Anda di halaman 1dari 242

ISBN 978-979-3145-63-1

Pengembangan
Teknologi Produksi

berbasis pemberdayaan masyarakat


Editor:
Sulistyo A. Siran; Maman Turjaman

PENGEMBANGAN TEKNOLOGI PRODUKSI GAHARU


BERBASIS PEMBERDAYAAN MASYARAKAT SEKITAR
HUTAN
Editor: Sulistyo A. Siran; Maman Turjaman
ISBN: 978-979-3145-63-1
Penerbit:
Pusat Penelitian dan Pengembangan Hutan
dan Konservasi Alam
Kampus Balitbang Kehutanan
Jl. Gunung Batu No. 5, Bogor 16110
Telp. (0251) 8633234, 7520067; Fax. (0251) 8638111
E-mail: p3hka_pp@yahoo.co.id

Petikan Undang-Undang Nomor 19 Tahun 2002 tentang Hak Cipta


Ketentuan Pidana
Pasal 72
(1) Barangsiapa dengan sengaja dan tanpa hak melakukan perbuatan sebagaimana
dimaksud dalam Pasal 2 ayat (1) atau Pasal 49 ayat (1) dan ayat (2) dipidana dengan
pidana penjara masing-masing paling singkat 1 (satu) bulan dan/atau denda paling
sedikit Rp 1.000.000,00 (satu juta rupiah), atau pidana penjara paling lama 7 (tujuh)
tahun dan/atau denda paling banyak Rp 5.000.000.000,00 (lima miliar rupiah).
(2) Barangsiapa dengan sengaja menyiarkan, memamerkan, mengedarkan, atau menjual
kepada umum suatu Ciptaan atau barang hasil pelanggaran Hak Cipta atau Hak
Terkait sebagaimana dimaksud pada ayat (1) dipidana dengan pidana penjara paling
lama 5 (lima) tahun dan/atau denda paling banyak Rp 500.000.000,00 (lima ratus juta
rupiah).

ii

KATA PENGANTAR
Terdapat enam tantangan pembangunan kehutanan yang
kita hadapi saat ini, yaitu: degradasi hutan, bencana alam dan
lingkungan, pemanasan global, share sektor kehutanan terhadap
pertumbuhan ekonomi nasional, desentralisasi sektor kehutanan,
dan kontribusi kehutanan dalam hal food, water scarcity, energy, and
medicine. Namun, kita masih melihat ada peluang yang merupakan
sebuah anugerah bagi bangsa kita, yang bila dibudidayakan dan
dikelola secara serius akan dapat menjawab paling tidak lima dari
enam tantangan tadi. Anu-gerah yang juga merupakan peluang
usaha sektor kehutanan dari jenis HHBK ini bernama gaharu.
Ide dan gagasan membangun hutan tanaman gaharu juga
menarik untuk kita kaji bersama. Kalau selama ini perusahaanperusahaan HTI telah eksis dengan komoditi-komoditi kayu seperti
mangium, sengon, mahoni, dan jenis tumbuhan penghasil kayu
lainnya, maka bukanlah hal yang mustahil untuk mengembangkan
hutan tanaman penghasil gaharu apabila secara finansial menjajikan
dan memungkinkan setelah dianalisis kelayakan usahanya.
Pengembangan usaha budidaya tanaman HHBK unggulan akan
berhasil dengan baik apabila didukung oleh semua stakeholder yang
berkepentingan, baik Pemerintah Pusat dalam hal ini Departemen
Kehutanan, Pemerintah Daerah, pengusaha, dan petani.
Disampaikan terima kasih dan penghargaan yang setinggitingginya kepada semua pihak yang telah berkontribusi hingga
terbitnya buku ini.
Jakarta,

Nopember 2010

Kepala Badan Litbang Kehutanan

Dr. Ir. Tachrir Fathoni, MSc.

iii

iv

DAFTAR ISI
KATA PENGANTAR...................................................................................iii
DAFTAR ISI................................................................................................. v
PERKEMBANGAN PEMANFAATAN GAHARU
Sulistyo A. Siran ......................................................................................................................................1

STATUS RISET GAHARU........................................................................31


Aspek PRODUKSI...................................................................................33
1. PENGEMBANGAN GAHARU DI SUMATERA
Mucharromah..............................................................................................................................35
2. KAJIAN KIMIA GAHARU HASIL INOKULASI Fusarium sp.
PADA Aquilaria microcarpa
Eka Novriyanti.............................................................................................................................53
3. TEKNOLOGI INDUKSI POHON PENGHASIL GAHARU
Erdy Santoso, Ragil Setio Budi Irianto, Maman Turjaman,
Irnayuli R. Sitepu, Sugeng Santosa, Najmulah, Ahmad Yani, Aryanto ................77
4. EFEKTIVITAS DAN INTERAKSI ANTARA Acremonium sp.
DAN Fusarium sp. DALAM PEMBENTUKAN GUBAL GAHARU
PADA Aquilaria microcarpa
Gayuh Rahayu .............................................................................................................................97

Aspek SILVIKULTUR........................................................................... 113


5. UJI PRODUKSI BIBIT TANAMAN GAHARU SECARA GENERATIF DAN
VEGETATIF
Atok Subiakto, Erdy Santoso, Maman Turjaman....................................................... 115
6. APLIKASI RHIZOBAKTERI PENGHASIL FITOHORMON
UNTUK MENINGKATKAN PERTUMBUHAN BIBIT Aquilaria sp.
DI PERSEMAIAN
Irnayuli R. Sitepu, Aryanto, Yasuyuki Hashidoko, Maman Turjaman............... 123
7. PENGGUNAAN FUNGI MIKORIZA ARBUSKULA PADA EMPAT
JENIS Aquilaria
Maman Turjaman, Irnayuli R. Sitepu, Ragil S.B. Irianto, Sugeng Sentosa,
Aryanto, Ahmad Yani, Najmulah, Erdy Santoso......................................................... 139

aftar Isi
D

8. HAMA PADA TANAMAN PENGHASIL GAHARU


Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R. Sitepu............. 151

Aspek SOSIAL EKONOMI DAN KONSERVASI............................... 157


9. PROSPEK PENGUSAHAAN GAHARU MELALUI POLA PENGELOLAAN
HUTAN BERBASIS MASYARAKAT (PHBM)
Sri Suharti................................................................................................................................... 159
10. THE ENVIRONMENTAL CHARACTERISTICS OF SOUTH KALIMANTAN
SITE FOR EAGLEWOOD PLANTATION PROJECT
Erry Purnomo............................................................................................................................ 181
11. KARAKTERISTIK LAHAN HABITAT POHON PENGHASIL GAHARU DI
BEBERAPA HUTAN TANAMAN DI JAWA BARAT
Pratiwi.......................................................................................................................................... 193
12. POTENSI DAN KONDISI REGENERASI ALAM GAHARU (Aquilaria
malaccensis Lamk.) DI PROVINSI LAMPUNG DAN BENGKULU,
SUMATERA
Titiek Setyawati....................................................................................................................... 213

vi

PERKEMBANGAN PEMANFAATAN
GAHARU
Sulistyo A. Siran
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu sebuah nama komoditi hasil hutan non kayu yang saat ini
menjadi perbincangan banyak kalangan. Dalam kehidupan seharihari telah dikenal pepatah sudah gaharu cendana pula. Pepatah
ini mengindikasikan bahwa sebenarnya komonditi gaharu sudah
dipopulerkan oleh nenek moyang kita dan menjadi bukti sejarah
bahwa keharuman gaharu telah dikenal sejak ratusan tahun yang
lalu. Pertanyaan yang muncul, lantas kenapa komoditi yang telah
populer tersebut sepertinya menghilang begitu lama dan saat ini
muncul kembali. Jawaban yang sudah pasti adalah rumus umum,
yaitu karena pengambilan jauh lebih besar daripada produksinya.
Dilihat dari wujud dan manfaatnya, gaharu memang sangat
unik. Gaharu sebenarnya sebuah produk yang berbentuk gumpalan
padat berwarna coklat kehitaman sampai hitam dan berbau harum
yang terdapat pada bagian kayu atau akar tanaman pohon inang
(misalnya: Aquilaria sp.) yang telah mengalami proses perubahan
fisika dan kimia akibat terinfeksi oleh sejenis jamur. Oleh sebab itu
tidak semua pohon penghasil gaharu mengandung gaharu.
Dari sisi manfaat, gaharu sejak zaman dahulu kala sudah
digunakan, baik oleh kalangan elit kerajaan, maupun masyarakat

suku pedalaman di Sumatera dan Kalimantan. Gaharu dengan


demikian mempunyai nilai sosial, budaya, dan ekonomi yang cukup
tinggi. Secara tradisional gaharu dimanfaatkan antara lain dalam
bentuk dupa untuk acara ritual dan keagamaan, pengharum tubuh
dan ruangan, bahan kosmetik dan obat-obatan sederhana. Saat ini
pemanfaatan gaharu telah berkembang demikian meluas antara
lain untuk parfum, aroma terapi, sabun, body lotion, bahan obatobatan yang memiliki khasiat sebagai anti asmatik, anti mikrobia,
dan stimulan kerja syaraf dan pencernaan.
Meningkatnya perdagangan gaharu sejak tiga dasawarsa
terakhir ini telah menimbulkan kelangkaan produksi gubal
gaharu dari alam. Berdasarkan informasi, harga gaharu dengan
kualitas Super di pasaran lokal Samarinda, Tarakan, dan Nunukan,
Kalimantan Timur mencapai Rp 40.000.000,- s/d Rp 50.000.000,- per
kilogram, disusul kualitas Tanggung dengan harga rata-rata per
kilogram Rp 20.000.000,-, kualitas Kacangan dengan harga rata-rata
Rp15.000.000,-, kualitas Teri (Rp 10.000.000,- s/d Rp14.000.000,-),
kualitas Kemedangan (Rp 1.000.000,- s/d Rp 4.000.000,-), dan Suloan
(Rp75.000,-).
Bertahun-tahun masyarakat dan pemerintah daerah Kalimantan
dan Sumatera menikmati berkah dari keberadaan gaharu, baik
sebagai sumber pendapatan masyarakat maupun penerimaan
daerah. Besarnya permintaan pasar, harga jual yang tinggi, dan
pola pemanenan yang berlebihan serta perdagangan yang masih
mengandalkan pada alam tersebut, maka jenis-jenis tertentu
misalnya Aquilaria dan Gyrinops saat ini sudah tergolong langka,
dan masuk dalam lampiran Convention on International Trade on
Endangered Spcies of Flora and Fauana (Appendix II CITES).
Walaupun sejak 1994 Indonesia berkewajiban melindungi pohon
penghasil gaharu, namun menurut kenyataan, keberadaan pohon
penghasil gaharu tersebut di Indonesia tidak terkecuali di Sumatera
dan Kalimantan semakin langka. Selama ini masyarakat hanya
tinggal memanen gaharu yang dihasilkan oleh alam. Seringkali
masyarakat tidak tahu pasti kapan pohon penghasil gaharu mulai
membentuk gaharu dan bagaimana prosesnya. Kelangkaan terjadi
karena pohon penghasil gaharu ditebang tanpa memperhatikan

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

ada atau tidak adanya gaharu pada pohon tersebut. Menurut hasil
kajian, dari 20 pohon penghasil gaharu yang ditebang di hutan alam
hanya ada satu atau sering sama sekali tidak ada yang mengandung
gaharu. Kalaupun ada pohon yang mengandung gaharu, maka
jumlah gaharu yang ada di pohon tersebut hanya beberapa gram
saja. Oleh karena itu dapat dibayangkan kalau pencari gaharu
mendapatkan gaharu kira-kira 5 kilogram, mungkin puluhan atau
bahkan ratusan pohon penghasil gaharu yang harus ditebang.
Praktek semacam inilah yang mengakibatkan jumlah pohon
pengahasil gaharu di alam semakin menurun dari tahun ke tahun.
Indikasi menurunnya pupulasi pohon penghasil gaharu
ditunjukkan oleh kecenderungan produksi gaharu dari Kalimantan
dan Sumatera dari tahun ke tahun, di mana realisasi produksi
gaharu pada dekade 80an pernah mencapai ribuan ton dengan
kualitas yang tinggi, sedangkan saat ini produksi tersebut merosot
drastis hanya kira-kira puluhan ton saja dengan kualitas yang
bervariasi.
Guna menghindari agar tumbuhan jenis gaharu di alam tidak
punah dan pemanfaatannya dapat lestari maka perlu diupayakan
untuk konservasi, baik in-situ (dalam habitat) maupun ek-situ
(di luar habitat) dan budidaya pohon penghasil gaharu. Namun
upaya tersebut tidak mudah dilaksanakan, dan kalaupun ada
usaha konservasi dan budidaya namun skalanya terbatas dan
hanya dilakukan oleh lembaga penelitian, perguruan tinggi, dan
LSM konservasi. Sementara masyarakat secara luas enggan untuk
melakukan budidaya pohon penghasil gaharu karena memang
tidak memberikan keuntungan apa-apa.
Prospek untuk mengembalikan gaharu menjadi komoditi
andalan kembali terbuka dengan ditemukannya teknologi rekayasa
produksi gaharu. Dengan teknologi inokulasi maka produksi
gaharu dapat direncanakan dan dipercepat melalui induksi jamur
pembentuk gaharu pada pohon penghasil gaharu. Peningkatan
produksi gaharu dimaksud (yang kegiatannya terdiri dari kegiatan
di bagian hulu sampai hilir) selanjutnya akan berdampak pada
peningkatan penerimaan oleh masyarakat petani, pengusaha

gaharu, dan penerimaan pendapatan asli daerah serta devisa


negara.
Tulisan ini dipaparkan dengan maksud untuk memberikan
gambaran secara umum mengenai pemanfaatan gaharu,
pemahaman mengenai pentingnya nilai gaharu, perlunya budidaya,
konservasi, dan rekayasa pembentukan gaharu yang dapat
mengembalikan status komoditi dari kelangkaan menjadi produk
andalan.

GAMBARAN UMUM TUMBUHAN PENGHASIL


GAHARU
Hutan hujan tropis di Indonesia semenjak tiga puluh tahun
yang lalu dikenal sebagai salah satu penghasil utama kayu bulat
(log) untuk bahan baku industri perkayuan. Selain itu hutan hujan
tropis Kalimantan juga sangat kaya dengan hasil hutan bukan
kayu (HHBK), di mana salah satu di antaranya adalah gaharu yang
bernilai ekonomis tinggi.
Gaharu adalah gumpalan berbentuk padat, berwarna coklat
kehitaman sampai hitam dan berbau harum yang terdapat pada
bagian kayu atau akar dari jenis tumbuhan penghasil gaharu
yang telah mengalami proses perubahan kimia dan fisika akibat
terinfeksi oleh sejenis jamur. Oleh sebab itu tidak semua tanaman
penghasil gaharu menghasilkan gaharu.
Di lndonesia hingga saat ini diperkirakan terdapat lebih kurang
25 jenis tumbuhan penghasil gaharu yang dikelompokkan ke dalam
delapan marga dan tiga suku. Berdasarkan sebaran tempat tumbuh,
tumbuhan penghasil gaharu umumnya tumbuh di Pulau Kalimantan
(12 jenis) dan Pulau Sumatera (10 jenis), kemudian dalam jumlah
terbatas tumbuh di Kepulauan Nusa Tenggara (3 jenis), Pulau
Papua (2 jenis), Pulau Sulawesi (2 jenis), Pulau Jawa (2 jenis), dan
Kepulauan Maluku (1 jenis).
Dari pengamatan sebaran Aquilaria spp. yang dilaksanakan
pada tahun 2000 ditemukan bahwa Aquilaria spp. tumbuh tersebar
secara luas di Kalimantan Timur, Kalimantan Barat, Kalimantan

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Tengah, dan Kalimantan Selatan. Tingginya permintaan pasar dunia


akan gaharu dan harga jual gaharu yang cukup tinggi telah menarik
minat masyarakat, baik lokal maupun pendatang untuk melakukan
eksploitasi gaharu secara besar-besaran. Akibatnya, populasi
Aquilaria spp. di hutan alam semakin menurun dan bahkan pada
suatu saat menjadi punah.
Untuk mencegah dari kepunahan maka pada pertemuan CITES
(The Convention on International Trade in Endangered Species of
Wild Flora and Fauna) ke-IX di Florida, Amerika Serikat pada tahun
1994, Aquilaria malaccensis, salah satu tumbuhan penghasil gaharu
terpenting yang banyak tumbuh di Kalimantan telah dimasukkan
ke dalam Appendix II sebagai tumbuhan yang terancam punah
sehingga dalam penebangan dan perdagangannya perlu dibatasi.
Bahkan sejak tahun 2004, seluruh jenis Aquilaria telah dimasukkan
dalam Appendix II CITES.
Indikasi dari menurunnya populasi Aquilaria spp. antara lain
dari pergerakan pencari gaharu yang telah mengarah pada bagian
utara Kalimantan Timur, di pedalaman hutan Kalimantan Barat
dan Kalimanatan Tengah serta menurunnya realisasi produksi
gaharu dari tahun ke tahun. Walaupun realisasi produksi gaharu
tidak menggambarkan besarnya potensi, namun dengan semakin
sulitnya mendapatkan gaharu dari waktu ke waktu menunjukkan
populasi Aquilaria spp. terus mengalami penurunan.
Menyadari semakin langkanya tumbuhan penghasil gaharu,
beberapa instansi pemerintah dan masyarakat telah melakukan
inisiatif untuk mengadakan pelestarian tumbuhan penghasil
gaharu dan sekaligus membudidayakan, baik untuk kepentingan
konservasi maupun ekonomi.

KANDUNGAN DAN MANFAAT GAHARU


Terdapat beberapa zat penting yang terkandung dalam gubal
gaharu yaitu (-agarofuran, (-agarofuran, nor-ketoaaga-rofuran,
(-)-10-epi-y-eudesmol, agarospirol, jinkohol, jinkohon-eremol,
kusunol, dihydrokaranone, jinkohol II serta oxo-aga-rospirol.
Lebih lanjut Susilo (2003) mengatakan bahwa terdapat 17 macam

senyawa yang terdapat pada gaharu, antara lain: noroxoagarofuran,


agarospirol, 3,4 dihydroxy-dihydro-agarufuran, p-methoxybenzylaceton, dan aquillochin. Selanjutnya Oiler (tanpa tahun)
dalam Suhartono dan Mardiastuti (2003) menyebutkan terdapat 31
unsur kimia yang terkandung di dalam gaharu dan bahan kimia
penyusun utamanya adalah 2-(2-(4 methoxyphenyl)ethil)chromone
(27%) dan 2-(2-phenylethyl)chromone (15%).
Gaharu dengan aromanya yang khas digunakan masyarakat
di Timur Tengah sebagai bahan wewangian. Di Cina, gaharu
dimanfaatkan sebagai obat sakit perut, gangguan ginjal, hepatitis,
asma, kanker, tumor, dan stres. Selain itu gaharu telah dipergunakan
sebagai bahan baku industri parfum, kosmetika, dan pengawet
berbagai jenis asesori.
Karena aromanya harum, gubal gaharu diperdagangkan sebagai
komoditi elit untuk keperluan industri parfum, tasbih, membakar
jenazah bagi umat hindu, kosmetik, hio, setanggi (dupa), dan obatobatan. Di samping itu dengan perkembangan ilmu dan teknologi
industri, saat ini berbagai negara memanfaatkan gaharu selain
sebagai bahan pengharum (parfum) dan kosmetik, juga telah
berkembang industri pemanfaatan gaharu sebagai bahan baku
industri obat herbal alami, untuk pengobatan stres, asma, reumatik,
radang lambung dan ginjal, malaria, bahan antibiotic, TBC, liver,
kanker, dan tumor yang masih dalam proses uji klinis.
Limbah bekas gaharu yang telah disuling digunakan untuk dupa
dan bahan untuk upacara agama, sedangkan air suling gaharu
dimanfaatkan untuk kesehatan, kecantikan, kebugaran serta bahan
minuman (kopi) oleh masyarakat di Kabupaten Berau.

PEMUNGUTAN DAN PENGOLAHAN GAHARU


A. Cara Pendugaan Kandungan Gaharu
Karena tidak semua tumbuhan penghasil gaharu berisi gaharu,
maka pengetahuan cara pendugaan kandungan gaharu pada
tumbuhan penghasil gaharu yang terinfeksi jamur pembentuk
gaharu perlu diketahui terutama oleh para pemungut pemula

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

sehingga tidak terjadi salah tebang pada pohon yang tidak berisi
gaharu. Adapun ciri dari tumbuhan penghasil gaharu berisi gaharu
antara lain adalah: daun berwarna kuning dan rontok, tajuk pohon
kecil dan tipis, cabang pohon banyak yang patah, banyak terdapat
benjolan dan lekukan sepanjang batang atau cabang pohon, kulit kayu
kering dan rapuh serta bila ditarik mudah putus. Setelah ditemukan
ciri-ciri tersebut maka dilakukan uji pelukaan pada batang pohon
dengan menggunakan kapak atau parang. Bilamana terdapat alur
coklat kehitaman pada batang menunjukkan adanya kandungan
gaharu. Untuk lebih meyakinkan biasanya serpihan kayu tadi
selanjutnya dibakar untuk mengetahui apakah mengeluarkan bau/
aroma wangi khas gaharu.

B. Sistem Pemungutan Gaharu


Pohon dari tumbuhan penghasil gaharu yang telah diyakini
mengandung gaharu ditebang, kemudian dipotong-potong dan
dibelah untuk diambil gaharunya. Cara pemungutan gaharu
semacam ini di Sumatera dan Kalimantan disebut servis, puncut
atau pahat. Cara lain yang berlaku pada masyarakat Dayak Kenyah
dan Punan di Kalimantan Timur adalah dengan mengiris dan
memotong bagian kayu dari tumbuhan penghasil gaharu yang
terkena infeksi penyakit hingga ke bagian tengah batang. Cara ini
disebut tubuk. Potongan kayu berisi gaharu kemudian dikumpulkan
dan secara perlahan bagian kayu dipisahkan dari gaharu dengan
menggunakan pisau kecil atau pahat cekung.

C. Pengolahan Gaharu
Sampai saat ini produk gaharu yang berasal dari alam umumnya
dipasarkan dalam bentuk bongkahan namun ada pula dalam
bentuk minyak hasil sulingan. Cara penyulingan minyak gaharu
dapat dilakukan dengan dua sistem yaitu sistem kukus dan tekanan
uap. Harga minyak gaharu di pasaran Jakarta Rp 750.000/tolak (1
tolak = 12 cc).

KLASIFIKASI MUTU GAHARU


Klasifikasi mutu gaharu di Kalimantan Timur khususnya di Kota
Samarinda dan daerah sekitarnya hingga saat ini masih belum
seragam (Tabel 1) dan penentuannya dilakukan secara visual.
Keragaman dan ketidakjelasan di dalam penentuan mutu tersebut
menyebabkan harga jual yang berbeda dengan kelas mutu yang
sama. Dengan telah ditetapkannya standar nasional untuk mutu
gaharu (SNI 01-5009.1-1999) diharapkan standar mutu tersebut
dapat segera menjadi bahan acuan para pengusaha gaharu,
pedagang pengumpul, dan pemungut gaharu di dalam menentukan
kelas mutu gaharu. Pada Tabel 1 disajikan kriteria dan klasifikasi
mutu gaharu.
Secara umum klasifikasi mutu gaharu dapat dikelompokkan
menjadi enam kelas mutu yaitu super, tanggung, kacangan, teri,
kemedangan, dan cincangan dan setiap kelas mutu dibedakan lagi
menjadi beberapa sub kelas mutu.
Tabel 1. Klasifikasi mutu gaharu di Kota Samarinda dan daerah sekitarnya
Klasifikasi mutu
No.

Lokasi

Super

Tanggung

Kacangan

Teri
Teri A
Teri B
Teri C
Teri kulit A
Teri kulit B

Cincangan

1.

Samarinda Super
king
Super A
Super AB

Kacangan A
Kacangan B
Kacangan C

2.

Muara
Kaman

Kacangan isi Teri isi


Kacangan
Teri kulit
kosong

Sudokan
Serbuk

3.

Kota
Bangun

Super A
Super B

Kacangan A
Kacangan B

Serbuk

4.

Muara
Wahau

Super A
Super B

Teri A
Teri B

TangKacangan isi Teri super


gung isi Kacangan
Teri laying
Tangkosong
gung
kosong

Sumber: Balai Penelitian dan Pengembangan Kehutanan Kalimantan, 2007

Kemedangan
Kemedangan A
Kemedangan B
Kemedangan
community

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Tabel 2. Kriteria dan klasifikasi mutu gaharu


No.

Klasifikasi

Kriteria

1.

Super

Gaharu berwarna hitam pekat, padat, keras, mengkilap dan


sangat berbau, tidak ada campuran dengan serat kayu, berupa
bongkahan atau butiran berukuran besar, bagian dalam tidak
berlubang.

2.

Tanggung

Gaharu berwarna hitam dan coklat, padat, keras, bagian


dalam kadang berlubang, kadang bercampur serat kayu dan
berukuran tanggung.

3.

Kacangan

Gaharu berwarna hitam terkadang bercampur coklat,


bercampur kayu, berupa butiran-butiran sebesar biji kacang
atau berdiameter sekitar 2 mm.

4.

Teri

Gaharu berwarna hitam terkadang bercampur coklat,


bercampur kayu, berupa butiran-butiran lebih kecil dari biji
kacang dan lebih tipis atau berdiameter sekitar 1 mm.

5.

Kemedangan

Kayu yang mengandung getah gaharu.

6.

Cincangan

Potongan kecil kayu dari pemisahan gaharu.

Sumber : Balai Penelitian dan Pengembangan Kehutanan Kalimantan, 2006

Berdasarkan informasi pasar di


Samarinda (Tabel 3) harga gaharu
dengan kualitas super dapat
Tabel 3. Harga jual gaharu di
mencapai Rp 30.000.000 per kg,
pasaran Samarinda,
disusul kualitas tanggung dengan
Kalimantan Timur
harga rata-rata Rp 10.000.000,- per
No.
Kelas mutu
Harga (Rp/Kg)
kg. Kualitas gaharu yang paling
1.
Super King
30.000.000,rendah berharga sekitar Rp 25.000
Super
20.000.000,per kg, dan pada umumnya
Super AB
15.000.000,2.
Tanggung
10.500.000,digunakan sebagai bahan baku
3.
Kacangan A
7.500.000,penyulingan untuk menghasilkan
Kacangan B
5.000.000,minyak gaharu. Secara visual
Kacangan C
2.500.000,4.
Teri A
1.000.000,beberapa sampel gaharu dapat
Teri B
750.000,dilihat pada Gambar 3.
Teri C
500.000,Berdasarkan Keputusan Kepala
Badan Standarisasi Nasional (BSN)
No. 1386/BSN-I/HK.71/ 09/99, telah
ditetapkan Standar Nasional mutu
gaharu dengan judul dan nomor:
Gaharu SNI 01-5009.1-1999. Dalam

5.

6.

Teri Kulit A
Teri Kulit B
Kemedangan A
Kemedangan B
Kemedangan C
Suloan

300.000,250.000,100.000,75.000,50.000,25.000,-

Sumber: Balai Penelitian dan Pengembangan


Kehutanan Kalimantan, 2006

standar ini diuraikan mengenai


definisi gaharu, lambang dan
singkatan, istilah, spesifikasi,
klasifikasi, cara pemungutan,
syarat mutu, pengambilan contoh,
cara uji, syarat lulus uji dan syarat
penandaan. Klasifikasi mutu
gaharu terdiri dari gubal gaharu,
kemedangan, dan abu gaharu.
Setiap kelas mutu selanjutnya
dibedakan lagi menjadi beberapa
sub kelas berdasarkan ukuran,
warna, kandungan damar wangi,
serat, bobot, dan aroma ketika
dibakar.
Menurut SNI 01-5009.1-1999
yang dimaksud dengan gubal Gambar 1. Sampel gaharu (a)
gaharu adalah kayu yang berasal
kelas tanggung; (b)
kacangan; (c) teri dan
dari pohon atau bagian pohon
(d) kemedangan
penghasil gaharu, dengan aroma
yang kuat, ditandai oleh warnanya yang hitam atau kehitaman
berseling coklat. Kemudian yang dimaksud dengan kemedangan
adalah kayu yang berasal dari pohon atau bagian pohon penghasil
gaharu, memiliki kandungan damar wangi dengan aroma yang
lemah, ditandai oleh warnanya yang putih keabu-abuan sampai
kecoklat-coklatan, berserat kasar dan kayunya yang lunak. Abu
gaharu adalah serbuk kayu sisa pemisahan gaharu dari kayu.
Klasifikasi mutu gaharu menurut Standar Nasional Indonesia dapat
dilihat pada Tabel 4.

10

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Tabel 4. Klasifikasi mutu gaharu menurut Standar Nasional Indonesia

No

Klasifikasi
mutu

Kesetaraan
dengan
standar mutu
di pasaran

Warna

Kandungan damar
wangi

Bau/aroma
(dibakar)

A.

Gubal

1.

Mutu Utama

Super

Hitam merata

Tinggi

Kuat

2.

Mutu I

Super AB

Hitam kecoklatan

Cukup

Kuat

3.

Mutu II

Sabah Super

Hitam kecoklatan

Sedang

Agak kuat

B.

Kemedangan

1.

Mutu I

Tanggung A

Coklat kehitaman

Tinggi

Agak kuat

2.

Mutu II

Sabah I

Coklat bergaris
hitam

Cukup

Agak kuat

3.

Mutu III

Tanggung AB

Coklat bergaris
putih tipis

Sedang

Agak kuat

4.

Mutu IV

Tanggung C

Kecoklatan
bergaris putih
tipis

Sedang

Agak kuat

5.

Mutu V

Kemedangan I

Kecoklatan
bergaris putih
lebar

Sedang

Agak kuat

6.

Mutu VI

Kemedangan
II

Putih keabuabuan garis hitam


tipis

Kurang

Kurang kuat

7.

Mutu VII

Kemedangan
III

Putih keabuabuan

Kurang

Kurang kuat

C.

Abu gaharu

1.

Mutu Utama

Cincangan

Hitam

Tinggi

Kuat

2.

Mutu I

Sedang

Sedang

3.

Mutu II

Kurang

Kurang

TATA NIAGA GAHARU


Proses pemasaran gaharu di berbagai tempat di Indonesia
dimulai dari pemungut gaharu yang menjual gaharu yang
ditemukannya kepada pedagang pengumpul di desa atau di
kecamatan dan selanjutnya oleh pedagang pengumpul dijual ke
pedagang besar (eksportir) di Ibukota Propinsi.

11

Salah satu contoh alur tata niaga gaharu di Kalimantan Timur


dapat diuraikan seperti pada Gambar 2.
Pemungut gaharu terdiri dari pemungut bebas dan pemungut
terikat. Pemungut bebas adalah pemungut gaharu dengan modal
kerja sendiri sehingga bebas di dalam menentukan waktu pencarian
gaharu dan menjual hasil perolehannya, baik kepada pedagang
pengumpul di desa, pedagang pengumpul di kecamatan maupun
langsung kepada pedagang besar (eksportir) di Kota Samarinda.
Pemungut terikat adalah pemungut gaharu yang dimodali sehingga
waktu pencarian dan penjualan hasil perolehannya terikat pada
pemberi modal yaitu pedagang pengumpul yang merupakan
perpanjangan dari pedagang besar.
Pemungut
Bebas

Pedagang
Pengumpul

Pedagang
Besar

Pemungut
Pemungut
Terikat

Pedagang
Perantara

Gambar 2. Contoh alur tata niaga gaharu di Kalimantan dan


Sumatra

Pedagang pengumpul terdiri dari pedagang perantara di desa


yang langsung melakukan pembelian gaharu yang diperoleh para
pemungut. Hasil pembelian dari pedagang perantara ini kemudian
dikumpulkan oleh pedagang pengumpul di kecamatan untuk
selanjutnya dijual kepada pedagang besar karena adanya ikatan
kontrak.
Pedagang besar selain memiliki modal besar juga izin usaha
yang dikeluarkan oleh instansi pemerintah. Pembelian gaharu
dilakukan sepanjang tahun melalui pedagang pengumpul atau
pemungut bebas. Pembelian meningkat bilamana permintaan pasar
terhadap gaharu tinggi, bahkan untuk mendapatkan jumlah yang
diinginkan mereka menanamkan modal yang disalurkan melalui

12

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

pedagang pengumpul ataupun secara langsung kepada pemungut


untuk modal kerja mencari gaharu.
Pemungut
Bebas

Pedagang
Pengumpul
Pedagang
Besar

Pemungut
Pemungut
Terikat

Pedagang
Perantara

Gambar 3. Alur tata niaga Gaharu di daerah (Kalimantan)

PEMASARAN GAHARU
Dalam dunia perdagangan gaharu, baik di Indonesia maupun
di luar negeri, gaharu menjadi komoditi primadona dan memiliki
nilai komersial yang cukup tinggi sehingga banyak diburu oleh
konsumen. Gaharu yang diperdagangkan di Indonesia terdiri dari
tiga jenis, yaitu: gaharu dari Sumatera dan Kalimantan dengan
jenis Aquilaria malaccensis dan A. microcarpa, gaharu dari Papua,
Sulawesi dan Maluku lebih dikenal dengan nama Aquilaria filaria,
sedangkan jenis gaharu Gyrinops lebih banyak diproduksi dari Nusa
Tenggara. Apabila diperhatikan maka perdagangan gaharu hasil
alam di Indonesia dari dulu hingga saat ini lebih banyak bertumpu
pada peyebaran secara ekologis jenis-jenis gaharu tersebut.
Pemasaran gaharu yang merupakan salah satu bentuk
pemanfaatan tumbuhan dan satwa liar diatur berdasarkan Peraturan
Pemerintah Nomor 8 Tahun 1999 dan Konvensi Perdagangan
Internasional tentang jenis flora dan fauna liar yang terancam punah
(CITES). Oleh karena itu maka secara umum pemanfaatan gaharu
harus mengikuti tahapan dan aturan-aturannya, yaitu: penentuan
kuota, pengambilan dari alam atau hasil budidaya (penangkaran),
pengangkutan untuk peredaran dalam negeri dan pengangkutan
untuk pemasaran luar negeri.

13

A. Pemasaran Dalam Negeri


Pemasaran dalam negeri dimulai dari aktivitas pengambilan,
pengangkutan dan peredaran secara domestik produk sampai
akhirnya ke konsumen. Karena perkembangan teknologi, produk
gaharu yang diperdagangkan dalam negeri saat ini tidak saja
terbatas pada chip atau serpihan dengan bermacam-macam kelas,
tapi juga sudah mengarah ke produk turunannya, antara lain:
minyak, sabun, lulur, cream whitening, lotion, makmul, hio, obat
nyamuk, pembersih muka, pemanfaatan untuk obat-obatan dan
aroma terapi. Bahkan saat ini sudah dikembangkan daun jenis
Aquilaria dan Gyrinops untuk bahan pembuatan minuman teh
karena kandungan zat anti oksidan dalam daun yang cukup tinggi.
Beberapa contoh produk dimaksud dapat dilihat pada gambar 3
dan 4 berikut.

Gambar 4. Produk turunan gaharu: sabun transparan, lulur


dan lotion

14

Sirup daun gaharu

Gaharu leaf tea

Gambar 5. Produk sirup dan teh untuk bahan minuman

Dilihat dari pelaku usaha, banyak fihak yang terlibat dalam


perdagangan gaharu, baik sebagai individu (perorangan), kelompok
masyarakat maupun lembaga. Karena jumlah pelaku usaha
pemasaran, misalnya pencari gaharu dan pedagang pengumpul
di bagian hulu (hutan atau desa sekitar hutan) lebih banyak
dibandingkan dengan pedagang menengah dan besar yang
berdomisili di ibukota kabupaten atau propinsi, maka terdapat
kecenderungan untuk saling menekan harga. Oleh karena itu
bentuk pemasaran gaharu di Indonesia lebih cocok dikatakan
sebagai pasar monopsoni, yaitu pasar yang dikuasai oleh pembeli,
baik dalam menentukan harga maupun kualitas gaharu.
Pemasaran gaharu dalam negeri terbentuk karena adanya
hubungan antara daerah pemasok dengan kota/pusat penerima.
Secara tradisional daerah pemasok gaharu untuk kota Surabaya
adalah Kalimantan, Sulawesi, Papua, Maluku, NTT, NTB. Daerahdaerah ini walaupun letaknya di Indonesia bagian timur, namun
karena akses yang mudah memasok gaharu pula ke Jakarta,
ditambah dari daerah Indonesia bagian barat, yaitu sumatera,
termasuk Riau. Di duga banyak gaharu yang di perdagangkan
secara illegal dari sumatera lewat Riau ke Singapura dan Malaysia.

15

Secara garis besar, lalu lintas perdagangan gaharu di dalam


negeri dapat dilihat pada gambar berikut.

Kalimantan

Papua

Sulawesi

Maluku
Riau

Sumatera

Surabaya

Sumatera
Jakarta
NTT
NTB

Gambar 6. Lalu lintas perdagangan gaharu dalam negeri

Beberapa permasalahan yang sering dijumpai di lapangan


antara lain: sulitnya menentukan jenis gaharu, standar dan kualitas
serta harga yang layak sehingga menguntungkan bagi kedua belah
fihak, yaitu konsumen dan produsen.

