr
evolution or speciation in Trypanosoma rangeli strains 1994;23:3-18
isolated from Rhodnius colombiensis, R. pallescens
and R. prolixus in Colombia. Infect Genet Evol 28. Brisse S, Barnabé C, Tibayrenc M. Identification of
2003;3:39-45. six Trypanosoma cruzi phylogenetic lineages by
random amplified polymorphic DNA and multilocus
19. Grisard EC, Campbell DA, Romanha AJ. Mini-exon enzyme electrophoresis. Int J Parasitol 2000;30:35-44.
gene sequence polymorphism among Trypanosoma
rangeli strains isolated from distinct geographical 29. Brisse S, Verhoef J, Tibayrenc M. Characterization of
regions. Parasitology 1999;118:375-82. large and small subunit rRNA and mini-exon genes
further supports the distinction of six Trypanosoma
20. Hoare CA. Herpetosoma from man and other mammals. cruzi lineages. Int J Parasitol 2001;31:1218-26.
En: The trypanosomes of mammals: a zoological

118
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

ARTÍCULO ORIGINAL

Comparación del ciclo de vida de Rhodnius colombiensis


Moreno, Jurberg & Galvão, 1999 y Rhodnius prolixus Stal, 1872
(Hemiptera, Reduviidae, Triatominae)
en condiciones de laboratorio
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Jairo Alfonso Clavijo 3,
Gustavo Adolfo Vallejo 1
1
Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima,
Ibagué, Colombia.
2
Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá
D.C., Colombia.
3
Departamento de Matemáticas y Estadística, Facultad de Ciencias, Universidad del Tolima, Ibagué,
Colombia.

Introducción. Rhodnius colombiensis es un triatomino silvestre asociado a palmas de vino


(Attalea butyracea) en la cuenca alta del río Magdalena (Colombia). La frecuente invasión de
estos vectores al domicilio y las elevadas prevalencias de Trypanosoma cruzi en infecciones
naturales constituyen un riesgo en la transmisión de la enfermedad de Chagas.
Objetivo. Comparar la duración del ciclo de vida de R. colombiensis y R. prolixus en condiciones
de laboratorio.
Materiales y métodos. Se utilizaron 92 insectos de cada especie. Se estudió la duración de
cada estadio, el número de comidas por estadio, el porcentaje de mortalidad, la causa de
muerte, el promedio de huevos puestos por cada hembra, el número de huevos fértiles y la
longevidad de los adultos.
Resultados. Los promedios de duración de todos los estadios de desarrollo de R. colombiensis
fueron mayores que en R. prolixus , presentando diferencias significativas en el tiempo
transcurrido desde huevo hasta adulto. Los promedios de huevos puestos y huevos fértiles,
presentaron diferencias significativas, siendo mayores en R. prolixus que en R. colombiensis.
El porcentaje total de mortalidad de R. colombiensis fue de 31,5% y de 6,5% para R. prolixus.
La longevidad en las hembras fue mayor en R. prolixus.
Conclusiones. Los estadios de R. prolixus tienen menor duración, las ninfas en general realizan
menor número de comidas que R. colombiensis , los adultos de R. prolixus toman mayor
número de comidas y ovipositan mayor número de huevos fértiles, presentando hembras con
mayor longevidad. Todos estos parámetros indican que R. prolixus presenta mejor éxito
reproductivo que R. colombiensis, en las condiciones experimentales utilizadas. Los datos
inéditos sobre el ciclo de vida de R. colombiensis serán de utilidad para el mantenimiento de
las colonias en el laboratorio.
Palabras clave: Rhodnius, etapas del ciclo de vida, longevidad, tasa de mortalidad.
Comparison of the life cycles of Rhodnius colombiensis Moreno, Jurberg & Galvão, 1999
and R. prolixus Stal, 1872 (Hemiptera, Reduviidae, Triatominae) under laboratory conditions
Introduction. Rhodnius colombiensis is a sylvatic triatomine associated with wine palm trees
(Attalea butyracea) in the high basin of the Magdalena river (Colombia). The frequent invasion
of these vectors into human dwellings and the high prevalences of natural infection with
Trypanosoma cruzi of these insects suggest an important role in the transmission of Chagas
disease.
Objective. The length of the life cycles of R. colombiensis and R. prolixus under laboratory
conditions were compared.

119
Arévalo A., Carranza J.C., Guhl F. et al Biomédica 2007;27(supl. 1):119-29

Materials and methods. Ninety-two individuals for each species were studied. The mean
duration time of each stage, the number of bloodmeals for each stage, the percentage of
mortality, the cause of death, the mean of eggs laid by female, the number of fertile eggs and the
longevity of adults were recorded.
Results. The mean duration time of all stages of R. colombiensis was higher than in R. prolixus,
producing significant differences in the overall time from egg to adult. The mean of total eggs
and fertile eggs showed significant differences, being higher in R. prolixus than in R.
colombiensis. The total mortality was 31.5% for R. colombiensis and 6.5% for R. prolixus. The
longevity of females was higher in R. prolixus.
Conclusions. The stages of R. prolixus are of relatively short duration. In general, the nymphs
take fewer bloodmeals than R. colombiensis, the adults take more bloodmeals and oviposit a
larger number of fertile eggs, and females have a greater longevity. These parameters indicated
that R. prolixus has superior reproductive success in comparison with R. colombiensis under
the experimental conditions used. These new life cycle data of R. colombiensis will be useful
for maintenance of laboratory colonies.
Key words: Rhodnius, life cycle stages, longevity, mortality rate.

Como consecuencia del aumento de la ha sustituido por cultivos de cachaco (Musa


urbanización y la extensión de cultivos, durante balbisiana ). Estas actividades antrópicas al
las últimas décadas se han presentado parecer han favorecido la adaptación de los
intervenciones humanas en ecotopos naturales insectos a ecotopos cercanos a las viviendas
de los triatominos silvestres y los reservorios de humanas (Vallejo GA, Lozano LE, Carranza JC,
Trypanosoma cruzi, lo cual ha favorecido la Sánchez JL, Jaramillo JC, Guhl F, et al. Ecología
interacción de estas especies con el ciclo de los triatominos no domiciliados en Colombia
peridoméstico y doméstico de la enfermedad de con especial referencia a Rhodnius colombiensis
Chagas (1,2). Por otro lado, los cambios climáticos en el departamento del Tolima. En: Vallejo GA,
pueden ocasionar modificaciones en la Carranza JC y Jaramillo JC editores. Curso Taller
distribución geográfica de las especies e Internacional: Biología, Epidemiología y Control de
incremento en el número de comidas, lo cual la Tripanosomosis Americana y Leishmaniosis.
implicaría un aumento en la probabilidad de Ibagué, Colombia 2000. p. 1-134). Por otro lado,
infección y transmisión, una aceleración del ciclo se han encontrado ninfas de cuarto y quinto
biológico y un aumento de la densidad poblacional estadio, hembras y machos de R. colombiensis
en los ciclos de transmisión (3). en viviendas y construcciones peridomiciliares de
14 municipios del departamento del Tolima,
Rhodnius colombiensis es una especie silvestre constituyendo un indicio de la invasión esporádica
distribuida en la cuenca alta del río Magdalena, la de esta especie al peridomicilio y domicilio
cual incluye los departamentos de Cundinamarca, humano (datos no publicados). De manera
Tolima y Huila, en donde se encuentra asociada semejante, otras especies consideradas
con palmas de vino ( Attalea butyracea ) en exclusivamente silvestres se han encontrado en
simpatría con R. prolixus domiciliado en esta infestaciones domiciliares y peridomiciliares, como
misma región. El hábitat natural de R. colombiensis es el caso de Panstrongylus geniculatus en el
en algunos municipios del departamento del estado de Lara en Venezuela y en la cuenca del
Tolima se ha intervenido sistemáticamente y se Amazonas en Brasil (4,5). En el departamento del
Tolima también se han observado en R.
Correspondencia: colombiensis preva-lencias de T. cruzi y T. rangeli
Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en del 45 y 28,6%, respectivamente (datos no
Parasitología Tropical, Facultad de Ciencias, Universidad publicados), situación que configura un riesgo para
del Tolima, A.A. 546, Ibagué, Colombia.
Telefax (+57-8) 2669176. la transmisión de T. cruzi por parte de este vector.
gvallejo@ut.edu.co
El éxito de las estrategias de vigilancia y control
Recibido: 23/03/06; aceptado: 08/09/06 de los triatominos no domiciliados en Colombia y

120
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

en América Latina depende en parte del insectos. Para cada individuo se verificó el número
conocimiento de su biología, de su evolución y de comidas necesarias para mudar de un estadio
genética, puesto que estas especies constituyen a otro. De los 92 R. prolixus estudiados, 86
un riesgo potencial en el desarrollo de procesos alcanzaron el estadio adulto y de ellos se
de domiciliación. Por este motivo, en el presente seleccionaron aleatoriamente 60 individuos para
trabajo se describe el ciclo de vida de R. el análisis estadístico.
colombiensis, la mortalidad, el número de comidas
Promedio de huevos e índice de fertilidad
de cada estadio de desarrollo y el número de
huevos puestos por las hembras durante su vida, Se establecieron 32 matrimonios con adultos
y se compara en las mismas condiciones vírgenes de cada especie. Diariamente, y hasta
experimentales con el ciclo de vida de R. prolixus, la muerte de las hembras, se contabilizaron los
principal vector domiciliado en Colombia. huevos y se calculó el promedio de los índices
Adicionalmente, los resultados inéditos de la de ovipostura, establecidos como la relación entre
bionomía de R. colombiensis serán de utilidad para el número de huevos puestos por cada hembra
el mantenimiento de las colonias en el laboratorio. durante el período de vida. También se calculó el
promedio de los índices de fertilidad, o sea, la
Materiales y métodos
relación entre el número de huevos fértiles y el
Los especímenes de R. colombiensis se número total de huevos puestos por cada hembra.
capturaron en palmas de Attalea butyracea y los
Análisis estadístico
de R. prolixus en domicilios humanos en el
municipio de Coyaima, departamento del Tolima, En cada una de las variables del estudio se
Colombia. hicieron estimaciones de medias con los
respectivos intervalos de 95% de confianza. Se
Las colonias de ambas especies se mantuvieron
utilizó una técnica de análisis multivariado de
a 28 ± 1°C, 75 a 80% de humedad relativa y
varianza (MANOVA) para comparar los promedios
fotoperiodicidad de 12/12 horas en una incubadora de las diferentes variables entre las dos especies
automática B.O.D. Lab-Line. Los triatominos en cada uno de los estadios de desarrollo. Los
fueron alimentados con sangre de gallina softwares utilizados fueron STATISTICA V. 4,5 y
semanalmente. Treinta y seis hembras y doce ESM PLUS V. 8.2,0.
machos de cada especie se emplearon para
obtener la descendencia con la cual se efectuó el Resultados
estudio del ciclo de vida. Los huevos se colocaron Duración del ciclo de vida
individualmente en recipientes transparentes de
5 cm de altura y 3 cm de diámetro. Se estudió el La duración desde huevo hasta adulto en R.
desarrollo de 92 insectos de cada especie. A las colombiensis fue de 144,4 días con un mínimo
N1 se les ofreció sangre de gallina diariamente de 96 y máximo de 268 días. Por otro lado, la
hasta su primera comida y luego se les alimentó duración del ciclo de vida de R. prolixus fue de
semanalmente con la misma fuente. Se revisaron 117,7 días en promedio, con un mínimo de 73 y
diariamente para determinar la duración de cada máximo de 206 días. El tiempo promedio de
estadio, y así mismo se determinó la mortalidad incubación de los huevos de R. colombiensis fue
de 16,2 días, mientras que el de R. prolixus fue
por estadio y la causa de muerte.
de 15,4 días (cuadro 1).
Número de comidas en cada estadio de
El tiempo de duración para cada uno de los
desarrollo
estadios de desarrollo de R. colombiensis fue de
De los 92 R. colombiensis estudiados, 63 de ellos 14,9 días para N1-N2, 18,5 días para N2-N3, 32,9
alcanzaron el estadio adulto, sin embargo, tres días para N3-N4, 29,4 días para N4-N5 y 32,5
de ellos no realizaron ninguna comida durante su días para el N5-adulto. Por su parte, los estadios
fase adulta y murieron por inanición, lo que explica de desarrollo de R. prolixus tuvieron un tiempo
que en los análisis estadísticos se utilizaran 60 promedio de duración de 12,4 días para N1-N2,

121
Arévalo A., Carranza J.C., Guhl F. et al Biomédica 2007;27(supl. 1):119-29

15,3 días para N2-N3, 19,8 días para N3-N4, 25,1 adulto. Para R. prolixus, el número promedio de
días para N4-N5 y 29,7 días para el N5-adulto. comidas fue de 1,3 para N1; 1,9 para N2; 2,3 para
Todos los estadios mostraron diferencias N3; 2,9 para N4; 3,2 para N5, y 28,1 para el adulto
significativas entre R. colombiensis y R. prolixus (cuadro 2). Los promedios del número de comidas
(figura 1). Las N1 de R. colombiensis demoraron para los estadios N1, N3, N4 y adulto de ambas
en promedio 5,6 días, con un mínimo de 2 y un especies presentaron diferencias significativas.
máximo de 13, para la toma de su primer alimento, A excepción de los adultos, cada uno de los
mientras que las N1 de R. prolixus necesitaron estadios de R. colombiensis presentó un mayor
4,2 días en promedio, con un mínimo de 3 y un número promedio de comidas que los de R.
máximo de 8. prolixus (figura 2).
Número de comidas por estadio Longevidad, fertilidad y mortalidad
El promedio del número de comidas por estadio La longevidad del adulto de R. colombiensis
de R. colombiensis fue de 1,8 para N1; 2,1 para presentó un promedio de 194,6 días, con un
N2; 3,7 para N3; 3,4 para N4 y N5, y 19,9 para el mínimo de 24 y máximo de 357. Para R. prolixus

Cuadro 1. Ciclo de vida de 60 R. colombiensis y 60 R. prolixus desde huevo hasta adulto expresado en días. Desviación
estándar (S) y varianza (S2). El nivel de significación es de 0,05. Las diferencias fueron significativas cuando p < 0,05.

Especie R. colombiensis R. prolixus Comparaciones


2
Estadios Mínimo Máximo Promedio S S Mínimo Máximo Promedio S S2 Valor p
H-N1 15 19 16,2 0,7 0,4 12 16 15,4 0,7 0,5 0,00000
N1-N2 11 22 14,9 3,1 9,3 10 23 12,4 2,5 6,2 0,00002
N2-N3 11 41 18,5 4,4 19,5 10 33 15,3 4,4 19,8 0,00042
N3-N4 17 67 32,9 13,4 178,6 11 34 19,8 4,2 17,9 0,00000
N4-N5 17 59 29,4 9,9 97,3 7 50 25,1 8,6 74,2 0,01096
N5-adulto 25 60 32,5 6,3 40,4 23 50 29,7 5,2 27,6 0,00908
Total 96 268 144,4 - - 73 206 117,7 - - -

Figura 1. Comparación entre las medias del tiempo (días) de eclosión A (huevo-N1) y de muda de cada estadio de
desarrollo (B: N1-N2, C: N2-N3, D: N3-N4, E: N4-N5 y F: N5-adulto) con sus respectivos intervalos de confianza de 95% para
Rhodnius colombiensis y Rhodnius prolixus.

122
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

Cuadro 2. Número de comidas de 60 R. colombiensis y 60 R. prolixus durante el ciclo de vida. Desviación estándar (S) y
varianza (S2). El nivel de significancia es de 0,05. Las diferencias fueron significativas cuando p < 0,05.

Especie R. colombiensis R. prolixus Comparaciones


2 2
Estadios Mínimo Máximo Promedio S S Mínimo Máximo Promedio S S Valor p

N1 1 3 1,8 0,6 0,3 1 3 1,3 0,5 0,2 0,00000


N2 1 5 2,1 0,6 0,3 1 4 1,9 0,7 0,5 0,08032
N3 2 8 3,7 1,8 3,1 1 4 2,3 0,6 0,3 0,00000
N4 2 8 3,4 1,4 2 1 6 2,9 1,1 1,1 0,01746
N5 2 6 3,4 0,7 0,5 2 5 3,2 0,6 0,3 0,12078
Adulto 3 44 19,9 8,1 65,9 15 39 28,1 5,9 35,1 0,00000
Total 11 74 34,3 - - 21 61 39,7 - - -

Figura 2. Comparación entre las medias del número de comidas y los intervalos de confianza de 95% para cada uno de los
estadios de desarrollo (A: N1, B: N2, C: N3, D: N4, E: N5, F: adulto) para R. colombiensis y R. prolixus.

el período de longevidad fue de 226,4 días, con para R. colombiensis fue de 30,9 (rango 0 a 105)
un mínimo de 136 y máximo de 318, dándose y de 59,9 (rango 0 a 202) para R. prolixus. El
diferencias significativas entre las dos especies. promedio del índice de ovipostura para R.
Se observó que el promedio de huevos colombiensis fue de 1,1 y para R. prolixus de 2,6.
ovipositados por R. colombiensis fue de 214,5, Por otro lado, el promedio del índice de fertilidad
con un mínimo de 82 y máximo de 408, en un para R. colombiensis fue de 0,8 y de 0,9 para R.
período de vida promedio de las hembras de 187,3 prolixus (cuadro 3).
días (rango 101 a 357 días). Para R. prolixus el De los 92 insectos de R. colombiensis observados,
promedio de huevos fue de 574,1, con mínimo de 29 murieron sin completar el ciclo de vida (31,5%),
259 y máximo de 1.083, en un período de vida presentándose el mayor porcentaje de mortalidad
promedio de las hembras de 222,7 días (rango en el estadio N3 a N4 (18,2%), seguido por el
136 a 287 días). El promedio de huevos fértiles estadio N5 a adulto, con 7,3%. En el estadio N1 a
para R. colombiensis fue de 183,6 (rango 41 a N2, ningún individuo murió. De los 92 insectos
332) y para R. prolixus fue de 514,1 (rango 250 a observados en R. prolixus, 6 (6,5%) murieron sin
903). Además, el promedio de huevos no fértiles completar el ciclo de vida. En este caso, el mayor

123
Arévalo A., Carranza J.C., Guhl F. et al Biomédica 2007;27(supl. 1):119-29

Cuadro 3. Promedio de huevos puestos; promedio de huevos fértiles y no fértiles; promedio del índice de ovipostura;
fertilidad y promedio de longevidad de las hembras de R. colombiensis y R. prolixus. El nivel de significación es de 0,05.

Especies R. colombiensis R. prolixus Valores p


Variables
Promedios

Huevos puestos 214,5 574,1 0,00000


Huevos fértiles 183,6 514,1 0,00000
Huevos no fértiles 30,9 59,9 0,01532
Índice de oviposturaa 1,1 2,6 0,00000
Índice de fertilidadb 0,8 0,9 0,09122
Longevidad de las hembrasc 187,3 222,7 0,00342
a
Indice de ovipostura = __Número de huevos ovipositados por hembra_
Número de días de cada hembra (longevidad)
b
Indice de fertilidad = __Número de huevos fértiles por hembra__
Total de huevos ovipositados por hembra
c
Longevidad de las hembras = número de días

porcentaje de mortalidad lo presentó el quinto en 1999 (10); en el departamento del Tolima se


estadio ninfal con 4,4%. En los estadios N1 a N2 encuentra en simpatría con R. prolixus
y N3 a N4 ningún individuo murió. domiciliado. Por tratarse de un especie silvestre,
R. colombiensis se ha estudiado poco y los
De los 29 R. colombiensis muertos, el 83% murió
conocimientos sobre su biología son escasos. El
atrapado en la exuvia o realizó ecdisis
hallazgo de ninfas de cuarto y quinto estadio,
defectuosas, y el 17,2% murió por presentar
machos y hembras de R. colombiensis en el
problemas en la toma de alimento. De los seis R.
interior de viviendas humanas indicaría el inicio
prolixus muertos, el 33,3% murió por presentar
de su domiciliación, tal como se ha reportado para
problemas en la toma de alimento y el 66,7%
R. neivai, una especie silvestre limitada a zonas
atrapado en la exuvia o realizó ecdisis
áridas de la región central y occidental de
defectuosas.
Venezuela y del norte de Colombia, en donde se
Discusión han encontrado grupos de ninfas y adultos en las
viviendas humanas (11,12). Los estudios sobre
La presencia de T. cruzi en vectores, reservorios
el ciclo de vida y comportamiento de R.
silvestres y en humanos se viene reportando en
colombiensis podrían contribuír a evaluar el riesgo
el departamento del Tolima desde la década de
de adaptación de esta especie al peridomicilio e
1930 (6-8). Recientes estudios de serología en
intradomicilio y su potencial como vector de T.
bancos de sangre mostraron en el departamento
cruzi en esta región de Colombia.
del Tolima una serorreactividad contra T. cruzi
de 0,69% (9). Por otro lado, el 67% de las muestras Ciclo de vida
de sangre de habitantes del municipio de Coyaima
Este es el primer trabajo en el que se obtuvo el
seropositivos para infección chagásica presentó
promedio del ciclo de vida de R. colombiensis
PCR positivo para T. cruzi (Sánchez JL, Carranza
(144,4 días, mínimo de 96 y máximo de 268), el
JC, Vallejo GA, Lozano LE, Jaramillo JC, Guhl F.
cual supera en 26,7 días el promedio de vida de
Diagnóstico molecular de Trypanosoma cruzi en
Rhodnius prolixus (117,7 días, mínimo de 73 y
reservorios y humanos en una área endémica del
máximo de 206). Estos resultados reflejan el
departamento del Tolima (Colombia). En: Vallejo
mayor vigor de las colonias de R. prolixus
GA, Carranza JC y Jaramillo JC editores. Curso
comparadas con las colonias de R. colombiensis
Taller Internacional: Biología, Epidemiología y
bajo las mismas condiciones de laboratorio.
Control de la Tripanosomosis Americana y
Leishmaniosis. Ibagué, Colombia 2000. p.1-134). Se ha señalado que el desarrollo de los triatominos
R. colombiensis es una especie silvestre descrita varía de acuerdo a las especies estudiadas y a

124
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

las condiciones experimentales de temperatura, se ha observado la existencia de rangos de


humedad relativa y fuente de alimento (13,14). temperaturas y de humedades relativas propicias
En consecuencia, es difícil comparar los para el óptimo desarrollo de los triatominos (38).
resultados sobre ciclos de vida existentes en la
Es posible que otras variables, como la
literatura, debido a las variaciones experimentales
competencia entre individuos por la toma del
de cada trabajo. Por ejemplo, para algunas especies
alimento, puedan influir sobre los resultados. Por
de Rhodnius se han reportado promedios de 102
esta razón, las condiciones experimentales
y 120 días, como es el caso de R. ecuadoriensis
utilizadas en el presente trabajo fueron optimizadas
(15); de 101, 127 y 209,4 días para R. nasutus
para evitar la competencia de individuos durante
(16,17); de 104, 131, 154,2 y 177,1 días para R.
el ofrecimiento y la toma del alimento de manera
neglectus (18,19); de 181,2, 118, 86,7 y 68,9 días
que los resultados no fueran afectados.
para R. neivai (20,21); de 212 y 126 días para R.
pallescens (22); de 190,7, 278 y 118 días para R. Días para tomar el alimento por primera vez
pictipes (20,23,24); de 114, 140 y 118 días para Las ninfas de primer estadio de R. colombiensis
R. prolixus (20,25), y de 114 y 135 días para R. emplean más tiempo (5,6 días en promedio, con
robustus (26). En otros géneros de triatominos mínimo de 2 días y máximo de 13) en tomar su
se han observado promedios de 196,8 y 189,5
alimento por primera vez que las ninfas de primer
días para Meccus picturatus (27); de 230,3 días
estadio de R. prolixus (4,2 días en promedio, con
para Triatoma flavida (28), y de 180,1 días para
mínimo de 3 días y máximo de 8). Probablemente
T. rubrovaria (29). el proceso de esclerotización de las N1 de R.
Con relación a la variación del ciclo de vida colombiensis sea más demorado, aunque se han
ocasionada por las diferencias en las fuentes de reportado otros factores que podrían dificultar la
alimento, varios autores han comparado los ciclos realización de la primera comida, como la fragilidad
de vida de al menos siete especies de triatominos, del aparato bucal, la dificultad para alcanzar el
encontrando que fueron más cortos cuando se hospedero y alcanzar un capilar (39).
alimentaron sobre mamíferos (ratones) que
Se ha reportado que las ninfas de primer estadio
cuando se alimentaron sobre aves (gallinas, pollos
de R. pictipes presentan un promedio de 4,7 días,
o palomas) (30-35). Sin embargo, el ciclo de vida
con un mínimo de 3 y máximo de 7, para comer
reportado en R. neivai alimentado sobre conejos
por primera vez (23), dato que se asemeja al
fue más prolongado que el de la misma especie
observado en el presente trabajo para R. prolixus.
alimentada sobre gallinas (36). Por otro lado, no
se observaron diferencias significativas en Número de comidas realizadas en cada estadio
cohortes de Meccus picturatus alimentadas sobre de desarrollo
gallinas o sobre conejos (27). Los resultados
El número de comidas realizadas por los
anteriores probablemente son el reflejo de
triatominos es de gran importancia desde el punto
asociaciones específicas entre los vectores y
de vista epidemiológico, ya que cuanto más
diferentes especies de mamíferos o de aves que
contactos ocurran entre vectores y hospederos,
constituyen su principal fuente de alimento en
mayor será la probabilidad de infección o transmisión
condiciones naturales.
de T. cruzi (30,37). Resulta de gran interés que
Se han señalado otros factores de importancia los estadios ninfales de R. colombiensis necesitaran
que influyen en la duración del ciclo de vida de mayor promedio de comidas (entre 1,8 y 3,4) para
los triatominos como la temperatura y la humedad. realizar la muda que los mismos estadios de R.
Se ha reportado que las temperaturas elevadas, prolixus (entre 1,3 y 3,2). Por otro lado, los adultos
independientemente de la humedad asociada, de R. prolixus presentaron un promedio de 28,1
pueden acelerar el ciclo biológico de la especie; alimentaciones y los de R. colombiensis un
sin embargo, también pueden afectar la promedio de 19,9 (figura 2). De acuerdo a lo
sobrevivencia de las colonias, impidiendo su anterior, las ninfas de R. colombiensis infectadas
mantenimiento en el laboratorio (37). Por otro lado, con T. cruzi presentarían mayor probabilidad de

125
Arévalo A., Carranza J.C., Guhl F. et al Biomédica 2007;27(supl. 1):119-29

transmisión que las ninfas de R . prolixus trabajo, R. colombiensis presentó mayor


infectadas con T. cruzi. De otra parte, los adultos mortalidad (31,5%) que R. prolixus (6,5%).
de R. prolixus infectados con T. cruzi tendrían Estudios realizados por otros autores sugieren que
mayor probabilidad de transmisión que los adultos las diferentes tasas de mortalidad podrían estar
de R. colombiensis infectados con el parásito. determinadas por la especie de triatomino
estudiada y por las condiciones experimentales
Algunos trabajos realizados con diferentes
utlilizadas. Por ejemplo, se han reportado
especies de triatominos han mostrado variabilidad
mortalidades de 16,3% para R. brethesi (40); de
en el promedio de comidas tanto en ninfas como
19,2% para R. domesticus (41); de 38 y 33% para
en adultos. Así por ejemplo, en R. brethesi (40)
R. pictipes (20,23), y de 16% para R. prolixus (42).
las ninfas presentaron un promedio del número
de comidas relativamente bajo (entre 1,57 y 1,73) En el presente trabajo se observó en R. prolixus
comparado con los resultados de R. colombiensis un mayor número de insectos que completaron
y R. prolixus en el presente trabajo. En otros exitosamente su ciclo de vida, el 93,5% (86/92
trabajos se han observado promedios semejantes, insectos). En contraste, el 68,5% (63/92 insectos)
como en el caso de R. pictipes alimentados sobre de los R. colombiensis completaron su ciclo de
ratones o artificialmente con membrana de silicona desarrollo.
con sangre de carnero, presentando un promedio En estudios previos se ha observado que las
de alimentaciones de 1 a 3,9 en los estadios causas de mortalidad durante el ciclo de vida son
ninfales, y en adultos hembras y machos (39). las mudas defectuosas y los problemas en la toma
En Meccus picturatus las ninfas alimentadas con de alimento (20,23,27,28,37,41). En el presente
sangre de gallina o conejo no superaron las 2,3 trabajo también se observaron estas causas de
comidas en promedio (27). En T. flavida las ninfas muerte, destacándose que para R. colombiensis
presentaron un número promedio que no superó la principal causa de mortalidad fue la incapacidad
las 3,7 comidas (28). Resulta interesante la obser- para la muda, pues el 83% (24/29) murió atrapado
vación de los adultos de R. brethesi, los cuales en la exuvia. Igualmente, se ha observado la
presentaron un promedio de 7,52, muy por debajo incapacidad para la muda en el ciclo de R.
de los adultos de R. colombiensis y R. prolixus robustus como la principal causa de muerte (37).
observados en el presente trabajo (40). Las
diferencias observadas en el número de comidas Promedio de huevos
de las ninfas reflejaría diferencias en la capacidad El promedio de huevos ovipositados por R.
de asimilación del alimento para promover la muda colombiensis fue de 214,5, con un mínimo de 82
y alcanzar el estado adulto. De igual manera, las y máximo de 408, en un período de vida promedio
diferencias observadas en el número de comidas de 187,3 días (rango 101 a 357 días). El promedio
del adulto reflejaría la variabilidad de la capacidad del índice de fertilidad fue de 0,8 para R.
de las hembras para la oviposición. colombiensis. El promedio de huevos para R.
Porcentaje de mortalidad prolixus fue de 574,1 huevos, con un mínimo de
259 y máximo de 1.083, en un período de vida
Al comparar los datos de mortalidad de algunos promedio de 222,7 días (rango 136 a – 287 días).
estudios, se observa una extensa variabilidad El promedio del índice de fertilidad fue de 0,9 para
entre diferentes especies e incluso dentro de la R. prolixus.
misma especie. La mortalidad de R. colombiensis
y de R. prolixus presentó un patrón irregular en el Se ha observado en R. domesticus un promedio
que las N1 de ambas especies no presentaron de huevos de 335 (rango de 173 a 469) en un
mortalidad, las N2 presentaron baja mortalidad y promedio de vida de 328 ± 73 días (41), superior
las N3 de R. colombiensis y las N5 de R. prolixus al observado en R. colombiensis, pero inferior al
presentaron la mayor mortalidad. Otros autores de R. prolixus.
también han reportado patrones irregulares de En los triatominos, la fuente de alimento es un
mortalidad en T. flavida (28). En el presente factor importante en la tasa reproductiva y en el

126
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

índice de fertilidad. Se ha planteado que la sangre Epidemiología y Control de la Tripanosomosis


de gallina presenta mayor cantidad de nutrientes Americana y Leishmaniosis. Ibagué, Colombia
que la sangre de mamífero (43) y que la digestión 2000. p.1-134). A manera de hipótesis se podría
de la sangre de gallina es más rápida para la plantear que si R. colombiensis, que posee un
producción de huevos en los insectos que la de ciclo de vida más largo y con mayor número
la sangre de mamífero (44,45). En el presente promedio de comidas que las ninfas de R. prolixus
trabajo se utilizó sangre de gallina, sin embargo, en condiciones de laboratorio, presentara también
los resultados mostraron menores tasas de características biológicas semejantes en los nidos
oviposición y fertilidad en R. colombiensis que en de las palmas, podría depender más del huésped
R. prolixus alimentados con sangre de gallina. Es vertebrado para su desarrollo hasta el estadio
posible que R. colombiensis se encuentre más adulto, lo cual explicaría la eficiencia de R.
adaptado a una fuente de alimento constituída por colombiensis en la transmisión de T. cruzi y T.
mamíferos silvestres, ya que con frrecuencia está rangeli a sus reservorios naturales en la cuenca
asociado a los nidos de Didelphis marsupialis. alta del río Magdalena. Por ello sería de gran
Probablemente en condiciones naturales esta importancia explorar esta hipótesis estudiando la
fuente de proteínas permita un ciclo de vida más duración del ciclo de vida de R. colombiensis y
eficiente con mayores tasas de oviposición y su comportamiento cuando se alimenta sobre
mayores índices de fertilidad. mamíferos didélfidos. Finalmente, es importante
Conclusiones destacar que el presente estudio aporta datos
inéditos de la bionomía para el mantenimiento de
La extrapolación de datos de laboratorio a las R. colombiensis en condiciones de laboratorio.
poblaciones naturales es relativamente fácil en
triatominos domiciliados como en el caso de R. Agradecimientos
prolixus, debido a que en el domicilio todas las Los autores agradecen el análisis crítico y las
etapas del ciclo de vida ocurren en un ambiente valiosas sugerencias aportadas por dos
relativamente uniforme. Para el caso de los evaluadores anónimos, las cuales mejoraron el
triatominos silvestres, como es el caso de R. manuscrito original.
colombiensis , la extrapolación de datos de
laboratorio a poblaciones naturales es más difícil Conflicto de intereses
porque las etapas del ciclo de vida pueden ocurrir Los autores del presente artículo declaramos que
en ambientes heterogéneos, con variaciones no teníamos conflictos de intereses de orden
climáticas significativas durante el día y con académico, institucional u operacional en el
diferentes fuentes de alimento. Aunque el éxito momento de realización de la investigación.
reproductivo de R. colombiensis fue menor que el
de R. prolixus en las condiciones experimentales Financiación
utilizadas en el presente trabajo, se ha Este trabajo recibió financiación del Instituto
comprobado que R. colombiensis en condiciones Colombiano "Francisco José de Caldas"
naturales presenta altas densidades de poblaciones (Colciencias), proyecto 105-05-279-99, y del Fondo
en ecotopos formados por las brácteas de Attalea de Investigaciones de la Universidad del Tolima.
butyraceae, asociada con nidos de Didelphis También recibió apoyo internacional de la Red
marsupialis en donde se han registrado promedios ECLAT (European Community – Latin-American
hasta de 39,5 insectos/nido, lo que sugiere éxito Network for Research on the Biology and Control
reproductivo en estos ecotopos (Vallejo GA, of Triatominae).
Lozano LE, Carranza JC, Sánchez JL, Jaramillo
Referencias
JC, Guhl F, et al. Ecología de los triatominos no
domiciliados en Colombia con especial referencia 1. Luitgards-Moura JF, Borges-Pereira J, Costa J,
a Rhodnius colombiensis en el departamento del Zauza PL, Rosa-Freitas MG. On the possibility of
autochthonous Chagas disease in Roraima, Amazon
Tolima. En: Vallejo GA, Carranza JC y Jaramillo region, Brazil, 2000-2001. Rev Inst Med Trop Sao Paulo
JC editores. Curso Taller Internacional: Biología, 2005;47:45-54.

127
Arévalo A., Carranza J.C., Guhl F. et al Biomédica 2007;27(supl. 1):119-29

2. Vasquez AM, Samudio FE, Saldaña A, Paz HM, 15. Silva IG, Silva HH. Influência da temperatura na biologia
Calzada JE. Eco-epidemiological aspects of de triatomíneos. XV. Rhodnius ecuadoriensis Lent e
Trypanosoma cruzi, Trypanosoma rangeli and their Léon,1958. Rev Goiana Med 1990;36:49-54.
vector (Rhodnius pallescens) in Panama. Rev Inst Med
16. da Silva IG, da Silva HH. The influence of temperature
Trop Sao Paulo 2004;46:217-22.
on the biology of triatomine. IX. Rhodnius nasutus Stal,
3. Carcavallo RU. Climatic factors related to Chagas 1859 (Hemipetera, Reduviidae). Mem Inst Oswaldo Cruz
disease transmission. Mem Inst Oswaldo Cruz 1999;94 1989;84:377-82.
(Suppl. 1):367-9.
17. Soares MJ, dos Santos Filho PN, Bento DN. The
4. Feliciangeli MD, Carrasco H, Patterson JS, Suarez developmental cycle of Rhodnius nasutus Stal, 1859
B, Martínez C, Medina M. Mixed domestic infestation studied in the laboratory. Rev Soc Bras Med Trop
by Rhodnius prolixus Stal, 1859 and Panstrongylus 1995;28:113-6.
geniculatus Latreille, 1811, vector incrimination, and
18. Silva IG, Silva HH. Influência da temperatura na biologia
seroprevalence for Trypanosoma cruzi among
de triatomíneos.II. Rhodnius neglectus Lent, 1954. Rev
inhabitants in El Guamito, Lara State, Venezuela. Am J
Goiana Med 1988;34:29-37.
Trop Med Hyg 2004;71:501-5.
19. Rocha Dda S, Jurberg J, Carcavallo RU, Cunha V,
5. Valente VC, Valente SA, Noireau F, Carrasco HJ,
Galvão C. Influence of the temperature and humidity
Miles MA. Chagas disease in the Amazon Basin:
on the biology of Rhodnius neglectus Lent, 1954 in
association of Panstrongylus geniculatus (Hemiptera:
laboratory conditions (Hemiptera, Reduviidae,
Reduviidae) with domestic pigs. J Med Entomol
Triatominae). Rev Soc Bras Med Trop 2001;34:357-63.
1998;35:99-103.
20. Lent H, Valderrama A. Observações em laboratório
6. Uribe PC. Infección del Rhodnius prolixus Stahl por
sobre o ciclo evolutivo de Rhodnius prolixus Stal, 1859,
Trypanosoma cruzi y Trypanosoma rangeli. Clásicos R. pictipes Stal, 1872 e R. neivai Lent, 1953. Rev Brasil
del INS. Biomédica 1996;16:87-92.
Biol 1977;37:325-44.
7. Marinkelle CJ. Colombian triatominae and their 21. Cabello DR. Effects of environmental temperature on
infestation with trypanosomatid flagellates. Mitt-Inst life tables of Rhodnius neivai Lent, 1953 (Hemiptera:
Colombo-Aleman Invest Cient 1972;6:11-30. Reduviidae) under experimental conditions. Mem Inst
8. Corredor A, Santacruz M, Paez S, Guatame LA. Oswaldo Cruz 1999;94:709-14.
Distribución de los triatominos domiciliarios en Colombia. 22. Jurberg J, Rangel EF. Ciclo biológico de Rhodnius
Bogotá D.E.: Ministerio de Salud, Instituto Nacional de pallescens Barber, 1932 (Hemiptera, Reduviidae,
Salud; 1990. p.144. Triatominae) em laboratório. Mem Inst Oswaldo Cruz
9. Beltrán M, Bermúdez MI, Forero MC, Ayala M, 1984;79:303-8.
Rodríguez MJ. Control de la infección por 23. Rocha Dda S, Galvão C, Jurberg J. Biology of
Trypanosoma cruzi en donantes de sangre de Rhodnius pictipes Stal, 1872 under laboratory conditions
Colombia, 2003. Biomédica 2005;25:527-32. (Hemiptera, Reduviidae, Triatominae). Mem Inst
10. Mejía JM, Galvão C, Jurberg J. Rhodnius colombiensis Oswaldo Cruz 1994;89:265-70.
sp. N da Colômbia com quadros comparativos entre 24. Otero AMA, Carcavallo RU, Tonn RJ. Notas sobre la
estruturas fàlicas do gênero Rhodnius Stal, 1859 biología, ecología y distribución geográfica de Rhodnius
(Hemiptera, Reduviidae, Triatominae). Entomol Vet pictipes Stal, 1872 (Hemiptera, Reduviidae). Bol Dir
1999;6: 601-17. Malariol San Amb 1976;16:163-8.
11. Zeledon R. Vectores de la enfermedad de Chagas y 25. Silva IG, Silva HH. Influência da temperatura na biologia
sus características ecofisiológicas. Interciencia de triatomíneos.VII. Rhodnius prolixus Stal, 1859. Rev
1983;8:384-95. Patol Trop 1988;14:145-55.
12. Cabello DR. Resistance to starvation of Rhodnius 26. Silva IG, Silva HH. Influência da temperatura na biologia
neivai Lent, 1953 (Hemiptera: Reduviidae: Triatominae) de triatomíneos. XI. Rhodnius robustus Larrousse,
under experimental conditions. Mem Inst Oswaldo Cruz 1927. Rev Goiana Med 1988;34:145-54.
2001;96:587-91.
27. Martínez-Ibarra JA, Novelo Lopez M, Hernandez
13. Schofield CJ. Population dynamics and control of Robles Mdel R, Grant Guillen Y. Influence of the blood
Tríatoma infestans. Ann Soc Belg Med Trop 1985;65 meal source on the biology of Meccus picturatus Usinger
(Suppl. 1):149-64. 1939 (Hemiptera: Reduviidae: Triatominae) under
laboratory conditions. Mem Inst Oswaldo Cruz
14. Zarate LG. The biology and behavior of Triatoma barberi 2003;98:227-32.
(Hemiptera: Reduviidae) in México. III. Completion of
the life cycle adult longevity, and egg production under 28. Cabello DR, Lizano E. Biology of Triatoma flavida
optimal feeding conditions. J Med Entomol 1983; 20: Neiva, 1911 (Hemiptera: Reduviidae) under laboratory
485-97. conditions. Mem Inst Oswaldo Cruz 2001;96:879-81.

128
Biomédica 2007;27(supl. 1):119-29 Ciclo de vida de Rhodnius colombiensis y R. prolixus

29. Almeida CE, Folly-Ramos E, Agapito-Souza R, humidity on the nymphal development of Rhodnius
Magno-Esperança G, Pacheco RS, Costa J. Triatoma robustus. Rev Saude Publica 2001;35:400-6.
rubrovaria (Blanchard, 1843) (Hemiptera-Reduviidae-
Triatominae) IV: bionomic aspects on the vector 38. Luz C, Fargues J, Grunewald J. Development of
capacity of nymphs. Mem Inst Oswaldo Cruz Rhodnius prolixus (Hemiptera: Reduviidae) under
2005;100:231-5. constant and cyclic conditions of temperature and
humidity. Mem Inst Oswaldo Cruz 1999;94:403-9.
30. Juarez E. Behavior of Triatoma infestans under various
laboratory conditions. Rev Saude Publica 1970;4:147-66. 39. Rocha Dda Silva, da Fonseca AH, Costa FA, Jurberg
J, Galvao C. Development of Rhodnius pictipes Stal,
31. Diotaiuti L, Dias JC. Comparative study of the 1872 fed on mice and through a silicone membrane
development cycle of Rhodnius neglectus fed on pigeons (Hemiptera, Reduviidae, Triatominae). Mem Inst
or mice. Rev Soc Bras Med Trop 1987;20:95-9. Oswaldo Cruz 1997;92:553-8.
32. Gomes JE, Azambuja P, Garcia ES. Comparative 40. Rocha D da Silva, dos Santos CM, Cunha V, Jurberg
studies on the growth and reproductive performances J, Galvão C. Life cycle of Rhodnius brethesi Matta,
of Rhodnius prolixus reared on different blood sources. 1919 (Hemiptera, Reduviidae, Triatominae), a potential
Mem Inst Oswaldo Cruz 1990;85:299-304. vector of Chagas disease in the Amazon region. Mem
Inst Oswaldo Cruz 2004;99:591-5.
33. Braga MV, Pinto ZT, Lima MM. Life cycle and
reproductive patterns of Triatoma rubrofasciata (De 41. Guarneri AA, Pinto CJ, Schofield CJ, Steindel M.
Geer, 1773) (Hemiptera: Reduviidae), under laboratory Population Biology of Rhodnius domesticus Neiva &
conditions. Mem Inst Oswaldo Cruz 1998;93:539-42. Pinto, 1923 (Hemiptera: Reduviidae) under Laboratory
Conditions. Mem Inst Oswaldo Cruz 1998; 93: 273-6.
34. Guarneri AA, Diotaiuti L, Gontijo NF, Gontijo AF,
Pereira MH. Comparison of feeding behaviour of 42. Carcavallo RU, Tonn RJ, Ortega R, Betancourt P,
Triatoma infestans, Triatoma brasiliensis and Triatoma Carrasquero B. Notas sobre la biología, ecología y
pseudomaculata in different hosts by electronic distribución geográfica de Rhodnius prolixus Stal, 1859
monitoring of the cibarial pump. J Insect Physiol (Hemiptera: Reduviidae). Bol Dir Malariol San Amb 1978;
2000;46:1121-7. XVIII:191-4.
35. Guarneri AA, Pereira MH, Diotaiuti L. Influence of the 43. Downe AE, Archer JA. The effects of different blood-
blood meal source on the development of Triatoma meal sources on digestion and egg production in Culex
infestans, Triatoma brasiliensis, Triatoma sordida, and tarsalis Coq. (Diptera: Culicidae). J Med Entomol
Triatoma pseudomaculata (Heteroptera, Reduviidae). 1975;12:431-7.
J Med Entomol 2000;37:373-9.
44. Wigglesworth VB. The principles of insect Physiology.
36. Cabello DR, Lizano E, Valderrama A. Vital statistics 7th ed. London: Chapman & Halla; 1974. p.827.
of Rhodnius neivai Lent, 1953 (Hemiptera: Reduviidae)
under experimental conditions. Mem Inst Oswaldo Cruz 45. Nayar JK, Sauerman DM. The effects of nutrition on
1987;82:511-24. survival and fecundity in Florida mosquitoes. Part 4.
Effects of blood source on oocyte development. J Med
37. Rocha DS, Jurberg J, Carcavallo RU, Presgrave OA, Entomol 1977;14:167-74.
Cunha V, Galvao C. Influence of temperature and

129
Hoyos
Biomédica
R., 2007;27(supl. 1):130-6 L.A. et al
Pacheco L., Agudelo Biomédica 2007;27(supl. 1):130-6

COMUNICACIÓN BREVE

Seroprevalencia de la enfermedad de Chagas y factores de


riesgo asociados en una población de Morroa, Sucre
Richard Hoyos 1, Lisandro Pacheco 1, Luz Adriana Agudelo 2, German Zafra 3, Pedro Blanco 1,
Omar Triana 2
1
Grupo de Investigaciones Biomédicas, Universidad de Sucre, Sincelejo, Sucre, Colombia.
2
Grupo de Chagas, Universidad de Antioquia, Medellín, Colombia.
3
Grupo de Inmunología y Epidemiología Molecular, Universidad Industrial de Santander,
Bucaramanga, Colombia.