B. Pemasaran Luar Negeri


Secara fisik, produk gaharu sulit dibedakan berdasarkan asal
jenis tumbuhan dan asal daerahnya. Demikian pula dari sisi warna
dan aroma sangat sulit bagi orang awam atau pedagang pemula
untuk dapat memilah-milahnya. Oleh karena kekhawatiran
salah satu species penghasil gaharu yang mungkin bisa cepat
punah, maka jenis Aquilaria yang ada, yaitu: A. malaccensis, A.
microcarpa, A. filaria dan Gyrinops diatur perdagangannya oleh
konvensi perdagangan internasional yaitu CITES (Convention on
International Trade in Endangered Species of Wild Fauna and
Flora) melalui sistem quota.

Menurut ASGARIN, produk gaharu yang diperdagangkan ke


luar negeri mengikuti selera konsumen. Gaharu dengan kualitas
super (superking, super A dan AB) umumnya dipasarkan ke negaranegara Timur Tengah untuk digunakan sebagai bahan acara ritual
keagamaan, wewangian dan aroma terapi. Untuk gaharu yang
berkualitas menengah ke bawah, ekspor lebih banyak dilakukan
ke negara-negara Asia Selatan untuk digunakan sebagai bahan
baku pembuatan minyak wangi dan untuk acara-acara ritual dalam
bentuk hio, makmul dan lain-lain.
Dalam beberapa tahun terakhir terdapat kecenderungan
pembeli dari Taiwan untuk mengimpor gaharu dari Indonesia
dalam bentuk log. Kayu gaharu yang bentuknya masih gelondongan
dan hanya sedikit mengandung gaharu tersebut digunakan sebagai
hiasan yang dipasang di suatu ruangan dengan diberikan sedikit
sentuan teknologi ukir sehingga terkesan mewah dan mempunyai
nilai seni yang sangat tinggi. Pada gambar 6 berikut, dapat dilihat
beberapa gaharu yang masih dalam bentuk gelondongan yang
siap untuk diekspor. Nilai keseluruhan dari gaharu tersebut tidak
kurang dari Rp 600 juta.

Gambar 7. Gaharu dalam bentuk gelondongan yang siap


dikirim ke Taiwan.

17

Selama 3 (tiga) tahun terakhir jumlah kuota dan realisasi gaharu


yang diekspor sebagaimana dapat dilihat pada tabel berikut.
Tabel 5. Perkembangan kuota dan realisasi ekspor gaharu Indonesia
Tahun

A. Malaccensis

A. filaria

Gyrinops

2007

30.000 (K)
23.709 (R)

76.000 (K)
76.000 (R)

24.000 (K)
8.000 (R)

2008

30.000 (K)
30.000 (R)

65.000 (K)
65.000 (R)

25.000 (K)
25.000 (K)

2009

173.250 (K)
74.890 (R)

455.000(K)
326.882(R)

Tabel diatas memperlihatkan bahwa kuota ekspor gaharu pada


tahun 2007 dari ketiga jenis yang dapat dipenuhi hanya dari jenis
A. filaria, sedangkan untuk A. malaccensis tidak dapat dipenuhi,
dan bahkan untuk Gyrinops realisasi ekspornya hanya mencapai
30% dari kuota yang ditetapkan. Pada tahun 2008, realisasi ekspor
gaharu untuk ketiga jenis dapat terpenuhi 100% dari kuota yang
ditetapkan. Pada tahun 2009, lonjakan kuota yang signifikan
terjadi pada jenis A. malaccensis sebanyak hampir enam kali lipat,
sedangkan pada A. filaria sebanyak tujuh kali lipat. Menurut sebuah
sumber, hal ini terjadi karena ditemukannya potensi baru yang
sebelumnya luput dari inventarisasi, misalnya untuk jenis A. filaria
yang banyak terpendam di rawa-rawa di Papua.
Menurut ASGARIN, pusat perdagangan gaharu dunia yang sangat
penting adalah Singapura dan Riyad (Saudi Arabia). Dua negara ini
pula yang menjadi daerah atau negara tujuan utama ekspor gaharu
dari Indonesia. Singapura selain mendapat pasokan gaharu dari
Indonesia juga dari negara Asia Tenggara, misalnya Vietnam dan
Kamboja. Oleh Singapura gaharu yang masuk dilakukan penyortiran
dan pengemasan dan kemudian di ekspor kembali ke India, China,
Hongkong, Taiwan dan Jepang, dan sebagian lagi ke Timur Tengah.
Sedangkan gaharu yang masuk ke Saudi Arabia di distribusikan
lagi ke negara-negara lain di sekitarnya dan sebagian lagi di ekspor
ke Inggris dan perancis, seperti dapat dilihat pada gambar berikut.

18

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Hongkong
India

Prancis

Malaysia
Taiwan

China

UK

Saudi
Arabia

Kwait
Oman

Japan

Qatar

UAE

SINGAPORE

Indonesia

Bahrain

Iraq
Iran

Middle
East
Riyadh

Afrika

Gambar 8. Lalu lintas perdagangan gaharu luar negeri

REKAYASA PEMBENTUKAN GAHARU


Teknik budidaya perlu dikuasai dengan baik untuk dapat
membudidayakan pohon penghasil gaharu. Teknik budidaya
dimaksud meliputi kegiatan perbanyakan bibit, penanaman,
pemeliharaan, pemberantasan hama dan penyakit hingga tumbuhan
tersebut memiliki volume yang cukup memadai. Rekayasa produksi
gaharu diarahkan untuk pohon-pohon penghasil gaharu hasil
budidaya, sedangkan pohon-pohon penghasil gaharu yang tumbuh
secara alami perlu dikonservasi dan dipelihara dengan baik untuk
dijadikan pohon induk penghasil anakan.
Secara garis besar proses pembentukan gaharu terdiri dari
dua, yaitu secara alami dan buatan, yang dua-duanya berkaitan
dengan proses patologis yang dirangsang oleh adanya luka pada
batang patah cabang atau ranting. Luka tersebut menyebabkan
pohon terinfeksi oleh penyakit (bakteri, virus, jamur) yang diduga
mengubah pentosan atau selulosa menjadi resin atau damar.

19

Semakin lama kinerja penyakit berlangsung, kadar gaharu menjadi


semakin tinggi.
Proses pembentukan gaharu di hutan alam sulit dipantau
dan diamati. Oleh karena itu untuk dapat mengamati secara
langsung proses pembentukan gaharu dilakukan rekayasa dengan
cara inokulasi (penyuntikan) jamur atau cendawan pada pohon
penghasil gaharu. Rekayasa pembentukan gaharu dengan inokulasi
telah dilakukan oleh banyak fihak, dengan teknik induksi yang
bermacam-macam dan jenis jamur yang bervariasi.
Tahapan rekayasa produksi gaharu meliputi banyak kegiatan,
dimulai dari kegiatan laboratorium, kegiatan lapangan dan
kombinasi keduanya. Kegiatan yang berskala laboratorium
dimulai dari kegiatan lapangan, kegiatan di laboratorium dan
kegiatan uji lapangan yaitu:
1.
2.
3.
4.
5.
6.
7.
8.

Eksplorasi, koleksi dan isolasi jamur.


Identifikasi jamur secara molekuler
Penyaringan (screening)
Uji efektivitas
Formulasi media
Produksi inokulan (jamur)
Pembangunan plot demonstrasi untuk ujicoba di lapangan
Observasi dan evaluasi

Alur kegiatan rekayasa produksi gaharu secara garis besar dapat


dilihat sebagaimana gambar berikut:

Gambar 9. Alur kegiatan rekayasa produksi gaharu.

20

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Sampai saat sudah berhasil dikoleksi 23 inokulan (isolat) dari


sebagian besar propinsi di Indonesia. Diantara isolat tersebut empat
isolat sudah diujicoba pada beberapa jenis pohon penghasil gaharu
di beberapa daerah dan memberikan hasil yang cukup bagus. Ke
empat isolat tersebut adalah: isolat dari Kalimantan Barat, Sumatera
Barat, Gorontalo dan Papua. Berdasarkan pengamatan sementara,
beberapa isolat lain yang juga cocok dan memberikan hasil yang
cukup bagus adalah Jambi dan Kalimantan selatan.
Berdasarkan bukti-bukti keberhasilan tersebut, maka secara
resmi ke empat jenis isolat tersebut telah di launching Menteri
Kehutanan (lihat gambar 8) pada Pameran Indo Green yang
berlangsung di Jakarta Convention Center (JCC) pada tahun 1999.
Launching tersebut juga dimaksudkan untuk memberikan akses
kepada publik agar dapat memanfaatkan isolat tersebut untuk
ujicoba produksi gaharu.

Gambar 10. Launching Inokulan Gaharu oleh Menteri


Kehutanan

Dengan adanya launching tersebut maka secara resmi inokulan


prododuksi Puslitbang Hutan dan Konservasi Alam (P3HKA) telah
dilepas di pasaran namun masih terbatas. Keterbatasan tersebut
dimaksudkan hanya kepada masyarakat petani gaharu atau pelaku
usaha gaharu yang telah mendapatkan pelatihan dari P3HKA saja
yang boleh menggunakan inokulan tersebut.

21

Untuk melihat efektivitas pembentukan gaharu, ujicoba ke


enam isolat telah dilaksanakan di 15 (lima belas) lokasi yang
tersebar di beberapa propinsi di Indonesia, yaitu: Bohorok (sumut),
Jambi, Sijunjung dan Padang Pariaman (Sumbar), Bangka, Sumsel,
Sukabumi, Bogor (Jabar), Carita (Banten), Bali, Lombok (NB),
Kalimantan Barat, Kalimantan Selatan, Kalimantan Tengah, Menado
dan Seram. Ujicoba tersebut dilaksanakan di lokasi dengan kondisi
yang berbeda, baik kondisi ekologis, jenis asal isolat dan jenis pohon
penghasil gaharu yang diinokulasi. Penyebaran plot inokulasi dapat
dilihat sebagaimana gamber berikut.

Bioinduction : 15 locations
Gambar 11. Penyebaran plot inokulasi pembentukan gaharu
(gambar bintang warna kuning)

Evaluasi dan pengamatan terus menerus dilakukan, untuk


mengetahui perkembangan inokulasi, baik kegagalan maupun
keberhasilanya. Beberapa faktor penting yang diamati adalah:
kondisi kelembaban dan suhu udara, keterbukaan tajuk, virulensi
inokulan yang digunakan, jarak titik lubang dan lain sebagainya.

22

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Perkembangan hasil inokulasi yang dilaksanakan di salah satu


lplot penelitian yaitu daerah Sukabumi dari waktu ke waktu dapat
dilihat sebagaimana tabel berikut.
Tabel 6. Perkembangan hasil inokulasi menurut waktu

Umur Setelah Inokulasi

Kualitas

3 bulan
6 bulan
9 bulan
1 tahun
2 tahun
3 tahun

Kemedangan
Kemedangan B
Kemedangan A
teri
kacangan
tanggung

Apabila di sejajarkan dengan kualitas gaharu hasil alam yang


ada di pasaran dalam negeri, maka hasil gaharu yang dipanen
setelah 3 bulan inokulasi memiliki kualitas kemedangan, dan terus
meningkat menjadi kelas teri setelah 1 tahun. Kualitas gaharu
tersebut terus meningkat menjadi kacangan setelah 2 tahun
inokulasi dan secara signifikan meningkat menjadi tanggung pada
3 tahun setelah inokulasi. Pada saat ini pohon yang ditebang secara
bertahap tersebut masih hidup dan masih tumbuh baik di lapangan.
Menurut rencana pada tahun 2011 akan dilakukan pemanen lagi
untuk melihat perkembangan kualitas gaharu, dengan harapan
bahwa gaharu yang akan dipanen tersebut akan mempunyai
kualitas` yang lebih bagus lagi dari sebelumnya.
Contoh gaharu hasil panen yang dilakukan secara bertahap
adalah sebagai berikut.

23

Gambar 12. Gaharu hasil panen 3 bulan setelah penyuntikan,


dengan kualitas kemedangan C.

Gambar 13. Gaharu hasil panen 9 bulan setelah penyuntikan


(inokulasi) dengan kualitas kemedangan A.

24

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Grade Kemedangan (US $ 100/kg)

Gambar 14. Gaharu hasil panen satu tahun setelah


penyuntikan dengan kualitas teri

Grade Gubah AB (US $ 200-250/kg)

Gambar 15. Gaharu hasil panen dua tahun setelah


penyuntikan dengan kualitas kacangan

25

> US $ 800

Gambar 16. Gaharu hasil panen 3 (tiga) tahun setelah


penyuntikan dengan kualitas tanggung

Berdasarkan survey pasar, referensi harga gaharu hasil alam


di pasaran dalam negeri dan penawaran dari pedagang gaharu
dari Riyad (gambar sudut kanan atas), estimasi harga gaharu hasil
panen dari plot penelitian P3HKA dapat dilihat sebagai mana tabel
berikut.
Tabel 7. Harga gaharu yang cenderung meningkat dengan semakin
tertundanya waktu panen.
Umur Setelah Inokulasi

26

Harga (Rp)

3 bulan

50.000

6 bulan

200.000

9 bulan

750.000

1 tahun

1.000.000

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

Umur Setelah Inokulasi

Harga (Rp)

2 tahun

2.500.000

3 tahun

US$ 800 atau 7.500.000

4 tahun

Hubungan antara kualitas gaharu, waktu penundaan panen


dan harga di pasaran sangan erat sekali. Semakin lama proses
pembentukan gaharu di pohon maka akan semakin meningkat
kualitas gaharu yang akan dihasilkan dan dengan sendirinya akan
meningkatkan harga gaharu tersebut. Grafik hubungan antara
terbentuknya gaharu dengan waktu dapat dilihat pada grafik
sebagai berikut.

Hasil
rekayasa

Kualitas

Super

Hasil alam 1

Tanggung

Hasil alam 2

Kacangan

Hasil alam 3

Teri

Hasil alam 4

Kemedangan

10

Tahun

Gambar 17. Grafik hubungan antara terbentuknya gaharu


dengan waktu penundaan panen.

Berdasarkan pemeriksaan laboratorium, gaharu hasil panen


9 bulan setelah penyuntikan mengandung zat aktif yang cukup

27

banyak, setidaknya terdapat 12 (dua belas) komponen kimia


sebagaimana dapat dilihat pada gambar berikut.

Azulene

= komponen minyak esensial tanaman,


wangi & warna biru

Benzylacetone = wangi manis bunga, komponen volatile dan kokoa


Dumasin = wangi mint, memiliki sifat pestisida
Cadinene = konstituen minyak esensial berbagai tanaman
Limonene = terpen aroma bunga & buah, insektisida botani,
bahan kosemtik

Komponen
Kimia

Isolongifolen = bahan odorant & parfum


Indole = wangi bunga & parfum,konsituen utama dalam minyak melati
Maltol

= wangi caramel (manis), penguat rasa/aroma pada roti &kue

Ketoisophorone = wangi manis campuran kayu, teh dan daun tembakau


Valerolactone = wangi herbal
Ambrox = odorant tipe amber, anti inflamantory
Ambrettolide = wangi musk, manis buah & bunga

Tahun

Gambar 18. Kandungan kimia yang terdapat pada gaharu


hasil rekayasa.

Pemeriksaan kandungan kimia pada gaharu hasil alam


menunjukkan hasil yang sama dengan gaharu hasil rekayasa jika
dua-duanya diambil dari kualitas yang sama.

28

Perkembangan Pemanfaatan Gaharu ..... (Sulistyo A. Siran)

PENUTUP
Dengan ditemukannya teknologi inokulasi pembentukan
gaharu, terbukalah peluang yang besar untuk kegiatan pengusahaan
gaharu yang dimulai dari subsistem hulu (penyiapan lahan,
penyiapan bibit, penanaman, penyediaan pupuk, pemberantasan
hama dan penyakit), subsistem tengah (penyuntikan, penyediaan
inokulan, peralatan inokulasi, dan pengamanan), subsistem hilir
(pemanenan, pengangkutan, pengolahan, pemasaran), subsistem
pendukung (kebijakan pemerintah, riset dan pengembangan,
pendidikan dan pelatihan, tranportasi, infrastruktur, skema kredit
dan asuransi).
Ketiga subsistem tersebut di atas memerlukan investasi yang
cukup besar, peluang penyerapan tenaga kerja yang besar dan
penerimaan asli daerah yang cukup signifikan.
Untuk dapat mewujudkan kondisi dan harapan tersebut, maka
seluruh sektor harus memainkan peran sesuai dengan tugas pokok
dan fungsinya masing-masing. Hanya dengan koordinasi dan
integrasi yang baik di antara seluruh komponen masyarakat dan
pemerintah, maka produk gaharu akan menjadi produk andalan
dimasa depan.

29

30

STATUS RISET GAHARU

31

32

Aspek PRODUKSI

33

PENGEMBANGAN GAHARU
DI SUMATERA
Mucharromah
Fakultas Pertanian Jurusan Perlindungan Tanaman
Universitas Bengkulu

PENDAHULUAN
Gaharu merupakan produk kehutanan yang memiliki nilai
ekonomi sangat tinggi dibanding produk kehutanan lainnya,
sehingga sangat potensial untuk dikembangkan. Pengembangan
gaharu ini perlu dilakukan, khususnya untuk menjaga
kesinambungan produksi, sekaligus untuk melindungi ragam pohon
penghasil gaharu yang ada di Indonesia. Dalam pengembangan
gaharu, masyarakat di sekitar hutan merupakan sasaran ideal yang
dapat melipatgandakan peran dan fungsi program tersebut. Dari
segi keberadaan material bibitnya lokasi sekitar hutan memiliki
jumlah tegakan gaharu alam terbanyak, mengingat buah pohon
ini bersifat rekalsitran, sehingga tidak menyebar jauh, kecuali
dengan campur tangan manusia. Dari segi kesiapan masyarakat,
pada umumnya masyarakat yang tinggal di sekitar hutan sudah
mengenal gaharu, sebagian bahkan pernah menjadi pengumpul,
sehingga pemahaman dan keterampilannya untuk mendukung
pengembangan cluster industri gaharu telah sangat memadai.
Dari aspek keamanan lingkungan dan keragaman hayati,
pengembangan gaharu di sekitar hutan juga akan membantu
pengamanan keragaman hayati dan kelestarian hutan, mengingat
35

Aspek PRODUKSI

masyarakat sudah dapat memperoleh penghasilan dari usaha


pengembangan gaharu yang sangat prospektif secara ekonomi.
Selain itu, mengingat pohon penghasil gaharu memiliki morfologi
yang sangat mendukung perannya sebagai penjaga lingkungan,
yaitu meningkatkan kapasitas absorbsi dan retensi air tanah,
menguatkan tanah, sehingga tidak mudah longsor serta menyerap
CO2 dan menghasilkan O2 yang sangat penting dalam mendukung
kehidupan.
Dengan demikian, pengembangan gaharu di wilayah sekitar hutan
akan memperkuat fungsi hutan tersebut, di samping pemberdayaan
dan pemakmuran masyarakat di sekitar wilayah hutan. Dengan
nilai ekonomi gaharu yang sangat tinggi dan permintaan pasar
dunia yang terus meningkat, maka pengembangan gaharu sangat
berpotensi mensejahterakan masyarakat, bangsa, dan negara di
samping menghindarkan dari bahaya bencana alam kekeringan,
kekurangan air bersih, longsor, paningkatan temperatur udara,
polusi, dan kekurangan oksigen. Namun demikian, pengembangan
gaharu tidak sama dengan pengembangan tanaman pertanian
yang dapat langsung menghasilkan. Pada pohon penghasil gaharu,
produksi gaharu justru tidak akan terjadi bila pohonnya tumbuh
sangat baik dan tidak terganggu sedikit pun. Oleh karenanya,
pengembangan produksi gaharu tidak cukup hanya dilakukan
dengan penanaman bibit pohon penghasilnya saja, tetapi juga
perlu didukung dengan pengembangan teknik produksi dan
pengembangan sistem yang akan mendukung pengembangan
produksi, khususnya yang berkaitan dengan pendanaan proses
produksi yang memerlukan dana cukup besar.
Sejauh ini produksi gaharu Indonesia masih banyak diambil
dari alam sehingga disebut sebagai gaharu alam. Gaharu alam
telah dikenal sejak ribuan tahun lalu diperdagangkan ke Timur
Tengah oleh para pedagang India dan Indo-China, termasuk dari
wilayah barat Indonesia atau Sumatera dan dihargai sangat mahal,
khususnya yang memiliki kualitas super dan di atasnya. Gaharu
kualitas super sudah mengeluarkan aroma harum meski tanpa
dipanasi atau dibakar. Bentuk gaharu super sangat beragam, dengan
tekstur yang sangat keras dan halus tidak berserat, berwarna hitam
mengkilat dan berat hingga tenggelam dalam air. Sementara gaharu

36

Pengembangan Gaharu di ..... (Mucharromah)

yang memiliki kualitas lebih rendah (kemedangan dan abuk)


disuling untuk diambil resinnya dan ampasnya dibuat makmul
atau hio untuk ritual keagamaan. Dengan makin meningkatnya
permintaan pasar internasional, maka volume perdagangan gaharu
makin meningkat, sehingga keberadaan pohon penghasil gaharu
juga makin terancam akibat banyak yang ditebangi dan dicacah
masyarakat untuk diambil gaharunya. Kondisi ini tak akan dapat
diatasi kecuali dengan melakukan pengembangan gaharu secara
besar-besaran, khususnya di area yang paling potensial yaitu wilayah
sekitar hutan. Dengan upaya ini, maka produksi gaharu Indonesia
akan tetap melimpah dan masyarakat yang memproduksinya juga
makin makmur dan sejahtera, sehingga lebih mampu menjaga
keamanan lingkungan dan keragaman sumberdaya alam di
sekitarnya.

KESIAPAN PENGEMBANGAN GAHARU


A. Kesiapan SDM Pendukung Proses Produksi
Meskipun gaharu sudah sangat lama menjadi salah satu
komoditi ekspor Indonesia, namun banyak masyarakat umum yang
tidak mengetahui apa yang disebut gaharu, kecuali masyarakat di
sekitar wilayah hutan yang sudah pernah terlibat dalam pencarian,
pembersihan, dan perdagangan gaharu. Karenanya mereka
merupakan kelompok sasaran yang sudah siap menjadi SDM
untuk pengembangan gaharu, khususnya pada proses pasca panen,
pembersihan gaharu dari sisa kayu putihnya. Proses ini sangat
lambat, hampir seperti seni memahat, sehingga membutuhkan
banyak tenaga kerja terampil. Dengan pengalaman mencari gaharu
alam yang sudah cukup lama, banyak masyarakat di sekitar hutan
yang terampil membersihkan gaharu sehingga cukup siap untuk
mendukung pengembangan gaharu di daerahnya.

B. Kesiapan Teknologi Produksi


Berbeda dengan produk pepohonan lainnya yang selalu
dihasilkan selama tanaman tumbuh sehat atau dengan kata lain

37

Aspek PRODUKSI

produksi merupakan fungsi dari pertumbuhan tanaman sehat,


gaharu justru tidak akan didapat pada pohon yang tumbuh sehat
tanpa ada gangguan apapun. Kebanyakan gaharu justru ditemukan
pada pohon yang terganggu, baik secara alami oleh faktor abiotik
maupun biotik ataupun telah diinduksi oleh manusia. Faktor abiotik
dapat berupa angin atau hujan angin dan petir. Namun kejadian
pembentukan gaharu oleh faktor abiotik dari alam ini sulit ditiru
sehingga tidak dapat dijadikan dasar pada proses produksi dalam
bentuk industri.
Sementara pembentukan gaharu oleh faktor biotik dapat
disebabkan oleh infeksi jasad renik terhadap tanaman, selain akibat
gesekan hewan dan perilaku manusia yang tidak direncanakan.
Temuan tentang adanya jenis jasad renik yang dapat menginduksi
terjadinya akumulasi resin wangi yang selanjutnya membentuk
gaharu inilah yang mendasari adanya temuan tentang teknik induksi
pembentukan gaharu yang dapat digunakan untuk mendukung
proses produksi gaharu dalam skala industri. Beberapa kelompok
peneliti telah mampu melakukan inokulasi yang merangsang
pembentukan gaharu (Mucharromah et al., 2008a,b,c,d; Santoso et al.,
2006, 2008; Kadir, 2009). Namun mengingat teknik yang diterapkan
belum biasa dilakukan masyarakat, maka untuk persiapan
pelaksanaannya dalam proses produksi dibutuhkan pelatihanpelatihan, baik pelatihan teknik inokulasi maupun pelatihan teknik
monitoring pembentukan gaharu. Selain itu juga perlu dilakukan
teknik pelatihan produksi inokulan sehingga proses produksi
dapat berlangsung lebih efisien. Dengan dukungan operasional,
maka teknik produksi inokulan dan induksi pembentukan gaharu
dengan inokulasi telah siap untuk dilatihkan kepada masyarakat
guna mendukung pengembangan produksi gaharu melalui
pemberdayaan masyarakat di sekitar wilayah hutan.

C. Kesiapan Kontrol Kualitas Produk


Untuk keberhasilan dan kesinambungan suatu proses produksi
umumnya selalu dilakukan monitoring kualitas produk. Untuk
itu penyiapan SDM pendukung pengembangan gaharu juga
perlu mempersiapkan personil yang mampu mengenali kualitas

38

dan mensortasi atau mengumpulkan gaharu yang dihasilkan


berdasarkan gradasi kualitas dan kegunaannya. Dari segi
bentuknya, gaharu merupakan jaringan kayu dari pohon jenis
tertentu (penghasil gaharu) dengan kandungan resin sesuiterpenoid
volatil beraroma harum gaharu yang cukup tinggi. Adanya aroma
harum yang khas dan tahan lama inilah yang membuat gaharu
sangat disukai dan dihargai dengan nilai ekonomi yang sangat
tinggi. Selain itu jaringan yang mengandung resin wangi gaharu
juga hanya didapati pada bagian pohon yang mengalami proses
tertentu, seperti pelukaan yang disertai infeksi patogen melalui
inokulasi atau proses lainnya, yang selanjutnya membuat jaringan
kayu tersebut memiliki warna, aroma, tekstur, dan tingkat kekerasan
dan berat jenis berbeda. Hal ini membuat gaharu menjadi makin
mahal dan nilainya sangat ditentukan oleh kualitas kadar dan
kemurnian resin yang dikandungnya.
Pada gaharu alam gradasi kualitas ditentukan berdasarkan
standar mutu yang telah ditetapkan secara nasional dalam SNI 015009.1-1999. Dalam standar ini kualitas gaharu dibedakan menjadi
tiga sortimen, yaitu gubal gaharu, kemedangan, dan abu gaharu.
Ketiga sortimen tersebut dibagi lagi dalam 13 kelas kualitas, yang
terdiri dari:
1. Gubal gaharu, dengan 3 tanda mutu, yaitu:
a. mutu utama = mutu super
b. mutu pertama = mutu AB
c. mutu kedua = mutu sabah super
2. Kemedangan, dengan 7 kelas mutu, yaitu:
a. mutu pertama = mutu TGA/TK1
b. mutu TGB/TK2
c. mutu TGC/TK3
d. mutu TGD/TK4
e. mutu TGE/TK5
f. mutu TGF/TK6
g. mutu ketujuh = setara dengan M3
3. Abu gaharu yang terbagi dalam 3 kelas mutu, yaitu:
a. mutu utama
b. mutu pertama

39

Aspek PRODUKSI

c. mutu kedua.
Namun pembedaan kelas kualitas tersebut secara detil
sangat sulit dilakukan sehingga pada prakteknya hingga saat ini
konsumenlah yang menentukan tingkat mutu produk dan harga
gaharu. Hal ini merupakan anomali dari kondisi perdagangan
komoditi lainnya, di mana pemilik barang merupakan penentu
harga. Namun dengan tingkat keahlian sortasi, standar kualitas
gaharu dan harganya akan lebih terjamin. Untuk itu pelatihan SDM
dalam teknik monitoring perkembangan pembentukan gaharu dan
kontrol kualitasnya sangat penting dilakukan.
Saat ini sudah cukup banyak pohon penghasil gaharu yang telah
diinokulasi, khususnya dari jenis Aquilaria dan Gyrinops. Teknik
inokulasi untuk induksi pembentukan gaharu juga telah makin
efisien dan murah. Pada hasil uji lanjut teknik produksi gaharu
yang dilakukan beberapa bulan lalu di Provinsi Bengkulu, proses
pembentukan gaharu telah semakin cepat terjadi. Pada 6 bulan
setelah inokulasi telah dicapai produk kualitas kemedangan TGB
dan TGA, yang biasanya baru dapat dicapai pada 12-18 bulan setelah
inokulasi, meskipun sebagian besar masih berada pada mutu TGC
(Mucharromah et al., 2008).
Perkembangan keberhasilan teknik inokulasi ini sangat
prospektif untuk mendukung pengembangan produksi gaharu yang
pohon penghasilnya telah mulai banyak dibudidayakan di Sumatera
dan wilayah lain di Indonesia. Dengan demikian pengembangan
gaharu siap dilaksanakan, tidak hanya di sekitar wilayah hutan
tetapi bahkan hingga ke halaman rumah dan perkantoran serta
sekolah, seperti yang telah dilakukan di Kota Bengkulu dan
sekitarnya. Namun pengembangan gaharu di sekitar wilayah
hutan kemungkinan akan jauh lebih efisien proses produksinya, di
samping lebih besar manfaatnya bagi pengamanan lingkungan dan
pemberdayaan serta pemakmuran masyarakat.

D. Kesiapan Modal dan Kelembagaan


Indonesia merupakan negara yang sangat kaya dengan
beragam jenis pohon penghasil gaharu. Hal ini menjadi modal
utama yang membuat proses produksi gaharu menjadi jauh lebih

40

Pengembangan Gaharu di ..... (Mucharromah)

mudah dan murah. Saat ini pembentukan gaharu di alam telah


dilaporkan terjadi pada sedikitnya 16 jenis pohon dari beberapa
genus famili Thymelaceae, satu famili Leguminoceae, dan satu famili
Euphorbiaceae (Wiriadinata, 2008 dan Sumarna, 2002).
Di alam tidak semua pohon penghasil gaharu membentuk
gaharu atau hanya sedikit sekali menghasilkan gaharu. Jumlah
gaharu yang dihasilkan per pohon di hutan alam sangat bervariasi
dari 0,3 hingga 14 kg dan umumnya semakin banyak dengan
makin besarnya diameter pohon (MacMahon, 1998). Selain itu,
tidak semua pohon menghasilkan gaharu. Hal ini membuat proses
produksi gaharu alam menjadi kian mahal. Pada gaharu budidaya,
proses produksi gaharu sangat ditentukan kuantitasnya oleh jumlah
lubang atau luka yang diinokulasi dan kualitasnya tergantung
dengan lamanya waktu sejak inokulasi hingga panen. Semakin lama
maka semakin banyak resin wangi yang terakumulasi dan semakin
tinggi kualitas gaharu yang dihasilkan. Dengan demikian, maka
pengembangan gaharu hasil budidaya dan inokulasi dapat jauh
lebih efisien dibandingkan produksi yang mengandalkan gaharu
bentukan alam.
Namun demikian pengembangan gaharu tetap memerlukan
dukungan dana yang relatif besar meskipun rasio keuntungannya
terhadap modal juga cukup besar, sebagaimana disajikan pada
analisis usaha inokulasi gaharu (Lampiran 1) dan analisis budidaya
gaharu (Lampiran 2). Berdasarkan hasil analisis tersebut maka
pengembangan gaharu paling efisien bila dilakukan di area sekitar
hutan yang masih kaya dengan tegakan gaharu berdiameter >
20 cm yang dapat diinokulasi untuk mempercepat produksi dan
menambah modal awal untuk penanaman pada area yang lebih
luas untuk kesinambungan usaha pengembangan gaharu. Selain
itu juga diperlukan adanya kerjasama dan komitmen semua pihak
untuk membantu mengawali usaha ini berdasarkan expertise dan
bidang pekerjaannya.
Sejauh ini keberadaan pohon penghasil gaharu di lapangan
telah banyak membantu pelaksanaan uji efektivitas inokulasi, uji
produksi, pelatihan inokulasi, pelatihan monitoring pembentukan
gaharu serta upaya produksi gaharu hasil inokulasi. Namun dari

41

Aspek PRODUKSI

segi kualitas, gaharu hasil inokulasi hingga kini belum dapat


mencapai kualitas tertinggi gaharu alam, yaitu super, double super,
dan lebih tinggi. Terbentuknya gaharu kualitas super atau yang
sering disebut gubal super ini kemungkinan akan dapat dicapai
seiring dengan pengembangan penelitian inokulan unggul yang
terus dilakukan. Secara teoritis keunggulan inokulan dalam
menginduksi pembentukan gaharu berkaitan dengan jenis dan
kemurnian mikroorganisme yang digunakan, sebagaimana
ditunjukkan oleh data mikroskopis perkembangan deposisi resin
gaharu pada area jaringan sekitar lubang yang diinokulasi atau
hanya dilukai (Mucharromah dan Marantika, 2009).
Sementara kehadiran jenis cendawan lainnya, khususnya
cendawan pelapuk kayu, justru mendegradasi kembali resin gaharu
yang sudah dideposisi bahkan hingga menghancurkan selnya
sehingga gaharu yang sudah mulai terbentuk menjadi hancur dan
lapuk minimal sebagian dan kualitas gaharu yang dihasilkan akan
menurun. Dengan demikian, maka penggunaan inokulan unggul
dan teknik inokulasi yang meminimalkan kontaminasi akan dapat
meningkatkan kualitas gaharu yang dihasilkan dan mengefisienkan
proses produksi hingga dapat dilaksanakan dengan modal lebih
rendah.
Pada gaharu kualitas gubal, akumulasi resin wangi terjadi
maksimal hingga luber dan menutupi sel-sel di sekitarnya.
Akibatnya jaringan kayu tersebut menjadi halus seperti dilapisi
agar dan berwarna coklat kemerahan atau kehitaman, tergantung
intensitas atau kadar resin gaharu yang dikandungnya. Bila kualitas
seperti ini dapat dihasilkan dari inokulasi pohon pada awal proses
pengembangan, maka produksi gaharu selanjutnya tidak banyak
memerlukan bantuan modal lagi, karena kualitas seperti gaharu
alam tersebut bernilai sangat tinggi, yaitu USD 2.000 hingga 16.000
per kg di tingkat end-consumer di luar negeri, sehingga mampu
menutupi pembiayaan untuk pengembangan selanjutnya.
Saat ini kualitas gaharu hasil inokulasi sudah jauh lebih baik
dan pada beberapa hasil penelitian sudah mendekati mutu gubal
kualitas kemedangan B/C (Santoso, 2008; Mucharromah dan
Surya, 2006) atau bahkan B (Surya, 2008 - komunikasi pribadi;

42

Pengembangan Gaharu di ..... (Mucharromah)

Mucharromah et al., 2008). Dengan teknik inokulasi dan jenis isolat


yang lebih murni dan potensial serta waktu antara inokulasi dan
panen yang lebih panjang, maka kualitas gubal super mungkin akan
dapat dicapai.
Selain karena kandungan resinnya yang jauh lebih tinggi, aroma
resin gaharu juga sangat menentukan kualitas. Sejauh ini aroma
gaharu alam lebih lembut dibanding hasil inokulasi, kemungkinan
karena kemurnian resin yang dikandungnya. Pada pengamatan
mikroskopis (Mucharromah dan Marantika, 2009) menunjukkan
bahwa pada jaringan yang terkontaminasi resin gaharu yang
awalnya berwarna coklat bening kemerahan berubah menjadi
berwarna kehitaman dan menghilang sebelum akhirnya selnya
menjadi hancur. Oleh karena itu dalam proses produksi gaharu
dengan inokulasi perlu diterapkan prinsip-prinsip aseptik yang
akan membatasi peluang terjadinya kontaminasi (Mucharromah
et al., 2008).
Selain itu kekhasan aroma gaharu juga dipengaruhi oleh jenis
pohon penghasilnya dan kemungkinan juga jenis mikro organisme
inokulannya, sehingga aroma gubal gaharu kualitas terbaik dari
berbagai wilayah dapat berbeda (Mucharromah et al., 2007). Jenisjenis pohon penghasil gaharu dari spesies Aquilaria malaccensis, A.
beccariana, A. microcarpa, A. hirta, dan A. agallocha yang banyak
dijumpai di Sumatera, dikenal menghasilkan gaharu yang disukai
konsumen mancanegara sejak jaman dahulu. Oleh karenanya
pengembangan gaharu di wilayah sekitar hutan dengan cara
memperbanyak pohon-pohon jenis Aquilaria yang ada di lokasi
tersebut dan menginokulasi pohon yang sudah tua untuk membiayai
peremajaannya akan dapat mengembalikan potensi produksi
gaharu yang dahulu dimiliki Sumatera dan wilayah Indonesia
lainnya.

MODEL PENGEMBANGAN GAHARU DI SUMATERA


Secara teoritis akumulasi resin wangi gaharu telah dilaporkan
distimulasi oleh infeksi cendawan dari jenis tertentu (Mucharromah
dan Surya, 2006, 2008a,b,c; Santoso et al., 2006; Sumarna, 2002).