Introducción. La enfermedad de Chagas constituye un grave problema de salud pública en


Latinoamérica; en Colombia existen en gran parte de su geografía las condiciones
ecoepidemiológicas propicias para la transmisión activa de esta enfermedad.
Objetivo. En este estudio fue evaluada una población del municipio de Morroa, departamento
de Sucre, para identificar factores de riesgo y determinar la seroprevalencia a la enfermedad
de Chagas.
Materiales y métodos. A una muestra de 122 personas pertenecientes al área rural (n=76) y
urbana (n=46), se les aplicó una encuesta epidemiológica y se les realizó un tamizaje serológico
con la prueba Elisa, confirmación de seropositivos con hemoaglutinación indirecta (HAI)
(Chagatest®) y reacción en cadena de la polimerasa (PCR) como prueba parasitológica
confirmatoria.
Resultados. Cuatro de las personas resultaron positivas para Elisa (3,28%); sin embargo,
fueron negativas a HAI y PCR. La serología discordante fue definida con prueba de
inmunofluorescencia indirecta (IFI), encontrándose una de las cuatro personas positivas. La
población analizada mostró una baja presencia de anticuerpos anti–Trypanosoma cruzi. No
fue posible determinar la presencia del parásito en sangre usando la prueba PCR. Los
principales factores de riesgo presentes fueron casas con techos de palmas, piso de tierra,
paredes de bahareque y madera, y la presencia de reservorios (animales domésticos).
Conclusiones. Nuestros resultados indican que la zona estudiada presenta elementos de
riesgo para el establecimiento de un ciclo de transmisión activa, se hace necesario verificar la
presencia de triatominos en la zona de estudio y establecer medidas para prevenir la presencia
de la enfermedad de Chagas en el área de Morroa, Sucre.
Palabras claves: Trypanosoma cruzi, enfermedad de Chagas, serología, factores de riesgo,
prueba de Elisa, epidemiología.
Seroprevalence of Chagas disease and associated risk factors in a population of Morroa,
Sucre
Introduction. Chagas disease is a major public health problem in Latin America. In Colombia,
a large area has the ecoepidemiological conditions which favor the active transmition of this
infection.
Objective. This study was undertaken in a population from the municipality of Morroa, Sucre
Province, to evaluate risk factors and to determine the seroprevalence to Chagas disease.
Materials and methods. A questionnaire was given to a sample population of 122 people
classed as rural (n=76) or urban area (n = 46). A serological screening was undertaken by Elisa
test, with confirmation of seropositives with IHA (Chagatest®) and parasitological confirmation
by polymerase chain reaction (PCR).
Results. Four people were positive by Elisa test (3.3%); however, they were negative by IHA
and PCR. One of the four positives by Elisa was positive by indirect immuno flourescence
(IFAT) as well. The sample showed a low presence of seropositives against Trypanosoma

130
Biomédica 2007;27(supl. 1):130-6 Seroprevalencia y factores de riesgo a T. cruzi

cruzi. However, the presence of parasite could not be confirmed by the PCR test.The main risk
factors were houses thatched with palm roofs, clay floors, wood walls, and presence of domestic
animal reservoirs.
Conclusions. The study population presented risk factors for the establishment of active
transmission. The presence of triatomines must be verified in this area and establishment of
control measures are necessary for preventiving the resurgence of the Chagas disease in
Morroa.
Key words: Trypanosoma cruzi, Chagas disease, serology, risk factors, Elisa test, epidemiology.

Trypanosoma cruzi , agente causal de la Cuando se desea determinar la presencia del


enfermedad de Chagas, es transmitido por parásito T. cruzi en sangre circulante, la reacción
insectos vectores de la subfamilia Triatominae. en cadena de la polimerasa (PCR) constituye una
La fase crónica de la enfermedad se caracteriza importante herramienta que de alguna manera reem-
por complicaciones cardíacas y digestivas (1). Los plaza las técnicas de microscopía existentes (6).
datos serológicos indican que alrededor de 17 a
La presencia de vectores triatominos en el
24 millones de latinoamericanos se encuentran
departamento de Sucre (7), la falta de datos
infectados y cerca de 120 millones están en riesgo
relacionados con la epidemiología y los factores
de infectarse (2). En Colombia se ha estimado
de riesgo para la enfermedad de Chagas en la
que un 5% de la población puede estar infectada
región motivaron el presente estudio de una
y un 23% se encuentra en zona de alto riesgo (3).
muestra poblacional del municipio de Morroa,
Las principales condiciones para el establecimiento Sucre, considerado de bajo riesgo (8), con el fin
de la enfermedad de Chagas en las zonas de de determinar la seroprevalencia de la enfermedad
riesgo son la presencia del insecto vector, los de Chagas con métodos serológicos convencionales
animales silvestres que sirvan de reservorios, la y evaluar los factores de riesgo asociados.
circulación del parásito y las condiciones
Materiales y métodos
socioeconómicas de la región (tipo de vivienda,
hacinamiento y presencia de animales domésticos Localidad y población de estudio
que facilitan la transmisión activa de T. cruzi) (4).
El estudio se llevó a cabo en el municipio de
Las condiciones biológicas, ecológicas y Morroa (coordenadas geográficas: 9° 28' norte, 9°
ambientales del territorio nacional favorecen los 18' sur, 75° 15' este y 75°21' oeste, departamento
ciclos ecoepidemiológicos del parásito, lo que de Sucre), situado a 150 metros sobre el nivel del
hace necesario realizar encuestas serológicas para mar en la costa Atlántica de Colombia, con una
conocer la proporción de individuos infectados en temperatura promedio de 27°C y predominio de
las zonas geográficas del país. clima de sabana tropical y vegetación principal-
Para estos estudios epidemiológicos se utilizan mente compuesta de palmas y áreas boscosas.
los métodos serológicos convencionales: La población es de 16.120 personas, de las cuales
inmunoensayo ligado a una enzima (Elisa), el 68% pertenece al área rural. La muestra
hemoaglutinación indirecta (HAI) e inmuno- poblacional fue calculada basándose en el
fluorescencia indirecta (IFI) para detectar la programa estadístico Epi info 2003, utilizando un
presencia de anticuerpos contra T. cruzi, (4,5). promedio de prevalencia de la enfermedad de
Chagas del 5%, la población del municipio y un
nivel de confianza del 95%.
Correspondencia:
Richard Hoyos Lopez; Carrera 14 N° 16B – 32, Laboratorio Muestras
de Investigaciones Biomédicas, Sincelejo, Sucre, Colombia.
Teléfono: (055) 2820830; fax: (055) 2823867. Las personas que participaron en el estudio debían
richard_hoyoslopez@yahoo.com pertenecer al área de Morroa y tener un periodo
Recibido: 02/02/06; aceptado: 16/08/06 de permanencia en la zona mayor a cinco años,

131
Hoyos R., Pacheco L., Agudelo L.A. et al Biomédica 2007;27(supl. 1):130-6

las personas que no cumplían con estos criterios (Sigma # catalogo 104) se adicionó a una
no fueron tenidas en cuenta para la realización concentración de 1 mg\ml para ser leída a una
del estudio. Previa firma de consentimiento longitud de onda de 410 nm después de agregar
informado, las personas respondieron una 50 ul de NaOH 3N. Se consideraron muestras
encuesta epidemiológica y se extrajo una muestra reactivas positivas aquellas cuya D.O fuera mayor
de sangre que fue dividida en dos viales: uno para al punto de corte (punto de corte = 0,300).
extracción de suero y uno con anticoagulante
Hemoaglutinación indirecta
(EDTA – 0,2 M, pH = 8,0) para extracción de ADN.
Las muestras de sangre y suero se recolectaron Esta prueba se realizó con el kit Chagatest®
en el Laboratorio Clínico del Centro Médico de (Wiener Lab) y se consideraron reactivas las
Salud San Blas del 2 de septiembre al 3 diciembre muestras con títulos iguales o mayores a 1:32.
del 2004, y correspondieron a 122 personas Inmunofluorescencia indirecta
asentadas en 117 viviendas del área rural y urbana.
En esta prueba se utilizaron como antígeno
Encuesta epidemiológica proteínas formalizadas totales de epimastigotes
Las variables tomadas en cuenta fueron el tipo de de la cepa HA de T. cruzi de Colombia, y como
vivienda; el conocimiento sobre el vector, para lo anticuerpo, un anti IgG humano marcado con
cual a cada persona participante en el estudio se isotiocianato de fluoresceína (FITC), según el
le mostraron ejemplares adultos y ninfales de Tri- protocolo establecido en el laboratorio de Chagas
atoma maculata; los lugares de avistamiento del de la Universidad de Antioquia (11). El punto de
insecto, los tipos de animales domésticos y el corte se estableció a partir de la segunda dilución
hacinamiento. Se realizó una búsqueda pasiva de (1:40).
vectores, para lo cual se distribuyeron viales Extracción de ADN y PCR
plásticos rotulados estériles en el corregimiento
de Las Flores. Estos datos se procesaron en el El protocolo de extracción empleado es el descrito
programa estadístico Epi Info 2003. por Sambrook et al. (1989) (12): 500 µL de sangre
se mezclaron con buffer de lisis 2X (Tris - HCl 10
Ensayos serológicos mM PH = 7,4; EDTA 5M a pH = 8,0; SDS al 1%)
La Organización Mundial de la Salud (OMS) y 10 µL de proteinasa K (20 mg/ml); se incubaron
recomienda que las muestras de suero sean a 55°C por 1 hora y después toda la noche a 37°C;
clasificadas como positivas para la enfermedad luego se inactivó la proteinasa K (5 minutos a
de Chagas si son reactivas a dos de tres técnicas 95°C) para centrifugar a 12.000 r.p.m por 40
serológicas con metodologías diferentes (2). En minutos; el sobrenadante resultante se tomó para
este trabajo se utilizaron como pruebas la extracción del ADN con sales de alta molaridad.
diagnósticas Elisa, HAI e IFI. El sobrenadante de ADN se resuspendió en 50
µL de buffer TE 1X, almacenándose luego a -20°C
La prueba de Elisa se desarrolló de acuerdo al
hasta su uso.
protocolo descrito por Gea et al. (1987) y Takasu
et al. (1989) (9,10); el ensayo se realizó en En la prueba de PCR se usaron los iniciadores
microplacas Nunc – Immuno Plate (Maxisorp sur- S35 (5‘AAA TAA TGT ACG GGT GAG ATG CAT
face) y un lector de Elisa Biorad (model 550). El G 3‘) y S36 (5‘GGG TTC GAT TGG GGT TGG
antígeno consistió en un extracto crudo de TG 3‘), que amplifican un fragmento de 330 bp de
epimastigotes de T. cruzi (cepa Y), el cual se las regiones variables de minicírculos del kDNA
adicionó a una concentración de 1,22 ug\ml e de T. cruzi. La reacción de amplificación se realizó
incubado 24 horas en buffer carbonato (pH = 9,6). según Moser et al. (1989) (13) así: 2 µL de buffer
Los sueros se utilizaron en diluciones de 1:800 y PCR (10X), 0,4 µL de dNTPs mezclados (200
como conjugado enzimático se utilizó anti- mM), 1,2 µL de MgCl2 (1,5 mM), 1,2 µL de cada
inmunoglobulina G ligada a fosfatasa alcalina en iniciador (0,6 mM), 0,2 µL de Taq polimerasa y
dilución de 1:1000. El sustrato p – nitrofenilfosfato 6 µL de ADN problema, para un volumen final de

132
Biomédica 2007;27(supl. 1):130-6 Seroprevalencia y factores de riesgo a T. cruzi

25 µL. La PCR se llevó a cabo en un termociclador vectores en el corregimiento de Las Flores fue
PCR – Express (Hybaid) en las siguientes negativa.
condiciones: 1 ciclo a 94°C (5 minutos), 35 ciclos
El análisis por Elisa reveló cuatro personas
a 94°C (1 minuto) 65°C (1 minuto) 72 °C (1 minuto),
seropositivas, un hombre y tres mujeres que se
y una extensión final a 72°C (10 minutos). Los
encontraban en el grupo de edad entre los 14 y 45
productos amplificados se sometieron a una
años. A los sueros seropositivos se les realizó
electroforesis en gel de agarosa al 1,8% y se
una prueba de HAI con el estuche Chagatest®
visualizaron bajo luz U.V después de la tinción (Wiener Lab) con resultados negativos. Dada la
con bromuro de etidio. discrepancia que existía en cuanto al estado
Consideraciones éticas serológico de estos cuatro individuos (Elisa +, HAI
-), se definió la seropositividad con el ensayo de
El Comité de Investigaciones de la Facultad de
IFI, el cual dio resultado positivo en una de las
Educación y Ciencias de la Universidad de Sucre
cuatro muestras, con un título de 1:40.
aprobó este estudio.
La amplificación del kDNA de T. cruzi por PCR
Resultados
en las muestras de sangre pertenecientes a
La encuesta epidemiológica reveló que en la individuos seropositivos por Elisa y positivos para
muestra poblacional estudiada (n = 122), las IFI fue negativa.
condiciones socioeconómicas de la vivienda Discusión
fueron uno de los factores de riesgo encontrados
con mayor frecuencia. Los tipos de vivienda En el ciclo silvestre los triatominos están ubicados
correspondieron principalmente a tres categorías: en ecotopos con unas características particulares
la combinada (62 viviendas, 50,9%), que presenta dependiendo del género Triatominae al que
por lo menos un elemento estructural de riesgo pertenezcan; así, las especies pertenecientes a
para la infestación por triatominos; en segundo Rhodnius se han encontrado asociadas
lugar tenemos el “rancho“(37 viviendas, 30,3%), principalmente a palmas (14,15); Panstrongylus
que presenta todos los elementos estructurales sp. se encuentra en cavidades y huecos de palmas,
de riesgo para la infestación por vectores de la en árboles y también en madrigueras de
enfermedad de Chagas y, por último, la casa de vertebrados silvestres (16); Triatoma sp.
material (18,8%). frecuentemente se localiza en hábitats rocosos y
madrigueras de roedores (16). Los diferentes
Los animales domésticos encontrados en la nichos ecológicos colonizados por las especies
mayoría de las viviendas de la población Triatominae se distribuyen de acuerdo a la
encuestada fueron perros ( Canis familiaris, asociación que presentan en el ambiente silvestre
57,2%), gallinas (Gallus gallus, 44,4%) y cerdos y las preferencias de sustrato se reflejan en los
(Sus scropha, 36,7%), presentándose convivencia sitios infestados por los triatominos dentro de las
de diferentes especies dentro de la misma casa. casas (14); por esta razón, se considera que uno
El hacinamiento fue un factor presente en el 83,6% de los factores de riesgo mas relevantes es el
de los domicilios encuestados, ya que tipo de construcción de los domicilios. En la
población estudiada, la mayor parte de las
presentaban cinco o más personas por habitación
viviendas presentaban por lo menos un elemento
en el domicilio.
estructural de riesgo para la infestación por
Las personas que manifestaron conocer el vector triatominos (50,9%), y otro porcentaje (30,3%)
después de ver ejemplares adultos y ninfales de presentaba todos los elementos estructurales de
T. maculata fueron 54 (44,2%), siendo las paredes riesgo para la infestación por vectores de la
de las habitaciones el lugar más frecuente de enfermedad de Chagas, ya que las viviendas con
observación y los dormitorios el sitio predilecto paredes de bahareque y techos de palma
para la alimentación de los triatominos (34 y 44%, presentan los micrositios (fisuras) y microclimas
respectivamente). La búsqueda pasiva de que permiten una domiciliación acelerada de

133
Hoyos R., Pacheco L., Agudelo L.A. et al Biomédica 2007;27(supl. 1):130-6

triatominos por tener una temperatura y humedad aumenta la densidad de animales en los domicilios
similares a las de los silvestres (17). estudiados y facilita a los insectos vectores la
obtención de alimento.
Aunque se considera que las casas con elementos
materiales sólidos (bloque, cemento y tejas de Se realizó una búsqueda pasiva en los domicilios
asbesto-cemento, presentes en un 18,8%) no del corregimiento de Las Flores (Morroa, Sucre),
presentan ningún tipo de riesgo, se ha observado después de realizar actividades de educación
que algunas especies como T. maculata y T. sobre los peligros de la enfermedad de Chagas y
dimidiata, presentes en Colombia y la Costa el vector Triatominae ; esta búsqueda arrojó
Atlántica (14,15,18), tienen una presencia ligada resultados negativos, pues no se encontraron
al hacinamiento y no a estructuras de riesgo, ejemplares de triatominos, aunque sí hay
considerándose la presencia de estas especies antecedentes de infestación años atrás, según
vectoras un factor de riesgo para cualquier tipo de informaciones anecdóticas de los moradores de
vivienda (15,19). El hacinamiento fue del 83,6%, este corregimiento. No se descarta la presencia
lo que indica que había casas con dos de vectores en el área de este municipio, debido
habitaciones y cinco o más habitantes; además, a que el principal tipo de vegetación son las palmas
las características de higiene asociadas con el en el peri y extradomicilio, y en el departamento
hacinamiento se consideran como de riesgo para de Sucre, Poyet (1995) (24) y Agudelo (2005)
la transmisión vectorial (19,20), la infestación, y (Agudelo L. Experiencias epidemiológicas del
también para la picadura de los triatominos a Grupo de Chagas, Universidad de Antioquia. En:
individuos, ya que facilitan una mayor Jaramillo N, Parra G, Triana O, Moreno J, editores.
concentración de fuentes de alimentos en un Memorias del VIII Curso Internacional sobre la
mínimo de espacio. Ecoepidemiología de la Enfermedad de Chagas y
sus Métodos de Estudio. Medellín: Editorial
Los principales animales domésticos encontrados
Gráficas; 2005) reportan infestación con
coinciden con los reservorios caracterizados para
triatominos (R. pallescens , T. dimidiata y P.
T. cruzi y con otras experiencias epidemiológicas,
geniculatus) en palmas del género Attalea (Attalea
en las que se han encontrado fuertes asociaciones
butyracea, “palma de vino”), Scheelea y Cocos
entre cerdos y la especie Panstrongylus
(Cocos nucifera, “palma de coco”).
geniculatus (21), y entre gallinas y T. dimidiata,
T. maculata y Rhodnius prolixus (3,15, 22). Hay Las pruebas serológicas constituyen importantes
que resaltar que existen reportes que asocian la herramientas que permiten estimar los niveles de
presencia de especies de triatominos infectados infección por T. cruzi y evaluar medidas de con-
con tripanosomas en los municipios del trol epidemiológico y vectorial (20). Sin embargo,
departamento de Sucre (7,23,24). la persistencia de resultados falsos debidos a la
gran cantidad de reacciones cruzadas con
Los perros son los reservorios principales para T.
anticuerpos de individuos que padecen otras
cruzi y los tres principales géneros de Triatominae
enfermedades parasitarias relacionadas (4) ha
tienen como fuente fundamental de alimento a esta
llevado a la OMS a recomendar el uso de por lo
especie. La presencia de posibles fuentes de
menos dos técnicas serológicas con fundamentos
alimentos susceptibles de ser reservorios está
metodológicos diferentes (2,4,5). En nuestro
ligada a altas densidades de animales domésticos
estudio, la prueba Elisa para detectar niveles de
que duermen en el intradomicilio y peridomicilio,
IgG anti–T. cruzi fue lo suficientemente sensible
además de la presencia de diferentes especies
en los sueros de la población estudiada,
de animales en la vivienda, como se observó en
discriminando cuatro muestras reactivas cuya
la muestra poblacional estudiada, en la que
densidad óptica fue mayor al punto de corte y no
además de los tres reservorios antes mencio-
se ubicaron dentro de la zona gris (0,270 a 0,330).
nados, se encontraron patos (Anas sp), pavos
(Meleagris gallipavo), gatos (Felis catus), burros Al realizar la prueba de HAI con el estuche
( Equus asinus ), vacas ( Bos taurus ), lo que Chagatest®, las cuatro muestras resultaron