43

Aspek PRODUKSI

Kemampuan cendawan inokulan dalam menstimulir produksi resin


juga sangat terkait dengan tingkat akumulasi resin yang merupakan
hasil netto dari proses sintesis dikurangi dengan degradasinya
serta jenis resin dan kemurniannya (Agrios, 2005; Langenhein,
2004; Mucharromah, 2004). Dengan demikian maka penggunaan
jenis inokulan tertentu dan kemurniannya serta penerapan teknik
aseptik dalam penyiapan dan aplikasi inokulan, ketepatan teknik
inokulasi, dan keterampilan pekerja akan sangat mempengaruhi
proses produksi dan kualitas produk. Oleh karenanya di
Bengkulu pengembangan gaharu diawali dengan pengujian
efektivitas berbagai isolat cendawan yang berpotensi menginduksi
pembentukan gaharu dan diikuti dengan pengembangan inokulan
unggul yang masih terus dilakukan untuk peningkatan kualitas.
Selain itu, setelah didapat inokulan efektif dan hasil inokulasi
yang cukup menjanjikan, maka kepada masyarakat pemilik tegakan
gaharu yang diameternya telah mencapai > 20 cm ditawarkan
kerjasama pengembangan gaharu dengan penanaman kembali dan
inokulasi. Kerjasama ini meliputi pemeliharaan dan penanaman
kembali anakan alam yang ada di sekitar tegakan induk hingga
mencapai populasi minimal 10-100 batang tanaman muda per
pohon induk diinokulasi untuk produksi gaharu. Sejauh ini telah
dilakukan pengembangan gaharu sebanyak > 10.000 batang yang
ditanam di sekitar pohon induk yang diinokulasi. Namun kerjasama
ini masih membutuhkan cukup banyak modal untuk menjadi
usaha pengembangan gaharu yang mandiri, karena masih harus
melakukan panen dan proses pembersihan gaharu yang bersifat
padat karya. Meskipun gaharu yang dipanen akan menghasilkan
produk yang dapat dijual, namun untuk pelaksanaan proses panen
dan pembersihan tersebut diperlukan modal yang cukup besar. Oleh
karenanya pengembangan gaharu tidak dapat dilakukan secara
mandiri, khususnya pada masyarakat yang tidak memiliki modal
dan hanya mengandalkan sumberdaya alam dan keterampilan.
Oleh karenanya campur tangan pemerintah sangat diharapkan.
Sebagaimana diuraikan sebelumnya, pengembangan gaharu
memerlukan modal yang cukup besar karena prosesnya cukup
kompleks. Pertama, anakan alam atau bibit harus ditanam dan
dipelihara. Selanjutnya pohon yang sudah cukup besar (diameter >

44

Pengembangan Gaharu di ..... (Mucharromah)

20 cm) perlu diinduksi dengan inokulasi jasad renik atau perlakuan


lainnya agar membentuk gaharu. Proses induksi pembentukan
gaharu dilakukan dengan memberikan inokulan pada sejumlah
besar lubang yang dibuat spiral dengan jarak 7-10 cm horisontal
dan 12-20 cm vertikal dari pangkal batang hingga ujung pucuk
yang masih bisa dipanjat. Proses inokulasi ini selain memerlukan
keterampilan, juga keberanian dan ketersediaan personil dengan
kondisi fisik yang mendukung pelaksanaan pekerjaan. Selanjutnya
pohon yang telah diinokulasi dimonitor hingga waktu panen.
Setelah dipanen secara total, dilakukan proses pembersihan
untuk memisahkan gaharu dari jaringan kayu yang lebih sedikit
kandungan resin wanginya. Proses ini dilakukan secara manual
dengan melibatkan sejumlah besar tenaga kerja.
Pada gaharu hasil inokulasi, untuk membersihkan 1 kg
gaharu umumnya diperlukan 4-5 orang hari kerja, sehingga untuk
menghasilkan gaharu sebanyak 270 ton sebagaimana jumlah yang
diekspor pada tahun 2000-an akan mampu menyerap tenaga kerja
sebanyak 56.000-68.000 orang/hari. Jumlah ini cukup besar dan
akan mampu mempekerjakan masyarakat sekitar hutan sebanyak
280 hingga 340 orang/tahun dengan 200 hari kerja/tahun. Dengan
peningkatan permintaan dan kapasitas produksi, maka jumlah
tenaga kerja yang dikaryakan juga akan semakin meningkat. Dari
segi jumlah tenaga kerja yang menangani proses pembersihan
produk ini kemungkinan tidak banyak berbeda antara produksi
gaharu alam dengan gaharu budidaya, tetapi dari segi keamanan
pekerja dan lingkungan, pengembangan gaharu hasil budidaya dan
inokulasi makin lama makin memberikan keuntungan melimpah
dan makin sustainable, sementara gaharu alam akan makin habis,
sehingga tidak berkelanjutan. Oleh karenanya pengembangan
gaharu harus dilakukan secara serius, sehingga upaya-upaya yang
dilakukan akan memberi hasil yang berkelanjutan.
Selain itu, mengingat proses produksi gaharu jauh lebih rumit
dibandingkan proses produksi komoditi hasil hutan dan perkebunan
atau pertanian lainnya, maka perlu ada suatu kelembagaan yang
bertugas untuk membantu penyiapan dan pelaksanaan proses
produksinya hingga berhasil berkembang menjadi industri gaharu
yang mandiri. Kelembagaan tersebut dapat sangat sederhana

45

Aspek PRODUKSI

bila pengembangan gaharu dapat diberlakukan seperti komoditi


pertanian atau perkebunan hasil budidaya. Namun bila perdagangan
gaharu masih diatur oleh kuota yang dalam proses perdagangannya
melibatkan banyak pihak, maka pengembangan gaharu perlu
dilakukan dengan melibatkan berbagai pihak yang terkait dengan
perdagangannya, tidak hanya dengan pihak yang dapat membantu
pengembangannya.
Dalam pelaksanaannya, pelibatan banyak pihak ini bila tidak
dipayungi dengan deskripsi tugas yang mendetil dan tidak saling
tumpang-tindih, justru akan dapat menghambat pengembangan
gaharu yang dituju. Sejauh ini pengembangan gaharu yang
dilakukan di Provinsi Bengkulu, baik oleh pihak swasta maupun
perguruan tinggi dan kelompok masyarakat, dibuat secara sangat
sederhana dengan kontrak kerjasama antara pemilik pohon/lahan
dengan pelaksana yaitu perguruan tinggi, swasta atau kelompok
masyarakat. Mengingat pohon yang diinokulasi atau bibit yang
ditanam berada di lahan pribadi, baik halaman maupun kebun,
maka proses pengembangan gaharu yang telah dilakukan sejauh
ini berjalan aman. Hal ini dikarenakan upaya pengembangan yang
dilakukan masih belum mencapai tahap produksi gaharu yang
siap diperdagangkan. Bila sudah mencapai tahap produksi, maka
dengan adanya aturan kuota, penjualan gaharu hingga kini masih
memerlukan adanya sertifikasi jumlah untuk memastikan bahwa
batas kuota belum terlewati, sehingga cukup menyulitkan meskipun
prosesnya sederhana. Hal ini mungkin perlu disederhanakan dalam
upaya pengembangan gaharu yang dilakukan, mengingat wilayah
sekitar hutan yang menjadi area pengembangan gaharu umumnya
cukup jauh dari lokasi institusi yang mensertifikasi produknya.
Dalam hal pengembangan gaharu, perguruan tinggi dapat
memainkan peran yang dapat menguntungkan semua pihak. Dalam
hal ini peran perguruan tinggi yang mengembangkan penelitian
gaharu dapat dilakukan dalam bentuk pembinaan kelompok
produksi gaharu di sekitar wilayah hutan serta penelitian untuk
pemutakhiran teknik produksi, pengembangan inokulan unggul
untuk peningkatan mutu serta pengembangan teknik pengawasan
kualitas produk. Peran tersebut dapat dilakukan melalui kegiatan
penelitian dan pengabdian pada masyarakat yang sudah secara

46

Pengembangan Gaharu di ..... (Mucharromah)

rutin dilakukan perguruan tinggi dengan dukungan pendanaan


dari instansi pemerintah maupun swasta.

PENUTUP
1. Pengembangan gaharu merupakan suatu program yang sangat
besar, tidak hanya karena menghasilkan produk bernilai
ekonomi yang sangat tinggi, yang berpotensi sangat besar untuk
pemberdayaan masyarakat di sekitar wilayah hutan, tetapi juga
karena upaya ini memerlukan investasi teknologi dan modal
yang cukup besar bagi keberhasilannya. Oleh karenanya
pengembangan gaharu perlu dilaksanakan dengan perencanaan
yang sangat matang dari setiap tahapan prosesnya sehingga
dapat berjalan dan meningkatkan kemandirian masyarakat
di wilayah sekitar hutan. Hal ini sangat penting dilakukan,
tidak hanya untuk menjamin peningkatan dan kesinambungan
produksi gaharu, tetapi juga untuk melindungi hutan dan
keragaman hayati yang ada di sekitarnya serta meningkatkan
kapasitas hutan dalam menanggulangi potensi bahaya bencana
alam yang disebabkan oleh longsor, banjir, kekeringan, polusi,
dan beragam kerusakan lingkungan lainnya.
2. Untuk lebih mengefisienkan proses produksi dan menekan
pembiayaan maka program pengembangan gaharu perlu
dilakukan dengan mengadopsi model yang paling efisien
dan praktis, sehingga keberhasilannya akan lebih terjamin.
Hal ini sangat penting untuk diperhatikan mengingat proses
pembentukan gaharu tidak berjalan secara otomatis pada
tanaman yang tumbuh sehat, sebagaimana produk pertanian
atau perkebunan dan kehutanan lainnya.

DAFTAR PUSTAKA
Agrios, G.N. 1988. Plant Pathology. Academic Press, New York.
Anonim. 1995. Analisa Penyebab Terjadinya Gubal dan Kemedangan
pada Pohon Gaharu. Makalah Dipresentasikan pada Temu
Pertama Pakar Gaharu, 20 Oktober1995. Jakarta.

47

Aspek PRODUKSI

Anonim. 2006. Agarwood. http://en.wikipedia.org/wiki /Agarwood.


Terakhir dimodifikasi 11:11, 31 Oktober 2006.
Maryani, N., G. Rahayu dan E. Santoso. 2005. Respon Acremonium
sp. Asal Gaharu terhadap Alginate dan CaCl2. Prosiding Seminar
Nasional Gaharu. Seameo-Biotrop, Bogor, 1-2 Desember 2005.
MacMahon, C. 1998. White Lotus Aromatics. http://members.aol.
com/ratrani/ Agarwood. html. Updated April 16th, 2001, Accessed
16 April 2006.
Mucharromah, Misnawaty, dan Hartal. 2008. Studi Mekanisme
Akumulasi Resin Wangi Aquilaria malaccensis (Lamk.)
Merespon Pelukaan dan Infeksi Cendawan. Laporan Penelitian
Fundamental. DIKTI.
Mucharromah. 2008. Hipotesa Mekanisme Pembentukan Gubal
Gaharu. Makalah Seminar Nasional Pengembangan Produksi
Gaharu Provinsi Bengkulu untuk Mendukung Peningkatan
Ekspor Gaharu Indonesia. FAPERTA UNIB, Bengkulu, Indonesia,
12 Agustus 2008.
Mucharromah, Hartal, dan Surani. 2008. Tingkat Akumulasi Resin
Gaharu Akibat Inokulasi Fusarium sp. pada Berbagai Waktu
Setelah Pengeboran Batang Aquilaria malaccensis (Lamk.).
Makalah Semirata Bidang MIPA, BKS-PTN Wilayah Barat,
Universitas Bengkulu, 14-16 Mei 2008.
Mucharromah, Hartal, dan U. Santoso. 2008. Potensi Tiga Isolat
Fusarium sp. dalam Menginduksi Akumulasi Resin Wangi
Gaharu pada Batang Aquilaria malaccensis (Lamk.). Makalah
Semirata Bidang MIPA, BKS-PTN Wilayah Barat, Universitas
Bengkulu, 14-16 Mei 2008.
Mucharromah. 2006. Teknologi Budidaya dan Produksi Gubal
Gaharu di Provinsi Bengkulu. Makalah Seminar. Fakultas
Pertanian Universitas Mataram Bekerjasama dengan Balai
Pengelolaan Daerah Aliran Sungai Dodokan Moyosari Nusa
Tenggara Barat (BP DAS Dodokan Moyosari NTB). Universitas
Mataram, Lombok, Nusa Tenggara Barat, 18 November 2006.
Mucharromah. 2006a. Fenomena Pembentukan Gubal Gaharu pada
Aquilaria malaccensis (Lamk.). (unpublished).

48

Pengembangan Gaharu di ..... (Mucharromah)

Mucharromah dan J. Surya. 2006b. Teknik Inokulasi dan Produksi


Gaharu. Makalah Workshop Gaharu Tingkat Nasional.
Kerjasama Dirjen PHKA dan ASGARIN. Surabaya 11-13
September 2006.
Ng., L.T., Y.S. Chang and A.K. Azizil. 1997. A Review on Agar (Gaharu)
Producing Aquilaria Species. Journal of Tropical Forest Products
2 : 272-285.
Ngatiman dan Armansyah. 2005. Uji Coba Pembentukan Gaharu
dengan Cara Inokulasi. Prosiding Seminar Nasional Gaharu
Peluang dan Tantangan Pengembangan Gaharu di Indonesia,
Bogor, 1-2 Desember 2005. SEAMEO BIOTROP.
Parman, T. Mulyaningsih, dan Y.A. Rahman. 1996. Studi Etiologi
Gubal Gaharu pada Tanaman Ketimunan. Makalah Temu Pakar
Gaharu. Kanwil Dephut Propinsi NTB, Mataram, 11-12 April
1996.
Parman dan T. Mulyaningsih. 2006. Teknologi Budidaya Tanaman
Gaharu untuk Menuju Sistem Produksi Gubal Gaharu secara
Berkelanjutan. Makalah disampaikan pada Workshop Gaharu
Tingkat Nasional. Surabaya, 11-13 September 2006.
Purba, J.N. 2007. Identifikasi Genus Cendawan yang Berasosiasi
dengan Pohon Aquilaria malaccensis (Lamk.) dan Gubal Gaharu
Hasil Inokulasi serta Potensinya untuk Menginfeksi Bibit
Gaharu. Skripsi Fakultas Pertanian Universitas Bengkulu.
Raintree. 2001. Database Entry For Aquilaria agallocha. Raintree
Nutrition, Inc., Austin, Texas. Sites : hhtp//www.rain-tree.com/
aquilaria.htm. Date 3/3/06.
Santoso, E., L. Agustini, D. Wahyuno, M. Turjaman, Y. Sumarna, R.S.B.
Irianto. 2006. Biodiversitas dan Karakterisasi Jamur Potensial
Penginduksi Resin Gaharu. Makalah Workshop Gaharu Tingkat
Nasional. Kerjasama Dirjen PHKA dan ASGARIN, Surabaya 12
September 2006.
Sumarna, Y. 2005. Strategi Budidaya dan Pengembangan Produksi
Gaharu. Prosiding Seminar Nasional Gaharu, Seameo-Biotrop,
Bogor, 1-2 Desember 2005.

49

Aspek PRODUKSI

Lampiran 1. Analisis usaha inokulasi gaharu


Waktu inokulasi
:
Jumlah tegakan gaharu
:
Proyeksi hasil
:

Total proyeksi hasil
:
Penjualan kelas BC per batang :
Penjualan powder
:
No
A.

3 tahun
1 batang
20 kg/batang (Kelas BC);
30 kg/batang (Kemedangan)
50 kg/batang
60 kg
100 kg/batang

Uraian

Harga/unit
(Rp000)

Unit

Pembelian batang/tanah

Btg

100

100

Pengadaan inokulan

Btg

5.000

5.000

Pembelian peralatan

Set

90

90

Stressing agent

Btg

1.500

1.500

Tenaga ahli inokulasi

Btg

200

200

Tenaga kerja

Btg

600

600

Pemeliharaan/perawatan

Thn

12

36

Operasi lainnya

Btg

300

300

Beban operasional

Total
A.1.

7.826

Beban panen dan pasca panen


Penebangan

Btg

50

50

Angkut ke gudang

Btg

50

50

Pembersihan gaharu

50

Kg

25

1.250

Packing

50

Kg

Total
A.2.

B.

100
1.450

Beban pemasaran & umum lainnya


Angkut penjualan

50

Kg

250

Penjualan

50

Kg

10

500

Retribusi

50

Kg

250

Pengurusan surat-surat

Btg

Umum lainnya

50

Kg

0,5

25

Total

1.031

Total beban operasi

10.307

Proyeksi penghasilan
Penjualan kelas BC

60

Kg

2.000

Penjualan powder

100

Kg

Total proyeksi penghasilan


C.

Beban zakat/pajak

D.

Proyeksi keuntungan

120.000
500
120.500

5%

Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu, 2006

50

Total cost
(Rp000)

QTY

6.025
104.168

Pengembangan Gaharu di ..... (Mucharromah)

Lampiran 2. Analisis usaha budidaya gaharu


Waktu budidaya
: 7 tahun
Luas lahan
: 1 ha
Populasi tegakan
: 1.000/ha
Rasio jumlah suntikan
: 80 lubang/kg
Jumlah lubang
: 160/batang
Proyeksi hasil panen per batang : 160/80 = 2 kg
Exchange rate IDR
: 9.000

No
A.

Uraian

Harga/
unit
(Rp000)

Total
cost
(Rp000)

ha

15.000

15.000

Surat*

4.000

QTY

Unit

1
1

Biaya akuisisi lahan


Pembelian lahan
Perizinan/sertifikat/notariat
Total

B.

4.000
19.000

Biaya pra operasi (start-up cost)


Sarana & prasarana TBM
Rumah jaga

Unit

2.000

2.000

Sarana penerangan (PLN)

Unit

1.000

1.000

Sarana komunikasi

Unit

2.000

2.000

1.000

1.000

Sarana lainnya
A+B
C
C.1.

Total

6.000

Total biaya (direkapitulasi)

25.000

Beban operasi
Penanaman pohon baru
Land clearing

ha

1.000

1.000

Pembelian bibit

1.000

Btg

5.000

Pembuatan lubang

1.000

Btg

1.000

Penanaman pohon gaharu

1.000

Btg

0,5

500

Pemupukan

1.000

Btg

5.000

ha

24.000

24.000

Perawatan dan pengamanan


Total
C.2.

36.500

Beban inokulasi
Pengadaan inokulan

1.000

Btg

20

Pembelian peralatan

Set

3.000

3.000

Stressing agent

1.000

Btg

10

10.000

Tenaga kerja

1.000

Btg

5.000

Pemelihaaan/perawatan

1.000

Btg

10

10.000

1.000

Btg

Operasi lainnya
Total

20.000

1.000
49.000

51

Aspek PRODUKSI

QTY

Unit

Harga/
unit
(Rp000)

Total
cost
(Rp000)

Penebangan

1.000

Btg

5.000

Angkut ke gudang

1.000

Btg

5.000

Pembersihan gaharu

2.000

Kg

10

20.000

2.000

Kg

No
C.3.

Uraian
Beban panen & pasca panen

Packing
Total
C.4.

Beban pemasaran & umum lainnya


Angkut penjualan

2.000

Kg

10.000

Penjualan

2.000

Kg

10

20.000

Retribusi

2.000

Kg

20

40.000

Umum lainnya

2.000

Kg

0,5

71.000

Total beban operasi

190.500

2.000

Kg

Total proyeksi penghasilan


F

Beban zakat /pajak

5%
Proyeksi keuntungan

Sumber: Hasil perhitungan peneliti dengan CV Gaharu 88 Bengkulu, 2006

52

1.000

Total
Proyeksi penghasilan
Penjualan kelas C
E

4.000
34.000

2.000

4.000.000
4.000.000

200.000
3.609.500

Kajian Kimia Gaharu .....(Eka Novriyanti)

2
KAJIAN KIMIA GAHARU HASIL
INOKULASI Fusarium sp. PADA
Aquilaria microcarpa
Eka Novriyanti
Balai Penelitian Hutan Penghasil Serat Kuok

PENDAHULUAN
Gaharu adalah komoditas hasil hutan non-kayu yang bernilai
ekonomi tinggi dengan harga pasar bervariasi tergantung
kualitasnya, mulai dari 300 ribu rupiah hingga 25 juta rupiah
untuk kualitas double super. Produk ini dihasilkan beberapa spesies
penghasil gaharu dalam famili Thymeleaceae. Indonesia yang
merupakan salah satu pemasok gaharu terbesar memiliki kekayaan
jenis penghasil gaharu tertinggi di dunia, yaitu 27 spesies dari 8
genus dan 3 famili yang tersebar di Sumatera, Kalimantan, Maluku,
dan Irian (Sumarna, 2005).
Gaharu bernilai jual tinggi terutama dari resin wanginya yang
disebut memiliki scent of God, meskipun pengunaan produk ini
sebenarnya tidak terbatas hanya pada bidang wewangian saja.
Pada prinsipnya, pemanfaatan gaharu adalah untuk pengobatan,
incense, dan parfum (Barden et al., 2000). Incense gaharu digunakan
dalam ritual kepercayaan dan upacara-upacara religius keagaman,
sebagai pengharum ruangan sembayang serta benda-benda rohani
seperti rosario dan tasbih (Barden et al., 2000). Sementara itu, dalam
bidang pengobatan gaharu digunakan sebagai analgesik dan anti

53

Aspek PRODUKSI

inflamatory (Trupti et al., 2007), dan bermanfaat untuk mengatasi


berbagai panyakit seperti sakit gigi, ginjal, rematik, asma, diare,
tumor, diuretic, liver, hepatitis, kanker, cacar, malaria, obat kuat
pada masa kehamilan dan bersalin; juga memiliki sifat anti racun,
anti serangga, anti mikrobia, stimulan kerja saraf dan pencernaan,
(Hayne, 1987; Barden et al., 2000; Adelina, 2004; Suhartono dan
Mardiastuti, 2002).
Gaharu adalah senyawa fitoaleksin yang merupakan metabolit
sekunder dari pohon gaharu sebagai mekanisme pertahanannya.
Pohon gaharu sehat tidak pernah memproduksi sesquiterpenoid
sebagai metabolit sekunder yang beraroma harum (Yuan dalam
Isnaini, 2004). Tanaman dapat mensintesis dan mengakumulasi
metabolit sekunder sebagai respon terhadap infeksi oleh agen
tertentu, rangsangan fisiologi, maupun keadaan cekaman (Goodman et al. dalam Isnaini, 2004). Metabolit sekunder atau zat
ekstraktif tanaman dapat efektif dalam melawan hama dan agen
penyakit karena analog dengan komponen vital tertentu dari sistem
sinyal seluler, atau dapat terlibat dengan enzim vital dan memblokir
jalur metabolisme (Forestry Commission GIFNFC, 2007). Metabolit
sekunder pada kayu teras dapat menjadi pertahanan pohon
terhadap agen perusak meskipun pengaruhnya sangat bervariasi
pada berbagai habitat (Hills, 1987). Konsentrasi metabolit sekunder
ini bervariasi antar spesies, antar jaringan (konsentrasi tertinggi
berada di kulit, kayu teras, akar, pangkal percabangan, dan jaringan
luka), antar pohon dalam spesies yang sama, antar spesies, dan
antar musim (Forestry Commission GIFNFC, 2007).
Informasi mengenai bahan-bahan kimia yang terkandung dalam
gaharu penting untuk pemanfaatan produk ini. Arah pemanfaatan
informasi kimia gaharu di antaranya adalah penyusunan standar
produk berdasarkan komposisi kimia yang dikandungnya
sehingga lebih seragam dalam praktek penentuan kualitas produk,
pengembangan pemanfaatan lain dengan terbukanya kemungkinan
diidentifikasinya senyawa-senyawa baru dengan manfaat yang baru
pula, informasi jalur biosintetis gaharu itu sendiri sehingga mungkin
dapat dibuat sintetis senyawa, pengembangan senyawa-senyawa
dalam gaharu dengan bio-teknologi, dan lain-lain pengembangan
yang masih sangat luas untuk dilakukan. Namun begitu, hal ini

54

Kajian Kimia Gaharu .....(Eka Novriyanti)

masih memerlukan pemikiran dan terus melakukan penelitianpenelitian lanjutan yang akan membuka satu demi satu kebenaran
yang saat ini masih belum terungkap.

ANALISIS KIMIA GAHARU HASIL INOKULASI


ISOLAT DARI BEBERAPA DAERAH ASAL
Dalam tulisan ini, analisis kimia gaharu dilakukan dengan
analisis GCMS pirolisis menggunakan aparatus Shimadzu GCMSQP2010. Helium digunakan sebagai gas pembawa (carrier) (0,8
ml/min) yang dilengkapi dengan kolom kapiler DB-5 MS (60 mm
x 0,25 mm, ketebalan film 0,25 m), dioperasikan dengan electron
impact (EI) mode pada 70 eV dan suhu ion source 2000C. Kondisi
kromatografi adalah sebagai berikut: suhu oven kolom 500C, suhu
injeksi 2800C. Injeksi dilakukan dalam mode split, yaitu isothermal
500C selama 5 menit, kemudian increased mencapai 2800C hingga 30
menit, dan ditahan pada suhu ini hingga menit ke-60. Identifikasi
senyawa dilakukan berdasarkan waktu retensi dan analisis MS.
Analisis komponen kimia dilakukan untuk gaharu rekayasa
hasil inokulasi isolat Fusarium sp. asal Bahorok, Kalimantan Tengah
Tamiang Layang, Mentawai, dan Maluku. Pengukuran luasan infeksi
dilakukan pada umur inokulasi 6 bulan, sedangkan analisis kimia
dilakukan untuk sampel berumur 1 tahun.
Gambar 1 menyajikan luasan infeksi Fusarium sp. pada batang
A. microcarpa. Meskipun secara deskriptif isolat asal Bahorok
sepertinya menyebabkan infeksi yang paling besar, namun secara
statistik, daerah asal isolat tidak berpengaruh nyata terhadap
luasan infeksi yang terjadi pada batang pohon penghasil gaharu ini.
Tidak signifikannya pengaruh asal isolat terhadap luas infeksi
diduga disebabkan karena isolat yang diinokulasikan sama-sama
Fusarium sp., dan perlu dicatat tidak satupun isolat yang origin dari
lokasi di mana penelitian dilakukan yaitu asal Carita. Meskipun di
awal inokulasi masing-masing isolat memperlihatkan kecepatan
pembentukan infeksi yang berbeda sesuai virulensinya, namun
setelah sekian waktu ternyata pengaruhnya terhadap luasan infeksi
menjadi tidak signifikan lagi.

55

Aspek PRODUKSI

Gambar 1. Panjang infeksi pada umur inokulasi 6 bulan di


batang A. microcarpa dengan pembeda daerah
asal isolat

Meskipun secara luasan infeksi tidak menunjukkan pengaruh


yang nyata, namun analisis komponen kimia dari gaharu hasil
rekayasa ini menunjukkan adanya perbedaan. Lampiran 1
menyajikan komponen kimia hasil analisis py-GCMS terhadap
sampel gaharu inokulasi umur satu tahun. Sampel yang dianalisi
adalah sampel masing-masing dari titik-titik inokulasi dengan jarak
suntik 5 cm dan 20 cm.
Lampiran 1 dibagi menjadi 3 kelompok, yaitu:
1. kelompok A: konstituen gaharu yang sudah diidentifikasi pada
pekerjaan beberapa peneliti sebelumnya
2. Kelompok B: senyawa berkarakter odorant namun merupakan
hasil pirolisis komponen kayu seperti selulosa dan lignin
3. Kelompok C: senyawa yang belum dikonfirmasi merupakan
konstituen gaharu namun memiliki karakter odorant.
Kelompok A pada Lampiran 1, dengan tanpa membedakan jarak
suntik menunjukkan bahwa akumulasi konsentrasi relatif tertinggi
untuk konstituen terkonfirmasi (Yagura et al., 2003; Bhuiyan et al.,
2009; Pojanagaroon dan Kaewrak, 2006; Burfield, 2005; Tamuli,
2005; Alkhathlan et al., 2005; Konishi, 2002; Nor Azhah et al.,

56

Kajian Kimia Gaharu .....(Eka Novriyanti)

2008) terjadi pada isolat asal Kalimantan Tengah Tamiang Layang


sebesar 12,89%, diikuti masing-masing Maluku (10,96%), Bahorok
(10,61%), dan Mentawai (8,27%). Secara kuantitas maupun kualitas
(komponen kimia terkonfirmasi), isolat asal Kalimantan Tengah
Tamiang Layang memberikan hasil gaharu artifisial yang relatif
terbaik yang ditunjukan oleh relatif lebih besarnya infeksi yang
terjadi dan akumulasi senyawa gaharu terkonfirmasi tertinggi.
Kelompok B pada Lampiran 1 merupakan kelompok senyawa
berkarakter odorant yang merupakan hasil pirolisis selulosa dan
lignin. Ditampilkannya fakta tersebut karena penggunaan gaharu
pada umumnya sebagai incense yang menghasilkan wangi hanya
jika kayu yang mengandung resinnya dibakar. Keberadaan senyawasenyawa odorant hasil pirolisis komponen kayu ini kemungkinan
memiliki peran pada kesatuan wangi yang dihasilkan incense
gaharu yang dibakar. Dengan kata lain, karena digunakan sebagai
incense yang mengumbar wangi saat dibakar, maka keberadaan
senyawa dalam kelompok B tidak bisa dikesampingkan walaupun
bukan merupakan konstituen resin gaharu yang sebenarnya. Untuk
kelompok odorant yang merupakan pirolisis komponen kayu ini,
konsentrasi relatif tertinggi justru dihasilkan oleh isolat asal Maluku
(12,47%), diikuti Bahorok (12,40%), Kalimantan Tengah Tamiang
Layang (12,23%), dan Mentawai (11,47%). Perbedaan konsentrasi
ini kemungkinan sangat dipengaruhi oleh konsentrasi selulosa
dan lignin dari bagian batang yang dijadikan sampel. Pengaruh
kontribusi senyawa dalam kelompok ini pada wangi gaharu
memerlukan investigasi lebih lanjut.
Untuk Kelompok C, akumulasi konsentrasi relatif tertinggi
dihasilkan oleh isolat asal Maluku (26,14%), Mentawai (24,37%),
Bahorok (22,31%), dan terakhir Kalimantan Tengah Tamiang Layang
(18,71%). Pola urutan konsentrasi yang sama juga terjadi untuk total
konsentrasi relatif komponen berkarakter odorant; Maluku, diikuti
Mentawai, Bahorok, dan Kalimantan Tengah Tamiang Layang.
Namun kontribusi komponen-komponen berkarakter odorant
tersebut terhadap wangi gaharu masih memerlukan observasi yang
lebih dalam lagi.

57

Aspek PRODUKSI

Untuk komponen gaharu terkonfirmasi (Kelompok A), secara


umum jarak suntik 5 cm menghasilkan akumulasi konsentrasi yang
lebih tinggi, kecuali untuk isolat asal Kalimantan Tengah Tamiang
Layang yang justru lebih tinggi akumulasi konsentrasinya pada
jarak suntik 20 cm (Tabel 1). Secara umum untuk kelompok A, jarak
suntik 5 cm dan 20 cm menghasilkan akumulasi konsentrasi relatif
masing-masing sebesar 11,25% dan 10,11%. Untuk kelompok B,
dihasilkan akumulasi masing-masing sebesar 12,17% dan 12,11%
untuk jarak suntik 5 cm dan 20 cm. Angka-angka ini tidak jauh
berbeda karena diduga konsentrasi komponen kayu yang relatif
sama pada pohon-pohon sampel yang relatif berumur sama dan
tumbuh pada kondisi yang relatif sama.
Tabel 1. Komponen dalam gaharu hasil inokulasi berbagai daerah asal
isolat Fusarium sp. pada A. microcarpa yang memiliki karakterisitik
odorant penting
Komponen

Keterangan

Ambrettolide

Senyawa ini memiliki karakter wangi musk, manis buah, dan


bunga (International Flavor and Fragrance, Inc., 2008)

Ambrox

Ambrox memiliki karakter odorant tipe amber dan juga


merupakan anti-inflamatory yang potensial untuk bidang
pengobatan (Castro et al., 2002).

Valerolactone

Senyawa ini memiliki wangi herbal yang dimanfaatkan dalam


industri parfum dan pewangi (Wikipedia Online, 2008).

Ketoisophorone

Ketoisophorone mengumbar wangi manis campuran kayu, teh,


dan, daun tembakau (The Good Scent Company, 2008).

Maltol

Komponen ini menyajikan wangi caramel dan digunakan untuk


menghasilkan wangi yang manis pada fragrance, biasanya
dimanfaatkan sebagai penguat rasa dan aroma (flavor enhancer)
pada roti dan kue (Wikipedia Online, 2008).

Indole

Senyawa ini pada konsentrasi rendah menyajikan wangi bunga


dan merupakan konstituen dalam berbagai wangi bunga dan
parfum. Indole merupakan konstituen utama dalam minyak
melati dan karena minyak melati ini berharga mahal, produk
ini dibuat sintetisnya dengan menggunakan indole (Wikipedia
Online, 2008).

Isolongifolen

Isolongifolene merupakan bahan yang sangat berguna sebagai


odorant dan minyak parfum (Bunke dan Schatkowski, 1997).

58

Kajian Kimia Gaharu .....(Eka Novriyanti)

Komponen

Keterangan

Limonene

Limonene merupakan terpen yang memiliki aroma bunga dan


buah. Limonen merupakan monoterpeneoid yang digunakan
sebagai insektisida botani, selain sebagai bahan kosmetik dan
flavouring karena memberi wangi sitrus. Geraniol dan limonen
juga dimanfaatkan dalam pengobatan herbal dan konstituen
dalam berbagai tanaman obat (Wikipedia Online, 2008; The Good
Scent Company, 2008; Mann et al., 1994; Blake, 2004).

Cadinene

Senyawa ini muncul sebagai konstituen minyak esensial berbagai


tanaman (Wikipedia Online, 2008).

Dumasin

Dikenal juga sebagai cyclopentanone yang memiliki wangi mint.


Merupakan material wewangian dan untuk pengobatan serta
memiliki sifat pestisida (ChemYQ, 2008).

Benzylacetone

Benzylacetone memiliki wangi manis bunga yang merupakan


komponen atraktan yang melimpah pada bunga, juga merupakan
komponen volatil pada kokoa (Wikipedia Online, 2008).

Azulene

Azulene sangat sering ditemukan sebagai komponen dalam


minyak esensial tanaman dalam family Asteraceae dan memiliki
wangi dan warna biru pada minyak dan ekstraknya (LyndShiveley, 2004).

Akumulasi total untuk komponen berkarakter odorant


menunjukkan bahwa jarak suntik 20 cm (52,59%) yang menghasilkan
konsentrasi relatif lebih tinggi dibandingkan jarak suntik 5 cm
(50,23%). Pola yang sama juga terlihat untuk akumulasi konsentrasi
relatif pada kelompok senyawa C, masing-masing 24,81% dan 20,96%
untuk jarak suntik 20 cm dan 5 cm.
Dengan besarnya spasi injeksi akan menyebabkan proses
pembentukan senyawa yang terjadi berlangsung relatif lebih lambat,
yang ditunjukan oleh infeksi yang lebih kecil. Namun, proses yang
lambat ini kemungkinan memberi waktu dan kesempatan bagi
senyawa tertentu untuk disintesis atau diakumulasikan hingga
diperoleh konsentrasi yang relatif lebih tinggi. Di pihak lain, dengan
spasi injeksi yang lebih kecil di mana infeksi terjadi lebih cepat dan
lebih besar, ada kemungkinan proses sintesis terjadi lebih cepat
dibandingkan jarak injeksi yang lebih besar sehingga dihasilkan
senyawa-senyawa baru yang lain yang berkarakter odorant namun
akumulasinya belum cukup tinggi saat observasi dilakukan. Kajian
lebih dalam lagi diperlukan untuk mengetahui perkembangan atau
perubahan yang terjadi dengan semakin lamanya waktu inokulasi.

59

Aspek PRODUKSI

Hasil analisis py-GCMS juga menunjukkan adanya senyawasenyawa yang pada beberapa hasil penelitian lain disebutkan
sebagai senyawa pertahananan. Beberapa di antara komponen ini
bahkan juga memiliki karakter wangi yang diketahui merupakan
konstituen minyak esensial dan digunakan secara komersil dalam
industri parfum dan pengharum seperti vanillin, eugenol (Cowan,
1999; Rhodes, 2008; Koeduka et al., 2006), senyawa 4H-pyran-4-one
dan derivatnya (Abrishami et a., 2002; Rho et al., 2007; Fotouhi et
al., 2008), benzoic acid (NBCI, PubChem Compound, 2008), derivat
cyclopentane (Wikipedia Onlie, 2008), syringal-dehyde (Pedroso et
al., 2008), dumasin (ChemYQ, 2008), dan elimicin (Rossi et al., 2007).
Eugenol serta isoeugenol digunakan dalam produksi vanilin
yang merupakan bahan penting dalam industri wewangian (Cowan,
1999). Eugenol, isoeugenol, metileugenol, dan isometileugenol
merupakan empat senyawa fenilpropanoid dari 12 senyawa volatil
yang diketahui menyebabkan wangi yang manis pada Clarkia
breweri (Rhodes, 2008). Sedangkan koniferil alkohol merupakan
intermediet dalam biosintetis eugenol dan isoeugenol (Cowan,
1999), dan guaiakol merupakan intermediet dalam pembuatan
eugenol dan vanilin (Li dan Rosazza, 2000).
Senyawa asetosiringon juga tercatat pada semua gaharu hasil
inokulasi kelima daerah asal isolat dalam penelitian ini, di mana
senyawa ini merupakan fenolik yang dihasilkan tanaman sebagai
respon alami terhadap pelukaan (Sheikholeslam dan Weeks, 1986).
Dalam Hua (2001) disebutkan bahwa konsentrasi asetosiringon
meningkat 10 kali lipat ketika suatu jaringan aktif tanaman dilukai.
Asetosiringon merupakan bioaktif dalam interaksi tanamanmikroba yang mempercepat pendeteksian kehadiran patogen
oleh tanaman di mana konsentrasi senyawa ini meningkat dalam
tanaman seiring dengan meningkatnya konsentrasi mikroba (Baker
et al., 2004).

60

Kajian Kimia Gaharu .....(Eka Novriyanti)

Tabel 2. Senyawa-senyawa yang berdasarkan beberapa referensi diketahui


merupakan pertahanan pada tanaman tertentu dan terdeteksi pada
gaharu hasil inokulasi
Senyawa

Keterangan

Eugenol

Bersifat bakteriostatik terhadap jamur dan bakteri (Cowan, 1999).


Eugenol digunakan dalam pembuatan parfum, minyak esensial, dan
obat-obatan. Senyawa ini digunakan untuk menghasilkan isoeugenol
yang diperlukan untuk membuat vanilin yang juga merupakan
bahan yang penting dalam obat-obatan dan industri parfum dan
pengharum. Eugenol dan isoeugenol diturunkan dari prekursor
lignin, yaitu asam ferulat ataupun koniferil alkohol (Rhodes, 2008).

Koniferil
alkohol

Merupakan senyawa pertahanan tipe fitoaleksin yang termasuk


dalam grup fenilpropanoid, contohnya adalah yang terdapat pada
Linum usitiltissimum (Sengbusch, 2008).

Guaiakol

Merupakan intermediet dalam pembuatan eugenol dan vanilin, yang


juga digunakan sebagai antiseptik dan parasitisida (Li dan Rosazza,
2000).

Katekol dan
pirogalol

Adalah fenol terhidroksilasi yang bersifat toksik pada


mikroorganisme. Letak dan jumlah grup hidroksil pada grup
fenol diduga berkaitan dengan daya racun relative-nya terhadap
mikroorganisme, di mana daya racun akan semakin meningkat
dengan semakin tingginya hidroksilasi (Cowan, 1999).

Veratrol

Merupakan dimetil eter dari pirokatekol. Kedua senyawa ini dan


turunannya digunakan sebagai antiseptik, ekspektoran, sedatif,
deodoran, dan parasitisida (Wikipedia, 2008a). Konstituen resveratrol
yang diturunkan dari asam p-hidroksisinamat dan 3 unit malonat,
memiliki sifat antimikrobial (Torssel, 1983; p:144).

KESIMPULAN
1. Hasil inokulasi Fusarium sp. pada batang Aquilaria microcarpa
dapat dianalisis kuantitas dan kualitasnya melalui pendekatan
besaran infeksi dan komponen kimia yang dapat dianggap
masing-masinng sebagai refleksi kuantitas dan kualitas gaharu
yang terbentuk.
2. Pada gaharu rekayasa hasil inokulasi Fusarium sp. pada A.
microcarpa ditemukan beberapa komponen senyawa yang sudah
diidentifikasi merupakan konstituen gaharu dan beberapa
senyawa lain yang memiliki karakter odorant dan secara
komersil digunakan dalam industri perfumery dan flavoring.

61

3. Meskipun secara statistik tidak memperlihatkan perbedaan


yang signifikan terhadap luasan infeksi yang terbentuk setelah
6 bulan inokulasi, daerah asal isolat menunjukkan perbedaan
dalam konsentrasi senyawa-senyawa gaharu yang terbentuk.
Secara umum, inokulasi Fusarium sp. asal Kalimantan Tengah
menunjukkan konsentrasi senyawa konstituen gaharu
terkonfirmasi yang lebih tinggi, namun isolat asal Maluku
menunjukkan konsentrasi yang relatif lebih tinggi untuk total
senyawa dengan karakter odoran.

DAFTAR PUSTAKA
Abrishami, F, R. Teimuri-Mofrad, Y. Bayat, A. Shahrisa. 2002.
Synthesis of Some Aldoxime Derivatives of 4H-Pyran-4-ones.
Molecules 7: 239244.
Azah, M. A. N., Y. S. Chang, J. Mailina, A. A. Said, J. A. Majid, S.
S. Husni, H. N. Hasnida, Y. N. Yasmin. 2008. Comparison of
Chemical Profiles of Selected Gaharu Oils from Peninsular
Malayia. The Malaysian Journal of Analytical Sciences 12 (2):
338-340.
Baker, C. J., B. D. Whitaker, N. M. Mock, C. Rice, D. P. Robert, K. L.
Deahl, A. A. Averyanov. 2004. Stimulatory Effect of Acetosyringone on Plant/Pathogen Recognition. http://www.ars.usda.
gov/research/publications/publications. htm. [20 Juni 2008].
Barden, A., N. A. Anak, T. Mulliken, M. Song. 2000. Heart of the
Matter: Agarwood Use and Trade and CITES Implementation for
Aquilaria malaccensis. www.traffic.org. [22 Mei 2007].
Blake, S. 2004 Medicinal Plant Constituents. http://www.
naturalhealthwizards. com/MedicinalPlantConstituents.pdf.
[21 Juni 2008].
Blanchette, R. A. 2006. Sustainable Agarwood Production in Aquilaria
Trees. www.therainforestproject.net. [2 Februari 2007].
Bunke, E. J, D. Schatkowski. 1997. Isolongifolanol Derivates, their
Production and their Use. United State Patent. http://www.
freepatentsonline.com [31 Desember 2008].

Burfield, T. 2005a. Agarwood Chemistry. www.cropwatch.org. [2


Februari 2007].
Castro, J. M., S. Salido, J. Altarejos, M. Nogueras, A. Snchez. 2002.
Synthesis of Ambrox from Labdanolic Acid. Tetrahedron 58
(29): 5941-5949.
ChemYQ. 2008. Dumasin; Succinaldehyde. http://www.chemyq.com/
En/xz/xz11 [3 April 2008].
CITES, 2004. Convention on International Trade in endangered
Species of Wild Fauna and flora: Amendments to Appendices
I and II of CITES. http://www.cites.org/common/cop/13/raw /
props/ID-Aguilaria-Gyrinops.pdf.
Cowan, M. 1999. Plant Products as Antimicrobial Agents. Clinical
Microbiology Review 12 (4): 564-582.
FAO. Food safety and Quality: Flavoruing Index. http://www.fao.org/
ag/agn/jecfa-flav/index.html?showSynonyms=1 [ 1 November
2008: 2.31 pm].
Forestry Commission GIFNFC. 2007. Chemicals from Trees. http: //
treechemicals. csl.gov.uk/review/extraction.cfm. [14 Juli 2007].
Fotouhi, L., A. Fatehi, M. M. Heravi. 2008. Investigation of
Electrooxidation Reaction of Some Tetrahydrobenzo[b]pyran
Derivatives. Int. J. Electrochem. Sci. 3: 721-726.
Hayne, K. 1987. Tumbuhan Berguna Indonesia Jilid III. Badan
Litbang Kehutanan Jakarta. Thymelaceae. Yayasan Sarana
Wana Jaya. Terjemahan dari: Nuttige Planten Van Indonesie.
hlm: 1467-1469.
Hills, W. E. 1987. Heartwood and Tree Exudates. Berlin: SpringerVerlag.
Hua, S. S. T. 2001. Inhibitory Effect of Acetosyringone on Two
Aflatoxin Biosynthetic Genes. Applied Microbiology 32: 278-281.
International Flavor and Fragrance, Inc. 2008. http://www.iff.com/
Ingredients.nsf/0/45BD7B214C6F661E8025699000 5D79C2 [31
Desember 2008].
Ishihara, M., T. Tsuneya, M. Shiga, and K. Uneyama. 1991. Three
Sesquiterpenes from Agarwood. Phytochemistry 30 (2): 563566.

63

Aspek PRODUKSI

Isnaini, Y. 2004. Induksi Produksi Gubal Gaharu melalui Inokulasi


Cendawan dan Aplikasi Faktor Biotik (Disertasi). Program
Pascasarjana Institut Pertanian Bogor. Bogor.
Koeduka, T.,E. Fridman,D. R. Gang,D. G. Vasso,B. L. Jackson,C.
M. Kish, I. Orlova, S. M. Spassova, N. G. Lewis, J. P. Noel, T.
J. Baiga, N. Dudareva, E. Pichersky. 2006. Eugenol and
Isoeugenol, Characteristic Aromatic Constituents of Spices, are
Biosynthesized via Reduction of a Coniferyl Alcohol Ester. Proc.
Natl. Acad. Sci. USA.
Konishi, T., T. Konoshima, Y. Shimada, S. Kiyosawa. 2002. Six New
2-(2-Phenylethyl)chromones from Agarwood. Chem. Pharm.
Bull. 50 (3): 419-422.
Li, T., J. P. N. Rosazza. 2000. Biocatalytic Synthesis of Vanillin. Applied
and Environmental Microbiology 66 (2): 684-687.
Lynd-Shiveley, E. M. 2004. Azulene and Chamomile. www.
Aromaticplant project.com. [20 Juni 2008].
NCBI PubChem. 2008. Benzoic acid. http://pubchem.ncbi.nlm.nih.
gov/summary/ summary.cgi?cid=243. [1 Desember 2008].
Pedroso, A. P. D., S. C. Santos, A. A. Steil, F. Deschamps, A. Barison,
F. Campos, M. W. Biavatti. 2008. Isolation of Syringaldehyde
from Mikania laevigata Medicinal: Extract and its Influence on
the Fatty Acid Profile of Mice. Brazilian Jour. of Pharmacognosy
18(1): 63-69.
Pojanagaroon, S., C. Kaewrak. 2006. Mechanical Methods to
Stimulate Aloes Wood Formation in Aquiliria crassna Pierre ex
H Lec (Kritsana) Trees. ISHS Acta Hort 676. www.actahort.org.
[22 Mei 2007].
Prema, B. R. and P. K. Bhattacharrya. 1962. Microbial Transformation
of Terpenes. Nat. Chem. Lab. India.
Rho, H. S., H. S. Baek, J. W. You, S. Kim, J. Y. Lee, D. H. Kim, and I. S.
Chang. 2007. New 5-Hydroxy-2-(hydroxymethyl)-4H-pyran-4one Derivative has Both Tyrosinase Inhibitory and Antioxidant
Properties. Bull. Korean Chem. Soc. 28 (3): 471-473.

64

Kajian Kimia Gaharu .....(Eka Novriyanti)

Rhodes, D. 2008. Secondary Products Derived from Aromatic Amino


Acids: Eugenol and Isoeugenol. www.hort.purdue.edu. [20 Juni
2008].
Rossi, P. G., L. Bao, A. Luciani, P. Panighi, J. M. Desjobert, J. Costa, J.
Casanova, J. M. Bolla, and L. Berti. 2007. (E)-Methy-lisoeugenol
and Elemicin: Antibacterial Components of Daucus carota L.
Essential Oil Against Campylobacter jejuni. J. Agric. Food Chem.
55 (18): 7332-7336.
Sengbusch, P. V. 2008. Phenolic Compounds. http://www.biologie.
unihamburg. de/b-online/e20/20d.htm. [10 April 2008].
Sheikholeslam, S. N., D. P. Weeks. 1987. Acetosyringone Promotes
High Efficiency Transformation of Arabidopsis thaliana Explants
by Agrobacterium tumafacien. Plant Molecular Biology 8: 291198.
Sumarna, Y. 2005. Budidaya Gaharu. Seri Agribusines. Penebar
Swadaya. Jakarta.
The Good Scent Company. 2008. Limonene; Ketoisophorone;
Syringaldehyde, Tiglaldehyde. http://www.thegoodscents
company.com/gca/gc1014951.html [20 Juni 2008].
Torssell, K. B. G. 1983. Natural Product Chemistry. John Wiley & Son
Limited. Chichester, New Tork, brisbane, Toronto, Singapore.
Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar,
Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and Antiimflamatoryactivity of Heartwood of Aquilaria agallocha in
Laboratory Animal. Pharmacologyonline 1: 288-298.
Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC
Press Inc. Boca Raton, Florida.
Verpoorte, R., R. van der Heijden, J. Memelink. 2000. General
Strategies. In Verpoorte, R. and A. W. Alfermann (eds). Metabolic
Engineering of Plant Secondary Metabolism. Kluwer Academic
Publisher. Dordrecht, Boston, London. p: 31-50.
Wikipedia Online. 2008. Pyrrolidine; Propargyl Alcohol; Ptalic Acid;
Mesityl Oxide; Maltol; Indole; Glutanic Acid, Furanone; Elemicin;
DABCO; Crotonic Acid; Cadinene; Butyric Acid; Benzylacetone;
Caprylic Acid. http://en.wikipedia.org/wiki/. [1 juni 2008].

65

Aspek PRODUKSI

Yagura, T., N. Shibayama, M. Ito, F. Kiuchi, G. Honda. 2005.


Three Novel Diepoxy Tetrahydrochromones from Agarwood
Artificially Produced by Intentional Wounding. Tetrahedron
Letters 46: 4395-4398.
Yagura, T., M. Ito, F. Kiuchi, G. Honda, Y. Shimada. 2003. Four New
2-(2-Phenylethyl) Chromone Derivatives from Withered Wood
of Aquilaria sinensis. Chem. Pharm. Bull. 51:560-564.
Zaika, E. I., R. A. Perlow, E. Matz, S. Broyde, R. Gilboa. 2004. Sub-strate
Discrimination by Formamidopyrimidine-DNA Glycosylase.
The Jour. of Biol. Chem. 279 (6) issue 6: 4849-4861.

66

Kajian Kimia Gaharu .....(Eka Novriyanti)

Lampiran 1. Komponen dalam gaharu hasil inokulasi Fusarium sp. pada A.


microcarpa
Konsentrasi Relatif (%)
Nama senyawa

Bo
5 cm

Kt

20 cm

5 cm

Me

20 cm

5 cm

Mu

20 cm

5 cm

20 cm

A. Komponen aromatis yang sudah diidentifikasi sebagai konstituen gaharu


4-(2-Methyl-3-butenyl)
azulene

0,09

0,06

0,49

0,07

0,09

0,08

0,08

0,10

0,09

0,08

0,06

0,21

4-METHYL-2,5DIMETHOXYBENZALDEHYDE

4,35

2,37

3,66

1,52

4,65

1,45

4,42

4,60

Benzaldehyde, 2,4-dihydroxy

0,42

0,30

0,25

Benzaldehyde,
2,4-dimethoxy- (CAS)
2,4-Dimethoxybenzaldehyde

0,22

0,11

Benzaldehyde,
3,4-dihydroxy- (CAS)
3,4-Dihydroxybenzaldehyde

0,32

0,29

0,26

0,24

0,28

Benzaldehyde,
3-hydroxy- (CAS)
m-Hydroxybenzaldehyde

0,37

0,39

0,29

Benzaldehyde, 4,6-dimethoxy2,3-dimethyl- (CAS)


2,4-Dimethoxy-5,6-dimethyl

0,36

Benzaldehyde,
4-[[4-(acetyloxy)-3,5dimethoxyphenyl]methoxy]3-methoxy

0,37

0,54

0,48

Benzaldehyde, 4-hydroxy(CAS) p-Hydroxybenzaldehyde

0,43

0,23

0,44

1,2-benzenedicarboxylic acid,
diisooctyl ester (CAS) Isooctyl
phthalate

0,07

0,12

0,24

0,41

0,53

0,04

0,04

0,05

2,5-DIMETHOXY-4ETHYLBENZALDEHYDE
2-Hydroxy-4methylbenzaldehyde
4-Ethoxy-3methoxybenzaldehyde

2-Butanone, 4-phenyl- (CAS)


Benzylacetone
2-Butanone, 3,3-dimethyl(CAS) 3,3-Dimethyl-2butanone

67

Aspek PRODUKSI

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

2-Butanone, 3-phenyl- (CAS)

0,15

4H-1-Benzopyran-4-one,
2-(3,4-dihydroxyphenyl)-7-(.
beta.-D-glucopyranosyl)

0,05

4H-1-Benzopyran-4one, 2-methyl- (CAS)


2-Methylchromone

0,18

4H-1-Benzopyran-4-one,
5,7-dihydroxy-2-methyl- (CAS)
2-Methyl-5,7-dihydroxy

0,06

0,36

0,34

4H-1-Benzopyran-4-one,
6-dihydroxy-2-methyl- (CAS)
6-Hydroxy-2-methylchromone

0,46

2-Coumaranone

0,28

.gamma.-Eudesmol

0,04

Hexadecanoic acid,
2-(octadecyloxy)-, tetradecyl
ester (CAS) TETRADECYL

0,03

Hexadecanoic acid, methyl


ester (CAS) Methyl palmitate

0,05

2,4-Hexadienedioic acid,
3,4-diethyl-, dimethyl ester,
(Z,Z)- (CAS) CIS.CIS.D

0,69

0,85

2,4-Hexadienedioic acid,
3-methyl-4-propyl-, dimethyl
ester, (Z,E)- (CAS)

0,12

0,16

0,09

0,17

.alpha.-humulene

0,11

1-Naphthalenol,
1,2,3,4-tetrahydro- (CAS)
1-Tetralol

0,07

1-Ethynyl-3,4-dihydro-2naphthalenecarbadehyde

0,08

Phenol, 2,6-dimethoxy- (CAS)


2,6-Dimethoxyphenol

2,94

3,37

2,74

3,67

3,11

3,05

4,22

2,83

Phenol, 3,4-dimethoxy- (CAS)


3,4-dimethoxyphenol

0,25

0,33

0,33

0,40

0,24

0,42

0,40

0,22

0,25

Benzenepropanoic acid,
methyl ester (CAS) Methyl
hydrocinnamate

68

Kajian Kimia Gaharu .....(Eka Novriyanti)

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

Propanoic acid,
3-(2-propynyloxy)-, ethyl ester
(CAS) ETHYL 3-PROPARGYL

0,28

0,24

0.12

Propanoic acid, anhydride


(CAS) Propionic anhydride

1,31

1,02

0,60

0,44

Propanoic acid, ethenyl ester


(CAS) vinyl propionate

0,04

CYCLOPENTANEPROPANOIC
ACID, 1-ACETYL-2,2DIMETHYL-, METHYL

3,86

4,25

0,12

Benzenepropanoic acid (CAS)


Phenylpropionic acid

2,74

3,4,5,6,7,8-HEXAHYDRO-2HCHROMENE

0,20

1,2,3,4,4A,5,6,8A-OCTAHYDRONAPHTHALENE

0,58

8,95

9,49

16,30

9,95

6,59

13,30

Jumlah

12,28

Rataan untuk kedua jarak


suntik

10,61

12,89

8,27

8,62
10,96

B. Komponen aromatis yang merupakan pyrolisis dari bagian kayu


4H-Pyran-4-one, 3-Hydroxy-2methyl- (CAS) Maltol

0,14

0,17

0,17

0,21

0,19

0,29

0,14

0,27

4H-Pyran-4-one, 5-Hydroxy2-methyl- (CAS) 5-hydroxy-2methyl-4H-pyran-4-one

0,66

0,18

0,22

0,20

2-Propanone, 1-(acetyloxy)(CAS) Acetol acetate

0,12

0,15

0,15

0,17

2-Propanone, 1-hydroxy- (CAS)


Acetol

5,57

4,99

3,55

4,26

6,94

3,84

5,87

6,17

Ethanone, 1-(4-hydroxy-3,5dimethoxyphenyl)- (CAS)


Acetosyringone

0,50

0,58

0,66

0,67

0,56

0,38

0,49

0,65

ACETOVANILLONE

1,03

0,49

Ethanone, 1-(4-hydroxy3-methoxyphenyl)- (CAS)


Acetovanillone

0,46

0,74

0,83

1,2-Benzenediol (CAS)
Pyrocathecol

2,20

0,66

0,58

0,20

1,17

0,19

0,66

0,79

0,28

1,2-benzenediol, 3-methyl(CAS) 3-methylpyrocathecol

69

Aspek PRODUKSI

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

3-Methoxy-pyrocathecol

1,43

1,69

1,06

2,01

1,13

1,37

1,70

1,14

4-METHYL CATHECOL

1,90

0,46

0,19

0,24

Phenol, 2-methyl- (CAS)


o-Cresol

0,18

Phenol, 3-methyl- (CAS)


m-Cresol

0,27

0,30

0,71

0,18

0,45

0,31

Phenol, 4-methyl- (CAS) p


-Cresol

0,57

0,11

Phenol, 2-methoxy- (CAS)


Guaiacol

1,57

1,92

1,82

2,08

1,82

2,19

1,36

Phenol, 2-methoxy-4-propyl(CAS) 5-PROPYL-GUAIACOL

0,18

0,23

0,13

0,15

0,11

0,22

0,12

0,14

0,39

0,52

0,40

0,35

0,34

0,35

0,50

0,35

0,89

1,07

0,87

0,36

13,37

11,43

10,28

14,18

11,63

11,31

13,40

11,54

Phenol, 3-methoxy- (CAS)


m-Guaiacol
Phenol, 4-ethyl-2-methoxy(CAS) p-Ethylguaiacol
Phenol (CAS) Izal
Jumlah
Rataan untuk kedua jarak
suntik

12,40

12,23

11,47

12,47

C. Komponen berkarakter odorant lainnya yang belum disebutkan sebagai konstituen


gaharu
Ascaridole

2,39

2H-Pyran-2-one,
6-ethyltetrahydro- (CAS)
6-ETHYL-.DELTA.VALEROLACTONE

0,14

Oxacycloheptadec-8-en-2-one
(CAS) Ambrettolide

0,05

0,82

0,52

0,64

Oxacycloheptadecan-2-one
(CAS) Dihydroambrettolide

0,06

0,64

0,16

0,03

0,24

0,07

Benzoic acid,
3,4,5-trimethoxy-, methyl ester
(CAS) 3,4,5-Trimethoxybenzoic
Benzoic acid,
4-(methylamino)Benzoic acid, 4-ethenyl-,
methyl ester (CAS) METHYL
4-VINYLBENZOATE

70

Kajian Kimia Gaharu .....(Eka Novriyanti)

Konsentrasi Relatif (%)


Nama senyawa

.beta.-bisabolene
2-Butanone (CAS) Mehtyl ethyl
ketone
Butyric acid, m-nitrophenyl
ester (CAS) m-Nitrophenyl
butyrate
Carveol, dihydro-, cis-

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

0,51

0,78

0,66

0,98

0,53

1,23

0,55

1,66

2,31

0,09

0,85

0,76

0,61

Cholestane-3,6,7-triol,
(3.beta.,5.alpha.,6.beta.,7.
beta.)- (CAS)

0,07

2,5-furandione, 3-methyl(CAS) Citraconic anhydride

0,03

Citronellyl acetate

0,20

.beta.-Cyclocitral

0,24

Cyclopentanone,
dimethylhydrazone
(CAS) Cyclopentanone
dimethylhydrazone

0,26

4,95

6,45

0,65

3,93

4,99

4,17

4,38

4,93

0,32

0,33

1,93

0,70

1,61

TRANS-ISOELEMICIN

0,04

Ethanone,
1-(2,5-dihydroxyphenyl)(CAS) Quinacetophenone

0,42

Phenol, 2-methoxy-4-(1propenyl)- (CAS) Isoeugenol

0,28

Phenol, 2-methoxy-4-(1propenyl)-, (E)- (CAS) (E)isoeugenol

0,98

1,14

1,25

1,45

1,30

0,71

1,38

0,84

Phenol, 2-methoxy-4-(2propenyl)- (CAS) Eugenol

0,12

0,22

0,22

1,67

5-BUTYL-2-VALERYLFURAN

0,33

2(3H)-Furanone,
3-acetyldihydro- (CAS)
2-acetylbutyrolactone

0,20

Cyclopropyl carbinol
Cyclopentanone (CAS)
Dumasin
1-Eicosanol (CAS) n-Eicosanol

71

Aspek PRODUKSI

Konsentrasi Relatif (%)


Nama senyawa

2(5H)-Furanone, 5,5-dimethyl(CAS) 4,4-Dimethylbut-2enolide

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

0,18

0,09

2(5H)-Furanone, 5-methyl(identity?) (CAS) 2-Penten-4olide

0,09

2(3H)-Furanone,
5-hexyldihydro- (CAS)
4-decanolide

0,93

2-Furancarboxaldehyde (CAS)
Furfural

0,60

0,31

0,56

0,28

0,74

0,56

0,40

0,75

2-Furanmethanol (CAS)
Furfuryl alcohol

0,54

0,54

0,26

0,70

1,09

0,98

0,54

1,03

0,13

0,23

0,35

0,63

0,25

0,30

2-Heptanone, 3-methyl- (CAS)


3-Methyl-2-heptanone

0,55

Hexanoic acid, 1-methylethyl


ester (CAS) Isopropyl
hexanoate

0,14

0,11

0,06

3-Hexenoic acid

0,21

0,64

0,77

0,65

0,51

0,18

1H-Indole, 2-methyl- (CAS)


2-methylindole

0,48

6-Nitro-5-hydroxy-1,2dimethylindole

0,03

0,04

0,02

Indolizine (CAS) Indolizin

0,59

0,36

Ionol 2

0,03

3-pentanone CAS) Diethyl


ketone

0,71

1-Penten-3-one (CAS) Ethyl


vinyl ketone

0,39

0,38

0,69

.GAMMA.HEXALACTONE

0,65

0,66

0,76

3,5-Dihydrodecanoic acid.
delta.-lactone

0,31

0,09

Muskolactone

0,21

2-Furanmethanol, tetrahydro(CAS) Tetrahydrofurfuryl


alcohol
2-Heptanol, acetate (CAS)
2-HEPTYL ACETATE

1H-Indole (CAS) Indole

72

Kajian Kimia Gaharu .....(Eka Novriyanti)

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

L-isoleucine, N-acetyl- (CAS)


N-Acetyl-L-isoleucine

0,70

5,7-dimethoxy-2-methylindan1-one

0,04

0,04

Lineolone

0,13

METHYL MALONIC ACID

0,11

p-Menthane-2-one-1,3,3-d3
(CAS)

0,89

2,6,6-TRIDEUTERIO-OMENTHONE

0,19

0,22

Benzene, 1-methoxy-4-methyl(CAS) p-methylanisole

0,20

NEROLIDOL ISOMER

0,15

4-Nonanol, 4-methyl- (CAS)


4-methyl-4-nonanol

0,21

2,5-Norbornanediol (CAS)
2,5-DIHYDROXYNORBORNANE

0,13

Piperidine, 1-nitroso- (CAS)


NITROSOPIPERIDINE

0,89

0,65

0,57

PIPERIDINE,
1-(1-METHYLPENTYL)-

0,48

0,50

0,86

0,43

3,56

2,34

3,29

0,50

3-PHENYL-PROPIONIC ACID
ISOPROPYL ESTER

2,45

2-PROPYNOIC ACID

3,17

5,93

9H-Purine, 6-methyl-9(trimethylsilyl)- (CAS)


6-METHYLPURINE,
9-TRIMETHYLSILYL

0,01

1,3-Benzenediol, 4-ethyl- (CAS)


4-Ethylresorcinol

0,42

1,3-Benzenediol, 5-methyl(CAS) Orcinol

0,21

0,19

0,20

0,13

0,04

0,21

0,15

Benzaldehyde, 4-hydroxy3,5-dimethoxy- (CAS)


Syringaldehyde

0,47

0,57

0,52

0,52

0,58

0,40

0,50

0,58

3-(2,5-DIMETHOXY-PHENYL)PROPIONIC ACID

73

Aspek PRODUKSI

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

0,09

0,11

0,97

Benzaldehyde, 4-hydroxy-3methoxy- (CAS) Vanillin

0,38

0,40

0,50

0,52

0,59

0,52

0,45

0,45

Benzeneacetic acid, .alpha.hydroxy-2-methoxy- (CAS)


2-methoxymandelic acid

0,01

Benzeneacetic acid,
4-hydroxy-3-methoxy- (CAS)
Homovanillic acid

0,20

0,11

0,21

ISO-VELLERAL

0,02

Benzenemethanol,
3,4-dimethoxy- (CAS) Veratryl
alcohol

0,10

2-Butanone, 4-(4-hydroxy3-methoxyphenyl)- (CAS)


Zingerone

0,63

Ethanone, 1-(2-furanyl)- (CAS)


2-Acetyfuran

0,14

0,12

0,12

2-ACETYL FURAN

0,23

2(3H)-Furanone (CAS) .alpha.Furanone

0,27

0,23

0,32

2(3H)-Furanone, 5-methyl(CAS) 5-Methyl-2-oxo-2,3DIHYDROFURAN

0,06

2(3H)-Furanone, hexahydro3-methylene- (CAS)


6-HYDROXYCYCLO

0,15

0,36

1,72

1,70

1,61

2,48

1,77

1,55

2,96

2,5-DIMETHYL-3(2H)
FURANONE

0,04

2-ETHYL-4-HYDROXY-5METHYL-3(2H)FURANONE

0,17

0,14

0,13

0,13

2-HYDROXY-5-METHYL-2(5H)FURANONE

0,28

3-HYDROXY-5-METHYL-2(5H)FURANONE

0,39

0,26

(E)-2-hydroxy-4phenylstilbene
1-TRICOSENE
Benzaldehyde, 3,4-dimethoxy(CAS) Vanillin methyl ether

2(5H)-FURANONE

74

Kajian Kimia Gaharu .....(Eka Novriyanti)

Konsentrasi Relatif (%)


Nama senyawa

Bo

Kt

Me

Mu

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5 cm

20 cm

5-HYDROXYMETHYLDIHYDRO-FURAN-2-ONE

1,23

1,65

1,30

1,02

1,33

1,18

HYDROXY DIMETHYL
FURANONE

0,81

0,87

2-(Acetyloxy)-1-[2-(acetyloxy02-(3-furanyl)ethyl]-5a[(acetyloxy)methyl]hexah

0,06

2-Methoxy-4-methylphenol

0,95

Phenol, 2,6-dimethoxy-4-(2propenyl)- (CAS) 4-allyl-2,6dimethoxyphenol

2,52

3,13

2,05

3,06

2,80

2,10

3,17

2,23

9H-Xanthen-9-one,
1,3-dihydroxy-6-methoxy-8methyl- (CAS) 6-O-METHYL-

0,06

Xanthosine (CAS) Xanthine


riboside

0,23

0,29

18,70

25,93

17,57

19,86

21,62

27,12

25,95

26,33

Jumlah
Rataan untuk kedua jarak
suntik
Total

22,31
44,34

Rataan total untuk kedua


jarak suntik

46,30
45,32

18,71
37,33

50,34
43,83

24,37
43,19

45,01

26,14
52,65

44,10

46,48
49,56

Keterangan:

Bo = Bahorok, Kt = Kalimantan Tengah Tamiang Layang, Me = Mentawai, Mu = maluku

Referensi:

FAO (2008); Abrishami et al. (2002); Rho et al. (2007); Fotouhi et al. (2008); Sheikholeslam & Weeks
(1987); Baker et al. (2004); Hua et al. (2001); Azah et al. (2008); International flavor and fragrance,
Inc (2008); Castro et al. (2002); Lynd-Shiveley (2004); ChemYQ (2008); Rossi et al. (2007); Koeduka
et al. (2006); Zaika et al. (2004); Valentines et al. (2005); The Good Scent Company (2008); Bunke &
schatkowski (1997); Pedroso et al. (2008); Wikipedia encyclopedia Online (2008).

75

76

3
TEKNOLOGI INDUKSI POHON
PENGHASIL GAHARU
Erdy Santoso, Ragil Setio Budi Irianto, Maman Turjaman,
Irnayuli R. Sitepu, Sugeng Santosa, Najmulah, Ahmad Yani,
Aryanto
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu yang merupakan produk komersil bernilai ekonomis
tinggi, sebenarnya merupakan endapan resin yang terakumulasi
pada jaringan kayu sebagai reaksi pohon terhadap pelukaan atau
infeksi penyakit. Gaharu telah diperdagangkan sejak ratusan tahun
lalu. Menurut Suhartono dan Mardiastuti (2002), perdagangan
produk ini di Indonesia pertama kali tercatat pada abad ke-5
Masehi, di mana China dilaporkan sebagai pembeli utama. Dalam
perdagangan internasional, komoditas ini dikenal dengan berbagai
nama seperti agarwood, aloeswood, karas, kresna, jinkoh, oudh,
dan masih banyak lagi nama lainnya. Bentuk perdagangan gaharu
beragam, mulai dari bongkahan, chip, serbuk, dan minyak gaharu
(Surata dan Widnyana, 2001). Komoditas berbentuk minyak
biasanya diperoleh dari penyulingan atau ekstraksi chip gaharu
dari kelas yang bermutu rendah.
Saat ini, gaharu bernilai jual tinggi terutama dari resin wanginya
yang disebut sebagai scent of God, meskipun penggunaan produk
ini sebenarnya tidak terbatas hanya pada bidang wewangian saja.

77

Aspek PRODUKSI

Pada prinsipnya, pemanfaatan gaharu adalah untuk pengobatan,


incense, dan parfum (Barden et al., 2000). In-cense gaharu digunakan
dalam ritual kepercayaan dan upacara-upacara religius keagamaan,
sebagai pengharum ruangan, sembahyang serta benda-benda
rohani seperti rosario dan tasbih (Barden et al., 2000). Sementara
itu, dalam bidang pengobatan gaharu digunakan sebagai analgesik
dan anti imflamatory (Trupti et al., 2007) dan diketahui bermanfaat
untuk mengatasi berbagai penyakit seperti sakit gigi, ginjal, rematik,
asma, diare, tumor, diuretic, liver, hepatitis, kanker, cacar, malaria,
obat kuat pada masa kehamilan dan bersalin, juga memiliki sifat
anti racun, anti mikrobia, stimulan kerja saraf dan pencernaan
(Heyne, 1987; Barden et al., 2000; Adelina, 2004; Suhartono dan
Mardiastuti, 2002).
Penelitian mengenai berbagai aspek yang terkait dengan gaharu
sudah dilakukan sejak lama dan semakin berkembang dewasa ini.
Penelitian-penelitian ini terutama didorong oleh berbagai hal seperti
pasokan komersil untuk gaharu yang masih sangat tergantung
dari produksi alam yang karena tingginya intensitas pemungutan
produk ini telah menyebabkan tercantumnya genus utama tanaman
penghasil gaharu, Gyrinops dan Aquilaria dalam Appendix II CITES.
Selain itu, tidak semua tanaman penghasilnya mengandung gaharu
yang hanya terpicu pembentukannya jika terjadi kondisi cekaman.
Proses pembentukan gaharu juga membutuhkan waktu yang lama,
di mana selama proses tersebut berlangsung dihasilkan variasi
mutu dan pada akhir proses dapat diperoleh gaharu dengan mutu
paling tinggi (Sumadiwangsa dan Harbagung, 2000).
Terbentuknya gaharu pada tanaman penghasilnya, terpicu oleh
faktor biotik maupun abiotik. Untuk menghasilkan gaharu secara
artifisial, pelukaan mekanis pada batang, pengaruh bahan-bahan
kimia seperti metal jasmonat, oli, gula merah, dan yang lainnya
dapat memicu pembentukan gaharu. Namun pembentukan gaharu
oleh faktor abiotik, seperti yang telah disebutkan sebelumnya tidak
menyebabkan terjadinya penyebaran mekanisme pembentukan ini
ke bagian lain dari pohon yang tidak terkena efek langsung faktor
abiotik tersebut. Lain halnya jika pembentukan gaharu dipicu oleh
faktor biotik seperti jamur atau jasad renik lainnya, mekanisme
pembentukan dapat menyebar ke bagian lain pada pohon, karena

78

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

penyebab mekanisme ini adalah mahluk yang melakukan semua


aktivitas yang diperlukan untuk kehidupannya. Dengan terjadinya
penyebaran pembentukan gaharu ke jaringan lain pada batang
pohon, maka kualitas dan kuantitas produk gaharu yang dihasilkan
akan lebih memuaskan.

BAHAN DAN METODE


A. Bahan
Bahan yang digunakan pada kegiatan ini adalah 21 isolat
Fusarium spp. yang diinokulasi di Laboratorium Mikrobiologi
Hutan, Pusat Penelitian dan Pengembangan Hutan dan Konservasi
Alam Bogor. Isolat fungi tersebut diperoleh dari batang Aquilaria
spp. yang telah menunjukkan adanya pembentukan gaharu secara
alami. Batang Aquilaria spp. diambil dari beberapa tanaman gaharu
yang terdapat di Jawa, Kalimantan, Sumatera, Maluku, NTB dan
Sulawesi (Tabel 1).
Tabel 1. Isolat-isolat yang diamati
No

Kode

Ga 1

Ga 2

Asal lokasi

No

Kode

Asal lokasi

Kalimantan Tengah

12

Ga 12

Lampung

Maluku

13

Ga 13

Bengkulu

Ga 3

Sukabumi

14

Ga 14

Bogor

Ga 4

Kalsel

15

Ga 15

Mentawai

Ga 5

Kaltim

16

Ga 16

Kaltim LK

Ga 6

Belitung

17

Ga 17

Kalbar

Ga 7

Riau

18

Ga 18

Yanlapa

Ga 8

Bengkulu

19

Ga 19

NTB

Ga 9

Jambi

20

Ga 20

Kalsel MIC

10

Ga 10

Sumatera Barat

21

Ga 21

Kalteng TL

11

Ga 11

Gorontalo

Media yang digunakan untuk menambahkan fungi, yaitu Potato


Dekstrose Agar (PDA). Inokulasi jenis fungi Fusarium spp. pada A.
microcarpa pada kegiatan ini bahan berupa pohon A. microcarpa
79

Aspek PRODUKSI

umur 13 tahun. Untuk fungi pembentuk gaharu asal Gorontalo,


Jambi, Kalbar, dan Padang (Sumatera Barat). Alat inokulasi, terdiri
dari bor listrik, mata bor ukuran 3 mm, genset, dan lain-lain.