134
Biomédica 2007;27(supl. 1):130-6 Seroprevalencia y factores de riesgo a T. cruzi

negativas, resultado similar al obtenido por Morroa es considerada un área de bajo riesgo no
Cárdenas et al.(2002), quien obtuvo seis muestras endémica para la enfermedad de Chagas.
reactivas por Elisa y todas negativas por
En conclusión, la zona de estudio presentó los
Chagatest®, lo que demuestra la discordancia
elementos de riesgo estructurales con los
entre esta prueba y Elisa (25). Hay que destacar
ecotopos artificiales propicios para la infestación
que el kit Chagatest® utiliza antígeno
de triatominos; la convivencia con diferentes tipos
citoplasmático liofilizado de cepas argentinas, por
de animales domésticos facilita una fuente de
lo que podría explicarse que las muestras no
alimento estable y reservorios para el desarrollo
reaccionen debido a la posible diferencia en
de colonias domiciliadas de triatominos y, en
determinantes antigénicos entre las cepas del
consecuencia, la transmisión activa de T. cruzi.
cono sur y las cepas de T. cruzi colombianas.
Por la prevalencia de 1,22% encontrada en la
Esta hipótesis es expuesta por Enciso et al.
muestra estudiada se recomienda realizar
(2004), quienes, para explicar las discordancias
estudios para ubicar la presencia de vectores
que existen al tamizar muestras por Elisa y
triatominos y su índice de infección natural en los
estuches de HAI foráneos, además proponen
corregimientos y veredas pertenecientes al
aspectos relacionados con el estadio del parásito
municipio de Morroa, así como establecer el
utilizado como antígeno, su preparación, el ciclo
estado seroepidemiológico de poblaciones
de transmisión al que pertenece la cepa aislada,
pertenecientes al corregimiento de Tumbatoro
así como el huésped o reservorio de origen (26).
(Morroa, Sucre), sitio de origen del individuo
Estos sueros también se analizaron con la técnica
positivo por Elisa e IFI en este estudio.
de IFI, y se confirmó una de las cuatro muestras
como positiva para T. cruzi, encontrándose el Conflicto de intereses
primer caso autóctono de la enfermedad de Los autores manifiestan no tener conflictos de
Chagas en un municipio considerado de bajo intereses con respecto a los resultados de esta
riesgo, en el cual no se ha reportado la presencia investigación.
de individuos infectados por T. cruzi.
Financiación
La PCR se realizó con el objetivo de detectar la
presencia del parásito en sangre; tres muestras Este trabajo de investigación pertenece a la línea
fueron negativas por ausencia de infección de investigaciones biomédicas de la Universidad
(positivos para Elisa, negativos para Chagatest® de Sucre y fue financiado parcialmente por el
e IFI), y una muestra fue negativa por ausencia proyecto 1102-04 -12901 registrado en Colciencias,
de parasitemia en sangre periférica (positivo para así como con recursos del Laboratorio de
Elisa e IFI, negativo para Chagatest®); este Investigaciones Biomédicas de la Universidad de
resultado es consistente con el de personas en Sucre y el Grupo de Chagas de la Universidad de
estado latente o crónico de la enfermedad de Antioquia.
Chagas, que presentan serología positiva pero Referencias
escasa presencia de parásitos en sangre (6,27);
otras posibles causas que pueden incidir en los 1. Atias A. Parasitología médica. Santiago de Chile:
Publicaciones Técnicas Mediterráneas Ltda.: 1999. p.
resultados son el tipo de extracción de ADN 251-64.
utilizado y el volumen de sangre usado en la
2. World Health Organization. Control of Chagas
extracción. Marcon et al (2002) desarrollaron una disease. Second Report of the WHO Expert Committee.
PCR anidada para detectar T. cruzi en pacientes Technical reports series 905. Geneva: WHO; 2002.
en estado crónico de la enfermedad (28); sin em-
3. Moncayo A. Chagas disease: current epidemiological
bargo, la alta sensibilidad encontrada con esta trends after the interruption of vectorial and
técnica es consecuencia de la alta parasitemia transfusional transmission in the southern cone
de las cepas procedentes de las áreas endémicas countries. Mem Inst Oswaldo Cruz 2003;98:577-91.
brasileñas, característica diferente a la de los 4. Cannova D, Aguilar M, Pacheco M, Simona M,
aislamientos colombianos. En este sentido, Medina M. Validación del inmunoensayo enzimático

135
Hoyos R., Pacheco L., Agudelo L.A. et al Biomédica 2007;27(supl. 1):130-6

(Elisa) y hemoaglutinación indirecta (HAI) para el (Heteroptera: Triatominae) BARBER 1932 en la costa
serodiagnóstico de la enfermedad de Chagas. Salus Caribe colombiana. Bull Inst Fr Etudes Audines
2002;6:4-9. 1998;27:309-25.
5. Gutierrez R, Angulo VM, Tarazona Z, Britto M, 18. Cortés L, Suárez H. Triatominos ( Reduviidae:
Fernandez O. Comparison of four serological tests for Triatominae) en un foco de enfermedad de Chagas en
the diagnosis of Chagas disease in a Colombian Talaigua Nuevo (Bolívar, Colombia). Biomédica
endemic area. Parasitology 2004;129:439-44. 2005;25:568-74.
6. Kirchhoff LV, Votava JR, Ochs DE, Moser DR. 19. Segura E, Escobar-Mesa A, Grupo de Estudio Sobre
Comparison of PCR and microscopic methods for la Enfermedad de Chagas. Epidemiología de la
detecting Trypanosoma cruzi . J Clin Microbiol enfermedad de Chagas en el estado de Veracruz. Salud
1996;34:1171-5. Pública Méx 2005;47:201-8.
7. Molina JA, Gualdron LE, Brochero HL, Olano VA, 20. Sanmartino M, Crocco L. Conocimientos sobre la
Barrios D, Guhl F. Distribución actual e importancia enfermedad de Chagas y factores de riesgo en
epidemiológica de las especies de triatominos comunidades epidemiologicamente diferentes de
(Reduviidae: Triatominae) en Colombia. Biomédica Argentina. Rev Panam Salud Pública 2000;7:173-8.
2000;20:344-60.
21. Valente VC, Valente SA, Noireau F, Carrasco HJ,
8. Guhl F, Restrepo M, Angulo VM, Antunes CM, Miles MA. Chagas disease in the amazon basin:
Campbell-Lendrum D, Davies C. Lessons from a association of Panstrongylus geniculatus (Hemíptera,
national survey of Chagas disease transmission risk in Reduviidae) with domestic pigs. J Med Entomol
Colombia. Trends Parasitol 2005;21:259-62. 1998;35:99-103.
9. Gea S, Rodriguez P, Vottero–Cima E. 22. D’Alessandro A, Barreto P, Thomas M. Nuevos
Characterization of Trypanosoma cruzi antigens registros de triatominos domiciliarios y extradomiciliarios
recognized by sera from patients with chronic Chagas en Colombia. Colombia Médica 1981;12:75-85.
disease. Int Archs Allergy Appl Immun 1987;84:410-3.
23. Corredor A, Santacruz M, Gomez S, Guatame L.
10.Takasu N, Masuko T, Hojo H, Hashimoto Y. A Distribución de los triatominos domiciliados en Colombia.
microplate-immunofluorescence assay for anti- Bogotá: Instituto Nacional de Salud; 1990.
Trypanosoma cruzi antibodies. Tohoku J Exp Med
1989;159:307-12. 24. Poyet G. Contexte écologique de Rhodnius pallescens
(Heteroptera: Reduviidae) vecteur de la maladie de
11. Agudelo L. Ecoepidemiología de la enfermedad de Chagas, dans son biotope natural, le palmera Attalea
Chagas en la cuenca del Río Palomino, Sierra Nevada butyraceae: peuplement de l’entomofaune associée et
de Santa Marta. (Tesis de maestría) Medellín: estratégies adaptatives Rhodnius pallescens. Mémoire
Universidad de Antioquia; 2006. de maítrise de biologie des organismos et des
populations. Paris: Université Pierre et Marie Curie;
12. Sambrook J, Fritsh E, Maniatis T. Molecular cloning. 1995.
A laboratory manual. New York: Cold Spring Harbor
Laboratory; 1989. p.223-45. 25. Cárdenas J, Mazariego M. Anticuerpos anti–
Trypanosoma cruzi en pacientes con cardiomiopatía
13. Moser D, Kirchhoff L, Donelson J. Detection of dilatada. Rev Med IMSS 2003;41:111-4.
Trypanosoma cruzi by DNA amplification using the
polymerase chain reaction. J Clin Microbiol 26. Enciso C, Montilla M, Santacruz M, Nicholls S,
1989;27:1477-82. Rodríguez A, Mercado M, et al. Comparación de la
prueba de inmunofluorescencia indirecta, un
14. Lent H, Wigodzinsky P. Revision of the Triatominae inmunoensayo enzimático y la prueba comercial
(Hemiptera, Reduviidae), and their significance as Chagatek® para la detección de anticuerpos anti-
vectors of Chagas disease. Bull Am Mus Nat Hist Trypanosoma cruzi. Biomédica 2004;24:104-8.
1979;163:123-520.
27. Guhl F, Jaramillo C, Carranza JC, Vallejo GA.
15. Márquez J, Palencia J. Detección de Trypanosoma Molecular characterization and diagnosis of
cruzi en una población de triatominos ( Triatoma Trypanosoma cruzi and T. rangeli . Arch Med Res
maculata) en Córdoba, Bolívar. (Tesis de grado). 2002;33:362-70.
Sincelejo: Universidad de Sucre; 2004.
28. Marcon GE, Andrade PD, de Alburquerque DM,
16. Gaunt M, Miles M. The ecotopes and evolution of Wanderley Jda S, de Almeida EA, Guariento ME, et
Triatomine bugs (Triatominae) and their associated try- al. Use of a nested polymerase chain reaction (N–
panosomes. Mem Inst Oswaldo Cruz 2000;95:557-65. PCR) to detect Trypanosoma cruzi in blood samples
17. Pizarro JC, Romaña C. Variación estacional de una from chronic chagasic patients and patients' doubtful
población silvestre de Rhodnius pallescens serologies. Diagn Microbiol Infect Dis 2002;43:39-43.

136
Biomédica 2007;27(supl. 1):137-42 Nitroforinas de Rhodnius colombiensis y R. prolixus

COMUNICACIÓN BREVE

Patrones electroforéticos de hemoproteínas salivares


(nitroforinas) de Rhodnius colombiensis y Rhodnius prolixus
(Hemiptera, Reduviidae, Triatominae)
Andrea Arévalo 1, Julio César Carranza 1, Felipe Guhl 2, Gustavo Adolfo Vallejo 1

1
Laboratorio de Investigaciones en Parasitología Tropical, Facultad de Ciencias, Universidad del Tolima,
Ibagué, Colombia.
2
Centro de Investigaciones en Microbiología y Parasitología Tropical, Universidad de los Andes, Bogotá
D.C., Colombia.

Introducción. La electroforesis de hemoproteínas salivares en geles de almidón es una técnica


de reciente aplicación para diferenciar especies del género Rhodnius que poseen gran
similaridad fenotípica o para diferenciar subpoblaciones de la misma especie, separadas
geográficamente. De las 15 especies de Rhodnius descritas en latinoamérica, por lo menos
ocho han sido reportadas en el territorio colombiano.
Objetivo. Utilizar la electroforesis de hemoproteínas salivares para diferenciar R. prolixus de
R. colombiensis, dos especies con similaridad fenotípica cuyos ciclos doméstico y selvático se
superponen en la cuenca alta del río Magdalena en la región Central de Colombia.
Materiales y Métodos. El contenido de las glándulas salivares de cada insecto se sometió a
electroforesis en gel de almidón utilizando buffer de glicina y revelado de las bandas con
3,3’,5,5’-tetrametilbenzidina. Los patrones de bandeo fueron registrados fotográficamente.
Resultados. Usando esta técnica se observaron los perfiles electroforéticos de las
hemoproteínas salivares de R. prolixus y R. colombiensis los cuales permitieron su inequívoca
diferenciación.
Conclusión. Estos resultados demuestran la utilidad de la técnica para la diferenciación entre
R. prolixus y R. colombiensis en adición a métodos morfométricos y moleculares previamente
utilizados para diferenciar estas dos especies.
Palabras clave: Rhodnius, Triatominae, saliva, Colombia.
Electrophoretic patterns of salivary hemeproteins (nitrophorines) of Rhodnius colombiensis
and R. prolixus (Hemiptera, Reduviidae, Triatominae)
Introduction. Salivary hemeprotein electrophoresis in starch gels is a recent technique used
for differentiation of Rhodnius species with great phenotypic similarity. Furthermore, populations
of the same species can be differentiated from geographically separated locales. Of the 15
described Rhodnius species in Latin America, at least eight have been reported in Colombia.
Objective. To use the salivary hemeproteins electrophoresis for R. prolixus and R. colombiensis
identification. These two species are phenotypically similar and have overlapping domestic
and sylvatic cycles where they occur in the upper basin of the Magdalena river, Central Colombia.
Material and methods. The content of salivary glands of each insect was subjected to starch
gel electrophoresis using glycine buffer, and the bands were revealed with 3,3’,5,5’-
tetramethylbenzidine. Band patterns were photographically recorded.
Results. Electrophoretic patterns of salivary hemeproteins of R. prolixus and R. colombiensis
were able to unequivocally differentiate the two species.
Conclusion. The usefulness of the starch gel technique for distinguishing between R. prolixus
and R. colombiensis was demonstrated as an additional tool to the morphometric and molecular
methods already in use for differentiation of these two species.
Key words: Rhodnius, Triatominae, saliva, Colombia.

137
Arévalo A., Carranza J.C., Guhl F., Vallejo G.A. Biomédica 2007;27(supl. 1):137-42

La saliva de los insectos hematófagos presenta estadio ninfal (N1) hasta el adulto. En el primer
sustancias anticoagulantes, antihistamínicas, estadio se han purificado, además, dos
vasodilatorias y antiplaquetarias que facilitan el hemoproteínas salivares, la NP5 y la NP6, cuya
proceso de alimentación sobre el huésped cantidad va disminuyendo en las glándulas
vertebrado (1-4). En los triatominos se han salivares con las mudas sucesivas hasta
encontrado varias sustancias relacionadas con ausentarse en la fase adulta. En el segundo
estas funciones. En el caso del género Rhodnius, estadio (N2) aparece la NP4. En el tercer estadio
hasta el momento se han reportado ocho proteínas ninfal (N3) se presenta la NP1. Por ultimo, en el
salivares: tres factores que contrarrestan la quinto estadio ninfal (N5) aparece la NP3, y a
agregación plaquetaria, llamados inhibidores de partir de este momento ya están presentes las
agregación de R. prolixus (RPAI 1-3) (proteínas cuatro nitroforinas, NP1 a NP4, que perduran en
lipocalinas) (4,5); una apirasa que se encarga de el adulto (17).
hidrolizar el ADP bloqueando la agregación En el género Rhodnius existen varias especies
plaquetaria (4,6), y, por último, las nitroforinas epidemiológicamente importantes para la
(NPs), un grupo de cuatro hemoproteínas transmisión de los parásitos T. cruzi y T. rangeli.
denominadas NP1 a NP4 según su relativa Según las características biológicas, ecológicas
abundancia en las glándulas salivares (7). Las y etológicas de estos vectores, que suelen variar
nitroforinas se pueden agrupar en dos conjuntos de una zona geográfica a otra, pueden
con base en las relaciones de sus secuencias de considerarse como vectores primarios o
aminoácidos; es así como NP1 y NP4 son secundarios, o estar en proceso de alcanzar este
idénticas en un 90%, y NP2 y NP3 son idénticas último nivel. Algunas especies del género
en un 80% (4,7,8). Para Cimex lectularius de la Rhodnius suelen ser fenotípicamente similares y,
familia Cimicidae se ha reportado otra nitroforina además, ser simpátricas en algunas zonas
que, aun cuando no es significativamente similar geográficas. En los estudios de la epidemiología
a las de R. prolixus (familia Reduviidae), revelaría y la biología de los vectores y de los ciclos de
una evolución convergente entre estas transmisión de los parásitos T. cruzi y T. rangeli,
hemoproteínas (9,10). En Rhodnius , las NP así como en las encuestas entomológicas y en
transportan óxido nítrico e histamina a través de las campañas de control y prevención vectorial,
su grupo hemo (Fe III), el cual es el sitio de enlace se han utilizado diferentes tipos de técnicas que
para ambas moléculas (4,11-14). El óxido nítrico han permitido distinguir la mayoría de las especies
permite la vasodilatación e inhibe la agregación pertenecientes a este género, entre ellos la
plaquetaria (4,11,15). Por su parte, la unión de la morfología (18-20), las isoenzimas (21-23), la
histamina a las NP impide la respuesta de morfometría cuantitativa (23), el análisis
inflamación en el huésped vertebrado (4,12,13). cuantitativo de patrones de sensilias antenales
La NP2 o prolixin-S se encarga de bloquear la (24), el análisis de secuencias de ADN
cascada de coagulación, ya que evita que el factor mitocondrial (25,26) y el análisis de genitalia
X se convierta en el factor Xa (4,13,16). Por otro masculina (20,27); sin embargo, algunas veces
lado, se ha comprobado que las NP en R. prolixus no suelen ser muy efectivas, ya que no generan
son estadio específicas, es decir, que puede diferencias y, además, algunas son dispendiosas
presentarse una o faltar otra de un estadio a otro. y muy costosas.
Es así como la NP2 está presente desde el primer
Mediante la electroforesis de hemoproteínas
salivares es posible diferenciar especies
Correspondencia: fenotípicamente similares o poblaciones de una
Gustavo Adolfo Vallejo, Laboratorio de Investigaciones en
Parasitología Tropical, Facultad de Ciencias, Universidad misma especie separadas por áreas geográficas
del Tolima, Ibagué, Colombia. (28,29). Además, los perfiles electroforéticos de
Fax (+57-8) 2669176. las hemoproteínas pueden reflejar distancias
gvallejo@ut.edu.co biogeográficas entre poblaciones y revelar
Recibido: 23/03/06; aceptado: 08/09/06 relaciones filogenéticas entre las especies (28).

138
Biomédica 2007;27(supl. 1):137-42 Nitroforinas de Rhodnius colombiensis y R. prolixus

Estas diferencias son considerablemente siguiendo la metodología descrita por Jaramillo


importantes para la epidemiología de los vectores et al. 2001 (32).
de T. cruzi (30) y T. rangeli, y ayudan a identificar
Preparación de la muestra y electroforesis
las especies relacionadas en el ciclo de
transmisión de un área geográfica específica. Se disectaron 13 insectos adultos de R. prolixus
Trabajos previos han mostrado que la y 13 de R. colombiensis y sus glándulas salivares
diferenciación morfológica de R. colombiensis y fueron lavadas en solución salina estéril al 0,9%.
R. prolixus no es fácil, tanto así que durante varios Las glándulas salivares de cada insecto se
años a la especie R. colombiensis se le denominó maceraron y homogeneizaron con 10 ml de buffer
R. prolixus “forma Tolima” (31); posteriormente, a de corrido (glicina 0,15 M/NaOH, pH 9,5). Una vez
partir de estudios de isoenzimas, genitalia y genes homogeneizadas, el contenido de las glándulas
ribosomales, se concluyó que se trataba de una fue absorbido en hilos de algodón estériles de 0,9
especie diferente hoy denominada como R. cm y colocados en las canaletas del gel de
colombiensis (20, 32). En el presente trabajo se almidón al 8% preparado con buffer de corrido
detectaron diferencias por medio de los patrones (glicina 0,15M/NaOH, pH 9,5) diluido 1:10. La
electroforéticos de hemoproteínas entre las electroforesis se llevó a cabo a 300 voltios por
especies R. colombiensis y R. prolixus, dos cuatro horas. Para el revelado, los geles se
especies fenotípicamente similares y simpátricas, sumergieron en una solución de 0,3 mg/ml de
ya que sus ciclos selvático y doméstico se 3,3’,5,5’-tetrametilbenzidina en una mezcla de
traslapan en la cuenca alta del Río Magdalena. etanol, ácido acético y agua en proporción 1:1:1.
Estas especies se han considerado vectores Luego se transfirieron a una solución de peróxido
importantes para la transmisión de T. cruzi y T. de hidrógeno al 2% hasta la aparición de las
rangeli en esa zona geográfica. R. colombiensis bandas (28,29). Con fines comparativos, se
presenta prevalencias de T. cruzi y T. rangeli del examinaron los patrones electroforéticos de las
45 y 28,6%, respectivamente (datos no hemoproteínas de dos adultos de R. pallescens.
publicados), situación que configura un riesgo para El número de bandas generado en cada carril del
la transmisión de T. cruzi por parte de este vector gel fue determinado en el momento inicial en que
en la región central de Colombia. se desarrolla la coloración, pues a medida que
Materiales y métodos transcurre el tiempo, las bandas pierden
resolución. A partir de las fotografías y del número
Insectos de bandas observadas al inicio de la coloración
Los triatominos fueron recolectados en el se obtuvieron diagramas que representan el
municipio de Coyaima, departamento del Tolima, número de bandas en cada carril.
Colombia. Los adultos de R. colombiensis fueron Análisis de datos
capturados en siete palmas de vino (Attalea
butyraceae) y los de R. prolixus dentro de 10 De conformidad con el análisis propuesto por
viviendas humanas de las veredas Totarco Dinde Soares et al . (29), se calculó el índice de
y Chenche Cucal del municipio de Coyaima. Los polimorfismo de hemoproteínas (P) para cada
insectos se mantuvieron a 28 ± 1°C, con humedad especie, p = 1- Σ(X2), donde X es igual a la
relativa de 75 a 80% y una fotoperiodicidad de frecuencia absoluta de cada perfil de
12/12 horas en una incubadora automática B.O.D. hemoproteínas en la especie sobre el número total
Lab-Line, y fueron alimentados semanalmente de insectos examinados.
sobre gallinas. Resultados
Para la determinación de las especies se utilizó El número de perfiles y el patrón de bandeo
la clave taxonómica de Lent & Wygodzinsky obtenido a través de la electroforesis de
(1979) (18) y se realizó amplificación por reacción hemoproteínas salivares en geles delgados de
en cadena de la polimerasa (PCR) de genes ADNr almidón para R. colombiensis y R. prolixus

139
Arévalo A., Carranza J.C., Guhl F., Vallejo G.A. Biomédica 2007;27(supl. 1):137-42

permitió establecer una clara diferencia entre las


dos especies (figura 1 y 2). R. prolixus presentó
cinco perfiles en el corrido electroforético,
designados desde la A hasta la E en las figuras 1
y 2; por otro lado, R. colombiensis mostró tres
perfiles (A, B y C) (figuras 1 y 2)
R. prolixus presentó un promedio de 3,1 bandas,
con un máximo de cinco y un mínimo de dos; en
R. colombiensis solamente se observaron dos
bandas en todos las insectos examinados (figuras
1 y 2). Además, se observó que las hemoproteínas
salivares de R. colombiensis tienen polaridad
negativa, pues corrieron hacia el polo positivo.
En R. prolixus, las hemoproteínas presentan carga
positiva y negativa, pues en el corrido
electroforético fue evidente una atracción hacia
ambos polos (figura 1 y 2).
El índice de polimorfismo de las hemoproteínas
salivares (p) para las dos especies estudiadas Figura 2. Electroforesis en gel delgado de almidón al 8% de
hemoproteínas salivares de R. prolixus (canaletas 1 a 7) y
fue de p = 0,7577 en R. prolixus y en R.
R. colombiensis (canaletas 8 a 14). El panel inferior de la
colombiensis de p = 0,6156. figura corresponde a un diagrama que representa las bandas
del panel superior.
Discusión
R. prolixus presentó un índice de polimorfismo de (p = 0,6156). Para Soares et al., (29) el índice de
hemoproteínas (p) alto (p = 0,7577) con respecto polimorfismo de R. prolixus presentó un valor p =
a R. colombiensis, que presentó un índice inferior 0,7300, inferior en 0,0277 al valor obtenido para
esta especie (p = 0,7577) en el presente trabajo.
Es probable que esta diferencia se deba a la
procedencia de ambas poblaciones, ya que la
población utilizada por Soares et al. (29) era
originaria de Venezuela, mientras que los R.
prolixus utilizados en el presente estudio se
recolectaron en la región central de Colombia. Por
otro lado, los perfiles electroforéticos de las
hemoproteínas pueden reflejar distancias
biogeográficas entre las poblaciones estudiadas
(28). El valor (p) de R. colombiensis (p = 0,6156)
se acerca mucho al índice de polimorfismo de R.
pallescens (p = 0,6524) (29), especies éstas
morfológicamente similares (20,31). Estos valores
estarían reflejando el parentesco filogenético entre
estas dos especies pertenecientes al grupo
“pallescens”, conformado por R. pallescens, R.
colombiensis y R. ecuadoriensis que representa
Figura 1. Electroforesis en gel delgado de almidón al 8% de un cline evolutivo desde el norte de Colombia
hemoproteínas salivares de R. prolixus (canaletas 1 a 6), R.
pallescens (canaletas 7 y 8) y R. colombiensis (canaletas 9
hasta el sur de la cordillera de los Andes, en donde
a 14). El panel inferior de la figura corresponde a un diagrama finalmente se originó R. ecuadoriensis en el
que representa las bandas del panel superior. Ecuador y norte del Perú (31).