B. Metode
Untuk identifikasi masing-masing koloni ditumbuhkan pada
media PDA dalam cawan petri, kemudian diinokulasi pada suhu
kamar dan diletakkan di ruangan inokulasi selama tujuh hari. Untuk
pengamatan morfologi dilakukan melalui mikroskop parameter,
yang diamati adalah ukuran diameter koloni, baik secara horizontal
maupun vertikal, diamati juga warna koloni dan keberadaan aerial
miselium.
Identifikasi juga mengamati ciri makrokonidia, mikrokonidia
serta bentuk konidiofor. Sediaan kultur dibuat dengan cara
memindahkan potongan kecil isolat fungi menggunakan alat
pelubang gabus berdiameter lima mm, isolat diletakkan pada
gelas obyek yang kemudian ditutup dengan cover glass preparat,
diinkubasi dengan cara diletakkan pada ruang tertutup yang
kelembabannya dijaga dengan cara memasukkan kapas yang telah
dibasahi aquadesh steril. Sediaan kultur diinkubasi selama tujuh
hari, setelah itu koloni yang tumbuh pada gelas obyek diamati di
bawah mikroskop setelah preparat diberi zat pewarna, yang diamati
adalah bentuk dan miselium.

C. Teknik Inokulasi
1. Inokulasi
Pohon contoh adalah A. microcarpa di Hutan Penelitian Carita.
Rancangan acak lengkap dengan perlakuan daerah asal isolat (I),
yaitu Fusarium spp. asal Gorontalo (II); Kalimantan Barat (12); Jambi
(13) dan Padang (14) serta campuran dari keempat isolat tersebut
(15). Masing-masing isolat diinokulasikan pada 3 ulangan.
Inokulasi dilakukan pada semua pohon contoh. Sebelum
penginjeksian, semua peralatan yang digunakan disterilkan
terlebih dahulu dengan alkohol 70% untuk menghindari adanya
kontaminasi dari mikrobamikroba lain. Pengeboran dilakukan

80

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

dengan kedalaman mencapai 1/3 diameter batang dengan tujuan


inokulum cair nantinya mencapai kambium dan bagian floem kayu.
Inokulum Fusarium spp. cair selanjutnya diinjeksikan sebanyak
1 ml untuk setiap lubang bor di batang pohon. Lubang injeksi
dibiarkan terbuka untuk memberi kondisi aerasi bagi mikroba yang
diinokulasikan.

Gambar 1. Pengeboran batang pohon contoh (A) dan injeksi


isolat pada lubang bor (B)

2. Pengamatan dan Pengambilan Contoh Gaharu


Pengamatan infeksi dilakukan pada umur inokulasi 2 bulan dan
6 bulan dengan mengukur panjang infeksi vertikal dan horizontal
yang terjadi pada permukaaan batang A. microcarpa. Pengambilan
data dilakukan secara acak pada beberapa titik injeksi inokulasi
dan nilai panjang infeksi merupakan rata-rata dari panjang titiktitik infeksi tersebut dalam satu pohon.

HASIL DAN PEMBAHASAN


A. Keragaman Isolat Fusarium spp.
1. Keragaman Morfologi Isolat Fusarium spp. yang Berasal dari
Berbagai Daerah
Karakter morfologi aerial miselium, warna koloni dan diameter
koloni isolat Fusarium spp. yang berasal dari berbagai daerah sangat

81

Aspek PRODUKSI

beragam (Tabel 2). Keragaman karakter morfologi Fusarium spp.


disebabkan oleh perbedaan asal isolat.
Tabel 2. Tabel 2. Keragaman morfologi Fusarium spp. yang berasal dari
berbagai daerah

No.

Kode
isolat

Karakter morfologi
Asal lokasi

Koloni pada

Diameter koloni

Aerial

Warna

mm/7 hari

Miselium

Medium PDA

Ga-1

Kalteng

61

Ada,+++

Putih, kuning muda

Ga-2

Maluku

49

Ada,++

Putih, coklat muda

Ga-3

Sukabumi

48

Ada,+

Coklat muda

Ga-4

Kalsel

50

Ada,++

Putih

Ga-5

Kaltim

45

Ada,++

Putih

Ga-6

Belitung

38

Ada,+

Putih

Ga-7

Riau

59

Ada,++

Putih krem

Ga-8

Bengkulu

49

Ada,++

Putih

Ga-9

Jambi

59

Ada,+++

Putih krem, coklat


muda

10

Ga-10

Padang

61

Ada,+++

Putih

11

Ga-11

Gorontalo

58

Ada,+++

Putih kecoklatan

12

Ga-12

Lampung

58

Ada,+++

Putih tulang, merah


muda

13

Ga-13

Bangka

59

Ada,+++

Putih

14

Ga-14

Bogor

61

Ada,++

Putih

15

Ga-15

Mentawai

56

Tidak ada

16

Ga-16

Kaltim LK

57

Ada,+

17

Ga-17

Kalbar

59

Ada,+++

Putih krem

18

Ga-18

Yanlapa

58

Ada,++

Putih, kuning muda

19

Ga-19

Mataram

52

Ada,++

Putih

20

Ga-20

Kalsel MIC

50

Ada,++

Putih, kuning muda

21

Ga-21

Kaltel TL

69

Ada,++

Putih, krem

Kelimpahan relatif aerial miselium: + Sedikit, ++ Cukup banyak, +++ Banyak

a. Keberadaan Aerial Miselium

82

Coklet, kuning,
putih
Putih, unggu

Karakter aerial miselium terdapat hampir pada setiap isolat


Fusarium spp. Isolat yang tidak memiliki aerial miselium dijumpai
pada Ga-15 asal Mentawai. Walaupun sebagian besar isolat
Fusarium spp. memiliki aerial miselium, namun terdapat perbedaan
antar isolat jika dilihat berdasarkan kerlimpahan relatif aerial
miseliumnya. Isolat Ga-1, Ga-9, Ga-10, Ga-11, Ga-12, Ga-13, dan Ga17 memiliki kelimpahan aerial miselium relatif banyak (Tabel 2),
sedangkan isolat Ga-3, Ga-6, dan Ga-16 merupakan isolat dengan
kelimpahan aerial miselium sedikit.
Irawati (2004) melaporkan bahwa secara umum cendawan
yang ditumbuhkan pada kondisi terang secara terus-menerus akan
membentuk aerial miselium relatif lebih banyak. Aerial miselium
yang terbentuk dengan kelimpahan relatif banyak merupakan
mekanisme fototropi terhadap kehadiran cahaya (Irawati, 2004).
Namun, karena pada penelitian semua isolat yang diuji mendapat
perlakuan cahaya yang sama, maka perbedaan kelimpahan aerial
miselium adalah disebabkan oleh karakter masing-masing isolat.
b. Warna Koloni

Selain aerial miselium, keragaman morfologi isolat Fusarium


spp. adalah warna koloni. Hasil yang diperoleh menunjukkan
bahwa warna koloni putih terdapat pada isolat Ga-4, Ga-5, Ga-6, Ga8, Ga-10, Ga-13, Ga-14, dan Ga-19 (Gambar 2, Gambar 3, dan Gambar
4). Selain warna putih, beberapa isolat memiliki warna putih dan
warna kuning muda pada isolat Ga-1, cokelat muda (Ga-2), putih
krem (Ga-7, Ga-17, dan Ga-21). Isolat ga-17 dan Ga-21 memiliki
kemiripan warna koloni dengan isolat Fusarium yang berasal dari
Riau yang telah teridentifikasi dan merupakan spesies Fusarium
solani (Luciasih et al., 2006).
Fusarium solani merupakan spesies yang kosmopolit dengan
ciri khas kelimpahan mikrokonidianya elips. Isolat Ga-10 dan Ga11 memiliki warna koloni putih dan warna cokelat muda (peach).
Isolat Ga-18, Ga-19, dan Ga-20 memiliki warna koloni putih dan
kuning muda.
Ditemukan juga isolat yang memiliki warna koloni yang sangat
berbeda dengan isolat lain, yaitu warna hifa miselium didominasi

83

Aspek PRODUKSI

oleh warna ungu namun memiliki warna koloni putih sedikit tipis
pada aerial miselium yang terletak pada bagian tepi koloni (Gambar
3). Keragaman yang terdapat pada warna koloni berhubungan
dengan pigmen yang dikandung oleh dinding sel hifa. Cendawan
yang tidak berpigmen umumnya berwarna hialin.
c. Diameter Koloni

Diameter koloni Fusarium spp. berkisar antara 30-69 mm. Semua


isolat yang diuji dapat diklasifikasikan menjadi tiga kelompok, yaitu
diameter kurang dari 40 mm (isolat Ga-6), isolat dengan diameter
antara 40-50 mm (isolat Ga-2, Ga-4, Ga-5, Ga-8, dan Ga-20), dan isolat
dengan diameter lebih dari 50 mm (isolat Ga-1, Ga-3, Ga-7, Ga-9, Ga10, Ga-11, Ga-12, Ga-13, Ga-14, Ga-15, Ga-16, Ga-17, Ga-18, Ga-19, dan
Ga-21) (Tabel 2, Gambar 2, Gambar 3, dan Gambar 4).
Keragaman diameter koloni Fusarium spp. berhubungan dengan
kecepatan tumbuh hifa. Selain itu, diperoleh adanya hubungan
yang erat antara kecepatan tumbuh hifa dengan kehadiran aerial
miselium.
Diameter koloni merupakan veriebel yang berhubungan
erat dengan kecepatan tumbuh. Pada beberapa isolat Fusarium,
kecepatan tumbuh merupakan karakter yang khas pada setiap
isolat. Kecepatan tumbuh yang tinggi dapat berhubungan juga
dengan kemampuan virulensi. Untuk mengetahui kemampuan
virulensi, maka isolat perlu diuji, misalnya terhadap inangnya.

2. Keragaman Mikro dan Makrokonidia serta Konidiofor Isolat


Fusarium spp.
Fusarium spp. memiliki keragaman pada karakter morfologi
juga tampak adanya keragaman karakter mikrokonidia dan
makrokonidia dari isolat yang diuji. Hasil pengamatan menunjukkan
bahwa keragaman terlihat pada karakter jumlah septa makrokonidia, percabangan konidiofor, bentuk, dan kelimpahan mikrokonidia.
Jumlah septa makrokonidia dominan berjumlah 2-3 yang dimiliki
oleh isolat Ga-1, Ga-3, Ga-5, Ga-6, Ga-7, Ga-8, Ga-10, Ga-18, Ga-20, dan
Ga-21. Namun, dari ke-10 isolat tersebut terdapat perbedaan pada

84

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

percabangan konidifornya. Isolat dengan konidiofor bercabang


adalah Ga-18 dan Ga-21; Sedangkan isolat Ga-1, Ga-3, Ga-5, Ga-6,
GA-7, Ga-8, dan Ga-10 memiliki konidiofor sederhana (Tabel 3).

Gambar 2. Keragaman morfologi Fusarium spp. (isolat Ga-1,


Ga-2, Ga-3, Ga-4, Ga-5, Ga-6, Ga-7, dan Ga-8) umur
tujuh hari pada medium PDA

Gambar 3. Keragaman morfologi Fusarium spp. (isolat Ga-9,


Ga-10, Ga-11, Ga-12, Ga-13, Ga-14, Ga-15, dan Ga16) umur tujuh hari pada medium PDA.

85

Aspek PRODUKSI

Gambar 4. Keragaman morfologi Fusarium spp. (isolat Ga-17,


Ga-18, Ga-19, Ga-20, dan Ga-21) umur tujuh hari
pada medium PDA
Tabel 3. Keragaman karakter makrokonidia Fusarium spp. yang berasal dari
berbagai daerah
Karakter histologi
No

Kode

Makrokonidia
Jumlah septa

Mikrokonidia
Konidiofor

Kelimpahan

Bentuk

Ga-1

Simpel

Banyak

Elips

Ga-2

Bercabang

Banyak

Elips, oval

Ga-3

Simpel

Banyak

Elips

Ga-4

4-7

Simpel

Banyak

Elips, oval

Ga-5

Simpel

Sedikit

Elips

Ga-6

Simpel

Sedikit

Elips, oval

Ga-7

Simpel

Sedikit

Elips, oval

Ga-8

Simpel

Sedikit

Elips, lonjong

Ga-9

Simpel

Sedikit

Elips, sekat

10

Ga-10

Simpel

Banyak

Elips, sekat

11

Ga-11

Bercabang

Banyak

Elips

12

Ga-12

Simpel

Banyak

Elips

13

Ga-13

Simpel

Sedikit

Elips

14

Ga-14

Simpel

Sedikit

Elips

15

Ga-15

Bercabang

Banyak

Elips

16

Ga-16

Simpel

Sedikit

Elips, sekat 3

17

Ga-17

Bercabang

Sedikit

Elips

18

Ga-18

Bercabang

Banyak

Elips

19

Ga-19

Simpel

Banyak

Elips

20

Ga-20

Bercabang

Sedikit

Elips, oval

21

Ga-21

Bercabang

Banyak

Elips

Isolat Ga-2, Ga-3, dan Ga-15 memiliki jumlah septa empat,


namun dari ke-3 isolat tersebut dapat dibedakan berdasarkan
86

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

percabangan konidifor dan bentuk mikrokonidianya. Isolat Ga-2


memiliki konidifor bercabang, bentuk mikrokonidianya elips dan
oval. Isolat Ga-13 memiliki bentuk konidifor simpel dan Ga-15
bentuk konidifornya bercabang.
Mikrokonidia pada berbagai Fusarium memiliki bentuk yang
khas, yaitu berbentuk bulan sabit (fusoid) sehingga memungkinkan
dapat dengan mudah dibedakan dengan genus lain yang memiliki
ciri mirip Fusarium. Genus Fusarium memiliki kemiripan dengan
Cylindrocarpon pada karakter morfologi, namun Booth (1971)
membedakan Cylindrocarpon karena karakter pangkal konidianya
yang relatif tumpul dan tidak memiliki hock/foot cell yang jelas
seperti pada Fusarium spp.
Isolat Ga-12, Ga-14, dan Ga-16 merupakan isolat yang memiliki
jumlah septa makrokonidia relatif banyak, yaitu berkisar 5-7 (Tabel
3). Dua dari tiga isolat tersebut, yaitu isolat Ga-12 dan Ga-14 memiliki
kemiripan pada bentuk konidiofor dan bentuk mikrokonidia, namun
kedua isolat tersebut berbeda pada tipe makrokonidianya. Isolat
Ga-12 memiliki ukuran relatif lebih besar pada makrokonidianya
apabila dibandingkan dengan Ga-14 (Gambar 5 dan Gambar 6).
Isolat Ga-14 berbeda dengan isolat Ga-16 karena pada isolat Ga-16
mikrokonidianya bersekat (Gambar 7).
Luciasih et al. (2006) melaporkan bahwa keragaman antar
Fusarium spp. dari 21 isolat Fusarium spp., beberapa isolat telah
teridentifikasi sampai pada tingkat spesies. Spesies tersebut
merupakan F. sambunicum (isolat Ga-1), F. tricinctum (isolat Ga-2,
Ga-3, dan Ga-5), dan F. solani (isolat Ga-4, Ga-6, Ga-7, Ga-8, dan Ga9). Di antara ketiga spesies tersebut F. solani keberadaannya paling
dominan sehingga perlu mendapat perhatian khusus.
Fusarium solani berbeda dengan F. sambunicum, antara lain
berdasarkan karakter kelimpahan dan bentuk mikrokonidianya.
Sedangkan F. solani dibedakan dari F. tricinctum berdasarkan
karakter bentuk makrokonidianya, juga bentuk mikrokonidianya
relatif lebih besar untuk F. solani dengan mikrokonidianya
berbentuk elips.
Cowan (1999) menerangkan bahwa tanaman memiliki
kemampuan yang tidak terbatas dalam mensintesis substansi

87

Aspek PRODUKSI

aromatis yang kebanyakan merupakan senyawa fenol atau turunan


oksigen-tersubstitusinya. Pada umumnya senyawa-senyawa
tersebut merupakan metabolit sekunder yang seringkali berperan
dalam mekanisme pertahanan tanaman terhadap serangan
mikroorganisme, serangga ataupun herbivora.

Gambar 5. Keragaman makrokonidia (a) dan mikrokonidia


(b) Fusarium spp. (isolat Ga-1, Ga- 2, Ga-9, Ga12, Ga-15, Ga-17, Ga-20, dan Ga-21) dengan
perbesaran 40x

Gambar 6. Keragaman makrokonidia (a) dan mikrokonidia


(b) Fusarium spp. (isolat Ga-4, Ga-5, GA-7, Ga8, GA-10, Ga-11, Ga-14, dan Ga-18) dengan
perbesaran 40x

88

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

Gambar 7. Keragaman makrokonidia (a) dan mikrokonidia


(b) Fusarium spp. (isolat Ga-3, Ga-6, Ga-13, Ga-16,
dan Ga-19) dengan per-besaran 40x

Gaharu merupakan senyawa fitoaleksin dari pohon gaharu


sebagai mekanisme pertahanannya terhadap infeksi patogen. Kayu
beresin ini merupakan metabolit sekunder yang dibentuk tanaman
sebagai respon pertahanan. Pohon penghasil gaharu sehat tidak
pernah memproduksi sesquiterpenoid sebagai metabolit sekunder
yang beraroma harum (Yuan dalam Isnaini, 2004). Tanaman dapat
mensintesis dan mengakumulasi metabolit sekunder sebagai respon
terhadap infeksi oleh agen tertentu, rangsangan fisiologi maupun
keadaan cekaman (Goodman et al. dalam Isnaini, 2004).
Metabolit sekunder dalam sistem pertahanan tanaman, baik
fitoantisipin maupun fitoaleksin, memainkan peranan penting
(Verpoorte et al., 2000). Fitoantisipin adalah senyawa aktif anti
mikrobial yang telah terdapat pada tanaman, kadangkala terpicu
pengaktifannya saat pelukaan. Fitoaleksin adalah senyawa aktif
anti mikrobial yang diproduksi secara de novo setelah pelukaan
atau infeksi. Biosintesis keduanya terpicu pada level gen (Verpoorte
et al., 2000; Vidhyasekaran, 2000).
Metabolit sekunder tanaman yang diturunkan dari terpenoid
memiliki berbagai fungsi dalam tanaman, di antaranya sebagai
minyak esensial (monoterpenoid), atraktan serangga, fitoaleksin
sebagai agen anti mikrobial (sesqui-, di-, dan triterpena). Berdasarkan
berbagai fungsi tersebut, ekspresi dari jalur biosintesis yang terlibat
akan berbeda. Terdapat jalur biosintesis yang terpicu pada level
gen setelah pelukaan atau infeksi dan ada yang terjadi pada level
senyawa, di mana senyawa yang telah ada secara enzimatis dirubah
menjadi senyawa aktif ketika pelukaan. Sebagai contoh, biosintesis
sesquiterpena tertentu pada solanaceae terpicu oleh infeksi
mikroba, sedangkan pada tanaman lain biosintesis sesquiterpenoid

89

Aspek PRODUKSI

merupakan ekspresi pembentukan yang umum, misalnya pada


Morinda citrifolia, anthraquinone biasa ditemukan di seluruh bagian
tanaman (Verpoorte, 2000).
Konsentrasi metabolit sekunder bervariasi antar spesies, antar
jaringan (konsentrasi tertinggi berada di kulit, kayu teras, akar,
pangkal percabangan, dan jaringan luka), antar pohon dalam
spesies yang sama, antar spesies, dan antar musim. Jenis-jenis
tropis dan sub-tropis umumnya mengandung jumlah ekstratif yang
lebih banyak dibanding jenis-jenis di daerah temperet (Forestry
Comission GIFNFC, 2007).
Metabolit sekunder pada kayu dapat disebut sebagai zat ekstratif.
Zat ekstratif yang terdiri dari bermacam-macam bahan ini memilki
fungsi yang penting dalam daya tahan terhadap serangan jamur dan
serangga, memberi bau, rasa, dan warna pada kayu. Zat ekstratif
pada kayu teras dapat menjadi pertahanan pohon terhadap agen
perusak meskipun pengaruhnya sangat bervariasi pada berbagai
habitat (Hills, 1987). Rowell (1984) menyatakan bahwa di antara
fungsi zat ekstratif adalah sebagai bagian dari mekanisme sistem
pertahanan pohon terhadap serangan mikroorganisme. Metabolit
sekunder tanaman efektif dalam melawan hama dan agen penyakit,
karena analog dengan komponen vital tertentu dari sistem sinyal
seluler atau dapat terlibat dengan enzim vital dan memblokir jalur
metabolisme (Forestry Comission GIFNFC, 2007).

B. Analisis Infeksi Batang


Dalam kondisi menghadapi infeksi oleh jamur, pohon penghasil
gaharu akan memberi respon untuk mempertahankan dan
memulihkan dirinya. Daya tahan pohon akan menentukan pemenang
antara pohon dengan penyakit yang disebabkan mikro-organisme
tersebut. Dalam hal pembentukan gaharu tentunya diharapkan
penyakitlah yang akan menang, sehingga dihasilkan produk gaharu
yang diinginkan. Senyawa kimia yang dimiliki pohon merupakan
salah satu upaya pertahanan pohon terhadap mikroorganisme
penyebab penyakit. Gaharu sendiri telah diidentifikasi sebagai
sesquiterpenoid, senyawa pertahanan tipe fitoaleksin. Kerentanan
pohon dalam menghadapi infeksi jamur akan berkaitan dengan

90

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

gaharu yang terbentuk, dapat direfleksikan masing-masing oleh


besar infeksi dan komponen kimianya.
Pada Gambar 8 terlihat panjang infeksi yang terjadi pada batang
pohon A. microcarpa pada umur inokulasi 2 bulan dan 6 bulan.
Pada umur inokulasi 2 bulan isolat Fusarium spp. asal Gorontalo
memperlihatkan nilai infeksi yang paling besar, yaitu 4,13 cm diikuti
oleh isolat campuran, Padang, Kalbar, dan yang terendah adalah
infeksi yang terbentuk oleh isolat asal Jambi. Dari hasil analisis
sidik ragam, terlihat bahwa asal isolat berpengaruh nyata terhadap
panjang infeksi yang terjadi pada batang A. microcarpa. Hasil uji
lanjut Duncan memastikan bahwa pada dua bulan sejak inokulasi,
isolat asal Gorontalo menyebabkan infeksi yang paling besar pada
batang pohon penghasil gaharu, diikuti oleh isolat campuran (Tabel
4).
Berbeda dengan kondisi pada Tabel 4. Uji lanjut Duncan
untuk infeksi 2 bulan
umur 2 bulan, pada umur inokulasi 6
umur inokulasi
bulan, isolat campuran menyebabkan
infeksi yang lebih tinggi dibandingkan
Asal isolat
Rataan
isolat yang lain (Gambar 8). Pada saat
(Isolate origin)
(Mean value)
ini, secara statistik asal isolat tidak
1,857a
lagi memberikan pengaruh nyata Jambi
2,223a
terhadap infeksi yang terbentuk pada Kalimantan Barat
batang A. microcarpa. Namun sama Padang
2,297a
halnya dengan kondisi pada umur Campuran
3,193a
inokulasi 2 bulan, dari Gambar 8
Gorontalo
4,133a
terlihat bahwa infeksi tertinggi masih
Keterangan: Nilai yang diikuti oleh huruf yang
disebabkan oleh isolat asal Gorontalo
sama tidak berbeda nya-ta pada 0,05
dan campuran.

91

huruf yang sama tidak berbeda nya-

bentuk pada batang A. mita pada 0,05


crocarpa. Namun sama halnya dengan kondisi pada umur inokulasi 2 bulan, dari Gambar 8
Aspek PRODUKSI
terlihat bahwa infeksi tertinggi masih disebabkan oleh isolat asal
Gorontalo dan campuran.

8. Panjang
infeksi
batang
A. microcarpa
GambarGambar
8. Panjang
infeksi
batang
A. microcarpa

Gambar 9 menunjukkan perubahan panjang infeksi yang

Gambar
9 menunjukkan
perubahan
panjang
infeksi Meskipun
yang terjadi
terjadi sejak
dua bulan inokulasi
hingga
bulan keenam.
sejak masih
dua bulan
inokulasi
hingga
bulan
keenam.
Meskipun
merupakan isolat yang menyebabkan infeksi terbesar,masih
tetapi infeksi
bulan
keenam
oleh isolatinfeksi
asal Gorontalo
terlihat
merupakan
isolat
yang
menyebabkan
terbesar,
tetapitidak
infeksi
perkembangan,
oleh
keempat
asal
bulanmengalami
keenam oleh
isolat asal sedangkan
Gorontaloinfeksi
terlihat
tidak
mengalami
perkembangan, sedangkan infeksi oleh keempat asal isolat71yang
|
lain menunjukkan peningkatan yang beragam. Namun begitu,
secara statistik untuk bulan keenam inokulasi, asal daerah isolat
tidak memberikan pengaruh nyata pada laju infeksi yang terjadi
(nilai signifikansi 0,186 pada 5%).

Gambar 9. Laju infeksi pada batang A. microcarpa

92

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

Perkembangan infeksi yang terjadi hingga 6 bulan setelah


inokulasi menunjukkan asal daerah isolat tidak lagi memberikan
pengaruh yang nyata, meskipun yang terbesar masih disebabkan
oleh isolat campuran dan isolat asal Gorontalo. Hal ini diduga
ada kaitannya dengan pertahanan masing-masing pohon contoh.
Meskipun tetap menyebabkan infeksi yang besar, kekonsistenan
perkembangan infeksi sebaiknya diteliti lebih lanjut dengan
mengikuti perkembangan laju infeksi oleh isolat asal Gorontalo ini
hingga kurun waktu tertentu.
Dari perkembangan infeksi pada pohon A. microcarpa ini dapat
dikatakan bahwa isolat asal Gorontalo menyebabkan infeksi yang
terbesar, yang berarti isolat ini menghasilkan kuantitas gaharu yang
paling besar. Meskipun isolat campuran menunjukkan panjang
infeksi yang lebih tinggi saat 6 bulan setelah inokulasi, namun ada
kemungkinan hal ini masih merupakan pengaruh dari isolat asal
Gorontalo tersebut.

KESIMPULAN
1. Secara morfologi isolat Fusarium spp. didominasi warna putih,
namun terdapat warna koloni merah muda, kuning, dan ungu.
Hampir semua isolat memiliki aerial miselium. Secara histologi
isolat Fusarium spp. memiliki karakter makrokonidia bersepta
3-4 dan makrokonidia didominasi oleh bentuk elips.
2. Uji perbedaan kecepatan tumbuh menunjukkan bahwa isolat Ga9, Ga-11, dan Ga-17 merupakan isolat yang memiliki kecepatan
tumbuh tinggi apabila dibandingkan dengan isolat Fusarium
yang lain.
3. Hasil inokulasi Fusarium spp. pada batang Aquilaria microcarpa
dapat dianalisis kuantitas dan kualitasnya melalui pendekatan
besaran infeksi dan komponen kimia yang dapat dianggap
masing-masing sebagai refleksi kuantitas dan kualitas gaharu
yang terbentuk.
4. Isolat Fusarium spp. asal Gorontalo menyebabkan infeksi yang
paling besar, jadi sebaiknya isolat ini digunakan untuk inokulasi

93

Aspek PRODUKSI

pada A. microcarpa jika diinginkan hasil gaharu dalam jumlah


besar.

DAFTAR PUSTAKA
Adelina, N. 2004. Seed Leaflet : Aquilaria malaccensis Lamk. Forest
and Landscape Denmark. www.SL.kvl.dk. [2 Februari 2007].
Barden, A., A.A. Nooranie, M. Teresia, and S. Michael (2000). Heart of
The Matter Agarwood Use and Trade and CITES Implementation
for Aquilaria malaccensis, TRAFFIC Network. pp. 2.
Booth, C. (1971). The Genus Cylondrocarpon. (England :
Commonwealth Mycological Institute). pp. 120-127.
Cowan, M. 1999. Plant Products as Antimicrobial Agents. Clinical
microbiology Review.12 (4) : 564-582.
Forestry Commission GIFNFC. 2007. Chemicals from Trees. http: //
treechemicals. csl. gov.uk/review/extraction.cfm. [14 Juli 2007].
Heyne, K. (1987). Tumbuhan Berguna Indonesia. Jilid III. Badan
Litbang Kehutanan. Jakarta. pp. 267-269.
Hills, W. E. 1987. Heartwood and Tree Exudates. Berlin : SpringerVerlag. Hua SST. 2001. Inhibitory Effect of Acetosyringone on
Two Aflatoxin Biosynthetic Genes. Applied Microbiology 32 :
278-281.
Irawati. 2004. Karakterisasi Mikoriza Rhizocstonia dari Perakaran
Tanaman Vanili Sehat. Tesis. Magelang. pp. 6-7.
Isnaini, Y. 2004. Induksi Produksi Gubal Gaharu Melalui Inokulasi
Cendawan dan Aplikasi Faktor Biotik. Disertasi). Program
Pascasarjana Institut Pertanian Bogor. Bogor
Luciasih, A., D. Wahyuno, dan E. Santoso. 2006. Keanekaragaman
Jenis Jamur yang Potensial dalam Pembentukan Gaharu dari
Batang Aquilaria spp. Jurnal Penelitian Hutan dan Konservasi
Alam III(5):555-564. Pusat Litbang Hutan dan Konservasi Alam.
Bogor.
Rowell, Rm. 1984. The Chemistry of Solid Wood. Washington :
American Chemical Society.

94

Teknologi Induksi Pohon .....(Erdy Santoso, dkk)

Soehartono, T., A. Mardiastuti. 2002. CITES and Implementation in


Indonesia. Nagao Natural Environment Foundation. Jakarta.
Sumadiwangsa, E. S. dan Harbagung. 2000. Laju Pertumbuhan
Tegakan Gaharu (Aquilaria malaccensis) di Riau yang Ditanam
dengan Intensitas Budidaya Tinggi dan Manual. Info Hasil
Hutan 6 (1) : 1-16. Pusat Penelitian Hasil Hutan. Bogor.
Surata, I K., I M. Widnyana. 2001. Teknik Budidaya Gaharu. Aisuli
14. Balai Penelitian Kehutanan Kupang.
Trupti, C., P. Bhutada, K. Nandakumar, R. Somani, P. Miniyar,
Y. Mundhada, S. Gore, K. Kain. 2007. Analgesik and AntiImflamatoryactivity of Heartwood of Aquilaria agallocha in
Laboratory Animal. Pharmacology-online 1 : 288-298.
Verpoorte, R.; R van der Heijden, J. Memelink. 2000. General
Strategies. In Verpoorte, R. and Alfermann, A. W. (Editors).
Metabolic Engineering of Plant Secondary Metabolism. Kluwer
Academic Publisher. Dordrecht, Boston, London. p : 31-50.
Verpoorte, R. 2000. Plant Secondary Metabolism. In : Verpoorte, R.
and Alfermann, A. W. (Editors). Metabolic Engineering of Plant
Secondary Metabolism. Kluwer Academic Publisher. Dordrecht,
Boston, London. p : 1-30.
Vidhyasekaran, P. 2000. Physiology of Disease Resistant in Plant. CRC
Press Inc. Boca Raton, Florida.

95

96

4
EFEKTIVITAS DAN INTERAKSI
ANTARA Acremonium sp. DAN
Fusarium sp. DALAM PEMBENTUKAN
GUBAL GAHARU PADA Aquilaria
microcarpa
Gayuh Rahayu
Departemen Biologi, FMIPA, Institut Pertanian Bogor
Erdy Santoso
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam
Esti Wulandari
Departemen Biologi, FMIPA, Institut Pertanian Bogor

LATAR BALAKANG
Gaharu merupakan salah satu komoditi hasil hutan bukan
kayu (HHBK) yang dihasilkan oleh beberapa spesies pohon gaharu
(Aquilaria sp., Magnoliopsida, Thymelaeaceae). Proses pembentukan
gubal pada pohon gaharu, hingga saat ini masih terus diteliti.
Menurut Nobuchi dan Siripatanadilok (1991), gubal gaharu diduga
dapat terbentuk melalui infeksi cendawan. Beberapa spesies
Fusarium seperti F. oxyporum, F. bulbigenium, dan F. lateritium
telah berhasil diisolasi oleh Santoso (1996). Selain itu, Rahayu et
al. (1999) menyatakan bahwa beberapa isolat Acremonium sp.
asal gubal gaharu pada Gyrinops verstegii (sin. A. filaria) dan A.
malaccensis mampu menginduksi gejala pembentukan gubal pada
pohon gaharu (A. crassna, A. malaccensis, A. microcarpa) umur

97

Aspek PRODUKSI

2 tahun. Pada gubal gaharu, hasil induksi cendawan, terdeteksi


senyawa oleoresin (Prema dan Bhattacharyya, 1962). Rahayu et al.
(2007) dan Rahayu (2008) juga menyatakan bahwa Acremonium sp.
merangsang perubahan warna kayu dan pembentukan senyawa
terpenoid. Oleh sebab itu, perubahan warna kayu dan adanya
senyawa terpenoid dijadikan indikator efektivitas dan interaksi
antara inokulan dalam pembentukan gubal.
Acremonium sp. dan Fusarium sp. seringkali diperoleh dari satu
gejala gubal. Mekanisme infeksi kedua cendawan ini pada satu lokasi
infeksi belum dipelajari. Padahal menurut Sticher et al. (1997), pada
beberapa kasus infeksi cendawan pada tumbuhan, infeksi cendawan
yang pertama dapat membangkitkan resistensi yang disebut Systemic
Acquired Resistance (SAR) terhadap infeksi cendawan kedua.
Sebagai contoh, Caruso dan Kuc (1977) menyatakan bahwa infeksi F.
oxysporum f.sp. cucumerinum dapat membangkitkan SAR tanaman
semangka terhadap infeksi Colletotrichum lagenarium. Liu et al. (1995)
juga menemukan proses SAR dari infeksi Pseudomonas lachrymans
pada timun terhadap F. oxysporum. Infeksi ganda Fusarium sp. dan
Acremonium sp. melalui pemanfaatan kedua cendawan tersebut
sebagai penginduksi ganda memerlukan informasi awal mengenai
kemungkinan terbentuknya SAR yang dibangkitkan oleh Fusarium sp.
terhadap Acremonium sp. dan sebaliknya. Oleh sebab itu penelitian
ini bertujuan untuk mengetahui efektivitas dan interaksi antara
Acremonium sp. terhadap Fusarium sp. dalam pembentukan gubal pada
pohon gaharu (A. microcarpa).

BAHAN DAN METODE


A. Bahan
Bahan dan alat yang digunakan adalah pohon A. microcarpa
umur 13 tahun di Hutan Penelitian Carita, Banten, biakan
Acremonium sp. IPBCC 07.525 (koleksi IPBCC, Departemen Biologi
FMIPA IPB), dan Fusarium sp. yang berasal dari Aquilaria sp. Padang
(koleksi Laboratorium Mikrobiologi Hutan, Pusat Penelitian dan
Pengembangan Hutan dan Konservasi Alam), larutan gula 2%,

98

alkohol, aquades, bor, mata bor berukuran 4 mm, meteran, bahan


pelet, dan alat pencetaknya.

B. Metode
1. Pembuatan Inokulan
Acremonium sp. dan Fusarium sp. diremajakan pada media agaragar kentang dekstrosa (Difco) dan diinkubasi pada suhu ruang
selama 7 hari. Biakan ini akan digunakan sebagai sumber inokulum
untuk pembuatan inokulan. Acremonium sp. ditumbuhkan pada
media serbuk gergaji selama 2 minggu, kemudian dibentuk berupa
pelet dengan ukuran 4 mm x 40 mm. Fusarium sp. ditumbuhkan pada
300 ml media cair, dan diinkubasi selama 3 minggu menggunakan
inkubator bergoyang.

2. Uji Efektivitas dan Interaksi Acremonium sp. dan Fusarium sp.


Pertama-tama, sederetan lubang dibuat di sekeliling batang
utama (mulai ketinggian 0,5-1 m di atas permukaan tanah) dengan
mata bor berdiameter 4 mm, dengan kedalaman lubang maksimal
1/3 diameter batang. Jarak antar lubang dalam deretan sekitar 5 cm.
Ke dalam deretan lubang ini dimasukkan inokulan 1 sampai lubang
dipenuhi oleh inokulan. Seminggu kemudian, pohon dilubangi lagi
pada jarak 15 cm secara vertikal dari deretan lubang yang pertama.
Ke dalam lubang pada deretan kedua ini dimasukkan inokulan 2.
Pasangan inokulan (FA atau AF) adalah set perlakuan. Jarak antar
set perlakuan dalam 1 pohon 30 cm. Untuk inokulan berupa pelet,
lubang diberi larutan gula 2% sebelum pemberian inokulan. Batang
yang tidak diberi perlakuan (K), yang dilubangi saja (B), batang yang
dilubangi dan diberi larutan gula (G), serta batang dengan perlakuan
tunggal (diberi Acremonium sp. saja (AA) atau Fusarium sp. saja
(FF)) digunakan sebagai pembanding. Pengamatan dilakukan setiap
1 bulan selama 4 bulan.
Efektivitas dan interaksi diukur melalui perkembangan
pembentukan gejala gubal di sekitar daerah induksi. Perubahan
warna batang dan pembentukan wangi merupakan indikator
pembentukan gubal. Batang di sekitar lubang dikupas kulitnya,
kemudian zona perubahan warna batang diukur secara horizontal

99

Aspek PRODUKSI

dan vertikal. Daerah yang menunjukkan perubahan warna kayu


dari putih menjadi coklat-kehitaman diambil dengan dipahat dan
dibawa ke laboratorium untuk pengamatan selanjutnya. Perubahan
warna diamati pada 10 titik untuk setiap pohon. Tingkat perubahan
warna kayu ditetapkan berdasarkan sistem skor (0 = putih, 1 = putih
kecoklatan, 2 = coklat, 3 = coklat kehitaman). Tingkat perubahan
warna kayu dinyatakan dalam rataan dari hasil pengamatan 3
responden.
Wangi ditetapkan berdasarkan sistem skor (0 = tidak wangi, 1
= agak wangi, 2 = wangi). Kayu di sekitar titik inokulasi dipahat,
kemudian diamati wanginya secara organoleptik ketika kayu
dibakar. Wangi dinyatakan dalam tingkat wangi dan persentase
titik induksi dengan kategori agak wangi dan sangat wangi. Tingkat
wangi dinyatakan dalam rataan skor dari 3 responden.