140
Biomédica 2007;27(supl. 1):137-42 Nitroforinas de Rhodnius colombiensis y R. prolixus

La electroforesis de hemoproteínas salivares es Financiación


una técnica fácil y rápida que permite diferenciar
Este trabajo recibió financiación del Instituto
especies del género Rhodnius, al cual pertenecen
Colombiano "Francisco José de Caldas"
especies epidemiológicamente significativas en
(Colciencias), proyecto 105-05-279-99, y del Fondo
la transmisión de los parásitos T. cruzi y T. rangeli
de Investigaciones de la Universidad del Tolima.
en muchas regiones de Colombia. Además, la
También recibió apoyo internacional de la Red
técnica podría ser útil en casos en que no se
ECLAT (European Community–Latin-American
pueda diferenciarlas debido a la similitud Network for Research on the Biology and Control
morfológica de las especies. of Triatominae).
Por otro lado, podría ser una herramienta útil para Referencias
los trabajos de encuestas entomológicas y en los
programas de control y prevención vectorial, pues 1. Stark KR, James AA. The salivary glands of disease
vectors. En: Beaty BJ, Marquardt WC, editors. The
mediante ella se podrían identificar las especies biology of disease vectors. Colorado: Colorado
de una manera fácil y rápida cuando se encuentren University Press; 1996. p. 333-48.
circulando en los ciclos de transmisión silvestre
2. Ribeiro JM. Role of saliva in blood feeding by
o doméstico en una región geográfica específica. arthropods. Annu Rev Entomol 1987;32:463-78.
Ello también sería útil cuando se van a emplear
3. Law JH, Ribeiro JM, Wells MA. Biochemical insights
estrategias de control vectorial, ya que pueden derived from diversity in insects. Annu Rev Biochem
existir especies silvestres que estén invadiendo 1992;61:87-111.
las viviendas, como en el caso de R. colombiensis
4. Montfort WR, Weichsel A, Andersen JF. Nitrophorins
en la cuenca alta del río Magdalena (región central and related antihemostatic lipocalins from Rhodnius
de Colombia), cuyas ninfas de cuarto, quinto prolixus and other blood-sucking arthropods. Biochim
estadio, hembras y machos han sido encontradas Biophys Acta 2000;1482:110-8.
durante trabajos previos en viviendas y 5. Francischetti IM, Ribeiro JM, Champagne D,
construcciones peridomiciliares de zonas en donde Andersen J. Purification, cloning, expression and
se adelantan programas de control tendientes a mechanism of action of a novel platelet aggregation
inhibitor from salivary gland of the blood-sucking bug,
eliminar a R. prolixus , el principal vector Rhodnius prolixus. J Biol Chem 2000;275:12639-50.
domiciliado en Colombia (datos no publicados).
6. Sarkis JJ, Guimarães JA, Ribeiro JM. Salivary
La técnica de electroforesis de hemoproteínas es
apyrase of Rhodnius prolixus. Kinetics and purification.
una herramienta que permite diferenciar especies Biochem J 1986;233:885-91.
de triatominos de una forma fácil, sin embargo,
7. Champagne DE, Nussenzveig RH, Ribeiro JM.
es importante durante el procedimiento de Purification, partial characterization and cloning of nitric
coloración registrar inmediatamente el número oxide-carrying hemeproteins (nitrophorins) from
original de las bandas, pues la intensidad de las salivary glands of the blood-sucking insect Rhodnius
mismas va disminuyendo con el tiempo. En prolixus. J Biol Chem 1995;270:8691-5.
conclusión, estos resultados demuestran la 8. Andersen JF, Montfort WR. The crystal structure of
utilidad de la técnica para la diferenciación entre Nitrophorin 2. A trifunctional antihemostatic protein from
R. prolixus y R. colombiensis y como the saliva of Rhodnius prolixus . J Biol Chem
2000;275:30496-503.
complemento de métodos morfométricos y
moleculares previamente utilizados para 9. Valenzuela JG, Walker FA, Ribeiro JM. A salivary
nitrophorin (nitric-oxide-carrying hemoprotein) in the
diferenciarlas. bedbug Cimex lectularius. J Exp Biol 1995;198:1519-26.
Conflicto de intereses 10. Valenzuela JG, Ribeiro JM. Purification and cloning
of the salivary nitrophorin from the hemipteran Cimex
El primer autor y los coautores del presente lectularius. J Exp Biol 1998;201:2659-64.
artículo declaramos que no teníamos conflictos
11. Ribeiro JM, Hazzard JM, Nussenzveig RH,
de intereses de orden académico, institucional u Champagne DE, Walker FA. Reversible binding of
operacional en el momento de realización de la nitric oxide by a salivary heme protein from a
investigación. bloodsucking insect. Science 1993;260:539-41.

141
Arévalo A., Carranza J.C., Guhl F., Vallejo G.A. Biomédica 2007;27(supl. 1):137-42

12. Ribeiro JM, Walker FA. High affinity histamine-binding 23. Dujardin JP, Chavez T, Moreno JM, Machane M,
and antihistaminic activity of the salivary nitric oxide- Noireau F, Schofield CJ. Comparison of izoenzyme
carrying heme protein (nitrophorin) of Rhodnius prolixus. electrophoresis and morphometric analysis for
J Exp Med 1994;180:2251-7. phylogenetic reconstruction of the Rhodniini (Hemiptera:
Reduviidae: Triatominae). J Med Entomol 1999;36:653-9.
13. Ascenzi P, Nardini M, Bolognesi M, Montfort WR.
Nitrophorins. Lipocalin-based heme proteins 24. Catalá S, Schofield C. Antennal sensilla of Rhodnius.
transporting nitric oxide. Biochem Mol Biol Educ J Morphol 1994;219:193-203.
2002;30:68-71.
25. Stothard JR, Yamamoto Y, Cherchi A, Garcia AL,
14. Walker FA. Nitric oxide interaction with insect Valente SA, Schofield CJ, et al. A preliminary survey
nitrophorins and thoughts on the electron configuration of mitochondrial sequence variation in Triatominae
of the {FeNO} 6 complex. J Inorg Biochem 2005;99: (Hemiptera: Reduviidae) using polymerase chain
216-36. reaction-based single strand conformational
polymorphism (SSCP) analysis and direct sequencing.
15. Moncada S, Radomski MW, Palmer RM. Endothelium- Bull Entomol Res 1998;88:553-60.
derived relaxing factor: identification as nitric oxide and
role in the control of vascular tone and platelet function. 26. Lyman DF, Monteiro FA, Escalante AA, Cordon-
Biochem Pharmacol 1988;37:2495-501. Rosales C, Wesson DM, Dujardin JP, et al.
Mitochondrial DNA sequence variation among triatomine
16. Ribeiro JM, Schneider M, Guimarães JA. Purification vectors of Chagas disease. Am J Trop Med Hyg
and characterization of prolixin S (nitrophorin 2), the 1999;60:377-86.
salivary anticoagulant of the blood-sucking bug
Rhodnius prolixus. Biochem J 1995;308:243-9. 27. Jurberg J. Uma abordagem filogenética entre os
Triatomineos baseada nas estruturas fálicas. In:
17. Moreira FM, Coelho HS, Zingali RB, Oliveira PL, Schofield CJ, Dujardin JP, Jurberg J, editors.
Masuda H. Changes in salivary nitrophorin profile during Proceedings of the International Workshop on
the life cycle of the blood-sucking bug Rhodnius prolixus. Population Biology and Control of Triatominae, Santo
Insect Biochem Mol Biol 2003;33:23-8. Domingo de los Colorados, Ecuador. Mexico D.F:
18. Lent H, Wygodzinsky P. Revision of Triatominae INDRE; 1996. p.45-50.
(Hemiptera, Reduviidae), and their significance as 28. Soares RP, Gontijo NF, Romanha AJ, Diotaiuti L,
vectors of Chagas’ disease. Bull Am Mus Nat Hist Pereira MH. Salivary heme proteins distinguish
1979;163:123-520. Rhodnius prolixus from Rhodnius robustus (Hemiptera:
19. Carcavallo R, Galíndez I, Jurberg J, Lent H. Atlas of Reduviidae: Triatominae). Acta Trop 1998;71:285-91.
Chagas’ disease vectors in the Americas. Río de 29. Soares RP, Sant’Anna MR, Gontijo NF, Romanha
Janeiro: Editora Fiocruz; 1998. p.53-72. AJ, Diotaiuti L, Pereira MH. Identification of
20. Moreno J, Galvão C, Jurberg J. Rhodnius morphologically similar Rhodnius species (Hemiptera:
colombiensis sp. n. da Colômbia com quadros Reduviidae: Triatominae) by electrophoresis of salivary
comparativos entre estructuras fálicas do género heme proteins. Am J Trop Med Hyg 2000;62:157-61.
Rhodnius Stal. 1859 (Hemiptera, Reduviidae, 30. WHO. Control of Chagas’ disease. Geneve: World
Triatominae). Entomol Vect 1999;6:601-17. Health Organ Tech Rep Ser. 811; 1991. p.95.
21. Harry M, Galíndez I, Cariou ML. Isoenzyme variability 31. Schofield CJ, Dujardin JP. Theories on the evolution
and differentiation between Rhodnius prolixus , R. of Rhodnius. Actualidades Biológicas 1999;21:183-97.
robustus and R. pictipes, vectors of Chagas disease in
Venezuela. Med Vet Entomol 1992;6:37-43. 32. Jaramillo C, Montaña MF, Castro LR, Vallejo GA,
Guhl F. Differentiation and genetic analysis of Rhodnius
22. Chavez T, Moreno J, Dujardin JP. Isoenzyme prolixus and Rhodnius colombiensis by rDNA and RAPD
electrophoresis of Rhodnius species: a phenetic amplification. Mem Inst Oswaldo Cruz 2001;96:1043-8.
approach to relationships within the genus. AnnTrop
Med Parasitol 1999;93:299-307.

142
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

REVISIÓN DE TEMA

Actualización de la distribución geográfica y ecoepidemiología


de la fauna de triatominos (Reduviidae: Triatominae)
en Colombia
Felipe Guhl, Germán Aguilera, Néstor Pinto, Daniela Vergara
Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT), Facultad de Ciencias,
Universidad de los Andes, Bogotá, Colombia.
La información de 10 departamentos del total de 31 que contempla este manuscrito, ha sido publicada en
“Memorias Primer Taller Internacional Sobre Control de la Enfermedad de Chagas. Curso de Diagnóstico,
Manejo y Tratamiento de la Enfermedad de Chagas. VI Reunión de la Iniciativa Andina para el Control de la
Enfermedad de Chagas, Bogotá; 2005. p.25-41.

La presente publicación recopila la información de registros de triatominos y datos sobre


infección natural con tripanosomátidos a nivel departamental y municipal, publicada hasta la
fecha así como la reportada por los servicios departamentales de salud e institutos de
investigación. Se presentan figuras elaboradas de acuerdo a la información suministrada por
los registros y una clasificación de la fauna triatomínica de acuerdo a las condiciones
ecoepidemiológicas del país, teniendo en cuenta la altitud como factor determinante en la
distribución de estos insectos.
Teniendo en cuenta la frecuencia con que se reportan en el domicilio y peridomicilio, se
consideran las siguientes especies como las de mayor riesgo de transmisión en Colombia:
Rhodnius prolixus, Triatoma dimidiata, Triatoma maculata y Triatoma venosa.
Se resalta la importancia de la vigilancia entomológica como herramienta indispensable para
reforzar las estrategias de control de la transmisión de la enfermedad de Chagas, permitiendo
también la evaluación del riesgo que representan las especies de triatominos silvestres en
Colombia.
Palabras clave: Triatominae, ecología de vectores, ubicaciones geográficas, enfermedad de
Chagas, control vectorial.
Updated geographical distribution and ecoepidemiology of the triatomine fauna (Reduviidae:
Triatominae) in Colombia
Information concerning triatomine records from provinces and municipalities was accumulated—
including data indicating natural infections with trypanosomatides—that has been previously
published or reported by Colombian provincial health services and research institutes. Altitude
appeared to be the main factor responsible for the distribution of the insects. Illustrations
summarize the information provided by the above records. A triatomine fauna classification is
presented that corresponds to the eco-epidemiological conditions of the country, considering
altitude as the factor determining the geographical distribution of these vectors. Rhodnius
prolixus, Triatoma dimidiata, Triatoma maculata and Triatoma venosa are considered the major
transmission risk species in Colombia, according to the frequency in which they are reported
inside dwellings and peridomiciliary areas.
Entomological surveillance providess a necessary tool to reinforce the control strategies for
Chagas disease. This also allows the evaluation of transmission risk that the sylvatic triatomines
represent in Colombia.
Key words: Triatominae; ecology, vector; geographic locations; Chagas disease; vector control.

143
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

La tripanosomiasis americana es una zoonosis insectos vectores. Si se tiene en cuenta que el


muy compleja; el parásito Trypanosoma cruzi principal mecanismo de transmisión de la
presenta una gran variedad de cepas e infecta a enfermedad de Chagas es a través del contacto
través de los triatominos vectores a 150 especies del hombre y los animales reservorios con los
de 24 familias de animales domésticos y insectos vectores, el conocimiento de la
silvestres (1). La existencia de la enfermedad de distribución de los triatominos es de gran impor-
Chagas humana es un hecho puramente tancia para poder encaminar de manera adecuada
accidental. En la medida en que el hombre fue las medidas de control y prevención (2).
entrando en contacto con los focos naturales y
Factores ecoepidemiológicos que determinan
provocó desequilibrios ecológicos, forzó a los
triatominos silvestres infectados a ocupar la distribución de los triatominos
viviendas humanas, llevándose a cabo el proceso Hay dos factores importantes en la distribución
de domiciliación, ya que allí no solamente de los Triatominae: primero, el grupo es
encuentran refugio, sino también suficiente principalmente tropical y subtropical, y segundo,
alimento en la sangre humana y de animales está restringido al hemisferio occidental y a la
domésticos. De esta manera, el hombre entra a región oriental, encontrándose completamente
formar parte activa de la cadena epidemiológica ausente de las regiones paleártica y etiópica, sin
de la enfermedad de Chagas (Guhl F, Aguilera G, considerar a Triatoma rubrofasciata, especie
Pinto N, Vergara D. Distribución geográfica de las dispersada por el hombre que toca marginalmente
especies de triatominos en los departamentos la región australiana. Las regiones tropicales y
endémicos para la enfermedad de Chagas en subtropicales de Sur América son el centro de la
Colombia. En: Felipe Guhl. Memorias Primer Taller diversidad de la subfamilia (3).
Internacional Sobre Control de la Enfermedad de
Chagas. Curso de Diagnóstico, Manejo y Dos terceras partes del territorio de Colombia
Tratamiento de la enfermedad de Chagas. VI están ubicadas en la zona intertropical o ecuatorial
Reunión de la Iniciativa Andina para el Control de que se caracteriza por dos épocas de lluvia y dos
la Enfermedad de Chagas, Bogotá; Corcas épocas secas en un mismo año. La duración de
Editores, 2005. p. 25-41). La enfermedad, asociada la radiación solar es prácticamente igual durante
con la pobreza y las malas condiciones de todo el año. La conformación montañosa derivada
vivienda, además de por los insectos triatominos, de la trifurcación andina, que se extiende a través
se transmite a través de transfusiones de sangre de todo el país desde el suroeste hasta el noreste
contaminadas por el parásito y también abarcando el territorio montañoso con sus valles
congénitamente de madre infectada a hijo. Son interandinos de diferentes alturas y climas, ofrece
de especial importancia epidemiológica aquellos un ambiente muy favorable para la domiciliación
vectores que se encuentran domiciliados y los de varias especies de triatominos. Esta región
que están en proceso de domiciliación (1). también se caracteriza por ser la zona más
densamente poblada del país.
El estimativo de la prevalencia de la infección
humana por Trypanosoma cruzi en Colombia es Distribución de las especies de triatominos
de 1’300.000 habitantes; alrededor de 3’500.000 adaptadas al hábitat humano de acuerdo a las
individuos están bajo riesgo de adquirir la infección condiciones ecoepidemiológicas
de acuerdo a la distribución geográfica de los La ubicación de Colombia y su orografía
determinan las diferencias en el clima y los
Correspondencia: ecosistemas, generando seis grandes regiones
Felipe Guhl, Departamento de Ciencias Biológicas,
biogeográficas que se caracterizan por su
Universidad de los Andes, Bloque A (Of.201), A.A. 4976,
Carrera 1ª N° 18A -10 Bogotá, Colombia. fisiografía, vegetación y suelos, lo que se relaciona
Tel/Fax: +57 1 3324540. con la presencia y distribución de los triatominos
fguhl@uniandes.edu.co (Guhl F, Pinto N, Aguilera G. Distribución y
Recibido: 10/02/06; aceptado: 26/06/06 ecoepidemiología de los triatominos vectores de

144
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

la enfermedad de Chagas en Colombia. Memorias R. prolixus y R. pictipes son las especies


XII Congreso Colombiano de Parasitología y silvestres de mayor distribución. Solamente
Medicina Tropical, Biomédica. 2005; 25:76-9). se ha reportado un caso de R. prolixus
domiciliado.
A continuación se hace una primera aproximación
a la distribución de los principales triatominos 6. En la Sierra Nevada de Santa Marta, que
adaptados al hábitat humano de acuerdo con las comprende todos los pisos térmicos hasta las
condiciones geográficas y teniendo en cuenta que nieves perpetuas, se encuentran bien
su distribución en Colombia está determinada por distribuidos R. prolixus y T. dimidiata
factores altitudinales (4) (la cota que limita su domiciliados. Hay registros de T. maculata y
distribución es de 2.000 msnm). T. dimidiata silvestres.
1. Las llanuras del Caribe, con clima ambiental La figura 1 muestra la distribución de las especies
que va desde semihúmedo hasta árido. Allí de triatominos más adaptadas al hábitat humano
se encuentran ampliamente distribuidas en Colombia según las zonas descritas.
Triatoma maculata (en vías de domiciliación)
y Rhodnius pallescens (especie de hábitos
Vectores de la enfermedad de Chagas en
silvestres). Colombia

2. La costa del Pacífico, con clima ambiental De las 24 especies de triatominos presentes en
húmedo y superhúmedo, no representa una Colombia, 15 se han encontrado con infecciones
región que permita albergar especies de naturales por T. cruzi (cuadro 1): Panstrongylus
triatominos de importancia epidemiológica. geniculatus, Panstrongylus lignarius,
Panstrongylus rufotuberculatus, T. dimidiata,
3. La región Andina, que presenta sub-regiones Triatoma dispar, T. maculata, T. venosa, R.
con diferentes cinturones horizontales y brethesi, R. colombiensis, R. pallescens, R.
verticales de clima, vegetación y suelos, pictipes, R. prolixus, Eratyrus cuspidatus,
incluye los valles interandinos y constituye la Eratyrus mucronatus, Cavernicola pilosa.
región de mayor densidad de asentamientos
humanos del país. Aquí se encuentran La presencia de Trypanosoma rangeli en áreas
ampliamente distribuidas las principales endémicas para T. cruzi constituye un factor
especies de triatominos domiciliados, Rhodnius epidemiológico de importancia, dado que
prolixus, Triatoma dimidiata y T. venosa; en comparten algunos insectos vectores y
los valles interandinos a lo largo del río huéspedes mamíferos, incluido el hombre. A
Magdalena se encuentran ampliamente pesar de que T. rangeli se ha considerado como
distribuidas especies silvestres como no patógeno para el huésped mamífero, su ciclo
Rhodnius colombiensis. de vida aún no se conoce y su presencia tanto en
las heces de los triatominos como en la sangre
4. Los llanos de la Orinoquía se caracterizan por de los mamíferos puede constituir una fuente de
extremos de sequía y humedad durante el año. error en el diagnóstico. Desde el punto de vista
Las especies domiciliadas predominantes son epidemiológico es importante conocer su
R. prolixus, T. dimidiata y T. maculata. Varios distribución dado que sí es patógeno para los
reportes demuestran la existencia de R. insectos vectores que infecta.
prolixus silvestre asociado a palmas tanto
silvestres (Attalea butyracea, Maximiliana De las 24 especies de triatominos presentes en
elegans y Mauritia flexulosa) como de cultivos Colombia, siete se han encontrado con infecciones
agroindustriales (Elaeis guineensis). de T. rangeli (37): R. colombiensis, Rhodnius
dalessandroi , R. pallescens , R, prolixus , R.
5. La selva de la Amazonía colombiana presenta
robustus, T. dimidiata y E. mucronatus.
un clima frecuentemente húmedo y caluroso
durante todo el año y registra muy pocos Las principales especies que transmiten T. cruzi
triatominos domiciliados. Rhodnius brethesi, en Colombia son R. prolixus y T. dimidiata, las