3. Deteksi Senyawa Terpenoid


Senyawa terpenoid dideteksi dengan metode LiebermanBurchard (Harborne, 1987). Setelah diamati tingkat wanginya, sampelsampel dari kayu yang mengalami perubahan warna dipisahkan
dari bagian yang sehat. Sebanyak 0,4 g kayu yang berubah warna
direndam dalam 5 ml etanol absolut panas, kemudian disaring pada
cawan petri steril dan diuapkan sampai kering (sampai terbentuk
endapan berwarna kuning). Pada endapan ditambahkan 1 ml dietil
eter pekat, dihomogenisasi lalu dipindahkan ke tabung reaksi steril,
ditambahkan 3 tetes asam asetat anhidrat dan 1 tetes H2SO4 pekat.
Perubahan warna menjadi merah atau ungu menunjukkan adanya
senyawa triterpenoid (Harbone, 1987). Sebanyak 5 ml etanol absolut
ditambahkan ke dalam larutan, kemudian absorbansinya diukur
dengan spektrofotometer pada 268 nm.

4. Analisis Data
Data hasil pengamatan (panjang, lebar zona perubahan warna,
tingkat perubahan warna, dan tingkat wangi) dianalisis dengan
SAS versi 9.1 menggunakan Rancangan Acak Lengkap (RAL) satu
faktor dengan waktu dan uji F pada = 5%. Bila terdapat pengaruh
nyata dari perlakuan yang diamati maka setiap taraf perlakuan

100

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

dibandingkan dengan menggunakan uji lanjut Duncan pada taraf


5%.

HASIL
A. Efektivitas Inokulan dalam Menginduksi Gejala
Pembentukan Gubal Gaharu
Secara umum semua perlakuan menyebabkan perubahan warna
kayu dan merangsang munculnya perubahan aroma kayu (Tabel 1).
Pemberian gula menyebabkan gejala pembentukan gubal gaharu
menjadi tertekan. Efektivitas inokulan tunggal maupun ganda
Acremonium dan Fusarium relatif lebih tinggi dalam merangsang
pembentukan gejala gubal gaharu dibandingkan dengan metode
induksi lainnya, Sebagai inokulan tunggal A dan F memiliki
efektivitas yang relatif sama. Gejala pembentukan gubal akibat
inokulan ganda juga cenderung tidak berbeda nyata dari inokulan
tunggalnya. Berdasarkan persentase titik induksi pada kategori
wangi, inokulan ganda lebih efektif. Di antara inokulan ganda, AF
lebih efektif dalam menginduksi pembentukan wangi daripada
FA dan inokulan tunggal. Sedangkan pada parameter lainnya, AF
justru lebih baik.
Tabel 1. Pembentukan gejala gubal gaharu hasil inokulasi cendawan tunggal
dan ganda
Rataan*
Perubahan warna kayu
Perlakuan
Panjang
(cm)

Lebar
(cm)

Warna
(skor)

Wangi
(skor)

Titik
induksi
agak
wangi
(%)

Titik
induksi
wangi
(%)

Inokulan
tunggal

AA

2,54ab

0,82a

1,90b

0,63ab

34,37

1,39

FF

3,14a

0,94a

1,45c

0,62ab

31,07

0,00

Inokulan
ganda

AF

3,20a

0,87a

1,75b

0,70a

39,55

6,24

FA

3,30a

0,83a

2,18a

0,59ab

20,12

4,16

101

Aspek PRODUKSI

Rataan*
Perubahan warna kayu
Perlakuan
Panjang
(cm)

Lebar
(cm)

Warna
(skor)

Wangi
(skor)

Titik
induksi
agak
wangi
(%)

Titik
induksi
wangi
(%)

Kontrol
positif

1,86b

0,55b

1,02d

0,38c

10,41

0,00

2,87ab

0,73ab

1,16d

0,47bc

11,11

0,00

Kontrol
negatif

0,00c

0,00c

0,00e

0,00d

0,00

0,00

* dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada
kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Kayu mengalami perubahan warna dari putih menjadi coklat atau


coklat kehitaman (Gambar 1). Pemberian inokulan tidak berpengaruh
pada panjang dan lebar zona perubahan warna. Namun panjang zona
perubahan warna tertinggi terjadi berturut-turut pada kayu yang
diberi perlakuan ganda FA dan AF. Sedangkan tingkat perubahan
warna dipengaruhi oleh inokulan. Tingkat perubahan warna tertinggi
pada FA dan berbeda nyata dari perlakuan lainnya.

Pemberian inokulan juga tidak berpengaruh nyata terhadap


pembentukan wangi. Berbeda dengan perubahan warna kayu,
tingkat wangi tertinggi terjadi pada kayu yang diberi inokulan
ganda AF. Secara rataan nilai tingkat wangi yang terbentuk dari
hasil perlakuan inokulan termasuk dalam kategori tidak wangi,
Meskipun demikian, pemberian inokulan meningkatkan persentase
titik induksi yang wangi. Bahkan inokulan tunggal AA dan inokulan
ganda menghasilkan titik induksi pada kategori wangi (Tabel 1).

Gambar 1. Perubahan warna kayu dengan tingkat kegelapan


yang berbeda dari (a) intensitas terendah sampai
(d) intensitas tertinggi

102

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Periode induksi berpengaruh pada semua parameter


pembentukan gubal kecuali panjang zona perubahan warna (Tabel
2). Secara umum, nilai parameter pembentukan gubal tertinggi
terjadi pada bulan ke-2, kecuali tingkat perubahan warna. Pada
bulan ke-2 induksi, intensitas warna cenderung naik, tapi intensitas
warna kayu pada bulan ke-4 relatif sama dengan bulan ke-3.
Tabel 2. Pengaruh periode induksi pada gejala pembentukan gubal gaharu
Rataan*
Perubahan warna kayu
Bulan
Tingkat
(skor)

Wangi
(skor)

Titik
induksi
agak
wangi
(%)

Titik
induksi
wangi
(%)

Panjang
(cm)

Lebar
(cm)

2,46ab

0,68a

0,83c

0,32c

8,43

0,00

2,58a

0,71a

1,24b

0,64a

39,47

0,00

2,32ab

0,65b

1,67a

0,51b

17,45

0,00

2,26b

0,65b

1,65a

0,36c

18,45

6,74

* dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada
kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

B. Interaksi Inokulan 1 dan Inokulan 2


Secara umum inokulan 1 tidak membangkitkan resistensi pohon
terhadap inokulan 2 (Tabel 3). Inokulasi F sebelum inokulasi A tidak
mempengaruhi pembentukan gejala gubal pada titik A termasuk
pembentukan wangi. Kehadiran F justru cenderung meningkatkan
respon perubahan warna kayu akibat inokulasi A. Demikian
pula inokulasi A sebelum F tidak mempengaruhi pembentukan
gejala gubal pada titik F, kecuali warna pada F menjadi lebih
gelap dan persentase titik induksi yang wangi relatif lebih tinggi
dibandingkan dengan inokulan tunggalnya. Inokulan ganda AF dan
FA menghasilkan masing-masing 8,33% titik induksi pada kategori
wangi.
Infeksi sekunder juga tidak secara konsisten mempengaruhi
infeksi primer (Tabel 4). Inokulasi F sebelum inokulasi A cenderung
tidak mempengaruhi pembentukan gejala gubal termasuk tingkat

103

Aspek PRODUKSI

wangi, kecuali pada perubahan warna kayu. Intensitas warna pada


titik induksi F lebih baik dibandingkan dengan perlakuan tunggalnya.
Infeksi kedua oleh F juga cenderung tidak mempengaruhi gejala
pembentukan gubal dan tingkat wangi.
Infeksi sekunder oleh cendawan yang sama dengan cendawan
tidak berpengaruh pada pembentukan gejala gubal (Tabel 5).
Meskipun demikian, secara umum nilai parameter gejala gubal
pada titik infeksi sekunder lebih rendah daripada pada titik infeksi
primernya. Inokulan A dan F memiliki potensi yang relatif sama
dalam merangsang pembentukan wangi.
Tabel 3. Pengaruh inokulan 1 terhadap inokulan 2 dalam gejala pembentukan
gubal gaharu
Rataan*
Perubahan warna kayu

Perla-kuan

Panjang
(cm)

Lebar (cm)

Warna
(skor)

Wangi
(skor)

Titik
induksi
agak wangi
(%)

Titik
induksi
wangi (%)

FAa

2,73abc

0,71bcd

2,15ab

0,60ab

26,37

8,33

AAa

1,96bc

0,66bcd

1,82bc

0,63ab

36,11

0,00

AFf

2,52abc

0,83abcd

1,57cd

0,70a

40,27

8,33

FFf

2,61abc

0,75abcd

1,36de

0,62ab

27,78

0,00

GGg

1,75c

0,53d

1,02e

0,38c

0,00

0,00

BBb

2,40abc

0,65cd

1,13e

0,47bc

0,00

0,00

KKk

0,00e

0,00e

0,00f

0,00d

0,00

0,00

* dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada
kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 4. Pengaruh infeksi sekunder dengan cendawan yang berbeda dari


cendawan penginfeksi primer
Rataan*
Perlakuan

Perubahan warna kayu


Wangi
(skor)

Titik
induksi
agak
wangi
(%)

Titik
induksi
wangi
(%)

Panjang
(cm)

Lebar
(cm)

Warna
(skor)

FFF

3,68ab

0,99ab

1,53cd

0,62ab

34,37

0,00

FAF

3,87a

0,95abc

2,22a

0,50bc

13,89

0,00

104

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Rataan*
Perlakuan

Perubahan warna kayu


Wangi
(skor)

Titik
induksi
agak
wangi
(%)

Titik
induksi
wangi
(%)

Panjang
(cm)

Lebar
(cm)

Warna
(skor)

AAA

3,13abc

0,96abc

1,98ab

0,63ab

32,63

2,78

AFA

3,88a

1,06a

1,93ab

0,70a

38,86

4,15

GGG

1,98bc

0,56d

1,01e

0,38c

20,83

0,00

BBB

3,35abc

0,80abcd

1,20de

0,47bc

13,89

0,00

KKK

0,00d

0,00e

0,00f

0,00d

0,00

0,00

* dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada
kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

Tabel 5. Pengaruh infeksi sekunder cendawan yang sama dengan cendawan


penginfeksi primernya
Rataan*
Perlakuan

Panjang
(cm)

Lebar
(cm)

Warna
(skor)

Wangi
(skor)

Titik
induksi
agak
wangi (%)

Titik
induksi
wangi (%)

AAA

3,13abc

0,96abc

1,98ab

0,63ab

32,63

2,78

AAa

1,96bc

0,66bcd

1,82bc

0,63ab

36,11

0,00

FFF

3,68ab

0,99ab

1,53cd

0,62ab

34,37

0,00

FFf

2,61abc

0,75abcd

1,36de

0,61ab

27,78

0,00

* dari 3 ulangan kecuali pada kriteria panjang dan lebar rataan dari 5 ulangan, huruf yang berbeda pada angka pada
kolom yang sama menunjukkan berbeda nyata pada uji Duncan pada = 0,05

C. Pembentukan Senyawa Terpenoid


Senyawa terpenoid terdeteksi pada semua perlakuan. Pada
perlakuan tunggal FF dan gandanya terbentuk warna merah,
yang menunjukkan adanya senyawa triterpenoid. Warna merah
pada minyak gaharu dijadikan sebagai pembanding kandungan
triterpenoid perlakuan. Pada ekstrak kayu B, G, dan inokulan A
terbentuk warna hijau. Warna hijau ini menunjukkan adanya
senyawa sterol (Harborne, 1987). Sedangkan pada K tidak terbentuk

105

Aspek PRODUKSI

warna (bening). Hal ini menunjukkan bahwa pada K tidak terdapat


senyawa triterpenoid maupun sterol.
Kandungan senyawa triterpenoid pada zona perubahan warna
bervariasi pada setiap perlakuan selama 4 bsi (Tabel 6). Secara
umum, nilai absorbansi ekstrak terpenoid hasil perlakuan kurang
dari nilai absorbansi minyak gaharu (0,813) sebagai pembandingnya.
Selain itu, secara umum nilai absorban perlakuan inokulan
ganda hampir sama dengan inokulan tunggal (Tabel 6). Hal
ini menunjukkan bahwa inokulan ganda tidak efektif dalam
meningkatkan kandungan senyawa terpenoid.
Inokulan AF maupun FA juga tidak mempengaruhi kandungan
terpenoid. Hal ini menunjukkan bahwa pemberian inokulan 2 tidak
mempengaruhi besarnya nilai absorban inokulan 1. Begitu pula
dengan nilai absorban inokulan 1 yang tidak dipengaruhi oleh
inokulan 2. Pada 3 bsi, perlakuan tunggal FF terbentuk endapan
merah dan memiliki nilai absorbansi yang relatif tinggi. Hal ini
menunjukkan kandungan triterpenoid yang relatif tinggi pula
(Tabel 6).
Tabel 6. Nilai absorbasi ekstrak kayu gaharu yang berubah warna
Perlakuan

Bulan ke1

0,29*

0,24*

0,34*

0,14*

0,12*

0,22*

0,39*

0,45*

AF A

0,20**

0,06*

0,25*

0,12**

AF F

0,20**

0,05*

0,23**

0,11*

FA F

0,12**

0,11**

0,21*

0,06*

FA A

0,12**

0,19**

0,23**

0,23*

AA

0,15*

0,20*

0,27*

0,40*

FF

0,14**

0,06*

0,25**

0,15*

* Endapan berwarna hijau; ** Endapan berwarna merah-kecoklatan

106

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

PEMBAHASAN
A. Efektivitas Induksi
Pohon-pohon yang diberi perlakuan menurun kebugarannya
mulai 1 bsi. Penurunan kebugaran ditunjukkan oleh adanya daundaun yang mengalami klorosis pada cabang pertama dan kedua dari
daerah lubang induksi dan kemudian daun-daun ini gugur. Secara
umum inokulan tunggal mengakibatkan klorosis pada daun-daun
di dua cabang dekat lubang induksi. Sedangkan pada pohon yang
diberi inokulan ganda klorosis terjadi pada tiga cabang dekat lubang
induksi. Berbeda dengan daun-daun pada pohon perlakuan, pada
pohon kontrol daun-daun tidak mengalami klorosis sampai akhir
pengamatan. Pada 2 bsi, jumlah daun yang mengalami klorosis
tidak berbeda dengan 1 bsi, tetapi klorosis hampir memenuhi
luasan helai daun.
Klorosis mungkin berhubungan dengan ketersediaan hara.
Ketersediaan hara terganggu karena jalur distribusinya ke daun
terhambat akibat pengeboran. Selain itu, adanya inokulan juga
menjadi penyebab klorosis. Caruso and Kuc (1977) menyatakan
bahwa Colletotrichum lagenarium menyebabkan klorosis pada daun
tanaman semangka dan muskmelon. Pohon semakin merana ketika
diserang ulat. Tajuk-tajuk pohon menjadi gundul. Berkurangnya
jumlah daun secara drastis dapat menghambat proses fotosintesis,
karena daun merupakan tempat utama berlangsungnya fotosintesis.
Fotosintat sebagai sumber karbon dalam pembentukan metabolit
sekunder antimikrob pun terganggu, karena kemungkinan sumber
karbon lebih diutamakan untuk pembentukan tunas baru. Pada
akhirnya, perkembangan gejala pembentukan gubal pun terganggu.
Perubahan warna kayu terjadi pada semua perlakuan.
Pelukaan, larutan gula, inokulasi Acremonium sp. dan Fusarium
sp. menyebabkan perubahan warna kayu dari putih menjadi gelap.
Menurut Braithwaite (2007) Acremonium sp. dan Fusarium sp.
berasosiasi dengan gejala perubahan warna kayu dan dicline pada
Quercus sp. di New Zealand. Sebelumnya, Walker et al. (1997) juga
menyatakan bahwa perubahan warna kayu menjadi warna coklat
(browning) dapat disebabkan oleh serangan patogen (cendawan)

107

Aspek PRODUKSI

dan kerusakan fisik. Perubahan warna kayu pada gaharu mungkin


dapat mengindikasi adanya senyawa gaharu. Hal ini didukung
oleh pernyataan Rahayu dan Situmorang (2006), bahwa perubahan
warna dari putih menjadi coklat-kehitaman merupakan gejala awal
terbentuknya senyawa gaharu.
Pemberian larutan gula (G) menekan perkembangan gejala
pembentukan gubal gaharu. Hal ini disebabkan karena gula
tersebut segera dipergunakan pohon untuk proses penyembuhan
daripada dimanfaatkan oleh cendawan. Menurut Nobuchi and
Siripatanadilok (1991), perubahan warna kayu menjadi coklat
muncul setelah sel-sel kehilangan pati akibat pelukaan.
Periode inkubasi cenderung mempengaruhi semua parameter
gejala gubal gaharu. Semakin lama periode induksi semakin gelap
warna kayu. Sedangkan pada parameter lainnya, nilai tertinggi
diperoleh pada bulan ke-2 induksi. Kemungkinan besar fenomena
ini berhubungan dengan kebugaran pohon yang menurun mulai
bulan ke-2.
Berdasarkan persentase titik induksi yang wangi, inokulan
ganda lebih baik dari inokulan tunggal maupun cara induksi
lainnya. Hal ini membuktikan bahwa wangi merupakan respon
spesifik terhadap bentuk gangguan (Rahayu et al., 2007).
Aroma wangi mulai terdeteksi pada bulan ke-2 dan menurun
pada bulan berikutnya. Aroma wangi merupakan bagian dari
senyawa gaharu (Rahayu et al., 2007). Senyawa wangi merupakan
senyawa yang mudah menguap sehingga kemungkinan besar
tergolong senyawa seskuiterpenoid. Namun demikian metabolisme
isopentenil pirofosfat sebagai pekursor pembentukan terpenoid
(McGarvey and Croteau, 1995) mungkin tidak berhenti pada produk
seskuiterpenoid tetapi dapat masuk dalam jalur metabolisme
selanjutnya. Pada penelitian ini senyawa triterpenoid dan sterol
juga terdeteksi. Hal ini menunjukkan bahwa metabolisme
terpenoid dapat berlangsung terus dan berakhir pada produk selain
seskuiterpenoid ketika dipanen.
Aroma wangi dan frekuensi wangi pada pemberian inokulan
ganda AF relatif lebih tinggi dibandingkan dengan perlakuan
lainnya. Namun, intensitas warna kayu lebih rendah dibandingkan

108

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

dengan pemberian inokulan ganda FA. Hal ini menunjukkan bahwa


aroma wangi yang dihasilkan tidak selalu sebanding dengan
intensitas warna kayu. Sesuai dengan pernyataan Rahayu et al.
(1999) bahwa terjadinya pembentukan wangi gaharu tidak selalu
diikuti oleh perubahan warna kayu.
Secara umum inokulan 1 tidak membangkitkan resistensi
pohon terhadap inokulan 2. Hal ini berbeda dari hasil penelitian
Krokene et al. (1999) yang membuktikan bahwa inokulasi
Heterobasidion annosum yang diikuti oleh Ceratocystis polonica
menekan pembentukan gejala bluestain pada pohon Norway spruce
(Picea abies). Kemungkinan besar hal ini disebabkan aktivitas
patologis yang berbeda. Acremonium dan Fusarium dikenal sebagai
penyebab busuk batang atau kanker batang pada pohon berkayu.
Heterobasidion juga menyebabkan busuk batang tetapi C. polonica
adalah penyebab bluestain saja dan tidak menyebabkan busuk
batang. Heterobasidion mungkin merangsang pohon membentuk
senyawa fitoaleksin yang bersifat anti C. polonica. Kemungkinan
lain adalah periode inokulasi antara inokulan 1 dan inokulan 2 yang
hanya berselang 1 minggu. Krokene et al. (1999) menyatakan bahwa
pada Norway spruce (P. abies) terhadap C. polonica terbentuk SAR
setelah 3 minggu infeksi H. annosum.

B. Pembentukan Senyawa Gaharu


Acremonium sp. dan Fusarium sp. dalam bentuk inokulan tunggal
atau inokulan ganda dapat merangsang pohon gaharu membentuk
senyawa terpenoid. Paine et al. (1997) menyatakan bahwa
serangan cendawan pada pohon Pinus akan merangsang pohon
untuk membentuk senyawa terpenoid sebagai pertahanan pohon.
Selain itu penelitian sebelumnya, Putri (2007) juga menyatakan
bahwa pemberian Acremonium sp. pada A. crassna terbukti dapat
merangsang pembentukan senyawa terpenoid.
Pada penelitian ini triterpenoid mulai terdeteksi pada 1 bsi.
Triterpenoid terdeteksi pada pemberian inokulan tunggal FF dan
inokulan ganda yang ditunjukkan dengan terbentuknya endapan
berwarna merah pada pengujian Lieberman-Burchard. Sedangkan
pada perlakuan B, G, dan inokulan tunggal AA terbentuk warna hijau.

109

Aspek PRODUKSI

Warna hijau ini mengindikasikan yang terbentuk adalah senyawa


sterol. Harborne (1987) menyatakan bahwa sterol merupakan salah
satu senyawa yang tergolong ke dalam senyawa terpenoid.

SIMPULAN
Semua pohon yag diinokulasi menurun kebugarannya sejak 1
bulan setelah inokulasi. Inokulan ganda terutama AF lebih efektif
daripada inokulan tunggal dalam merangsang pembentukan wangi.
Induksi dengan inokulan 1 yang hanya berselang 1 minggu dari
pemberian inokulan 2 tidak membangkitkan resistensi pohon
terhadap inokulan 2. Semua inokulan, kecuali inokulan tunggal A
merangsang pohon membentuk triterpenoid.

DAFTAR PUSTAKA
Benhamou, N., S. Gagn, D.L. Qur, L. Dehbi. 2000. BacterialMediated Induced Resistance in Cucumber: Beneficial Effect of
the Endophytic Bacterium Serratia plymuthica on the Protection
Against Infection by Pythium ultimum. Amer. Phytopathol. Soc.
90(1): 45-56.
Braithwaite, M., C. Inglis, M.A. Dick, T.D. Ramsfield, N.W. Waipara,
R.E. Beever, J.M. Pay and C.F. Hill. 2007. Investigation of Oak
Tree Decline In Theauckland Region. New Zealand Plant
Protection 60:297-303
Caruso, F.L., J. Kuc. 1977. Protection of Watermelon and Muskmelon
Against Colletotrichum lagenarium by Colletotrichum
lagenarium. Phytopathol. 67: 1285-1289.
Harbone, J.B. 1987. Metode Fitokimia. Padmawinata K dan I
Sudiro (penerjemah). Institut Teknologi Bandung. Bandung
Terjemahan dari: Phytochem Methods.
Krokene, P., E. Christiansen, H. Solheim, V.R. Franceschi, A.A.
Berryman. 1999. Induced Resistance to Phatogenic Fungi in
Norway Spruce. Plant Physiol. 121: 565-569.

110

Efektivitas dan Interaksi .....(Gayu Rahayu, dkk.)

Liu, L., J.W. Kloepper, S. Tuzun. 1995. Induction of Systemic Resistance


in Cucumber by Plant Growth-Promoting Rhizobacteria:
Duration of Protection and Effect of Host Resistance on
Protection and Root Colonization. Phytopathol. 85:1064-1068.
McGarvey, D.J. and F. Croteau. 1995. Terpenoid Metabolism. Plant
Cell 7:1015-1026.
Nobuchi, T., S. Siripatanadilok. 1991. Preliminary Observation
of Aquilaria crassna Wood Associated with the Formation of
Aloeswood. Bull. Kyoto Univ. Forest 63:226-235.
Paine, T.D., K.F. Raffa, T.C. Harrington. 1997. Interactions Among
Scolytid Bark Beetles, their Associated Fungi, and Host Conifers.
Annu. Rev. Entomol. 42:179-206.
Rahayu, G., Y. Isnaini, M.I.J. Umboh. 1999. Potensi Hifomiset dalam
Menginduksi Pembentukan Gubal Gaharu. Prosiding Kongres
Nasional XV dan Seminar Perhimpunan Fitopatologi Indonesia.
Purwokerto, 16-18 September 1999. Perhimpunan Fitopatologi
Indonesia. Purwokerto. hlm 573-581.
Rahayu, G., A.L. Putri dan Juliarni. 2007. Acremonium and MethylJasmonate Induce Terpenoid Formation in Agarwood Tree
(Aquilaria crassna). Makalah dipresentasikan dalam 3rd Asian
Conference on Crop Protection. Yogyakarta, 22-24 August 2007.
Rahayu, G. 2008. Increasing Fragrance and Terpenoid Production
in Aquilaria crassna by Multi-Application of MethylJasmonate Comparing to Single Induction of Acremonium sp.
Makalah dipresentasikan dalam International Conference on
Microbiology and Biotechnology. Jakarta, 11-12 November 2008.
Santoso, E. 1996. Pembentukan Gaharu dengan Cara Inokulasi. Makalah
Diskusi Hasil Penelitian dalam Menunjang Pemanfaatan Hutan
yang Lestari. Bogor, 11-12 Maret 1996. Pusat Litbang Hutan dan
Konservasi Alam. Hlm 1-3.
Sticher, L., B. Mauch-Mani, J.P. Mtraux. 1997. Systemic Acquired
Resistance. Institute de Biologie Vgtale, Universit de Fribourg,
3 route A Gockel, 1700 Fribourg. Switzerland.

111

112

Aspek
SILVIKULTUR

113

114

5
UJI PRODUKSI BIBIT TANAMAN
GAHARU SECARA GENERATIF DAN
VEGETATIF
Atok Subiakto, Erdy Santoso, Maman Turjaman
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Pengembangan tanaman gaharu umumnya tidak bertujuan untuk
menghasilkan kayu, melainkan ditujukan untuk menghasilkan resin
gaharu yang terbentuk dari respon tanaman atas infeksi mikroba,
khususnya jamur Fusarium sp., Cylindrocarpon sp., Trichoderma sp.,
Pythium sp., Phialophora sp., dan Popullaria sp. (Santoso et al., 2007;
Daijo and Oller, 2001; Parman et al., 1996; Sidiyasa dan Suharti, 1987).
Di alam, kurang dari 5% gaharu terbentuk dari populasi pohon dan
bila terbentuk biasanya kurang dari 10% biomas kayu pada pohon
yang terinfeksi. Namun gaharu alam dapat mencapai kualitas
tertinggi (kelas super) yang harganya bisa mencapai Rp 30 juta/kg.
Karena potensi harga yang sangat tinggi, eksploitasi gaharu alam
dilakukan tanpa mengindahkan kelestariannya. Akibatnya populasi
jenis-jenis gaharu menyusut tajam, sehingga jenis ini dimasukkan
dalam Appendix II CITES (Santoso et al., 2007). Konsekuensinya,
dalam perdagangan resmi, gaharu harus dihasilkan dari pohon
hasil budidaya, bukan dari alam.
Budidaya gaharu memerlukan input iptek agar pertumbuhan
dan produksi resin gaharu dapat optimal. Dukungan iptek dimaksud

115

Aspek SILVIKULTUR

berkaitan dengan aspek pembibitan dan penyuntikan stimulan


gaharu. Pembahasan makalah ini difokuskan pada aspek pembibitan
atau perbanyakan bibit pohon penghasil gaharu. Perbanyakan bibit
pohon penghasil gaharu dapat dilakukan, baik secara generatif
maupun vegetatif. Biji pohon penghasil gaharu tergolong rekalsitran
(Hou, 1960). Biji rekalsitran umumnya cepat berkecambah dan tidak
dapat disimpan dalam jangka panjang (Roberts and King, 1980).
Penerapan perbanyakan vegetatif dan pemuliaan pohon berpotensi
untuk menghasilkan bibit klon gaharu yang memiliki keunggulan,
baik pertumbuhan maupun produktivitas resin gaharunya.
Proyek ITTO PD 425/06 berupaya untuk mengembangkan dan
menerapkan iptek pada penanaman pohon penghasil gaharu
agar pertumbuhan dan produktivitas resin gaharunya tinggi.
Namun informasi iptek mengenai teknik perbenihan dan teknik
perbanyakan vegetatif gaharu masih sangat terbatas. Makalah ini
menyajikan hasil penelitian berkaitan dengan aspek perbenihan
dan perbanyakan stek gaharu.

METODE
A. Perbanyakan Generatif
Pengujian pada perbanyakan generatif dilakukan pada benih
(biji) dan cabutan (anakan alam). Benih pohon penghasil gaharu
yang digunakan pada uji penyimpanan dan daya kecambah benih
adalah campuran Aquilaria microcarpa dan A. malacensis asal
Sukabumi. Perlakuan pada uji penyimpanan benih adalah waktu
(0, 2, 4, 6, dan 8 minggu) dan temperatur penyimpanan (25,4-26,1oC
dan 4,9-6,5oC). Pengujian dilakukan menggunakan rancangan acak
lengkap dengan 5 ulangan.
Bibit cabutan yang digunakan dalam uji waktu simpan cabutan
adalah campuran Aquilaria microcarpa dan A. malacensis. Perlakuan
pada uji waktu simpan bibit cabutan adalah tiga waktu simpan (1, 2,
dan 3 hari penyimpanan) serta kondisi penyapihan (dalam sungkup
dan tanpa sungkup). Pengujian dilakukan menggunakan rancangan
acak lengkap dengan 5 ulangan.

116

Uji Produksi Bibit .....(Atok Subiakto, dkk.)

B. Perbanyakan Vegetatif
Teknik perbanyakan vegetatif yang digunakan pada penelitian
ini adalah teknik stek pucuk. Penelitian dilakukan pada rumah
kaca yang menggunakan sistem pendingin kabut KOFFCO system
(Sakai dan Subiakto, 2007; Subiakto dan Sakai, 2007). Bahan stek
yang digunakan pada pengujian ini adalah A. malacensis. Uji
produksi bibit stek gaharu dilakukan dalam tiga tahap. Perlakuan
pada pengujian pertama menggunakan prosedur rutin, yaitu media
campuran serbuk kulit kelapa dan sekam padi dengan perbandingan
2:1. Penyiraman 2 kali seminggu. Pada pengujian kedua perlakuan
intensitas penyiraman dikurangi menjadi sekali seminggu dengan
media arang sekam. Pada pengujian ketiga, media menggunakan
campuran serbuk kulit kelapa dan sekam padi dengan perbandingan
1:1 dan intensitas penyiraman 1 kali pada bulan pertama, 2 kali
pada bulan kedua, dan 3 kali pada bulan ketiga.

HASIL DAN PEMBAHASAN


A. Perbanyakan Generatif
Biji gaharu tergolong rekalsitran, sehingga harus secepatnya
dikecambahkan. Uji penyimpanan benih dilakukan untuk
mengetahui seberapa lama benih gaharu dapat disimpan. Hasil uji
pengecambahan biji dari dua kondisi penyimpanan disajikan pada
Tabel 1 dan Tabel 2. Kondisi penyimpanan (kondisi ruang dan dalam
re-frigerator) tidak secara nyata mempengaruhi perkecambahan
benih (P Anova = 0,0993). Di Tabel 1. Persen kecambah dari hasil uji
lain pihak, periode penyimpenyimpanan biji
panan mempengaruhi persen
Periode
Kondisi
Refrigerator
kecam-bah benih (P Anova = <
simpan
ruang (%)
(%)
0,0001).
Secara teknis pengecambahan biji gaharu mudah
dilakukan, media tabur dapat
menggunakan arang sekam

Langsung

82

2 minggu

69

69

4 minggu

77

69

6 minggu

56

61

8 minggu

48

24

117

Aspek SILVIKULTUR

atau zeolit. Dalam pengujian ini media kecambah yang digunakan


adalah arang sekam padi. Pada jenis-jenis biji rekalsitran seperti
meranti, penaburan biji dilakukan segera setelah buah yang masak
dan jatuh. Pada jenis gaharu penyimpanan pada kondisi ruang
selama 2 bulan masih dapat menghasilkan kecambah dengan
tingkat keberhasilan 48%.
Perkecambahan umumnya Tabel 2. Persen jadi bibit (6 minggu setelah penaburan) dari hasil uji
dimulai pada minggu kedua
penyim-panan biji
dan persen jadi bibit dihitung
pada minggu keenam setelah
Periode
Kondisi
Refrigerator
penaburan. Pada Tabel 2
simpan
ruang (%)
(%)
tampak ada penurunan antara Langsung
74
persen berkecambah dan 2 minggu
50
54
persen jadi bibit. Penurun- 4 minggu
64
58
annya cenderung lebih besar 6 minggu
37
48
bila bibit disimpan dalam
8 minggu
29
9
jangka waktu yang lebih lama.
Oleh sebab itu untuk mendapatkan persen jadi bibit yang tinggi,
pengecambahan harus dilakukan segera setelah pengunduhan
buah.
Perbanyakan generatif Tabel 3. Persen tumbuh bibit cabutan
dari uji penyimpanan dan
dapat pula dilakukan dengan
kondisi tanam bibit
menggunakan bibit yang
diperoleh dari cabutan di
Periode
Dalam
Tanpa
bawah pohon induknya. Pasimpan
sungkup (%) sungkup (%)
(hari)
da pengujian penanaman
0
80
40
cabutan digunakan bibit
1
76
46
gaharu berukuran tinggi
2
87
24
7 cm, kotiledonnya telah
luruh. Hasil uji penanaman
3
76
38
cabutan disajikan pada Tabel
3. Penggunaan sungkup
meningkatkan secara nyata persen tumbuh bibit cabutan (P Anova
= < 0,0001).
Umumnya bibit cabutan yang masih memiliki kotiledon dapat
langsung ditanam dalam kantong plastik tanpa penyungkupan.

118

Uji Produksi Bibit .....(Atok Subiakto, dkk.)

Namun bila kotiledon telah luruh, maka penanaman bibit cabutan


harus melalui tahap penyungkupan. Sungkup dapat dibuat
dari plastik PVC transparan, penyungkupan harus rapat agar
kelembaban dalam sungkup dapat dijaga pada level di atas 95%.
Hasil pengujian ini membuktikan bahwa kelembaban tinggi di dalam
sungkup mempengaruhi keberhasilan penanaman bibit cabutan.
Penyimpanan bibit cabutan selama tiga hari masih memberikan
hasil yang cukup baik (76%) bila penanamannya menggunakan
sungkup.

B. Perbanyakan Vegetatif
Uji produksi stek gaharu dilakukan dengan menggunakan
teknologi KOFFCO system yang dikembangkan oleh Badan Litbang
Kehutanan dan Komatsu (Sakai dan Subiakto, 2007; Subiakto dan
Sakai, 2007). Teknologi ini mengatur kondisi lingkungan, yaitu
cahaya, kelembaban, temperatur, dan media pada tingkat optimal
bagi pertumbuhan (Sakai et al., 2002). Hasil uji produksi stek gaharu
disajikan pada Tabel 4.
Uji produksi stek dilakukan dalam tiga tahap penelitian.
Pada tahap pertama digunakan prosedur baku pembuatan stek.
Perlakuannya adalah jenis dan wadah tanam (tabur) stek. Ratarata persen jadi stek pada uji tahap pertama berkisar antara 4047%. Pembuatan stek dinilai dapat diusahakan secara ekonomis bila
persen jadi mencapai 70% (Subiakto dan Sakai, 2007). Perlakuan
jenis tidak menunjukkan perbedaan nyata (P Anova = 0,6600) dalam
persen jadi stek. Demikian pula perlakuan wadah tanam tidak
menunjukkan perbedaan nyata (P Anova = 0,8276) dalam persen
jadi stek. Mengingat persen jadi stek masih di bawah 70%, maka
dilakukan pengujian lebih lanjut.
Pada pengujian tahap kedua, penyiraman dikurangi menjadi
satu kali seminggu, adapun perlakuan yang diuji adalah tiga
jenis media (arang sekam padi, pasir, dan zeolit). Hasil pengujian
menunjukkan media berpengaruh secara nyata (P Anova = 0,0083)
terhadap persen jadi stek. Media terbaik adalah zeolit, namun
persen berakar masih di bawah 70%. Zeolit merupakan media
dengan porositas yang baik dan tidak ditumbuhi oleh cendawan

119

Aspek SILVIKULTUR

ataupun alga. Karena zeolit adalah media yang berat dan relatif
lebih mahal, maka perlu dicoba media lain yang memiliki tingkat
porositas relatif sama dengan zeolit.
Pada pengujian ketiga digunakan media campuran cocopeat dan
sekam padi yang telah disteril. Perlakuan yang diuji adalah tingkat
penyiraman (1 kali seminggu, 2 kali seminggu, dan 3 kali seminggu).
Hasil pengujian menunjukkan bahwa pada tingkat kepercayaan 5%,
penyiraman berpengaruh secara nyata terhadap persen berakar
stek (P Anova = 0,0210). Penyiraman terbaik adalah dua kali
seminggu dengan persen berakar 69%. Efek dari penyiraman adalah
menyebabkan jenuhnya media dan meningkatkan pertumbuhan
cendawan, termasuk cendawan pembusuk.
Tabel 4. Persen berakar stek dari rangkaian uji produksi stek
Tahapan
riset
1

A. crassna

A. crassna

A. microcarpa

A. microcarpa

Campuran
A. crassna dan
A. microcarpa
Campuran
A. crassna dan
A. microcarpa
Campuran
A. crassna dan
A. microcarpa
Campuran
A. crassna dan
A. microcarpa
Campuran
A. crassna dan
A. microcarpa
Campuran
A. crassna dan
A. microcarpa

2
2
3
3
3

120

Spesies

Perlakuan
Tanpa pot-tray, siram 3 kali seminggu,
media coco-peat : sekam = 2:1
Dengan pot-tray, siram 3 kali seminggu,
media coco-peat : sekam = 2:1
Tanpa pot-tray, siram 3 kali seminggu,
media coco-peat : sekam = 2:1
Dengan pot-tray, siram 3 kali seminggu,
media coco-peat : sekam = 2:1
Media sekam bakar, siram 1 kali
seminggu

Persen
berakar
(%)
40
42
44
47
17

Media pasir, siram 1 kali seminggu

31

Media zeolit, siram 1 kali seminggu

55

Media cocopeat : sekam = 1:1, siram 1 kali


seminggu

53

Media cocopeat : sekam = 1:1, siram 2 kali


seminggu

69

Media cocopeat : sekam = 1:1, siram 3 kali


seminggu

49

Uji Produksi Bibit .....(Atok Subiakto, dkk.)

KESIMPULAN
1. Persen kecambah terbaik diperoleh dari benih yang langsung
dikecambahkan setelah pengunduhan. Namun dengan
mengantisipasi penurunan daya kecambah, benih masih dapat
disimpan selama dua bulan. Benih gaharu tidak perlu disimpan
dalam refrigerator, cukup disimpan pada suhu ruangan.
Penanaman bibit cabutan menggunakan sungkup menghasilkan
persen tumbuh lebih baik dibandingkan bila tidak menggunakan
sungkup.
2. Media terbaik untuk penyetekan gaharu adalah campuran
antara serbuk kulit kelapa (cocopeat) dan sekam padi dengan
perbandingan 1:1. Penyiraman terbaik dilakukan dua kali dalam
seminggu. Pembuatan stek gaharu tersebut dilaksanakan pada
rumah kaca dengan KOFFCO system.

DAFTAR PUSTAKA
Daijo, V. dan D. Oller. 2001. Scent of Earth. URL:http://store.yahoo.
com/scent-of-earth/alag.html (diakses : 5 Febuari 2001).
Hou, D. 1960. Thymelaceae. In : Flora Malesiana (Van Steenis,
C.G.G.J., ed). Series I, Vol. 6. Walter-Noodhoff, Groningen. The
Netherland. p. 1-15.
Parman, T., Mulyaningsih, dan Y. A. Rahman. 1996. Studi Etiologi
Gubal Gaharu Pada Tanaman Ketimunan. Makalah Temu Pakar
Gaharu di Kanwil Dephut Propinsi NTB. Mataram.
Sakai, C. and A. Subiakto. 2007. Pedoman Pembuatan Stek Jenisjenis Dipterokarpa dengan KOFFCO System. Badan Litbang
Kehutanan, Komatsu, JICA. Bogor.
Sakai, C., A. Subiakto, H. S. Nuroniah, dan N. Kamata. 2002. Mass
Propagation Method from The Cutting of Three Dipterocarps
Species. J. For. Res. 7:73-80.
Santoso, E., A. W. Gunawan, dan M. Turjaman. 2007. Kolonisasi
Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil
Gaharu Aquilaria microcarpa. J. Pen. Htn & KA. IV-5 : 499-509.

121

Aspek SILVIKULTUR

Sidiyasa, K. dan M. Suharti. 1987. Jenis-Jenis Tumbuhan Penghasil


Gaharu. Makalah Utama Diskusi Pemanfaatan Kayu Kurang
Dikenal. Cisarua, Bogor.
Subiakto, A. dan C. Sakai. 2007. Manajemen Persemaian KOFFCO
System. Badan Litbang Kehutanan, Komatsu, JICA. Bogor.
Roberts, E. H. and M. W. King. 1980. The Characteristic of Recalcitrant
Seeds. In : Recalcitran Crop Seeds (Chin, H. F., and Roberts, E.
H., eds). Tropical Press SDN. BHD. Kuala Lumpur, Malaysia. 1-5.
Turjaman, M., Y. Tamai, and E. Santoso. 2006. Arbuscular
Mycorrhizal Fungi Increased Early Growth of Two Timber
Forest Product Species Dyera polyphylla and Aquilaria filaria
Under Greenhouse Conditions. Mycorrhiza 16 : 459-464.

122

6
APLIKASI RHIZOBAKTERI
PENGHASIL FITOHORMON UNTUK
MENINGKATKAN PERTUMBUHAN
BIBIT Aquilaria sp. DI PERSEMAIAN
Irnayuli R. Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

Aryanto
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

Yasuyuki Hashidoko
Lab. of Ecological Chemistry, Division of Applied Bioscience, Graduate School of
Agriculture, Hokkaido University

Maman Turjaman
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu (dalam Bahasa Inggris dikenal dengan agarwood atau
eaglewood) adalah kayu resin yang bernilai komersial tinggi karena
digunakan sebagai dupa, bahan aditif minyak wangi, dan minyak
esensial untuk kegiatan keagaman, budaya, bahkan kegiatan
sehari-hari. Di alam, perburuan gaharu dilakukan secara agresif
dan tidak bijaksana. Pohon penghasil gaharu yang ditemukan
dengan ciri-ciri adanya lubang kecil yang disebut lubang semut,
ditebang dan dipanen gaharunya. Cara perburuan ini mengancam
kelestarian gaharu di habitat alaminya, sehingga untuk mencegah
punahnya pohon penghasil gaharu, sejak November 1994, Aquilaria

123

Aspek SILVIKULTUR

dan Gyrinops, dua genus pohon penghasil gaharu terpenting yang


termasuk ke dalam famili Thymelaeaceae (Ordo: Myrtales dan Kelas:
Magnoliopsida) telah masuk ke dalam daftar CITES (the Convention
on the International Trade in Endangered Species of Wild Flora and
Fauna). Appendix II TRAFFIC-CITES-CoP13 Prop.49 (2004) mencatat
ada 24 spesies yang termasuk genus Aquilaria dan tujuh spesies
termasuk ke dalam genus Gyrinops. Kedua genus ini ditemukan
tumbuh alami di paling tidak 12 negara, termasuk Bangladesh,
Butan, Kamboja, Indonesia, Lao PRD, Malaysia, Myanmar, Filipina,
Thailand, Vietnam, dan Papua New Guinea (Barden et al. dalam
Gunn et al., 2004).
Gaharu terjadi melalui proses patogenisitas di mana jenis
patogen fungi tertentu menginfeksi jenis pohon tertentu dan sebagai
respon terhadap serangan patogen, pohon menghasilkan metabolit
sekunder atau senyawa resin yang menyebabkan bau wangi ketika
dibakar. Selain ditemukan pada kedua genus di atas, produk unik
ini juga dapat terjadi pada beberapa genus tanaman lainnya, yaitu
Aetoxylon, Enkleia, Phaleria, Wikstroemia, Gonystylus.
Keberadaan gaharu semakin menipis di alam. Agar ketersediaan
produk gaharu dan pohon penghasil gaharu tidak punah dan untuk
menjaga kesinambungan produksi gaharu yang lestari, perlu
upaya budidaya pohon penghasil gaharu. Gaharu hasil budidaya
diharapkan akan dapat memenuhi kebutuhan pasokan gaharu
untuk ekspor ke negara-negara pemakai. Budidaya merupakan
kunci utama dalam meningkatkan produksi gaharu yang semakin
menipis.
Kegiatan budidaya pohon penghasil gaharu tidak terlepas dari
penyediaan bibit yang berkualitas tinggi. Lain halnya dengan
komoditas pertanian yang langsung ditanam di lapangan, persiapan
bibit kehutanan dilakukan mulai di persemaian. Upaya peningkatan
mutu bibit di persemaian dapat dilakukan dengan pemupukan,
penggunaan biji yang bermutu baik dan inokulasi mikroba yang
dapat memacu pertumbuhan, seperti bakteri penghuni perakaran
yang disebut rhizobakteri pemacu pertumbuhan tanaman (RPPT
atau plant growth promoting rhizobacteria). Istilah RPPT digunakan
untuk bakteri yang dapat membantu pertumbuhan tanaman melalui

124

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

mekanisme yang beragam, baik secara langsung maupun tidak


langsung (Glick, 1995; Kokalis-Burelle et al., 2006). Mekanisme ini
meliputi produksi fitohormon, solubilisasi atau mineralisasi fosfat,
penambatan nitrogen, sequestration besi oleh siderofor, membantu
proses terbentuknya mikoriza, dan pencegahan terjadinya serangan
patogen tular tanah (Garbaye, 1994; Glick, 1995; Lucy et al., 2004).
Di antara mekanisme ini, fitohormon mendapatkan perhatian
penelitian karena aplikasi bakteri penghasil fitohormon dilaporkan
meningkatkan produksi tanaman inang secara berkesinambungan
(Narula et al., 2006). Narula et al. (2006) mengatakan bahwa
dalam studi pemanfaatan bakteri penambat nitrogen untuk
meningkatkan produksi tanaman, kandungan nitrogen pada
tanaman yang diinokulasi tidak meningkat secara myata, sehingga
respon peningkatan pertumbuhan tanaman disebabkan oleh
mekanisme lain dan bukan nitrogen, dan diduga adalah produksi
fitohormon oleh bakteri penambat nitrogen tersebut. Azospirillum
sp. yang dikenal sebagai bakteri penambat nitrogen, misalnya
dapat memproduksi tiga jenis fitohormon, yaitu asam indol asetat
(AIA/auksin), giberelin (AG), dan kinetin. Sedangkan Azospirillum
chroococcum diketahui dapat memproduksi AIA, AG, dan sitokinin
(berbagai sumber dalam Narula et al., 2006). Mikroorganisme
yang menghuni rhizosfir berbagai macam tanaman umumnya
memproduksi auksin sebagai metabolit sekunder sebagai respon
terhadap suplai eksudat akar yang berlimpah di zona perakaran.
Barbieri et al. (1986) dalam Ahmad et al. (2005) melaporkan bahwa
Azospirilum brazilance meningkatkan jumlah dan panjang akar
lateral. Sedangkan Pseudomonas putida GR12-2 pada bibit canola
meningkatkan panjang akar sampai tiga kali lipat. Dikatakan
bahwa bakteri penghasil hormon pertumbuhan diduga memegang
peranan penting dalam memacu pertumbuhan tanaman. Namun,
sampai saat ini informasi penelitian tentang pemanfaatan bakteri
fitohormon untuk tanaman kehutanan di daerah tropis masih
terbatas.
Untuk menguji hipotesa ini, maka dilakukan penelitian uji
aplikasi bakteri penghasil AIA/auksin dalam memacu pertumbuhan
bibit penghasil gaharu Aquilaria sp. di persemaian. Dalam
penelitian ini, bakteri terlebih dahulu diseleksi secara in vitro untuk

125

Aspek SILVIKULTUR

mengetahui kapasitasnya sebagai bakteri penghasil fitohormon


AIA/auksin.

BAHAN DAN METODE


A. Bakteri Penghasil Fitohormon: Identifikasi,
Karakterisasi in vitro dan Persiapan Inokulum
Rhizobakteri diisolasi dari rhizosfir dan rhizoplan bibit atau
sapling menggunakan media campuran mineral Winogradskys
bebas N dengan pH 5,6-6,2 yang mengandung 1% sukrosa sebagai
sumber karbon dan 0,3% gellan gum sebagai bahan pemadat
(Hashidoko et al., 2002).
Rhizobakteri ini kemudian diidentifikasi secara molekuler
mengikuti metode Weisburg et al. (1991). Analisa sekuens DNA
menggunakan BigDye Terminator v3.1 cycle (Applied Biosystems,
Foste City, USA) dengan empat pilihan primer, yaitu:
1.
2.
3.
4.

926F (5 AAACTCAAAGGAATTGACGG 3),


518R (5 GTATTACCGCGGCTGCTGG 3),
1112F (5 GTCCCGCAACGAGCGCAAC 3),
dan/atau 1080RM (5 ACGAGCTGACGACA 3).

Homologi sekuens ditelusuri dengan menggunakan BLASTN


online DNA database in National Center for Bio-technology
Information (NCBI).
Seleksi awal rhizobakteri secara in vitro dilakukan untuk
mengetahui kemampuannya dalam memproduksi fitohormon (asam
indol asetat-AIA) melalui karakterisasi kualitatif dan kuantitatif.
Katakterisasi kualitatif menggunakan metode colorimetric Brick
et al. (1991) yang dimodifikasi sebagai berikut: Rhizobakteri
ditumbuhkan dalam media agar Winogradskys yang dimodifikasi
(AWM) yang diberi 100 mg/L L-tryptophan (C 11H 12N 2O 2). Segera
setelah agar diinokulasi rhizobakteri, media ditumpuk dengan
membran nitrocellulose berukuran pori 0,45mm, diameter 47
mm, dan diinkubasi dalam gelap pada suhu 28C. Setelah inkubasi
selama 3 hari, membran dipindahkan dan ditumpuk pada kertas
saring berdiameter 55 mm No. 2 (Advantec, Toyo Roshi Kaisha Ltd.,

126

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

Tokyo, Japan) yang telah direndam sebelumnya dalam larutan


Salkowski. Perubahan warna diamati setelah 30 menit kemudian.
Rhizobakteri yang mampu memproduksi AIA akan membentuk
cincin halo warna merah di sekitar koloni. Intensitas warna yang
terbentuk, kemudian dikelompokkan menjadi merah muda, merah,
dan merah tua. Sedangkan karakterisasi AIA secara kuantitatif
dilakukan mengikuti metode Narula (2004). Rhizobakteri yang
membentuk cincin halo berwarna merah muda sampai merah pekat
digunakan untuk uji kuantitatif AIA. Rhizobakteri dikulturkan pada
media MW cair yang ditambah dengan 100mg/L L-tryptophan dan
diinkubasikan pada suhu 28C dalam kondisi statis di dalam gelap
selama 7 hari. Kemudian larutan Salkowski ditambahkan pada
supernatant kultur rhizobakteri. Setelah 0,5 jam, pembentukan
warna dibaca pada A665nm. Strain rhizobakteri yang bereaksi positif
dengan larutan Salkowski kemudian diuji untuk mengetahui
kemampuannya dalam memacu pertumbuhan akar Vigna radiata
sebagai tanaman uji. Namun demikian, uji lanjutan pada V. radiata
tidak menunjukkan adanya korelasi yang positif antara intensitas
kepekatan warna merah dengan laju pertumbuhan tanaman (tinggi
dan total panjang akar). Tidak adanya korelasi yang spesifik ini
mengindikasikan bahwa kepekatan warna merah bukan merupakan
indikasi tingginya kuantitas IAA yang dihasilkan, melainkan diduga
merupakan indikasi perbedaan/variasi derifat dari senyawa indol
yang dikonversi dari L-triptophan. Glickmann dan Dessaux (1995)
menyatakan bahwa larutan Salkowsky memberikan respon positif
tidak hanya terhadap auksin (IAA) melainkan juga terhadap asam
indolpirufat dan indoleacetamide.
Dari ketiga uji pendahuluan untuk mendapatkan bakteri
penghasil AIA, maka dipilih sembilan bakteri (Tabel 1). Selain itu,
digunakan juga satu isolat bakteri pemacu asosiasi mikoriza, yaitu
Chromobacterium sp. CK8 karena Aquilaria sp. diketahui berasosiasi
dengan fungi mikoriza arbuskula, untuk mengetahui kemampuan
bakteri dalam membantu terbentuknya asosiasi mikoriza pada bibit
Aquilaria sp.

127

Aspek SILVIKULTUR

B. Inokulasi Bakteri Fitohormon pada Bibit Aquilaria


sp.
Sel bakteri yang ditumbuhkan pada media cair MW + 100 mg/L
L-tryptophan diinkubasi dengan menggoyang selama 3 hari pada
suhu 28C, setelah itu kultur bakteri agak dikentalkan dengan
menambahkan 0,5% gellan gum selama 30 menit. Inokulasi dilakukan
pada bibit yang berumur 4 minggu dengan cara merendam bibit
dalam larutan bakteri selama 30 menit, kemudian ditanam dalam
polybag yang berisi 500 g media tanah yang tidak steril. Pada saat
penanaman, 1 ml larutan bakteri juga disebarkan di daerah
perakaran. Bibit ditumbuhkan di rumah kaca dan disiram setiap
hari dengan air keran. Pengamatan dilakukan terhadap tinggi,
diameter, dan bobot kering biomassa.
Tabel 1. Informasi bakteri PGPR penghasil fitohormon yang digunakan
sebagai inokulum

Inang

Substrat

Sta-dium

Asal lokasi

Strain
bakteri

Sub
kelas

Hasil
analisa
colorimetric AIA

Dipterocarpus sp. Rizoplan

Sapling ~1 th Nyaru
Menteng

Stenotrophomonas sp.
CK34

Proteobacteria

Merah

Hopea sp.

Rizoplan

Sapling ~1
tah

Bacillus sp.
CK41

Bacilli

Merah
muda

S. teysmanniana

Rizoplan

Sapling ~1 th Nyaru
Menteng

Azospirillum
sp. CK26

Proteobacteria

Merah
muda

S. teysmanniana

Rizoplan

Sapling ~1
tah

Burkholderia Proteosp. CK28


bacteria
(DQ195889)

Merah
muda pupus

Burkholderia Proteosp. CK59


bacteria
(DQ195914)

Merah
muda pupus
Merah
muda pupus

Nyaru
Menteng

Nyaru
Menteng

Dipterocarpus sp. Rizoplan

Sapling ~1th

Nyaru
Menteng

Serratia sp.
CK67

Proteobacteria

S. teysmanniana

Rizoplan

Bibit~ 6 bln

Nyaru
Menteng

NI CK53

Merah tua

NI CK54

Merah tua

S. balangeran

Rizoplan

Sapling ~1
bln

Pembi-bitan
UP

NI CK 61

Merah
muda

S. parviflora

Rizoplan

Sapling ~1.5
th

Nyaru
Menteng

Chromobacterium
sp. CK8
(DQ195926)

Proteobacteria

Catatan: S: Shorea; H: Hopea; NI: bakteri yang belum teridentifikasi; UP: Universitas Palangkaraya; * isolat
mycorrhization helper bacteria; AIA: asam indol asetat

128

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

b
Gambar 1. Warna merah yang terbentuk di sekitar koloni
setelah direaksikan dengan reagen Salkowski
(a): Pembentukan warna pada membrane
nitroselulose 3 hari setelah inkubasi; (b):
Pembentukan warna pada media cair. Bakteri
NICK53 yang membentuk warna merah tua
dibanding dengan kontrol media tanpa bakteri

C. Rancangan Percobaan dan Analisa Data


Penelitian menggunakan rancangan acak lengkap dengan
faktor tunggal, yaitu 10 isolat bakteri, yang masing-masing diulang
sebanyak 10 bibit per perlakuan. Data dianalisa secara statistik
dengan analisa sidik ragam menggunakan program SPSSversion
10.0 (SPSS Inc., Chicago, USA). Data yang berbeda nyata diuji
lanjut dengan Least Significant Difference untuk mengelompokkan
perlakuan yang tidak berbeda nyata. Parameter yang diukur untuk
mengetahui respon bibit terhadap inokulasi, yaitu tinggi, diameter,
berat kering total, indeks mutu bibit, dan persentase peningkatan
pertumbuhan.
Analisa persentase peningkatan pertumbuhan dilakukan
sebagai berikut:
%Peningkatan =

Bibit yang diinokulasi bibit kontrol


Bibit kontrol

x 100%

129

Aspek SILVIKULTUR

HASIL DAN PEMBAHASAN


Bibit Aquilaria sp. menunjukkan respon beragam terhadap
inokulasi bakteri fitohormon (Gambar 2). Bakteri fitohormon
memberikan pengaruh positif, netral atau negatif terhadap
pertumbuhan tanaman jika dibandingkan dengan tanaman yang
tidak diinokulasi (kontrol negatif ). Respon tanaman diamati
melalui pertumbuhan tinggi dan diameter setiap bulannya. Bakteri
fitohormon memberikan pengaruh nyata terhadap tinggi tanaman
mulai 1-5 bulan setelah inokulasi (P < 0,05). Dua isolat bakteri,
yaitu Burkholderia sp. CK28 (DQ195889, Proteobacteria) dan
Chromobacterium sp. CK8 (DQ195926, Proteobacteria) merupakan
isolat yang paling konsisten dalam memberikan pengaruh paling
efektif dalam meningkatkan pertumbuhan tinggi selama lima
bulan setelah inokulasi (Gambar 2). Kedua bakteri ini berasal
dari rhizoplan S. teysmanniana umur kurang lebih 1 tahun dan
S. parviflora umur kurang lebih 1,5 tahun dari arboretum Nyaru
Menteng, Kalimantan Tengah.
Peningkatan pertumbuhan tinggi bibit Aquilaria sp. berkisar
antara 12,2-38,7% dibandingkan dengan bibit yang tidak diinokulasi
pada lima bulan setelah inokulasi. Semua bibit yang diinokulasi
secara signifikan memiliki pertumbuhan tinggi yang lebih baik
daripada tanaman kontrol melalui analisa Least Significant
Difference (LSD).
Pertumbuhan diameter tidak menunjukkan respon yang
konsisten terhadap inokulasi (Tabel 2). Respon yang serupa juga
telah dilaporkan oleh Sitepu et al. (2007) bahwa respon diameter
bibit Shorea selanica terhadap inokulasi RPPT tidak konsisten.
Dijelaskan bahwa tanaman hutan pertumbuhannya jauh lebih
lambat dari tanaman pertanian sehingga untuk pertumbuhan
stadium awal di persemaian, tinggi merupakan parameter yang
reliable untuk mengamati respon bibit terhadap inokulasi mikroba
pemacu pertumbuhan. Pada habitat hutan yang rimbun dengan
kanopi yang bertingkat, bibit yang tumbuh di lantai hutan perlu
memiliki kemampuan untuk segera tumbuh tinggi bersaing dengan
bibit di sekitarnya untuk mendapatkan cahaya agar dapat tumbuh
baik.

130

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

Gambar 2. Pengaruh bakteri PGPR terhadap pertumbuhan


tinggi bibit Aquilaria sp. sampai 5 bulan
setelah inokulasi. Angka di atas notasi adalah
peningkatan pertumbuhan dibanding kontrol

Inokulasi tidak memberikan pengaruh nyata terhadap


pertumbuhan tinggi, enam bulan setelah inokulasi, juga terhadap
berat kering total, rasio pucuk terhadap akar, dan indeks mutu
bibit (Gambar 3 dan Gambar 4). Inokulasi juga tidak berpengaruh
terhadap pertumbuhan setelah bibit dipindah ke lapangan, bibit
cenderung tumbuh lambat (Tabel 2). Bibit Aquilaria sp. ditumbuhkan
di bawah tegakan meranti di Hutan Penelitian Dramaga.
Tidak responnya bibit terhadap bakteri, enam bulan setelah
inokulasi, dapat dijelaskan sebagai berikut: Tanah sebagai media
tumbuh dan bibit Aquilaria sp. tidak disterilisasi pada saat
inokulasi bakteri sehingga mikroba alami yang terdapat dalam
tanah, kemudian bebas untuk berinteraksi dengan bakteri yang
diinokulasikan. Diduga tidak adanya respon bibit yang nyata pada
bulan keenam dan selanjutnya disebabkan karena bibit telah
terinfeksi oleh fungi mikoriza secara alami yang dapat berasal
dari tanah maupun air yang dipakai untuk menyiram tanaman
walaupun analisa infeksi mikoriza alami tidak dilakukan. Fungi
mikoriza dilaporkan baru berperan efektif tujuh bulan setelah
inokulasi pada tanaman dipterokarpa, yaitu Shorea leprosula,
Shorea acuminata, Hopea odorata, dan Shorea pinanga (Lee, 1990;
Yazid et al., 1994; Turjaman et al., 2005).

131

Aspek SILVIKULTUR

Tabel 2. Tabel 1. Analisa sidik ragam pada parameter pertumbuhan yang


diukur
Parameter

Analisa sidik ragam

Diameter (mm)

tn

tn

tn

tn

Tinggi (cm)

tn

Berat Kering Pucuk (g)

tn

Berat Kering akar (g)

tn

Berat Kering Total (g)

tn

Rasio P/A

tn

Indeks Mutu Bibit

tn

Catatan: tn: tidak nyata pada taraf 0,05 *: nyata pada taraf 0.05; P/A: Pucuk/akar

Gambar 3. Berat kering total bibit Aquilaria sp. yang


diinokulasi bakteri

132

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

Gambar 4. Gambar 4. Indeks mutu bibit Aquilaria sp. yang


diinokulasi bakteri

Pada bibit Aquiliaria sp. dalam penelitian ini, pengaruh mikoriza


dimulai lebih awal, yaitu pada enam bulan setelah inokulasi. Bakteri
tertentu dapat berperan dalam merangsang terbentuknya asosiasi
mikoriza antara fungi mikoriza dan tanaman inangnya. Salah satu
dari kedua inokulan yang paling efektif, yaitu Chromobacterium sp.
CK8 adalah bakteri yang telah diuji secara in vitro dapat membantu
pertumbuhan miselia fungi ektomikoriza Laccaria sp. Penelitian
yang dilakukan oleh Poole et al. (2001) menyatakan bahwa bakteri
Paenibacillus sp., Burkholderia sp., dan Rhodococcus sp. merangsang
infeksi ektomikoriza pada tahapan pembentukan akar lateral
antara Laccaria rufus dan Pinus sylvestris. Sedangkan Paenibacillus
monteilii dan Paenibacillus resinovorans memacu simbiosis antara
Pisolithus alba dengan Acacia holosericea di mana P. monteilii
meningkatkan biomassa fungi di dalam tanah (Founoune et al.,
2002). Penelitian yang dilakukan oleh Enebak et al. (1998) pada
bibit loblolly dan slash pine melaporkan bahwa inokulasi RPPT
meningkatkan biomassa tegakan. Pengaruh tidak langsung dari
inokulasi RPPT berupa pembentukan asosiasi mikoriza (disebut
sebagai mycorrhizal helper bacteria, MHB) juga telah dilaporkan.
Pseudomonas fluorescense BBc6R8 memacu simbiosis antara
Laccaria bicolor S238N-Douglas fir (Pseudotsuga menziesii) dan efek
dari bakteri MHB ini paling efektif pada saat fungi mikoriza tumbuh
berada pada kondisi yang tidak optimal (Garbaye, 1994; Brule et al.,
2001).

133

Aspek SILVIKULTUR

Untuk mengetahui apakah fenomena MHB ini juga berlaku


untuk Aquilaria sp. dan apakah hipotesa di atas benar, maka perlu
uji lebih lanjut untuk mengetahui pengaruh inokulasi ganda antara
bakteri dan fungi mikoriza arbuskula dalam memacu pertumbuhan
bibit, baik di persemaian maupun di lapangan. Penelitian yang
dilakukan oleh Kashyap et al. (2004) menunjukkan bahwa inokulasi
ganda fungi mikoriza arbuskula dan bakteri Azotobacter dengan
tambahan asam indol butirat secara nyata meningkatkan survival
rate sapling Morus alba (Moraceae) yang ditanam pada kondisi yang
bergaram tinggi dari 25-50%. Dalam hal ini bibit bermikroba dapat
meningkatkan ketahanan tumbuh tanaman pada kondisi ekstrim.
Dalam penelitian ini, pendekatan yang dilakukan adalah
menyeleksi bakteri secara in vitro terlebih dahulu sebelum
dilakukan uji pada tanaman target di persemaian. Uji in vitro
merupakan metode yang praktis, terutama dalam menyeleksi isolat
dalam jumlah besar sebelum dilakukan uji selanjutnya. Dari hasil in
vitro didapat sembilan bakteri penghasil indol yang kemudian diuji
lanjut pada bibit Aquilaria sp. Respon pertumbuhan bibit Aquilaria
sp. terhadap inokulasi menghasilkan satu bakteri penghasil indol
yang efektif, yaitu Burkholderia sp. CK28 yang menghasilkan warna
pink muda pada uji colorimetric.

KESIMPULAN
Bibit Aquilaria sp. menunjukkan respon beragam terhadap
inokulasi bakteri penghasil fitohormon. Inokulasi bakteri penghasil
fitohormon dapat meningkatkan tinggi bibit Aquilaria sp. segera
setelah inokulasi berturut-turut selama lima bulan. Peningkatan
pertumbuhan tinggi bervariasi dari 12,2-38,7% dibandingkan
dengan bibit yang tidak diinokulasi. Dua isolat Burkholderia sp.
CK28 dan Chromobacterium sp. CK8 adalah dua bakteri yang secara
konsisten memacu pertumbuhan tinggi. Uji lanjutan inokulasi ganda
dengan fungi mikoriza arbuskula perlu dilakukan untuk mengetahui
mikroba yang berperan dalam memacu pertumbuhan bibit pada
stadia lanjut di persemaian sebelum dipindah ke lapangan.

134

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

Ucapan Terimakasih
Para penulis mengucapkan terimakasih kepada Bapak Ahmad
Yani dan Bapak Zaenal yang telah membantu pengukuran dan
perawatan tanaman di Hutan Penelitian Dramaga.

DAFTAR PUSTAKA
Ahmad, F., I. Ahmad, dan M.S. Khan. 2005. Indole acetic acid
production by the indigenous isolates of Azotobacter and
fluorescent Pseudomonas in the presence and absence of
tryptophan. Turkish Journal of Biology 29: 29-34.
Brick, J.M., R.M. Bostock, and S.E. Silverstone. 1991. Rapid in situ
assay for indoleacetic acid production by bacteria immobilized
on a nitrocellulose membrane. Applied and Environmental
Microbiology 57: 535-538.
Brul, C., P. Frey-Klett, J.C. Pierrat, S. Courrier, F. Gerard, M.C.
Lemoine, J.L. Rousselet, G. Sommer, and J. Garbaye. 2001.
Survival in the soil of the ectomycorrhizal fungus Laccaria
bicolor and the effects of mycorrhiza helper Pseudomonas
fluorescens. Soil Biology and Bio-chemistry 33: 1683-1694.
Enebak, S.A., G. Wei, and J.W. Kloepper. 1998. Effect of plant growthpromoting rhizobacteria on loblolly and slash pine seedlings.
Forest Science 44: 139-144.
Founoune, H., R. Duponnois, A.M. Ba, S. Sall, I. Branget, J. Lorquin,
M. Neyra, and J.L. Chotte. 2002. Mycorrhiza Helper Bacteria
stimulate ectomycorrhizal symbiosis of Acacia holosericea with
Pisolithus alba. New Phytologist 153: 81-89.
Garbaye, J. 1994. Helper bacteria: a new dimension to the mycorrhizal
symbiosis. New Phytologist 128: 197-210.
Glick, B.R. 1995. The enhancement of plant growth by free-living
bacteria. Canadian Journal of Microbiology 41: 109-117.
Glickmann, E. and Y. Dessaux. 1995. A critical examination of the
specificity of the Salkowski reagent for indolic compounds
produced by phytopathogenic bacteria. Applied Environmental
Microbiology 61: 793-796.

135

Aspek SILVIKULTUR

Gunn, B.V., P. Stevens, M. Singadan, L. Sunari, and P. Chatterton.


2004. Eaglewood in Papua New Guinea. Resource Management
in Asia-Pacific Working Paper No.51. The Australian National
University. Canberra. 18 pp.
Hashidoko, Y., M. Tada, M. Osaki, and S. Tahara. 2002. Soft gel medium
solidified with gellan gum for preliminary screening for rootassociating, free-living nitrogen-fixing bacteria inhabiting the
rhizoplane of plants. Bio-science Biotechnology Biochemistry
66: 22592263.
Kokalis-Burelle, N., J.W. Kloepper, and M.S. Reddy. 2006. Plant
growth-promoting rhizobacteria as transplants amendments
and their effects on indigenous rhizo-sphere microorganisms.
Applied Soil Ecology 31: 91-100.

Lee, S.S. 1990. The mycorrhizal association of the Dipterocarpaceae


in the tropical rain forests of Malaysia. AMBIO 19: 383-385.
Lucy, M., E. Reed, and B.R. Glick. 2004. Applications of free living plant
growth-promoting rhizobacteria. Antonie van Leeuwenhoek 86:
1-25.
Narula, N., A. Deubel, W. Gans, R.K. Behl, and W. Merbach. 2006.
Paranodules and colonization of wheat roots by phytohormone
producing bacteria in soil. Plant Soil Environment 52:119-129.
Narula, N. 2004. Biofertilizer technology-A manual. Department
of Microbiology. CCS Haryana Agricultural University, Hisar,
India. pp.67.
Poole, E.J., G.D. Bending, J.M. Whipps, and D.J. Read. 2001. Bacteria
associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas
and their effects on mycorrhiza formation in vitro. New
Phytologist 151: 743-751.
Sitepu, I.R. 2007. Screening of plant-growth promoting rhizobacteria
from Dipterocarpaceae plants growing in Indonesian tropical
rain forests, and investigations of their functions on seedling
growth. PhD Dissertation. Hokkaido University. 91 pp.
Turjaman, M., Y. Tamai, H. Segah, S.H. Limin, J.Y. Cha, M. Osaki, and
K. Tawaraya. 2005. Inoculation with the ectomycorrhizal fungi

136

Aplikasi Rhizobakteri Penghasil .....(Irna R. Sitepu, dkk)

Pisolithus arhizus and Scleroderma sp. improves early growth


of Shorea pinanga nursery seedlings. New Forest 30: 67-73.
Weisburg, W. G., S.M. Barns, D.A. Pelletier, and D.J. Lane. 1991. 16S
ribosomal DNA amplification for phylogenic study. Journal of
Bacteriology 173: 697-707.
Yazid, S.M., S.S. Lee, and F. Lapeyrie. 1994. Growth stimulition
of Hopea spp. (Dipterocarpaceae) seedlings following
ectomycorrhizal inoculation with an exotic strain of Pisolithus
tinctorius. Forest Ecology Management 67: 339-343.

137

138

7
PENGGUNAAN FUNGI MIKORIZA
ARBUSKULA PADA EMPAT JENIS
Aquilaria
Maman Turjaman, Irnayuli R. Sitepu, Ragil S.B. Irianto,
Sugeng Sentosa, Aryanto, Ahmad Yani, Najmulah,
Erdy Santoso
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Salah satu famili pohon tropika yang sekarang menjadi perhatian
dunia internasional adalah Thymelaeaceae. Famili pohon ini sangat
penting karena menghasilkan produk gaharu dan kayu mewah untuk
masyarakat di sekitar kawasan hutan di kawasan Asia (Lemmens
et al., 1998; Oyen dan Dung, 1999). Thymeleaceae terdiri dari 50
genera dengan Aetoxylon, Gyrinops, Enkleia, Gonystylus, Phaleria,
Wikstroemia, dan Aquilaria yang memproduksi gaharu (Ding Hou,
1960). Karena disebabkan tingginya nilai produk gaharu, maka jenisjenis ini mengalami kelebihan pemanenan di seluruh kawasan Asia
selama 20 tahun terakhir (Paoli et al., 2001). Pada saat ini Aquilaria,
Gyrinops, dan Gonystylus dimasukkan ke dalam CITES (Convention
on the International Trade in Endangered Species) Appendix II (CITES
2005). Jenis-jenis Aquilaria pada umumnya banyak dijumpai pada
hutan-hutan primer dan sekunder dataran rendah di Indonesia,
Papua Nugini, Thailand, Malaysia, Vietnam, India, Bangladesh,
Bhutan, Myanmar, China, Cambodia, dan Filipina. Jenis-jenis ini
merupakan sumber utama dari kayu gaharu (semacam kayu yang

139

Aspek SILVIKULTUR

mempunyai resin wangi) yang termasuk dalam urutan teratas


dari kelompok hasil hutan bukan kayu bernilai sangat tinggi yang
berasal dari hutan tropika. Produk gaharu biasanya digunakan
sebagai bahan dasar parfum, incence, obat tradisional, dan produk
komersial lainnya (Eurling dan Gravendeel, 2005). Namun demikian,
jenis Aquilaria berkurang populasinya di alam, sulit sekali untuk
melakukan pengaturan perlindungan genus ini dan termasuk juga
dalam pengaturan kelestarian produksi gaharu alami.
Ketersediaan nutrisi tanah merupakan salah satu faktor
pembatas untuk pertumbuhan awal dalam kegiatan penanaman
bibit-bibit tanaman hutan pada kondisi lahan hutan yang
terdegradasi (Santiago et al., 2002). Pada tahap awal pertumbuhan
jenis Aquilaria sering mengalami pertumbuhan yang lambat, sebab
pada umumnya kondisi lahan hutan tropika di Indonesia kahat
unsur hara terutama N dan P. Pada saat ini kegiatan reforestasi
memproduksi ratusan juta bibit tanaman hutan setiap tahunnya.
Penggunaan bibit tanaman hutan yang vigor sangat diperlukan
dalam kegiatan reforestasi. Pada kenyataannya ketersediaan bibit
biasanya cenderung dibuat dengan kualitas rendah dan mengalami
defisiensi unsur hara dan pada akhirnya mengalami kematian yang
tinggi pada saat telah ditanam di tingkat lapang.
Telah banyak dilaporkan dalam beberapa jurnal internasional
pentingnya pemanfaatan fungi mikoriza arbuskula dari beberapa
jenis tanaman hutan yang berbeda untuk membantu kegiatan
reforestasi. Fungi mikoriza arbuskula (FMA) telah diuji dengan
hasil yang signifikan pertumbuhannya pada jenis Leucaena
leucocephala (Michelsen dan Rosendahl, 1990), Parkia biglobosa,
Tamarindus indica, Zizyphus mauritiana (Guissou et al, 1998),
Sesbania aegyptiaca dan S. grandiflora (Giri and Mukerji, 2004),
11 jenis Eucalyptus (Adjoud et al., 1996), Tectona grandis (Rajan
et al., 2000). Dari hasil studi literatur, belum dilaporkan adanya
uji inokulasi fungi mikoriza arbuskula pada jenis-jenis Aquilaria.
Tujuan dari penelitian ini adalah menentukan tingkat pengaruh
fungi mikoriza arbuskula pada jenis-jenis Aquilaria, baik di tingkat
persemaian maupun di lapangan.