145
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

cuales presentan un ciclo epidemiológico muy F. Memorias Primer Taller Internacional Sobre
complejo que no sólo involucra una distribución Control de la Enfermedad de Chagas. Curso de
en el domicilio sino también en el peridomicilio y Diagnóstico, Manejo y Tratamiento de la
en hábitats silvestres. Las poblaciones de Enfermedad de Chagas. VI Reunión de la Iniciativa
insectos no domiciliadas causan dificultad en el Andina para el Control de la Enfermedad de
control, pues pueden ser fuente de infestación o Chagas, Bogotá; Corcas Editores: 2005. p.25-41).
de reinfestación de las viviendas ya intervenidas Estos hallazgos merecen consideraciones
con insecticidas y, por lo tanto, hay posibilidad similares a las ya expuestas para R. prolixus.
de que se reinicíe el ciclo de transmisión a los
Las especies que no representan riesgo de
humanos.
transmisión al hombre, y que conservan hábitos
R. prolixus se ha adaptado extremadamente bien silvestres específicos, pueden resumirse de la
a los domicilios humanos; sin embargo, estudios siguiente forma: Psamolestes arthuri en nidos de
recientes adelantados en el departamento de aves, palmas o debajo de la corteza de árboles
Casanare han mostrado poblaciones abundantes muertos; Panstrongylus lignarius en nidos de aves;
de R. prolixus silvestres asociadas a palmas Cavernicola pilosa en cuevas o árboles y palmas
nativas, A. butyracea, y a palmas introducidas donde habitan murciélagos; Belminus rugulosus
en cultivos agroindustriales, E. guineensis. Los en palmas; R. colombiensis en palmas; T. dispar
índices de infección natural por T.cruzi en zonas boscosas, y Microtriatoma trinidadensis
encontrados en los insectos capturados en estas bajo de la corteza de árboles muertos.
especies de palmeras fueron de 67 y 41%,
En el cuadro 1 se presenta el resumen de la recopila-
respectivamente, y los índices de colonización,
ción de toda la información actualizada sobre los
de 92,8 y 100%, respectivamente.
registros de las especies de triatominos presentes
Estos hallazgos indican la necesidad de instaurar en Colombia y su infección natural con tripano-
programas de vigilancia entomológica muy activos somátidos a nivel departamental y municipal según
encaminados a evaluar el riesgo epidemiológico actualización y modificación de Molina J et al. (4).
que representan estas poblaciones de insectos
Distribución geográfica de los triatominos en
silvestres (Guhl F, Pinto N, Marín D, Herrera C,
Colombia
Aquilera G, Naranjo JM, Vallejo G. Primer reporte
de Rhodnius prolixus Stal, en Elaeis guineensis, En los últimos años se ha hecho evidente el
variedad Papúa, en plantaciones agroindustriales interés de los grupos de investigación en la
de Villanueva, Casanare. Memorias XII Congreso epidemiología de la enfermedad de Chagas en
Colombiano de Parasitología y Medicina Tropical, Colombia.
Biomédica 2005;25:158-59 y Pinto N, Marín D,
De igual manera, el personal de los servicios de
Herrera C, Vallejo G, Naranjo JM, Guhl F.
salud ha adquirido un mayor conocimiento sobre
Comprobación del ciclo silvestre de Rhodnius
la fauna de triatominos y la importancia de los
prolixus Stal en reductos de Attalea butyracea en
programas de vigilancia y control. Estos hechos
el departamento de Casanare. Memorias XII
han permitido aumentar el registro de nuevas
Congreso Colombiano de Parasitología y Medicina
especies de triatominos en el país y aumentar de
Tropical. Biomédica 2005;25:159).
manera considerable el número de registros en
De igual manera es importante anotar que también nuevas localidades a nivel nacional.
se han reportado poblaciones silvestres de T.
Teniendo en cuenta esta información se presentan
dimidiata en algunos municipios del departamento
mapas que indican la distribución de los
de Boyacá, al igual que en la Sierra Nevada de
triatominos por departamento y municipio (figuras
Santa Marta (Guhl F, Aguilera G, Pinto N, Vergara
2-11).
D. Distribución geográfica de las especies de
triatominos en los departamentos endémicos para Las figuras 4, 6, 7, 9 y 11 corresponden a los
la enfermedad de Chagas en Colombia. En: Guhl departamentos que conforman la región andina;

146
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Cuadro 1. Registro por departamentos y municipios de las especies de triatominos presentes en Colombia y su
infección natural con tripanosomátidos.

Departamento Especie Municipio

Amazonas P. geniculatus* El Calderón (Leticia) (5), Leticia (a), (b), Tarapacá (A)
R. pictipes* El Calderón (Leticia) (5), Leticia (a) ,(b), Puerto Nariño (A, 5), (b)
R. prolixus° Tarapacá (A)
R. robustus° Leticia (A), Puerto Nariño (b)
Antioquia B. rugulosus¨ San Carlos (c)
E. cuspidatus¨ Apartadó (B), Chigorodó (B), San Carlos (B, c)
E. mucronatus¨ San Carlos (c)
P. geniculatus*+ Amalfi (B) (6) Anori (B), Arboletes (B), Campamento (B) Caracolí (B),
Cisneros (B), Cocorna (B), Dabeiba (B), Hispania (B), La pintada (B),
Maceo (B), Medellín (7, 8), Murindó (B), Nariño (B), Peque (B), Puerto
Berrío (B, b), Puerto Triunfo (B), San Carlos (B,b), San Francisco (B), San
Juan de Urabá (B), San Luis (B), San Pedro de Urabá (B), San Rafael (B),
San Roque (B), Sonsón (B), Támesis (B), Taraza (B), Urabá (d), Uramita
(B), Valdivia (B), Vegachí (B, 9, 10), Yalí (B), Yolombó (B)
P. humeralis° Puerto Berrío (B, e), San Carlos (c, e), Vegachí (e)
P.rufotuberculatus° Anori (B), Puerto Berrío (B, e), San Carlos (c, e), Vegachí (B, e)
R. pallescens* Amalfi (B), Anori (B), Arboletes (B), Chigorodo (B), Maceo (B), Necoclí (B),
Puerto Berrío (B, 4), Puerto Nare (B), Remedios (B), San Carlos (c, e),
San Juan de Urabá (B), San Pedro de Urabá (B), Tarazá (B), Turbo (B, f),
Vegachí (B, c), Yalí (B), Yondo (B), Zaragoza(B)
R. prolixus° Necoclí (B, 9, 10)
T. dimidiata+ Apartadó (B), Chigorodó (B), Necoclí (B), Turbo (B)
T. dispar* Amalfi (B), Cocorná (B), Dabeiba (B, d, 11), Murindó (B), San Francisco (B)
T. venosa* Concepción (B), Nariño (B), San Francisco (B), San Luis (B), Puerto Nare
(B, g)
Arauca E. mucronatus° Saravena (C)
R. prolixus¨ (C, 9, 10), Arauca (I)
R. robustus° (C)
T. dimidiata° Arauca (C)
T. maculata°¨ Arauca (C), Tame (C), Arauca (I)
P. arthuri¨ Arauca (I)
C. pilosa° Arauca (I)
Atlántico T. maculata° (9, 10, 12)
Bolívar E. cuspidatus¨ Talaigua Nuevo (B),
P. geniculatus¨ Cantagallo(B), Santa Catalina (B), Santa Rosa del Sur (B)
R. pallescens¨ María la Baja (B), Mompós (B), Morales (B), San Juan Nepomuceno (B),
Santa Rosa del Sur (B), Turbacó (B, 9, 10)
R. prolixus° Las Boquillas (Mompós) (A)
R. robustus° (13)
T. maculata¨ Cantagallo (B), Córdoba (B), Mompós (B), Santa Catalina (B), San Juan
Nepomuceno (B), Santa Rosa del Sur (B), Talaigua Nuevo (B)
Boyacá E. cuspidatus° Páez (D), San Pablo de Borbur (D, d, 10, h)
E. mucronatus° Páez (D, h)
P. geniculatus° Berbeo (D), Boavita (D), La Victoria (D), Maripí (D), Puerto Boyacá (D),
San Pablo de Borbur (D), San Eduardo (D), Santa María (D), Soatá (D),
Susacón (D), Zetaquirá (D)
P. rufotuberculatus° Miraflores (D), San Pablo de Borbur (D), Zetaquirá (D)
R. pictipes° Garagoa (D, h)
R. prolixus*·+ Almeida (D), Berbeo (D), Boavita (D), Campo Hermoso (D), Chiquinquirá (13,
14), Chitaraque (D), Chivor (D), Covarachía (D), Cubará (D), Garagoa (D, 7,
13), Guateque (D, 7, 13, 14), Guayatá (D, 13, 14), Labranza Grande (D), La
Capilla (D), La Uvita (D), Macanal (D), Miraflores (7, 13), Moniquirá (D, 7,
13, 14), Otanche (D, 13), Pachavita (D), Páez (D), Pajarito (13), Pauna (13),

147
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Departamento Especie Municipio

Paya (D), Pisba (D), Puerto Boyacá (D), Ramiriquí (13), Rondón (D), San
Eduardo (D), San Luis de Galeno (D), San Mateo (D), Santa María (D),
Sátiva Norte (D), Soatá (D, c, 13, 14, 15), Somondoco (D), Susacón (D),
Sutatenza (D), Tenza (D), Tinjacá (13), Tipacoque (D), Togui (D), Zetaquirá
(D, 9, 10, h)
T. dimidiata*·+ Boavitá (D), Campo Hermoso (D), Chiscas (D), Chitarque (D), Guayatá (13),
La Uvita (D), Miraflores (13), Moniquirá (D), Páez (D), Pisba (D), Puerto
Boyacá (D), San Eduardo (D), San Mateo (D), Sátiva Norte (D), Soatá (D, 7,
13, 14), Susacón (D), Sutatenza (D), Tipacoque (D), Zetaquirá (D, 9, 13, h)
T. maculata° Cubará (D), Páez (D), Paya (D, h)
T. venosa* Boavita (D), Campo Hermoso (D), Chinavitá (D), Chivor (D), Garagoa (D),
Guateque (D, 13), Guayatá (D, 13), La Capilla (D), La Victoria (D), Macanal
(D), Moniquirá (D), Munantá (4), Pachavitá (D), Páez (D), Pisba (D),
Ramiriquí (4), San Pablo de Borbu r (D), Santa María (D), Sátiva Norte (D),
Soatá (D), Somondoco (D), Susacón (D), Sutatenza (D), Tenza (D), Tinjacá
(13), Tipacoque (D), Zetaquirá (9, 10, h)
Caldas R. pallescens° Samaná (A)
Caquetá P. geniculatus* Belén de los Andaquíes (A), Solano (16, 17)
R. pictipes¨ Tres Esquinas (13, g)
R. prolixus* Doncella (A), Florencia (c, 13, 14), Maguareño (A), Puerto Rico (A), Santa
Helena (A, 9, 10)
Casanare C. pilosa° Yopal (G)
E. cuspidatus° Nunchía (D), Sabanalarga (D), Tauramena (D), Villanueva (D)
E. mucronatus° Nunchía (D), Poré (D), Villanueva (D), (G)
P. geniculatus° Hato Corozal (D), Sabanalarga (D), Tauramena (D), Villanueva (D, G)
P. lignarius° Yopal (G)
Ps. arthuri° Monterrey (D, G), Paz de Ariporo (D), Villanueva (D)
R. prolixus*· Aguazul( D), Hato Corozal (D), Maní (13, 14), Monterrey (D), Nunchía (D),
Orocué (D), Paz de Ariporo (D), Poré (D), Recetor (D), Sabanalarga (D),
San Luis de Palenque (D), Támara (D), Tauramena (D), Trinidad (D),
Villanueva (D), Yopal (D, G, 9, 10, 14)
T. dimidiata*· La Salina (D, G, 9, 10), Sácama (D)
T. maculata*+ Aguazul (D), Hato Corozal (D, g), Monterrey (D), Nunchía (D), Paz de
Ariporo (D), Poré (D), San Luis de Palenque (D), Tauramena (D), Villa Nueva
(D), Yopal (D, G)
Cauca P. geniculatus° Gorgona (9, 10 , 15, 16)
T. nigromaculata El Tambo ver. La Playa (18)
P. rufotuberculatus* Santander de Quilichao (13, e, 17)
Cesar B. herreri° San Alberto (C), San Martín (C)
E. cuspidatus° San Alberto (C), San Diego (C)
P. geniculatus° Aguachica (C), Chiriguaná (C), Agustín Codazzi (C), Chimichagua (C),
Curumaní (C), El Paso (C) Gamarra (C), La Paz (C), Pailitas (C), Pelaya (C),
Río de Oro (C), San Alberto (C), San Diego (C) Valledupar (C)
R. neivai° La Paz (C), San Alberto (C), Valledupar (C, 9, 10)
R. pallescens¨ Caserío Los Pajaritos (g), Chimichagua (C), Chiriguana (C), Agustín Codazzi
(C), Curumaní (C), Gamarra (C), La Paz (C), Pailitas (C), Pelaya (C), San
Martín (C), Tamalameque (C)
R. prolixus*· Chiriguaná (13), El Paso (13), La Jagua (C), Río de Oro (9, 10), San Alberto
(C), Valledupar (C)
T. dimidiata¨ Aguachica (C), Chiriguana (C), Agustín Codazzi (C), Curumaní (C), La Jagua
(C), La Paz (C), Pailitas (C), Pueblo Bello (C), Río de Oro (C), San Diego
(C), Valledupar (C, g)
T. maculata° Astrea (C), Becerri l(C), Agustín Codazzi (C), El Copey (C), El Paso (C), La
Jagua (C), La Paz (C), San Diego (C), San Juan del Cesar (9, 10, 12, 19),
Valledupar (C)

148
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Departamento Especie Municipio

Chocó P. geniculatus° Quibdó (7, 8, 13)


R. pallescens* (20)
T. dispar° San José del Palmar (16)
T. venosa° (D)
Córdoba E. cuspidatus* Buenavista (B)
P. geniculatus° Moñitos (B), Planeta Rica (B), Sahún (B), San Andrés Sotavento (B), San
Antero (B)
R. pallescens* Canalete (B), Chinu (B), Cienaga de Oro (B), Los Córdobas (B), Moñitos (B),
Planeta Rica (B), Sahún (B), San Carlos (B), San Pelayo (B), Valencia (B)
Cundinamarca C. pilosa* Girardot (13), Tocaima (13), Villeta (9, 10)
E. cuspidatus° Medina (D)
E. mucronatus° Medina (D)
P. geniculatus° Agua de Dios (D), Caparrapí (D), La Mesa (D), La Palma (D), Medina (D),
Nilo (D), Pacho (D), Paime (D), Paratebueno ( D), San Antonio del Tequen-
dama (D), Tibacuy (D), Tocaima (D), Viotá (D), Yacopí (D, 9, 10)
P. lignarius° (D)
P. rufotuberculatus° Guayabetal (D), Nilo (D), Pacho (D)
R. colombiensis° Apulo (A), Nilo (A), Viotá (D)
R. pallescens° Yacopí (D)
R. pictipes° Medina (i)
R. prolixus*· Agua de Dios (D), Anapoima (D, 7, 13), Anolaima (7, 13, 14), Apulo (7, 13,
14), Cáqueza (7, 13), Choachí (7, 13, 14), El Peñón (D), Fómeque (7, 13,
14), Fosca (D), Fusagasugá (7, 13, 14), Gachalá (D, 9), Gachetá (7, 13),
Girardot (7, 13, 14), Guachetá (13), Guaduas (13, 14), Guayabal (13), La
Mesa (D, 13, i), La Palma (13, 14, 21), La Unión (Fómeque) (7, 13, 14), La
Vega (7, 13, 14), Machetá (7, 13) , Manta (7, 13, 14), Medina (D), Mesitas del
Colegio (7, 13), Nariño (7, 13, 14), Nilo (D, 7, 13, 14), Pacho (D, 7, 13, 14,
22), Pandi (13), Paratebueno (D), Puerto Salgar (13, 14), San Antonio de
Tena (13, 14, 21), San Antonio del Tequendama (D), Tibacuy (D), Tibiritá (7,
13, 14), Tocaima (D, 13, 14), Ubalá (D), Ubaque (13, 14, 21), Villeta (13),
Viotá (7, 10, 13), Yacopí (D, 9, 10)
R. robustus° Viotá (i)
T. dimidiata¨ Guachetá (13), Machetá (9, 10, 13)
T.venosa° El Peñón (D), Manta (D), Paime (D), Tibiritá (D), Villagómez (D)
Guainía P. geniculatus° Barranco Mina (23, j), Inírida (23, j)
R. brethesi* Cacahual (24), Inírida (j), Puerto Colombia (24)
R. prolixus° Barranco Mina (23, j)
Guaviare P. geniculatus San José del Guaviare (H)
R. pictipes San José del Guaviare (H),
R. prolixus San José del Guaviare (H)
Huila P. geniculatus° La Plata (9, 10, 13, 16)
R. prolixus*· Altamira (13), Baraya (7, d), Campoalegre (7, 13), El Hobo (7, 13), Garzón
(13), Gigante (7, 13, 14) Neiva (7, 13, 14), Planadas (9, 10, 13)
T. dimidiata* Altamira (13), Garzón (7, 13), Neiva (9, 10)
T. dispar° La Plata (16)
La Guajira E. cuspidatus° (19)
P. geniculatus° Maicao (19)
R. neivai° Maicao (19)
R. prolixus* Manaure (14, 21), Rioacha (9, 10, 14)
T. dimidiata· Perijá (g)
T. maculata° Barrancas (C), El Molino (C), Fonseca (C), Hato Nuevo (C), Maicao (19),
San Juan (C), Urbilla (C, 9, 10, 12, 19), Villanueva (C)
Magdalena E. cuspidatus° El Banco (B, F), Guamal (A, B, F), Santa Marta (D, E, F)
P. geniculatus* Ariguani (B), Cienaga (A, B), El Banco (B, F) Fundación (B), Guamal (A, B)

149
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Departamento Especie Municipio

Pueblo Viejo (B), Santa Marta (B, E, F), Sierra Nevada de Santa Marta (E, F)
P. rufotuberculatus° Santa Marta (B, D, E, F)
R. pallescens*+ El Banco (A, B, F), Fundación (B), Guamal (A, F) Pijiño del Carmen (B), San
Sebastián (F) Santa Marta (B, D, E, F), Sierra Nevada de Santa Marta (E)
R. neivai Sierra Nevada de Santa Marta (E, F)
R. prolixus*· Aracataca (B), Fundación (B), Pivijay (14, 21), Santa Marta (A, g), Sierra
Nevada de Santa Marta (E, F)
T. dimidiata* Aracataca (B), Cienaga (B), Fundación (B), Santa Marta (9, 10, g), Sierra
Nevada de Santa Marta (E, F)
T. maculata¨ Guamal (B, F), Pijiño del Carmen (B), San Sebastián de Buenavista (B),
Santa Ana (B), Santa Marta (A, E, F, g)
Meta C. pilosa*+ El Porvenir (Puerto Gaitán) (24), Granada (9, 10)
E. cuspidatus° Puerto Gaitan (D)
E. mucronatus° (9, 10)
M. trinidadensis° San Martín (9, 10 )
P. geniculatus* Acacias (D), El Porvenir (24),Granada (D), La Macarena (D, k), Restrepo
(D), Villavicencio (D)
P. lignarius* El Porvenir (d, 13, g, 24)
P. rufotuberculatus° El Calvario (D, 9)
Ps. arthuri¨ El Porvenir (d, 13, g, 24)
R. dalessandroi· San Martín (9, 10, 25)
R. pictipes* Acacias (D), Cumaral (A), Fuente de Oro (D), Granada (D), Guamal (D), La
Macarena (D, k), La Uribe (D), Lejanías (A, D), Mesetas (D), San Carlos de
Guarda (D), San Martín (9, 10, 26), Villavicencio (D)
R. prolixus*·+ Acacias (13, 14), Barranca de Upía (D), Cumaral (13), El Porvenir (12, 24),
Fuente de Oro (D), Granada (D), Guamal (13, 14), Guape (Granada) (10),
La Macarena (D), Lejanías (D), Mesetas (D), Puerto Gaitán (D), Puerto
Lleras (D), Puerto López (13, 14), Restrepo (7, 13, 14), San Antonio (13),
San Carlos de Guarda (D), San Juan de Arama (D), San Martín (7, 13),
Villavicencio (7, 9, 10, 12, 14), Vista Hermosa (14)
T. dimidiata° Cumaral (27), Restrepo (27)
T. maculata¨ El Porvenir (24)
Nariño T. dispar* Inda (28), Tumaco (A)
Norte de SantanderE. cuspidatus° (9, 10)
E. mucronatus*· Acarí (C), Convención (C), Cúcuta (C), El Carmen (C), Los Patios (C), San
Cayetano (C), Santiago (C), Sardinata (C), Teorema (C, 9, 10)
P. geniculatus* Arboledas (C), Cúcuta (C), Durania (C), El Carmen (C), El Zulia (C),
Santiago (C), Sardinata (C), Teorema (C), Tibú (14), Villa del Rosario (16).
(9, 10)
R. pallescens° La Esperanza (C)
R. pictipes° (C)
R. prolixus*· Convención (C), Cúcuta (C, 7, 13, 14), Cucutilla (l), Chinácota (7, 13, 14),
Gramalote (13, 14), San Cayetano (13, 14), Santiago (13, 14), Tibú (7, 13,
14), Toledo (13, 14), Villa del Rosario (13, 14), Zulia (9, 10, 14)
R. robustus· Cúcuta (C), El Zulia (C). (9, 10)
T. dimidiata° El Carmen C, Toledo (9, 10)
Putumayo P. geniculatus° Puerto Asís (m), Valle del Guamuez (m, 9, 10)
R. pictipes* Puerto Asís (m), Puerto Guzmán (m), Puerto Leguízamo (m, 9, 10)
R. prolixus*+ Puerto Asís (g, m), Puerto Guzmán (m), Orito (9, 10, g), Villa Garzón (m)
Risaralda P. geniculatus° Pueblo Rico (16)
San Andrés y
Providencia T. dimidiata Sector Aguamansa (D) (n)
Santander B. herreri° El Carmen (C), San Vicente de Chucurí (C)
C. pilosa° Curití (C), Galán (C), San Gil (C), Socorro (C)

150
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Departamento Especie Municipio

E. cuspidatus° Bolívar (C), El Carmen (C), Pinchote (C), San Gil (C), San Vicente de
Chucurí (C), Socorro (C)
P. geniculatus° Barichara (29), Capitanejo (C), Contratación (29), Curití (29), El Carmen
(29), El Playón (C), Enciso (C), Málaga (C, 6), Pinchote (29), San Gil (o), San
José de Miranda (C), San Vicente del Chucurí (29), Simácota (29), Socorro
(9, 10, o)
P. humeralis° El Carmen (29), San Vicente del Chucurí (29)
P. rufotuberculatus° El Carmen (29), San Vicente de Chucurí (29)
R. pallescens° Bolívar (C), Contratación (29), El Carmen (29), El Peñón (C), El Playón (C),
San Gil (29), San Vicente de Chucurí (29), Socorro (29), Sucre (C)
R. prolixus*· Barbosa (13, 14, 21), Betulia (C), Bolívar (C), Bucaramanga (8, 13),
Capitanejo (C), El Carmen (29), Charalá (13, 29), Chimá (29), Cimitarra (9),
Coromoro (29), Curití (13, 29), El Peñón (C), Enciso (C), Gambita (29),
Guadalupe (29), Guapotá (29), Guavatá (13), Güenza (13, 14), Güepsa
(13), Macravita (C), Málaga (7, 13, 14), Miranda (7, 13, 14), Mogotes (13,
29), Molagavita (C), Ocamonte (29), Oiba (7, 13, 14, 29), Onzaga (13, 14,
29), Páramo (29), Piedecuesta (7, 13, 14), Pinchote (13), Puente Nacional (7,
13, 14), Rionegro (7, 13, 14), San Gil (7, 13, 14, 29), San Joaquín (13, 14,
29), San Miguel (C), San Vicente de Chucurí (7, 13, 29), Simácota (29),
Socorro (7, 13, 14, 29), Suaita (29), Sucre (C), Valle de San José (13, 29),
Vélez (7, 9, 10, 14)
R. robustus° (10, 13)
T. dimidiata*· Capitanejo (C), Charalá (29), Curití (29), El Carmen (29), El Hato (29),
Enciso (C), Guacamayo (C), Guadalupe (C), Macaravita (C), Málaga (13),
Mogotes (13, 29), Molgavita (C), Onzaga (13, 14, 29), San Gil (29), San
Joaquín (13, 29, 30), San José de Miranda (C), San Miguel (C), San Vicente
de Chucurí (29), Socorro (o), Suaita (9, 10, 29)
T. maculata° Capitanejo (C)
T. venosa* Bolívar (C), Contratación (29), El Carmen (29), Florian (C), Gambita (C),
Matanza (C), Onzaga (13), San Gil (29), San Joaquín (13), San Vicente de
Chucurí (9, 10, 29), Socorro (29), Suaita (29)
Sucre E. cuspidatus* Galeras (C, c, d, 9, 10)
P. geniculatus+ Coloso (B), Corozal (B), Ovejas (B), San Marcos (B),San Onofre (B), Since
(B), Sincelejo (B), Toluviejo (B, d, 10)
R. pallescens+* Caimito (B), Galeras (C, 9, 31), Guaranda (C) , La Unión (C) , San Benito
Abad (c), San Marcos (C), San Onofre (C, d, 10, 32)
T. dimidiata* Galeras (9, d, 20)
Tolima C. pilosa* Guamo (13), Honda (d, 10, 33, p)
P. geniculatus° Casablanca (D), Dolores (D), Falan (D), Fresno (D), Iconazo (D), Prado (D),
Purificación (D, d, 9, 10, p)
R. colombiensis*·+ Alvarado (D, q), Carmen de Apicalá (D, q), Chaparral (4), Coello (D, q),
Coyaima (D, 20, q 34, r, 35), Guamo (D, q), Ibagué (D, q), Icononzo (q)
Lerida (D, q) Libano (D, q), Melgar (D), Ortega (D c, 13, q) Prado (D, q)
Purificación (D, q) San Luís (D, q) Santa Isabel (D, q)
R. prolixus*· Alvarado (7, 13), Carmen de Apicalá (13), Coello (13, 21), Coyaima (D, c, r,
31), Espinal (13, 14, 21), Flandes (13), Guamo (13), Honda (7, 13), Ibagué
(7, 13), Lérida (13), Líbano (13), Mariquita (7, 13), Melgar (7, 13), Natagaima
(D, 13), Ortega (7, 13), Prado (7, 13, 14, 22), Saldaña (13, 14), San Antonio
Suárez (d, 10)
R. robustus*· Coyaima (13, p)
T. venosa° Villahermosa (D)
Valle del Cauca C. pilosa* Palmira (13), Restrepo (9, 10)
P. geniculatus° Buenaventura (9, 10, 16)
P. rufotuberculatus° Buenaventura (9, 13, 16, 35)
R. proluxus° Cali (13)
T. dispar* Buenaventura (16, 36), Calima (15, 16, 28) Caserío Bajo Calima (s)

151
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Departamento Especie Municipio

Vaupés E. mucronatus° Mitú (A)


P. geniculatus° Mitú (A)
R. pictipes° Mitú (A)
R. prolixus° Mitú (A)
Vichada P. lignarius° (13, e)
R. prolixus¨ (13, e)
T. maculata° (13, e, h)

* Presencia de T. cruzi; . presencia de T. rangeli; + presencia de Trypanosoma sp; ° sin datos disponibles; ¨ negativos
para T. cruzi, T. rangeli y Trypanosoma sp.

A Material identificado por el Instituto Nacional de Salud (INS)


B Material identificado en el Instituto Colombiano de Medicina Tropical (ICMT) de Medellín.
C Material identificado en el Centro de Investigaciones Tropicales (CINTROP) de la Universidad Industrial de Santander.
D Material identificado en el Centro de Investigaciones en Microbiología y Parasitología Tropical (CIMPAT) de la Universidad
de los Andes, Bogotá.
E Material identificado en La Fundación Salud Para el Trópico (FSPT)
F Material identificado en el Laboratorio Departamental de Salúd Pública del Magdalena (LDSP).
G Material identificado por Grupo ETV, Secretaría de Salud de Casanare.
H Material identificado por la Secretaria de Salud del Guaviare (Primer informe de la presencia de vectores de la
tripanosomiasis americana o enfermedad de Chagas en el departamento del Guaviare. Fajardo, Torres).
I Material identificado por el Laboratorio de Salud Pública Fronterizo – Unidad Administrativa Especial de Salud de Arauca.
a. Gualdrón LE, Brochero HL, Arévalo C, Pérez L, Suárez M, Olano VA. Hallazgo de algunos vectores de la
enfermedad de Chagas en el departamento del Amazonas. Resúmenes, XXVI Congreso Sociedad Colombiana de
Entomología, Santafé de Bogotá; 1999. p.72.
b. Rodríguez MH. Etnoconocimiento de los vectores de la enfermedad de Chagas de las comunidades indígenas Ticuna
y Huitoto del trapecio amazónico, departamento del Amazonas, Colombia. P. 71-8. En Guhl F, Schofield CJ Editores.
Proceedings of the ECLAT-AMCHA International Workshop on Chagas disease surveillance in the Amazon region, Palmari,
Brazil. Bogotá; 2004. p.75-82).
c. Moreno J. Recientes estudios epidemiológicos de tripanosomiasis americana en diferentes áreas de Colombia.
Biomédica 1991;11:43-4.
d. Moreno J. Estudios epidemiológicos sobre la enfermedad de Chagas en algunas regiones de Colombia. En: Guhl F,
editor. Memorias del curso de postgrado, Genetica poblacional de Triatominos aplicada al Control vectorial de la Enfermedad
de Chagas. Santafé de Bogotá: Corcas Editores Ltda.1997. p.35-41.
e. Ospina S. Situación actual de la enfermedad de Chagas. En: OPS/OMS/Ministerio de Salud, Dirección de Campañas
Directas. III reunión de investigadores de malaria y otras enfermedades tropicales. Rionegro, Antioquia: Ministerio de
Salud; 1991. p.69-70.
f. Londoño E, Isaza D. Rhodnius pallescens (Barber, 1932) y Trypanosoma cruzi en Urabá. Biomédica 1997;17:66-7.
g.Guhl F, Marinkelle CJ, Becerra W, Romero C. Nuevos registros de triatominos en Colombia. Biomédica 1991;11:90-
1.
h. Pinto N, Molina J, Zipa N, Cuervo R, Guhl F. Determinación de la distribución de triatominos en el departamento de
Boyacá. Resúmenes, XXVI Congreso Sociedad Colombiana de Entomología, Santafé de Bogotá; 1999. p.69.
i. Guhl F, Pinto N, Molina J. Nuevos registros de Rhodnius pictipes y Rhodnius robustus (Reduviidae: Triatominae) en
Cundinamarca, Colombia. Biomédica 1997;17:152.
j. Villegas ME, Manotas LE, Molina J, Guhl F. Primer reporte de la presencia de Rhodnius brethesi Matta, 1919 en
Colombia; Resúmenes XXVI Congreso Socolen. Bogotá; 1999. p.68.
k. Molina JA, Guhl F, Marinkelle CJ. Primer registro de Rhodnius pictipes y Panstrongylus geniculatus (Reduviidae:
Triatominae) En PNN Tinigua, La Macarena, Colombia. Biomédica 1995;15:86.
l. Duque S, Peláez D, Gualdrón LE, Villareal E, Corredor A. Aislamiento de tripanosomas a partir de material fecal de
Rhodnius prolixus. Biomédica 1986;6:37-9.
m. Barreto M, Burbano M.E, Barreto P. Nuevos datos sobre la distribución de Triatominae (Hemiptera: Reduviidae) en
el departamento de Putumayo, Colombia. Memorias XI Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica
2003;23:1:101.
n. Guhl F, Cano A, Aguilera G, Pinto N. Primer reporte insular de Triatoma dimidiata (Latreille): isla de Providencia,
Colombia. Memorias XII Congreso Colombiano de Parasitología y Medicina Tropical, Biomédica 2005;25:103-4.
o. Angulo VM, Tarazona A, Arismendi MJ; Joya MI, Sandoval CM. Distribución de triatomineos (Hemiptera: Reduviidae)
domiciliarios en 27 municipios de Santander. Biomédica 1997;17:81.

152
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

p. Vallejo G, Jaramillo JC, Silva JC, Castañeda N, Gualtero D, Lozano LE, et al. Implementación de un programa de
control de la trasmisión vectorial de la enfermedad de Chagas, municipio de Coyaima, Tolima. Biomédica 1997;17:94-6.
q. Carranza J.C, Lozano L, Vallejo G. Distribución y Dinámica Poblacional de Rhodnius colombiensis en la Cuenca alta
del Río Magdalena En: Memorias Curso Taller Internacional Sistemas de Información Geográfica, Sensores Remotos y
Genética Poblacional de Vectores y Parásitos Aplicados al Control de la Enfermedad de Chagas. Universidad de los
Andes, Bogotá; 2002. p.165-9.
r. Ospina S. Estudio preliminar de un foco de tripanosomiasis americana en el municipio de Coyaima, departamento de
Tolima. En: OPS/OMS/Ministerio de Salud, Dirección de Campañas Directas. III Reunión de investigadores de malaria y otras
enfermedades tropicales. Rionegro, Antioquia: Ministerio de Salud. 1991. p.71.
s. Barreto M, Burbano ME, Barreto P. Actividad de Triatoma dispar (Hemiptera: Reduviidae) en Hanz, Bajo Calima,
Buenaventura, Valle, Colombia. Memorias XI Congreso Colombiano de Parasitología y Medicina Tropical. Biomédica
2003;23:101-2.
( ) Entre paréntesis aparecen el número y la letra en minúscula de la referencia bibliográfica correspondiente.

Figura 1. Distribución de los principales triatominos asociados al hábitat humano según las zonas biogeográficas.

153
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

la figura 5 contiene la información para la costa el efecto de la dispersión pasiva en triatominos


Pacífica (departamento del Chocó) e incluye los (figura 3).
departamentos de Caldas y Risaralda; la figura 3
Por otra parte, los reportes de ejemplares de T.
corresponde a los departamentos de la región de dimidiata (figuras 3, 6 y 11) capturados en hábitats
la llanura del Caribe, incluida la Sierra Nevada de de palmas y cuevas en los departamentos de
Santa Marta y la isla de Providencia; la figura 2 Santander, Boyacá y Magdalena (Guhl F, Pinto
muestra la distribución de los triatominos en los N, Aguilera G. Distribución y ecoepidemiología de
departamentos de la Amazonia, y las figuras 8 y los triatominos vectores de la enfermedad de
10 corresponden a los departamentos de Meta, Chagas en Colombia. Memorias XII Congreso
Casanare y Arauca. Colombiano de Parasitología y Medicina Tropical.
Se destaca el nuevo registro de Triatoma Biomédica 2005;25:76-9) demuestran la
nigromaculata, especie recientemente descrita importancia de fortalecer los programas de
para el departamento del Cauca (27). Molina et vigilancia entomológica para que futuros trabajos
al. en el año 2000 (4) predijeron la aparición de centren su interés en las especies silvestres como
esta especie con base en su presencia en países un elemento fundamental en la epidemiología de
vecinos, en los cambios ambientales y el aumento la enfermedad de Chagas. Los departamentos
en las migraciones poblacionales. de Santander, Norte de Santander, Boyacá,
Casanare, Tolima y Meta (figuras 4, 6, 8, 10 y
Los nuevos registros de R. prolixus silvestres 11) continúan siendo las zonas de mayor
infectados con T. cruzi en los departamentos de importancia en cuanto al número de registros. Se
Casanare, Magdalena y Arauca (figuras 3 y 10) confirma igualmente que R. prolixus es la especie
ponen de manifiesto la importancia de reforzar los con la mayor distribución en el país, seguida por
programas de vigilancia entomológica, sobre todo especies del género Triatoma como T. dimidiata,
si se tienen en cuenta sus altos índices de T. maculata y T. venosa.
infección natural con el parásito.
Los nuevos registros de la fauna triatomínica en
El departamento de Arauca muestra datos de los la Amazonia (figura 2) (Rodríguez MH. Etnoco-
especímenes recolectados e identificados por el nocimiento de los vectores de la enfermedad de
personal del Laboratorio de Salud Pública Chagas de las comunidades indígenas Ticuna y
Fronterizo, Unidad Administrativa Especial de Huitoto del trapecio amazónico, departamento del
Salud de Arauca, que indican un aumento Amazonas, Colombia. En: Guhl F, Schofield CJ.
considerable en el registro de la fauna triatomínica, Proceedings of the ECLAT-AMCHA International
incluidos nuevos registros de Ps. arthuri y de R. Workshop on Chagas disease surveillance in the
prolixus silvestre (figura 10) Amazon region, Palmari, Brazil. Bogotá: Corcas
De igual manera, se destaca el primer reporte Editores; 2004. p.75-82) han contribuido en la
insular de T. dimidiata en la isla de Providencia implementación de la reciente iniciativa de los
(departamento de las islas de San Andrés y países amazónicos. Al igual que las ya existentes
Providencia) (Guhl F, Pinto N, Aguilera G. (del Cono sur, Andina, Centroamericana y de
Distribución y ecoepidemiología de los triatominos México), esta iniciativa, creada en el año 2.004
vectores de la enfermedad de Chagas en por los Ministerios de Salud de los nueve países
Colombia. Memorias XII Congreso Colombiano de amazónicos, pretende fijar políticas y estrategias
Parasitología y Medicina Tropical. Biomédica de vigilancia epidemiológica y control efectivas
en la cuenca amazónica.
2005;25:76-9.). Al compararlos morfométricamente
con ejemplares capturados en el interior del país, La amplia distribución de P. geniculatus, especie
los ejemplares capturados en un domicilio de la de hábitos eminentemente silvestres, debe
isla corresponden fenotípicamente a ejemplares tenerse en cuenta de manera especial en los
centroamericanos. Esto indica un alto grado de programas de vigilancia, ya que existen reportes
dispersión humana, comprobándose una vez más de su domiciliación en el municipio de Amalfi,

154
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Antioquia, (Gualdrón LE, Brochero HL, Arévalo C, estas especies, originalmente consideradas como
Pérez L, Suárez M, Olano VA. Hallazgo de algunos de hábitos silvestres.
vectores de la enfermedad de Chagas en el
Los índices de infección natural en 15 de las 24
departamento del Amazonas. Santafé de Bogotá;
especies de triatominos registradas en Colombia,
Resúmenes XXVI Congreso Sociedad Colombiana
la presencia de R. prolixus en 21 departamentos,
de Entomología: 1999. p.72). Igualmente, la
sumada a la continua acción antrópica sobre los
demostración del proceso de domiciliación de T.
ambientes silvestres que sirven de hábitat a los
maculata en Santa Marta (Guhl F, Aguilera G, Pinto
triatominos selváticos, así como el
N, Vergara D. Distribución geográfica de las
desplazamiento masivo de poblaciones humanas,
especies de triatominos en los departamentos
constituyen factores determinantes en la
endémicos para la enfermedad de Chagas en
aceleración de los procesos de domiciliación de
Colombia. En: Felipe Guhl. Memorias Primer Taller
los triatominos.
Internacional Sobre Control de la Enfermedad de
Chagas. Curso de Diagnóstico, Manejo y Se espera que la información aquí presentada sirva
Tratamiento de la Enfermedad de Chagas. VI como herramienta para reforzar las estrategias de
Reunión de la Iniciativa Andina para el Control de control de la enfermedad de Chagas, permitiendo
la Enfermedad de Chagas, Bogotá; Corcas también la evaluación del riesgo que representan
Editores: 2005. p.25-41), pone de manifiesto la las especies de triatominos silvestres en
importancia de mantener bajo estricta vigilancia Colombia.

Figura 2. Distribución de las diferentes especies de triatominos en los departamentos que conforman la región de la
Amazonia y la Orinoquia.

155
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Figura 3. Distribución de las diferentes especies de triatominos en los departamentos que conforman la región de la llanura
del Caribe, incluida la Sierra Nevada de Santa Marta y la isla de Providencia (perteneciente al departamento de San Andrés
y Providencia).

Figura 4. Distribución de las diferentes especies de triatominos en los departamentos de Cauca, Huila, Nariño, Tolima y
Valle.

156
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Figura 5. Distribución de las diferentes especies de triatominos en los departamentos de Chocó, Caldas y Risaralda.

Figura 6. Distribución de las diferentes especies de triatominos en los departamentos de Norte de Santander y Santander.

157
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Figura 7. Distribución de las diferentes especies de triatominos en el departamento de Cundinamarca.

Figura 8: Distribución de las especies de triatominos en el departamento del Meta.

158
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

Figura 9. Distribución de las diferentes especies de triatominos en el departamento de Antioquia.

Figura 10. Distribución de triatominos en los departamentos de Arauca y Casanare.

159
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Figura 11. Distribución de las diferentes especies de triatominos en el departamento de Boyacá.

Adendo Referencias
Al cierre de esta edición se ha reportado una nueva 1. Schofield CJ, Diotaiuti L, Dujardin JP. The process
especie para Colombia, recientemente descrita que of domestication in triatominae. Mem Inst Oswaldo Cruz
1999;94(Suppl.1):375-8.
corresponde a Belminus corredori (38). Los
ejemplares fueron capturados en una vivienda de 2. Padilla J, Guhl F, Soto J, Alvarez G. Diagnóstico y
terapéutica de las enfermedades transmitidas por
buena calidad, ubicada en la vereda Puente Tierra vectores en Colombia. Santafé de Bogotá: Servi Offset
en el municipio de San Gil, departamento de Ltda; 1999.
Santander. La región se caracteriza por la presencia
3. Gorla DE, Dujardin JP, Schofield CJ. Biosystematics
de bosque montano seco a una altura de 1.810 of Old World Triatominae. Acta Trop 1997;63:127-40.
metros sobre el nivel del mar. Con este nuevo
4. Molina JA, Gualdrón LE, Brochero HL, Olano VA,
registro se completan 25 especies de triatominos Barrios D, Guhl F. Distribución e importancia
en Colombia. epidemiológica de las especies de triatominos
(Reduviidae: Triatominae) en Colombia. Biomédica
Conflicto de Intereses 2000;20:344-60.
Los autores declaran no tener conflicto de 5. Gualdrón LE, Brochero HL, Arévalo C, Pérez LP,
intereses con el contenido del manuscrito. Suárez MC, Olano VA. Hallazgo de algunos vectores
de la enfermedad de Chagas en el departamento del
Financiación Amazonas y sus implicaciones en salud pública. Revista
Colombiana de Entomología 2001;27:121-7.
Este estudio se realizó con el apoyo financiero
6. Wolf M, Arboleda JJ, Gonzalez C, Manotas LE,
del Fondo de Investigaciones y Posgrados de la Rueda AM. Estudio tripanosomiasis americana,
Facultad de Ciencias de la Universidad de los municipio de Amalfi, vereda Montebello, 1994. Boletín
Andes y el CDIA- EC - Chagas Disease Epidemiológico de Antioquia 1994:29:302-5.
Intervention Activities - Contract N° ICA4CT-2003- 7. Ucros H. Distribución de los triatominae en Colombia.
10049. Rev Fac Med Bogotá 1960;28:181-9.

160
Biomédica 2007;27(supl. 1):143-62 Distribución y ecoepidemiología de triatominos en Colombia

8. Dunn LH. Notes on some insects and other arthropods 23. Villegas M, López A, Manotas L, Molina J, Guhl F.
affecting man and animals in Colombia. Am J Trop Med Distribución de triatominos (Hemiptera: Reduviidae) en
1929;9:493-508. el departamento de Guainía y su papel en la transmisión
de Trypanosoma cruzi . Revista Colombiana de
9. D’Alessandro A, Barreto P. Colombia. En: Carvallo RU, Entomología 2001:27:115-120.
Ravinovich JE, Tonn RJ, editores. Factores biológicos
y ecológicos de la enfermedad de Chagas. Tomo II. 24. D’ Alessandro A, Barreto P, Saravia N, Barreto M.
Buenos Aires: Centro Panamericano de Ecología Humana Epidemiología de Trypanosoma cruzi en los Llanos
y Salud, Organización Panamericana de la Salud/ Orientales de Colombia. Colombia Med 1985;
Organización Mundial de la Salud; 1985. p.377-99. 16:84-93.
10. D’ Alessandro A, Barreto P, Thomas M. Nuevos 25. Carvallo RU, Barreto P, Duarte CA. Una nueva
registros de triatominos domiciliarios y extradomiciliarios especie de Rhodnius Stal (Hemiptera, Reduviidae,
en Colombia. Colombia Med 1981:12:75-85. Triatominae) de Colombia. Biol Dir Malariol San Amb
1976;16:176-83.
11. Restrepo M, Morales A, Ferro C. Presencia del
Triatoma dispar Lent, 1950. Colombia. Boletín 26. D’ Alessandro A, Barreto P, Duarte CA. Distribution
Epidemiológico de Antioquia 1989;14:109. of triatomine-transmitted trypanosomiasis in Colombia
and new records of the bugs and infections. J Med
12. Barreto M, Barreto P. Aves y pitos en Colombia.
Entomol 1971;8:159-72.
Cespedesia 1984;13:93-6.
27. Castro AT. Soroprevalencia e conditionantes para
13. Marinkelle CJ. Colombian triatominae an their doença de Chagas (tripanossomiase americana) regiao
infestation with trypanosomatid flagellates. Mitt Inst
de sope da cordilheira Oriental, Estado de Meta,
Colombo-Alemán Invest Cient 1972;6:13-29.
Colombia (Tesis) Sao Paulo: Universidad de Sao
14. Ucros H, Rocha H, Duque M. Distribución de triatominae Paulo;1993.
en Colombia. Antioquia Médica 1971;8:707-17.
28. Loyola EG, Freyre JL, Holguín AF, Sanchez A,
15. Hernández C. Infección natural del Triatoma capitata Gonzales A, Barreto M. Trypanosoma cruzi infections
Usinger 1939 por el Trypanosoma cruzi. Revista de la in sylvatic hosts on the Pacific coast of Colombia. Trans
Facultad de Medicina 1947;15:465-80. R Soc Trop Med Hyg 1987;81:760.

16. Barreto P, Barreto M, Hurtado C. Nuevos hallazgos 29. Angulo VM, Gutiérrez R, Rubio I, Joya M, Arismendi
en Colombia de Panstrongylus geniculatus (Latreille, M, Esteban L, et al . Triatomineos domiciliados y
1811) y Triatoma dispar Lent 1950 (Hemiptera: silvestres: impacto en la transmisión de la enfermedad
Reduviidae). Colombia Med 1988;19:64-7. de Chagas en Santander. En: Angulo VM, editor. Control
y manejo de la tripanosomiasis americana.
17. Minter-Goedbloed E, Mister DM, Cadena A, Howells Bucaramanga: Gráficas Trijaimes;1999. p.72-6.
RE. First record of Trypanosoma (Schizotrypanum)
cruzi from western Amazon basin, Caquetá, Colombia. 30. Marinkelle CJ. Triatoma dimidiata capitata, a natural
Trans R Soc Trop Med Hyg 1987;81:612. vector of Trypanosoma rangeli in Colombia. Rev Biol
Trop 1968;15:203-5.
18. Vasquez LR, Galvão Cleber, Pinto N, Granados H.
Primer registro de Triatoma nigromaculata (Stål, 1859) 31. López G, Moreno J. Genetic variability and
(Hemiptera, Reduviidae, Triatominae) para Colombia. differentiation between populations of Rhodnius prolixus
Biomédica 2005;25:417-21. and R. pallescens , vectors of Chagas disease in
Colombia. Mem Inst Oswaldo Cruz 1995;90:353-7.
19. Morales A, Ferro C, Isaza de Rodrguez C, Cura E.
Encuesta sobre artrópodos de interés médico en La 32. Romaña CA, Pizarro JC, Rodas R, Guilbert E. Palm
Guajira, Colombia, Suramérica. Biomédica 1987;7:87-94. trees as ecological indicators of risk areas for Chagas
disease. Trans R Soc Trop Med Hyg 1999;93:594-5.
20. Moreno J. Estudio de vectores y reservorios de
Trypanosoma cruzi en algunas regiones de Colombia. 33. Marinkelle CJ. Developmental stages of Trypanosoma
En: Vallejo GA, Carranza JC, Jaramillo JC. Biología, cruzi-like flagellates in Cavernicola pilosa. Rev Biol Trop
epidemiología y control de la tripanosomiasis americana 1982;30:107-11.
y leishmaniosis. Ibagué; Lito Ediciones Tolima: 2000.
34. Moreno MJ, Galvao C, Jurberg J. Rhodnius
p.19-22.
colombiensis sp. n. da Colombia, com quiadros
21. Ucros H, Escallón Al. Ampliación de la distribución de comparativos entre estructuras fálicas do genero
los triatominae en Colombia. Universitas Médicas Rhodnius Stahl, 1859 (Hemiptera, Reduviidae,
1967;4:47-9. Triatominae). Entomol Vect 1999;6:601-17.
22. Uribe C. Infección del Rhodnius prolixus Stahl por 35. Vallejo GA, Lozano LE, Carranza JC, Sánchez JL,
Trypanosoma cruzi y Trypanosoma rangeli. Biomédica Jaramillo JC, Guhl F, et al. Ecología de los triatominos
1996;16:87-92. no domiciliados en Colombia con especial referencia a

161
Guhl F., Aguilera G., Pinto N., Vergara D. Biomédica 2007;27(supl. 1):143-62

Rhodnius colombiensis en el departamento del Tolima. 37. Guhl F, Vallejo GA. Trypanosoma (Herpetosoma)
En: Vallejo GA, Carranza JC, Jaramillo JC. Biología, rangeli Tejera, 1920: an updated review. Mem Inst
epidemiología y control de la tripanosomosis Oswaldo Cruz 2003;98:435-42.
americana y leishamniosis. Ibagué: Lito Ediciones
Tolima; 2000. p.22-8. 38. Galvao C, Angulo VM. Belminus corredori, a new
species of Bolboderini ( Hemiptera: Reduviidae:
36. Barreto M, Bareto P. Triatoma dispar (hemiptera: Triatominae ) from Santander, Colombia. Zootaxa
Reduviidae), a new record for Colombia. J Med Entomol 2006;1241:61-8.
1984;21:750.

162
Instrucciones para los autores
Biomédica es la revista del Instituto Nacional de una breve descripción del contenido, algunas
Salud de Colombia cuyo fin primordial es la referencias claves, su probable extensión y el
difusión de trabajos originales que contribuyan a número aproximado de ilustraciones.
ampliar los conocimientos en biomedicina. · La revisión debe incluir un resumen con énfasis
Información general en el significado de los hallazgos recientes, una
introducción al tema señalando hitos pasados
Biomédica publicará trabajos científicos, escritos
y desarrollos presentes, y los encabezamientos
en español o en inglés, en las siguientes categorías:
del texto con el objeto de hacer más provechosa
Artículo original: trabajo inédito derivado de una su lectura. La revisión debe incluir un análisis
investigación biomédica que aporta información crítico de la literatura y datos propios de los
nueva sobre aspectos específicos y contribuye de autores. El desarrollo del tema queda a
manera relevante al conocimiento científico. discreción del autor pero se aconseja que
Comunicación breve: es el informe de resultados incluya tablas, esquemas y figuras que hagan
ágil el texto y ofrezcan una comprensión más
parciales o finales de una investigación cuya
rápida de su contenido.
divulgación rápida es de gran importancia o cuyo
contenido no satisface los requisitos para Imágenes en biomedicina: es un trabajo
considerarlo como un artículo original. ilustrado con fotografías que muestran y explican
de manera didáctica un concepto, una estructura,
Nota técnica: describe en detalle una técnica de
una enfermedad o un diagnóstico biomédico. Debe
laboratorio novedosa o modificaciones realizadas incluir un comentario corto que resalte la
a una técnica ya establecida, enfatizando las importancia del tema ilustrado.
ventajas que tiene el procedimiento o la innovación
desarrollados. Haga usted el diagnóstico: pretende retar la
capacidad diagnóstica de los lectores, utilizando
Ensayo: es un manuscrito filosófico, literario o ilustraciones o fotografías de casos clínicos o de
científico que presenta la opinión sustentada del hallazgos microscópicos. Consta de dos partes,
autor sobre un tema específico o de actualidad. la presentación clínica y los hallazgos corres-
Comentario: manuscrito sobre un artículo pondientes y el diagnóstico correcto; este último
publicado en la revista. aparece en página aparte y debe acompañarse
de un comentario actualizado sobre la entidad que
Reseña histórica: es un manuscrito que destaca se pretende ilustrar.
personajes o sucesos y su contribución al
desarrollo de las ciencias biomédicas. Presentación de casos: son ejemplos de casos
clínicos de enfermedades que destacan alguna
Revisión de tema: presenta el estado actual del particularidad llamativa o señalan un hallazgo es-
conocimiento sobre un tema; incluye dos pecial de las mismas, con una revisión breve de
categorías: la literatura pertinente.
· solicitado directamente por el Comité Editorial Cartas al editor: los lectores pueden solicitar
a personas expertas en el tema; aclaraciones o presentar comentarios sobre el
· presentado por profesionales interesados en material publicado en la revista. La decisión sobre
un tema particular; en este caso, se debe la publicación de las cartas recibidas queda a
enviar una propuesta en la que se indique discreción del Comité Editorial.
porqué el tema escogido es pertinente para Comentarios bibliográficos: son escritos
los lectores de Biomédica, el cual debe incluir críticos breves sobre libros de biomedicina.

601
Información general sobre los manuscritos

Todo material propuesto para publicación en Panamericana de Salud Pública (Rev Panam
Biomédica será revisado por el Comité Editorial y Salud Pública 2004;15:41-57).
enviado para evaluación externa a dos evaluadores Después de realizadas la edición y la corrección
o pares científicos; para facilitar este paso, los de estilo, los autores recibirán las galeradas del
autores deben enviar el nombre y la dirección de artículo, las cuales deben ser cuidadosamente
cuatro posibles evaluadores. Los editores revisadas y devueltas al Editor en un término
informarán al autor principal que su trabajo ha sido máximo de 48 horas.
recibido; posteriormente, le harán llegar los
comentarios de los evaluadores y le harán conocer Una vez realizada la publicación, el autor princi-
la decisión final sobre la publicación de su pal recibirá, libre de costo, 5 ejemplares de la
manuscrito. Los autores deben incluir una carta revista.
en la que expresen si existen conflictos de interés El manuscrito debe incluir las siguientes
o si no los hay; de la misma forma, deben incluir secciones:
una nota sobre la fuente de financiación de la Hoja de presentación: además del título del
investigación adelantada. trabajo y del título corto para los encabezamientos
La revista Biomédica se reserva el derecho de de las páginas, esta sección debe incluir los
aceptar o rechazar los artículos y hará nombres completos de los autores, su afiliación y
sugerencias que tiendan a mejorar su el nombre de la institución donde se llevó a cabo
presentación. el trabajo. Además, se debe anotar el nombre del
autor responsable de la correspondencia con su
Una vez que el autor reciba los comentarios de
dirección completa, número telefónico y de fax y
los evaluadores, deberá proceder a contestarlos
dirección electrónica.
punto por punto y a incorporar las modificaciones
correspondientes en el texto. Si en el transcurso Resúmenes y palabras clave: el trabajo debe
de las 6 semanas siguientes, Biomédica no ha presentar un resumen estructurado (objetivo,
recibido las respuestas de las evaluaciones, se métodos, resultados y conclusión) en español y
retirará el manuscrito. otro en inglés, cada uno de no más de 250
palabras. No se permite el uso de referencias ni
Una vez aceptado el manuscrito para publicación se recomienda la inclusión de siglas o acrónimos.
el Comité Editorial no aceptará modificaciones Se requiere listar de 6 a 10 palabras clave en cada
sobre su contenido. idioma; consulte los Descriptores en Ciencias de
Los originales de los artículos aceptados para la Salud (DeCS) del índice de la Literatura
publicación permanecerán en los archivos de la Latinoamericana y del Caribe en Ciencias de la
revista hasta por un año. Salud (LILACS) en la última versión publicada en
disco compacto o en http://decs.bvs.br; para
Preparación del manuscrito verificar las de inglés, consulte los Medical Sub-
Por favor, cíñase a las indicaciones del Interna- ject Headings (MeSH) del Index Medicus en http:/
tional Committee of Medical Journal Editors que /www.nlm.nih.gov/mesh/meshhome.htm.
se encuentran publicadas como "Uniform require- Texto: todo el manuscrito, incluso la página del
ments for manuscripts submitted to biomedical título, los resúmenes, las referencias, los cuadros
journals" en Ann Intern Med 1997;126:36-47 o en y las leyendas de figuras y cuadros, debe estar
http://www.icmje.org/index.html. La versión en escrito a doble espacio, por un solo lado de la
español se puede consultar en el portal de la hoja, sin dejar espacios extras entre párrafo y
revista Acta Médica Colombiana (Acta Med párrafo; deje un solo espacio después del punto
Colomb 1997;22:199-211) o en http:// seguido o aparte. Use la fuente Arial de tamaño
www.actamedica.com o en la Revista 12 y no justifique el texto. Use letra bastardilla o

602
cursiva para los términos científicos, por favor, no completo de la revista. Transcriba únicamente los
los subraye. seis primeros autores del artículo, seguidos de et
Formato electrónico: envíe el manuscrito en al. Se recomienda la inclusión de referencias
Word Perfect o MS Word como procesador de nacionales y latino-americanas para lo cual puede
palabra. consultar Lilacs, Latindex, Sibra, el índice de
Colciencias y otras fuentes bibliográficas
Las gráficas elaboradas en PowerPoint, MS Word
pertinentes.
o Word Perfect son de baja resolución; sirven para
el proceso de impresión únicamente si son Cuadros y figuras: elabore los cuadros usando
imágenes de líneas, no tienen sombras, ni grises el programa del procesador de palabra que
ni colores y se ha enviado una copia impresa en aparece como 'utilidad de cuadros'; absténgase
láser de alta calidad; por lo tanto, no incluya en de preparar archivos en columnas o tabulados en
formato electrónico este tipo de imágenes. Las el texto mismo del manuscrito. Recuerde que debe
ilustraciones se imprimen en una columna (75 mm) enviar una página con los nombres de los archivos.
o en dos columnas (153 mm); por consiguiente, Para las figuras (diagramas, dibujos o ilustraciones)
se deben enviar las ilustraciones del tamaño en en blanco y negro, envíe el original y dos copias
que van a quedar impresas. Si las ilustraciones de la ilustración correspondiente. Si son
son en color y las remite en formato electrónico, fotografías en blanco y negro, se deben enviar tres
se deben enviar en archivos CMYK en formato .eps copias de excelente calidad; si son transparencias,
(Encapsulated Postscript); la resolución óptima envíe la diapositiva original y no una copia, junto
para los archivos CMYK es de 300 dpi si la imagen con dos impresiones en papel (fotocopia o por
no tiene texto incluido; si incluye texto, la escáner) de la misma imagen para facilitar el envío
resolución recomendada es de 600 dpi y si son de este material a los evaluadores del manuscrito.
de blanco y negro, de 1.200 dpi. La fuente preferida En las preparaciones de microscopio, recuerde
para las gráficas es Helvética. Si sus archivos son que debe mencionar la coloración y el aumento
de Macintosh, conviértalos a uno de los formatos según el objetivo utilizado, pero no incluya el valor
mencionados. No olvide incluir una lista de los del ocular.
archivos enviados y anotar el programa en que
fueron hechos. Remisión del manuscrito
Referencias bibliográficas: por favor, observe El manuscrito debe ser remitido con una carta
estrictamente las indicaciones de los Requisitos firmada por todos los autores en la que conste
uniformes para manuscritos del área biomédica. que todos conocen y están de acuerdo con su
Asígnele un número a cada referencia citada del contenido. Se debe mencionar, igualmente, que
texto, los cuadros y las figuras en orden el manuscrito no ha sido publicado anteriormente
ascendente. Anote los números de las referencias ni se ha sometido a publicación en otra revista. El
entre paréntesis y no como índice (superscript). documento original y las dos copias exigidas deben
Las comunicaciones personales, los datos sin ser remitidos a los editores a la siguiente dirección:
publicar, los manuscritos en preparación o
Revista Biomédica
sometidos para publicación y los resúmenes de
Instituto Nacional de Salud
trabajos presentados en congresos se deben citar
Avenida Calle 26 No.51-60
en el cuerpo del artículo entre paréntesis. Consulte
Bogotá, D.C., Zona 6, Colombia, S.A.
la lista de publicaciones periódicas del Index
o
Medicus (http://www.nlm.nih.gov/tsd/serials/
lji.html) para la abreviatura exacta de la revista Apartado aéreo 80334 u 80080
citada; si la revista no aparece, escriba el título Bogotá, D.C., Zona 6, Colombia, S.A.

603
BIOMÉDICA

Lista de verificación

Con el fin de comprobar que se han cumplido todas las instrucciones correspondientes a las normas
de publicación de la revista Biomédica, le solicitamos nos devuelva debidamente diligenciada esta
lista de verificación junto con su manuscrito corregido.

Categoría

Artículo original ______ Comunicación breve______ Nota técnica______

Revisión de tema______ Reseña histórica______ Ensayo ______

Comentario ______ Imágenes en biomedicina ______

Presentación de caso ______ Haga usted el diagnóstico ______

Carta al editor ______ Reseña bibliográfica ______

1- Presentación:
___ Texto escrito a doble espacio en fuente Arial de 12 puntos de tamaño, en una sola cara de la
hoja, tamaño carta.
___ Páginas numeradas consecutivamente en la esquina inferior derecha.
___ Se remiten 3 copias impresas del artículo y una en medio magnético y se especifican los
programas utilizados y las versiones, además de los nombres de archivo.

2- Título:
___ Se incluyen los títulos en español e inglés (máximo 165 caracteres).
___ Se incluye el título abreviado en español (máximo 50 caracteres).
___ Los autores aparecen sólo con su afiliación institucional, sin mencionar cargos ni títulos
académicos.
___ El autor de la correspondencia suministró los datos completos: nombre, apellidos, dirección,
teléfono, fax y correo electrónico.

3- Resumen:
___ Se incluye el resumen estructurado en español e inglés, con una extensión máxima de 250
palabras y con los siguientes subtítulos: introducción, objetivos, materiales y métodos,
resultados y conclusiones.
El resumen estructurado es sólo para artículos originales y comunicaciones breves.

4- Palabras clave:
___ De 6 a 10 por artículo en cada idioma.
___ Se incluyen las palabras clave en español e inglés (keywords), indexadas en los Descriptores
en Ciencias de la Salud (DeCS), http://decs.bvs.br/E/homepagee.html.

5- Estructura del artículo original:


Se incluyen los siguientes apartados:
___ Página de presentación: título en español, título en inglés, título abreviado en español,
presentación de los autores y datos completos del autor de correspondencia.

604
___ Resúmenes: en español e inglés.
___ Materiales y métodos.
___ Resultados.
___ Discusión.
___ Agradecimientos.
___ Declaración de conflicto de intereses.
___ Fuente de financiación.
___ Referencias.
___ Cuadros y figuras con sus respectivas leyendas.
6- Figuras:
___ Se incluye cada una en página aparte.
___ Se incluyen las leyendas correspondientes en hoja aparte.
7- Cuadros:
___ Se adjuntan en hoja aparte, elaborados en el modelo más sencillo de tablas del programa
Word y las copias en impresora láser.
___ Se ordenan secuencialmente.
___ Se incluye el título correspondiente.
8- Fotografías:
___ Se adjuntan tres copias.
___ Se señala la identificación de la misma y la orientación al respaldo.
___ Se acompañan del correspondiente pie de foto en hoja aparte.
9- Referencias:
___ Las citas se numeran según orden de aparición en el texto.
___ Se ordenan secuencialmente y en el formato adecuado, tal y como lo indican las normas de
Biomédica en las instrucciones a los autores (http://www.icmje.org/index.html).
___ Cuando se citan referencias en los cuadros, éstas deben seguir el orden con el que se
venía en el texto.
10- Abreviaturas y siglas:
___ Se anota entre paréntesis después de la primera vez cuando debe aparecer en formacompleta
y en el idioma original.
11- Nomenclatura:
___ Los nombres de género y especie están escritos en letra cursiva.
___ Los nombres de microorganismos se escriben completos la primera vez que se citan, incluso
en el título y en el resumen, y luego se usa la solamente inicial del género y permanece el
nombre completo de la especie.
12- Consideraciones generales:
___ Carta firmada por todos los autores.
___ Incluye autorización del Comité de Ética para la experimentación en humanos.
___ Incluye autorización del Comité de Ética para la experimentación en animales.
___ Los autores deben certificarle al Comité Editorial que la (s) persona (s) mencionada (s) en los
agradecimientos tiene (n) conocimiento y está (n) de acuerdo con aparecer en ellos.
___ Todos los manuscritos deben incluir declaración de conflicto de intereses y fuente de
financiación.
___ Los decimales en español deben separarse de los enteros por comas, no por puntos.
___ Se envían los nombres de 4 evaluadores con sus respectivos datos.

605