140

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

BAHAN DAN METODE


A. Perbenihan dan Perkecambahan
Benih Aquilaria crassna diperoleh dari Dramaga (Bogor),
A. malaccensis dikoleksi dari Desa Gudang (Pulau Bangka), A.
microcarpa dari Desa Mianas (Kalimantan Barat), A. beccariana
berasal dari Sanggau (Kalimantan Barat). Semua benih Aquilaria
spp. direndam selama dua jam, kemudian disterilisasi dengan
sodium hypochlorit (5%) selama lima menit. Setelah disterilisasi,
benih tersebut dicuci beberapa kali dengan air sampai bersih. Benih
Aquilaria spp. dikecambahkan pada bak plastik yang berisi media
zeolite. Benih Aquilaria spp. mulai berkecambah 21 hari setelah
ditaburkan.

B. Media Semai
Jenis tanah ultisol diambil dari Hutan Penelitian Haurbentes,
Jasinga dan kemudian disimpan di rumah kaca. Media semai tersebut
disaring dengan diameter saringan lima mm. pH media adalah 4,7; P
tersedia (Bray-1) adalah 0,17 mg kg-1, dan N total (Kjeldahl) was 1.7 mg
kg-1. Kemudian media semai disterilisasi pada temperatur 121oC selama
30 menit.

C. Inokulum Mikoriza Arbuskula


Fungi mikoriza arbuskula, G. decipiens, G. clarum, Glomus
sp. ZEA, dan Glomus sp. ACA diisolasi dari Desa Kalampangan,
Palangkaraya, Kalimantan Tengah melalui teknik pot kultur.
Teknik pot kultur dimulai dengan cara spora tunggal. Inang yang
digunakan untuk mempropagasi FMA adalah Pueraria javanica. Pot
plastik diisi dengan zeolite steril dan ditambahkan 5 g dari masingmasing jenis FMA. Kemudian ditanam benih P. javanica yang telah
berumur enam hari pada pot plastik tersebut. Pot-pot disusun pada
rak-rak besi di rumah kaca dan dipelihara selama 90 hari. Spora,
hifa eksternal, dan akar yang terkolonisasi dari masing-masing jenis
FMA diamati di bawah mikroskop.

141

Aspek SILVIKULTUR

D. Inokulasi FMA
Polybag (ukuran 15 cm x 10 cm) diisi tanah steril 500 g. Inokulasi
FMA diberikan 5 g untuk setiap pot dan diletakkan dekat akar semai
Aquilaria spp. Semai empat jenis Aquilaria yang tidak diinokulasi
sebagai kontrol. Dari hasil penelitian pendahuluan, penggunaan
inokulum steril tidak memberikan pengaruh pertumbuhan pada
Aquilaria spp. Semai dipelihara dan disiram setiap hari pada
kondisi rumah kaca dan diamati selama 6 bulan. Temperatur di
rumah kacar berkisar antara 26-35oC dan kelembaban udara 8090%. Gulma dan hama yang mengganggu semai dimonitor setiap
hari.

E. Parameter Pertumbuhan
Percobaan inokulasi pada jenis-jenis Aquilaria terdiri atas (a)
kontrol (tanpa inokulum); (b) Entrophospora sp.; (c) G. decipiens;
(d) G. clarum; (e) Glomus sp. ZEA; dan (f) Glomus sp. ACA. Desain
penelitian dilakukan dengan rancangan acak lengkap (RAL) dengan
30 ulangan. Parameter yang diukur adalah tinggi, diameter, dan daya
hidup semai. Setelah berumur enam bulan, dilakukan pemanenan
pucuk dan akar semai Aquilaria. Semua sampel di-oven pada suhu
70oC selama tiga hari. Analisis N dan P jaringan semai dilakukan
dengan metode semi-micro Kjeldahl dan vanadomolybdate-yellow
assay (Olsen and Sommers, 1982). Pada tingkat lapang, percobaan
yang dilakukan hanya pada jenis A. beccariana dengan desain RAL
yang sama. Percobaan dilakukan di Kawasan Hutan Dengan Tujuan
Khusus (KHDTK) Dramaga di bawah naungan tegakan Gmelina
arborea. Paramater yang diamati pada tingkat lapang ini adalah
tinggi dan diameter A. beccariana yang telah dilakukan selama dua
tahun.

F. Kolonisasi Mikoriza Arbuskula


Akar dari masing-masing jenis Aquilaria dicuci untuk
membersihkan partikel-partikel tanah yang masih menempel.
Akar dibersihkan dalam 100 g l-1 KOH selama satu jam, diasamkan
dalam larutan HCl dan diberi warna dengan 500 mg l -1 tryphan
blue dalam lactoglycerol (Brundrett et al., 1996). Kemudian akar

142

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

dicuci dalam 50% glycerol dan 100 potong akar berukuran satu cm
diamati di bawah mikroskop compound dengan perbesaran 200x.
Penghitungan kolonisasi mikoriza dilakukan dengan sistem skoring
keberadaan dan tidak adanya struktur FMA (McGonigle et al., 1990).

G. Analisis Statistik
Analisis statistik menggunakan ANOVA dengan software
StatView 5.0 (Abacus Concepts). Sedangkan analisis statistik lanjutan
menggunakan uji beda nyata terkecil (LSD) apabila nilai F signifikan.

HASIL DAN PEMBAHASAN


Lima jenis fungi mikoriza arbuskula (FMA) sangat efektif
mengkolonisasi sistem perakaran dari A. crassna, A. malaccensis,
A. Microcarpa, dan A. beccariana setelah enam bulan diinokulasi
pada kondisi rumah kaca. Dari hasil penelitian sebelumnya
Santoso et al. (2008), kolonisasi FMA yang terjadi pada akar bibit
A. microcarpa dimulai sebelum minggu ke-7 setelah inokulasi.
Tidak ada perbedaan nyata antara lima jenis FMA dalam
mengkolonisasi perakaran empat jenis Aquilaria. Kolonisasi FMA
dapat meningkatkan parameter pertumbuhan tinggi, diameter
batang, berat kering, berat basah, dan daya hidup semai Aquilaria
di persemaian (Tabel 1). Pada jenis A. crassna, A. Malaccensis, dan
A. microcarpa, penggunaan FMA Entrophospora sp. lebih efektif
meningkatkan parameter pertumbuhan dibandingkan jenis FMA
lainnya. Khusus FMA G. clarum sangat efektif meningkatkan
parameter pertumbuhan pada jenis A. beccariana. Semai yang tidak
diinokulasi terkolonisasi oleh FMA yang tidak teridentifikasi (110%), tetapi tidak dapat mempengaruhi pertumbuhan empat jenis
Aquilaria. Kolonisasi FMA mampu meningkatkan serapan N dan P
pada jaringan empat jenis Aquilaria dibandingkan semai yang tidak
diinokulasi (Tabel 2). Peningkatan serapan N dan P ini memberikan
pengaruh pada peningkatan dari parameter pertumbuhan empat
jenis Aquilaria. Pada tingkat lapang, dilakukan kegiatan penanaman
hanya pada jenis A. beccariana dua tahun setelah diinokulasi oleh
FMA. Hasil penelitian pada tingkat lapang menunjukkan bahwa

143

Aspek SILVIKULTUR

jenis G. clarum lebih efektif dalam meningkatkan pertumbuhan A.


beccariana dibandingkan dengan kontrol dan jenis FMA lain yang
telah diujicobakan.

Dari hasil penelitian ini memberikan informasi yang sangat
penting dalam memanfaatkan inokulum FMA pada jenis-jenis
Aquilaria spp. Regenerasi jenis-jenis Aquilaria yang berkelanjutan
dapat dibantu dengan adanya pemanfaatan teknologi FMA dimulai
pada saat di persemaian. Penggunaan FMA yang efektif dapat
meningkatkan pertumbuhan Aquilaria yang sangat signifikan,
sehingga biomassa pohon penghasil gaharu yang akan dipanen
akan meningkat, artinya produk gaharu hasil induksi yang akan
dipanen lebih meningkat produksinya. Penelitian ini sejalan dengan
penelitian yang terdahulu, yaitu tentang pemanfaatan FMA pada 11
jenis Eucalyptus spp. (Adjoud et al., 1996), 17 jenis tanaman legume
(Duponnois et al., 2001), Sesbania aegyptiaca dan S. grandiflora (Giri
dan Mukerji, 2004).
Penelitian pemanfaatan FMA pada jenis-jenis pohon tropika
(Muthukumar et al., 2001) dan khususnya jenis-jenis Aquilaria
menunjukkan bahwa ada kemungkinan inokulum FMA dapat
menurunkan penggunaan pupuk kimia di persemaian. Meskipun
perhitungan tentang keuntungan dan biaya penggunaan FMA
belum diuji dalam penelitian ini, hasilnya tidak diragukan lagi
menunjukkan FMA dapat menurunkan penggunaan pupuk kimia
dalam penyediaan semai tanaman penghasil gaharu. Selanjutnya
mekanisme penggunaan FMA sebagai pemacu pertumbuhan jenisjenis Aquilaria pada tanah masam dan pada tanah yang populasi
FMA sangat rendah harus menjadi perhatian dan pertimbangan
untuk mengetahui keberadaan FMA alami.
Pola penanaman jenis-jenis Aquilaria dengan pola agroforestry
sangat membantu mempercepat ketersediaan pohon-pohon
penghasil gaharu di Indonesia. Pada prinsipnya, pencampuran
dilakukan untuk melindungi pertumbuhan semai Aquilaria pada
tahun pertama dan kedua dari sengatan sinar matahari. Jenis-jenis
Aquilaria yang telah dikolonisasi oleh FMA akan dapat mempunyai
hubungan antara sistem perakaran pohon jenis-jenis lain, sehingga
kebutuhan nutrisi untuk pertumbuhan gaharu dapat terpenuhi.

144

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Jenis-jenis pohon yang direkomendasikan sebagai pohon pencampur


dengan pohon penghasil gaharu adalah pohon karet, kelapa sawit,
kelapa, sengon, gmelina, melinjo, jengkol, dan beberapa jenis lain
pohon buah-buahan.

Gambar 1. Pertumbuhan tinggi dan diameter pohon


penghasil gaharu Aquilaria beccariana setelah
dua tahun ditanam di tingkat lapang. K = Kontrol;
Ent = Entrophospora sp.; Gg = G. decipiens; G.Aca
= Glomus sp. ACA; Gc = G.clarum; G.ZEA = Glomus
sp. ZEA.

KESIMPULAN DAN REKOMENDASI


1. Penggunaan FMA pada jenis-jenis Aquilaria sangat signifikan
dalam memacu pertumbuhan awal di persemaian dan
lapangan. Jenis FMA Entrophospora sp. sangat efektif dalam
memacu pertumbuhan tanaman dan serapan nurtisi pada jenis
A. malaccensis, A. crassna, dan A. microcarpa. Khusus jenis
pohon penghasil gaharu A. beccariana lebih memilih jenis FMA
G. clarum untuk memacu pertumbuhan tanaman dan serapan
nutrisinya, baik di tingkat semaian maupun lapangan.
2. Direkomendasikan untuk menggunakan jenis FMA efektif
untuk mempercepat pertumbuhan jenis-jenis Aquilaria mulai
di tingkat persemaian. Ketersediaan inokulum FMA di tingkat

145

Aspek SILVIKULTUR

pengguna dan sosialisasi penggunaanya perlu dilakukan, agar


penggunaan FMA menjadi efektif dan efisien.

DAFTAR PUSTAKA
Adjoud, D., C. Plenchette, R. Halli-Hargas and F. Lapeyrie. 1996.
Response of 11 Eucalyptus Species to Inoculation with Three
Arbuscular Mycorrhizal Fungi. Mycorrhiza 6 : 129-135.
Brundrett, M., N. Bougher, B. Dell, T. Grove and N. Malajczuk. 1996.
Working with Mycorrhizas in Forestry and Agriculture. ACIAR
Monograph 32, Canberra.
CITES. 2005. Convention on International Trade in Endangered
Species of Wild Fauna and Flora. Appendices I, II and III of
CITES. UNEP. 48 pp.
Ding Hou. 1960. Thymelaeaceae. In : Van Steenis, C.G.G.J. (ed) Flora
Malesiana. Series I, Vol. 6. Wolters-Noordhoff, Groningen, The
Netherlands. p. 1-15.
Duponnois, R., H. Founoune, D. Masse and R. Pontanier (2005).
Inoculation of Acacia holosericea with Ectomycorrhizal Fungi
in a Semiarid Site in Senegal : Growth Response and Influences
on The Mycorrhizal Soil Infectivity After 2 Years Plantation.
Forest Ecology and Management 207 : 351-362.
Eurlings, M.C.M. and B. Gravendeel. 2005. TrnL-TrnF Sequence Data
Imply Paraphyly of Aquilaria and Gyrinops (Thymelaeaceae)
and Provide New Perspectives for Agarwood Identification.
Plant Systematics and Evolution 254 : 1-12.
Giri, B. and K.G. Mukerji. 2004. Mycorrhizal Inoculant Alleviates Salt
Stress in Sesbania aegyptiaca and Sesbania grandiflora Under
Field Conditions : Evidence for Reduced Sodium and Improved
Magnesium Uptake. Mycorrhiza 14 : 307-312.
Guisso, T., A.M. B, J-M.Ouadba, S. Guinko and R. Duponnois. 1998.
Responses of Parkia biglobosa (Jacq.) Benth, Tamarindus indica
L. and Zizyphus mauritiana Lam. to Arbuscular Mycorrhizal
Fungi in a Phosphorus-Deficient Sandy Soil. Biology and Fertility
Soils 26 : 194-198.

146

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lemmens, R.H.M.J., I. Soerianegara and W.C. Wong (Eds.). 1998.


Timber Trees : Minor Commercial Timbers. Plant Resources of
South-East Asia No. 5 (2). Prosea, Bogor, Indonesia.
McGonigle, T.P., M.H. Miller, D.G. Evans, G.L. Fairchild and J.A.
Swan. 1990. A New Method Which Gives an Objective Measure
of Colonization of Roots by Vesicular-Arbuscular Mycorrhizal
Fungi. New Phytologist 115 : 495-501.
Michelsen, A. and S. Rosendhal. 1990. The Effect of VA Mycorrhizal
Fungi, Phosphorus and Drought Stress on The Growth of Acacia
nilotica and Leucaena leucocephala Seedlings. Plant and Soil
124 : 7-13.
Muthukumar, T., K. Udaiyan and V. Rajeshkannan. 2001. Response
of Neem (Azadirachta indica A. Juss) to Indigenous Arbuscular
Mycorrhizal Fungi, Phosphate-Solubilizing and Asymbiotic
Nitrogen-Fixing Bacteria Under Tropical Nursery Conditions.
Biology and Fertility Soils 34 : 417-426
Olsen, S.R. and L.E. Sommers. 1982. Phosphorus. In : Page AL (ed.)
Methods of Soil Analysis Part 2 Chemical and Micro-biological
Properties. American Society of Agronomy, Madison, p 403-430.
Oyen, L.P.A. and N.X. Dung (Eds.). 1999. Essential-Oil Plants. Plant
Resources of South-East Asia No. 19. Prosea, Bogor, Indonesia.
Paoli, G.D., D.R. Peart, M. Leighton and I. Samsoedin. 2001. An
Ecological and Economic Assessment of The Nontimber Forest
Product Gaharu Wood in Gunung Palung National Park, West
Kalimantan, Indonesia. Conservation Biology 15 : 1721-1732.
Rajan, S.K., B.J.D. Reddy and D.J. Bagyaraj. 2000. Screening of
Arbuscular Mycorrhizal Fungi for Their Symbiotic Efficiency
with Tectona grandis. Forest Ecology and Management 126:
91-95.
Santiago, G.M., Q. Garcia and M.R. Scotti. 2002. Effect of Post-Planting
Inoculation with Bradyrhizobium sp. and Mycorrhizal Fungi
on The Growth Brazilian Rosewood, Dalbergia nigra Allem. Ex
Benth., in Two Tropical Soils. New Forests 24 : 15-25.
Santoso, E., A.W. Gunawan dan M. Turjaman. 2008. Kolonisasi
Cendawan Mikoriza Arbuskula pada Bibit Tanaman Penghasil

147

Aspek SILVIKULTUR

Gaharu. Jurnal Penelitian Hutan dan Konservasi Alam IV


(5): 499-509. Pusat Penelitian dan Pengembangan Hutan dan
Konservasi Alam, Bogor.

148

Penggunaan Fungsi Mikoriza .....(Maman Turjaman, dkk.)

Lampiran 1. Kolonisasi mikoriza arbuskula dan pertumbuhan pada jenisjenis Aquilaria setelah enam bulan pada kondisi di rumah kaca
Kolonisasi
AM

Perlakuan

A. crassna

Tinggi
(cm)

Berat basah

Diameter
(mm)

Entrophospora sp.

73b

46,14 c

5,4 c

63b

29,58 b

4,1 b

G. clarum

78b

32,43 b

4,4 b

8,82b

4,3b

Glomus sp. ZEA

78b

38,94 c

4,7 b

9,92b

4,54b

Glomus sp. ACA

59b

24,60 a

3,7 a

13,46b 6,94b

4,19b

Entrophospora sp.

0,33a

0,13a

12,58b 5,72b

3,82b

1,35b

100

11,64b 7,36b

3,26b

1,56b

100

0,86a

0,27a

100

2,99b

1,01b

87

1,52b

100

1,06a

Daya
hidup
(%)

Akar (g)

G. decipiens

0,68a

Pucuk
(g)

4a*

Kontrol

2,9 a

Berat kering

Akar
(g)

Kontrol

A. malaccensis

20,90 a

Pucuk
(g)

70

1a

16,43a

2,28a

1,46a

0,52a

0,41a

0,18a

73

97b

25,97c

3,88c

4,68c

2,24c

1,44c

0,48c

100

G. decipiens

88b

21,91b

3,02b

2,92b

1,20b

0,88b

0,27b

100

G. clarum

83b

19,96b

2,94b

2,90b

1,28b

1,95c

0,78c

97

Glomus sp. ZEA

84b

22,33b

3,26b

2,62b

1,38b

0,79b

0,27b

90

Glomus sp. ACA

86b

21,30b

3,12b

2,74b

1,22b

0,89b

0,26b

93

A. microcarpa
Kontrol

2a

13,39a

2,23a

Entrophospora sp.

97b

24,74d

3,89c

4,32c

G. decipiens

88b

21,99c

3,67c

3,87c

Glomus clarum

83b

20,28c

3,58c

3,46c

Glomus sp. ZEA

85b

17,24b

2,84b

Glomus sp. ACA

87b

18,09b

2,98b

A. beccariana

0,75a

0,23a

0,09a

67

2,29c

1,31c

0,37b

100

3,41d

1,44c

0,57c

97

1,55b

0,95b

0,30b

93

2,24b

1,08b

0,64b

0,24b

87

2,70b

1,23b

0,76b

0,28b

90

0,34a

Kontrol

10a

15,40a

1,90a

0,30a

0,10a

0,09a

0,02a

73

Entrophospora sp.

85b

19,20b

2,37b

5,46e

2,54c

1,76c

0,78c

100

G. decipiens

71b

32,18d

3,94c

4,74d

1,64b

1,59c

0,41b

100

Glomus clarum

79b

45,30e

5,02d

6,74f

2,82d

2,30d

0,91d

100

Glomus sp. ZEA

61b

32,03d

3,75c

3,14b

1,38c

0,97b

0,36b

100

Glomus sp. ACA

84b

26,24c

3,53c

3,84c

1,20b

1,19b

0,28b

100

149

Aspek SILVIKULTUR

Lampiran 2. Kandungan N dan P pada jenis-jenis Aquilaria setelah enam


bulan diinokulasi oleh beberapa jenis fungi mikoriza arbuskula
(FMA)
N Concentrations
(mg/g)

Perlakuan
A. crassna

P Concentrations
(mg/g)

N Content
(mg/plant)

P Content
(mg/plant)

Kontrol

7,9 0,1a*

2,6 0,6a

0,78 0,02a

0,26 0,06a

Entrophospora sp.

9,8 0,1c

37,7 4,3d

1,42 0,03e

5,4 0,6d

G. decipiens

8,2 0,2a

26,7 4,1c

0,85 0,02b

2,8 0,5c

G. clarum

8,7 0,2b

7,4 1,0b

0,95 0,02c

0,82 0,14b

Glomus sp. ZEA

8,7 0,1b

25,8 3,6c

0,96 0,03c

2,85 0,41c

Glomus sp. ACA

10,8 0,2d

45,9 9,6d

1,22 0,02d

5,14 1,0d

A. malaccensis

Kontrol

8,6 0,2a

3,49 0,5a

0,65 0,02a

0,26 0,04a

Entrophospora sp.

12,1 0,1d

17,28 2,0c

0,73 0,01b

1,06 0,15d

G. decipiens

10,7 0,1c

9,02 0,7b

0,85 0,01c

0,75 0,07c

G. clarum

10,4 0,1b

20,5 3,3c

0,72 0,02b

1,60 0,20e

Glomus sp. ZEA

11,1 0,2c

8,8 0,9b

0,77 0,03b

0,6 0,07b

Glomus sp. ACA

10,9 0,2c

9,7 1,8b

1,04 0,03d

0,92 0,17c

A. microcarpa

Kontrol

7,8 0,1a

1,02 0,07a

0,65 0,02a

0,08 0,01a

Entrophospora sp.

9,6 0,2c

16,9 1,5d

1,12 0,03d

1,97 0,18d

G. decipiens

9,6 0,1c

11,7 0,9c

0,86 0,01c

1,20 0,18c

G. clarum

9,3 0,1c

8,3 0,4b

0,78 0,02b

0,70 0,03b

Glomus sp. ZEA

9,4 0,1c

9,17 1,35b

0,77 0,03b

0,75 0,12b

Glomus sp. ACA

8,9 0,2b

8,28 0,40b

0,77 0,02b

0,9 0,1b

A. beccariana

Kontrol

6,0 0,1a

5,02 0,07a

0,40 0,02a

0,10 0,01a

Entrophospora sp.

9,9 0,2c

10,2 1,0c

0,98 0,02d

0,87 0,20d

G. decipiens

10,6 0,1c

11,8 0,8c

0,89 0,03c

1,25 0,21c

G. clarum

11,3 0,d

12,5 0,4d

1,11 0,02e

1,95 0,03e

Glomus sp. ZEA

9,4 0,1b

9,17 1,35b

0,77 0,03b

0,75 0,12b

Glomus sp. ACA

8,8 0,2b

9,28 0,40b

0,97 0,02d

1,04 0,1c

*Nilai-nilai dengan huruf yang sama adalah tidak berbeda nyata (P<0.05).

150

8
HAMA PADA TANAMAN PENGHASIL
GAHARU
Ragil SB Irianto, Erdy Santoso, Maman Turjaman, Irnayuli R.
Sitepu
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Tanaman penghasil gaharu yang ada di Indonesia sekitar 27
jenis, beberapa di antaranya yang cukup potensial menghasilkan
gaharu yaitu Aquilaria spp., Aetoxylontallum spp., Gyrinops spp.,
dan Gonystylus spp.
Pemanfaatan gaharu di Indonesia oleh masyarakat terutama
di pedalaman Pulau Sumatera dan Kalimantan telah berlangsung
ratusan tahun yang lalu. Secara tradisional gaharu dimanfaatkan,
antara lain dalam bentuk dupa untuk upacara keagamaan,
pengharum tubuh dan ruangan, bahan kosmetik dan obat-obatan
sederhana.
Produk gaharu saat ini sangat dicari oleh para pencari gaharu,
karena harganya yang cukup mahal, dimana harga gaharu super
dapat mencapai sekitar Rp 40 juta/kg. Akibat dari harga yang cukup
tinggi tersebut, maka para pencari gaharu semakin intensif untuk
mendapatkannya, saat ini para pencari gaharu mulai memfokuskan
mencari gaharu di Pulau Papua yang potensi alamnya (gaharu)
masih cukup tinggi dibandingkan dengan di Pulau Kalimantan atau
Sumatera.

151

Aspek SILVIKULTUR

Dengan semakin langkanya tanaman penghasil gaharu di


lapang dan harganya yang cukup tinggi tersebut, maka para
peneliti kehutanan, rimbawan, dan masyarakat awam mulai
mendomestikasi atau menanam tanaman penghasil gaharu di luar
habitat aslinya. Saat ini banyak sekali para petani maupun orang
kota yang mulai menanam tanaman penghasil gaharu dalam skala
kecil dari beberapa pohon sampai dengan ribuan pohon.
Penanaman tanaman penghasil gaharu yang monokultur dan di
luar habitat aslinya pada umumnya akan rentan terhadap serangan
hama dan penyakit.
Dimulai dua tahun yang lalu banyak sekali sentra penanaman
tanaman penghasil gaharu yang terserang hama daun Heortia
vitessoides Moore. Sentra penanaman tanaman penghasil gaharu
yang terserang hama dan telah dilaporkan terdapat di KHDTK
Carita (2008), Sanggau (2007), Mataram (2009), dan lain-lain.

HAMA Heortio vitessoides


A. Gejala Serangan
Gejala serangan tingkat awal adalah permukaan daun yang
muda dimakan oleh larva instar pertama dan daun tersebut hanya
meninggalkan tulang-tulang daunnya. Pada stadia lebih lanjut ulatulat tersebut mulai menyerang daun-daun pada bagian cabang
lebih atasnya dan menyebabkan tanaman menjadi gundul.
Ngengat meletakkan telurnya pada bagian bawah permukaan
daun yang muda pada cabang tanaman yang dekat dengan
permukaan tanah.

B. Siklus Hidup
1. Telur
Ngengat meletakkan telurnya yang berwarna putih kekuningkuningan yang akan segera berubah menjadi kuning kehijauhijauan dalam bentuk kluster pada bagian bawah permukaan daun

152

Hama pada Tanaman .....(Ragil SB Irianto, dkk.)

yang muda pada cabang tanaman yang dekat dengan permukaan


tanah, jumlah telur yang dihasilkan per imago betina berkisar
antara 350-500. Telur akan menetas sekitar 10 hari.

2. Larva/Ulat
Ulat H. vitessoides pada instar pertama berwarna kuning pucat
dan pada instar selanjutnya menjadi hijau kekuning-kuningan, ulat
ini terdiri dari 5 instar dan berlangsung selama 23 hari. Larva instar
terakhir pada saat akan berkepompong mulai berhenti makan dan
ulat turun ke permukaan tanah untuk berkepompong.

3. Pupa
Larva instar terakhir sebelum berkepompong akan berhenti
makan dan turun ke permukaan tanah dengan bantuan benang
sutera yang dihasilkannya. Ulat akan membungkus dirinya dengan
butiran-butiran tanah atau serpihan-serpihan serasah yang ada di
permukaan dengan bantuan benang-benang suteranya. Stadium
pupa berkisar 8 hari.

4. Ngengat
Serangga dewasa berbentuk ngengat yang aktif pada waktu
malam. Ngengat betina dapat meletakkan telur sebanyak 350-500.
Stadium ngengat berkisar sekitar 4 hari.
Ngengat
(4 Hari)

Kepompong
(8 Hari)

Telur
(10 Hari)

Larva
(23 Hari)

Gambar 1. Siklus hidup hama daun tanaman penghasil


gaharu H. vitessoides

153

Aspek SILVIKULTUR

STRATEGI PENGENDALIAN
A. Jangka Pendek
1. Mekanis
Pengendalian mekanis merupakan pengendalian yang
sangat sederhana, sudah populer di tingkat petani, yaitu dengan
cara mengambil ulat atau telur yang ada di tanaman tersebut.
Pengendalian dengan cara ini mudah diaplikasikan terutama pada
pesemaian atau bibit yang baru dua tahun, dimana tanaman masih
bisa dijangkau oleh orang dengan berdiri tanpa bantuan alat.

2. Kimiawi
Pengendalian kimiawi dapat dilakukan dengan insektisida
kontak, sistemik atau dengan insektisida yang berbahan aktif
mikroorganisme, seperti Beauveria bassiana atau Bacillus
thuringiensis. Karena hama ini memakan daun dan pada serangan
berat umumnya tanaman gundul, maka disarankan pada saat
penyemprotan dikombinasikan dengan pemupukan lewat daun
dengan pupuk daun seperti gandasil, growmore, dan lain-lain untuk
merangsang tumbuhnya tunas-tunas baru.

3. Nabati
Pengendalian nabati merupakan pengendalian yang cukup
sederhana dan dapat dilakukan oleh petani sendiri dengan
mengambil bahan-bahan yang ada di sekitar lokasi penanaman
tanaman gaharu.

B. Jangka Menengah
1. Predator Rangrang
Semut rangrang (Oecophylla smaradigna) merupakan serangga
yang mudah ditemukan di kampung-kampung pada tanamantanaman yang banyak mengeluarkan nektar, seperti tanaman
nangka, rambutan, melinjo, durian, dan lain-lain. Pencarian sarang
semut rangrang yang memiliki ratu merupakan salah satu faktor

154

Hama pada Tanaman .....(Ragil SB Irianto, dkk.)

keberhasilan dalam perkembangan populasi serangga tersebut


dalam jangka panjang.

C. Jangka Panjang
1. Musuh Alami
Musuh alami, baik parasit maupun predator dari serangga
perusak daun tanaman penghasil gaharu H. vitessoides merupakan
suatu cara pengendalian yang sangat diharapkan dalam jangka
panjang.

2. Teknik Silvikultur
Pengendalian dengan cara teknik silvikultur merupakan salah
satu cara pengendalian yang sudah menyatu dengan penanaman
suatu tanaman dan termasuk pengendalian yang sudah cukup
dikenal oleh petani.

DAFTAR PUSTAKA
Kalita, J., P. R. Bhattacharyya, and S. C. Nath. 2002. Heortia vitessoides
Moore A Serious Pest of Agarwod Plant (Aquilaria malaccensis
Lamk). Geobios 29: 13-16.
Mele, P. V. dan N. T. T. Cuc. 2004. Semut Sahabat Petani: Meningkatkan
Hasil Buah-Buahan dan Menjaga Kelestarian Lingkungan
Bersama Semut Rangrang. ICRAF. 59 p.
Mele, P. V. 2008. A Historical Review of Research on The Weaver
Ant Oecophylla in Biological Control. Agricultural and Forest
Entomology 10: 13-22.

155

156

Aspek
SOSIAL EKONOMI DAN
KONSERVASI

157

158

9
PROSPEK PENGUSAHAAN GAHARU
MELALUI POLA PENGELOLAAN
HUTAN BERBASIS MASYARAKAT
(PHBM)
Sri Suharti
Pusat Litbang Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu merupakan salah satu tanaman hutan yang mempunyai
nilai ekonomi tinggi karena kayunya mengandung resin yang
harum. Sejenis resin beraroma ini berasal dari tanaman jenis
Aquilaria, Gyrinops, dan Gonystylus. Jika tanaman ini terluka, rusak
atau terinfeksi, baik disebabkan penyakit atau serangan serangga,
akan menghasilkan resin/substansi aromatik berupa gumpalan
atau padatan berwarna coklat muda sampai coklat kehitaman yang
terbentuk pada lapisan dalam dari jenis kayu tertentu sebagai reaksi
dari infeksi/ luka tersebut. Resin ini sebetulnya dapat melindungi
tanaman dari infeksi yang lebih besar sehingga dapat dianggap
sebagai sistim imun yang dihasilkan (Squidoo, 2008).
Tanaman penghasil gaharu secara alami tumbuh di wilayah
Asia Selatan dan Asia Tenggara. Beberapa nama diberikan pada
gaharu seperti agarwood, aloeswood, gaharu (Indonesia), ood, oudh,
oodh (Arab), chenxiang (China), pau daquila (Portugis), bois daigle
(Perancis), dan adlerholz (Jerman). Aquilaria yang merupakan
tanaman penghasil gaharu saat ini menjadi jenis yang dilindungi

159

Aspek SOSIAL EKONOMI DAN KONSERVASI

di banyak negara dan eksploitasi gaharu dari hutan alam dianggap


sebagai kegiatan ilegal.
Kesepakatan internasional seperti CITES (Convention on
International Trade in Endangered Species of Wild Fauna and Flora)
yang disepakati oleh 169 negara ditetapkan untuk menjamin bahwa
perdagangan gaharu tidak mengganggu survival dari Aquilaria.
Meskipun demikian, eksploitasi gaharu secara ilegal ternyata tetap
berlangsung dan konsumen yang kurang memahami hal ini secara
tidak sadar justru menciptakan permintaan yang tinggi yang dapat
membahayakan keberadaan tanaman Aquilaria (Blanchette, 2006).
Sampai saat ini, permintaan akan gaharu jauh melebihi supply
yang ada. Sebagai akibatnya pada beberapa tahun terakhir ada
kecenderungan besar-besaran untuk mambudidayakan gaharu
terutama di wilayah Asia Tenggara (Squidoo, 2008). Di Indonesia,
tingginya harga gaharu dan makin langkanya tanaman gaharu di
hutan alam juga mendorong masyarakat di berbagai daerah untuk
melakukan budidaya gaharu seperti yang terjadi di Riau, Jambi,
Sumatera Utara, dan Kalimantan Selatan. Upaya pembudidayaan
tersebut makin berkembang karena ditunjang oleh kemajuan hasil
penelitian yang menunjukkan bahwa budidaya gaharu memberikan
keuntungan yang layak bagi pelakunya. Namun karena pengusahaan
gaharu memerlukan modal yang tidak sedikit, maka masyarakat
yang mampu membudidayakan gaharu adalah kelompok yang
memiliki permodalan yang kuat.
Untuk mengembangkan budidaya gaharu secara lebih luas,
perlu dikembangkan suatu skema kerjasama antara pemilik modal
dengan masyarakat. Salah satu bentuk kemitraan yang dapat
dikembangkan adalah pola PHBM (Pengelolaan Hutan Berbasis
Masyarakat). Pengembangan budidaya gaharu dengan pola PHBM
(sistem bagi hasil) merupakan salah satu alternatif bentuk usahatani
produktif yang selain bertujuan untuk mengembangkan budidaya
gaharu secara luas juga sekaligus dapat meningkatkan pendapatan
masyarakat serta mengurangi tekanan masyarakat terhadap hutan
yang tingkat ketergantungannya terhadap hutan tinggi.
PHBM diharapkan menjadi suatu cara yang efektif karena
melibatkan masyarakat sekitar hutan dan parapihak pemangku

160

Prospek Pengusahaan Gaharu .....(Sri Suharti)

kepentingan lainnya untuk bekerjasama dan berbagi (ruang, waktu,


hak dan kewajiban) dengan prinsip saling menguntungkan, saling
memperkuat, dan saling mendukung. Tulisan ini bertujuan untuk
memberikan gambaran tentang prospek pengusahaan gaharu oleh
masyarakat melalui pola pengelolaan hutan berbasis masyarakat
(PHBM).

METODOLOGI
Tulisan ini merupakan hasil desk study dari berbagai pustaka,
laporan hasil penelitian, dan data statistik yang tersedia. Data dan
informasi serta literatur tersebut dihimpun dari berbagai sumber
antara lain, Departemen Kehutanan, CITES, BPS, Asosiasi Gaharu
Indonesia (Asgarin), serta berbagai terbitan lainnya.
Data dan informasi yang berhasil dihimpun, diolah dan Dianalisis
secara deskriptif. Khusus untuk perhitungan analisis finansial
usahatani gaharu digunakan kriteria kelayakan Net Present Value
(NPV), Internal Rate of Return (IRR), dan Benefit Cost Ratio (B/C ).

NPV atau nilai kini bersih dirumuskan sebagai berikut:

n Bt Ct
NPV =
t =0 (1 + i)t

................................................................................... (1)

dimana:
NPV = Net Present Value (Nilai Kini Bersih),
Bt = benefit atau penerimaan pada tahun t,
Ct = biaya pada tahun t,
i
= tingkat diskonto atau potongan (=bunga bank yang berlaku),
n
= umur ekonomi proyek (cakrawala waktu).
Suatu kegiatan usaha dinyatakan layak secara finansial bila nilai
NPV > 0.
IRR atau tingkat pengembalian internal dirumuskan sebagai
berut:

161

Aspek SOSIAL EKONOMI DAN KONSERVASI

IRR = i1 +

NPV1
NPV1 NPV2

(i2 i1)

.............................................................. (2)

dimana:
IRR = Internal Rate of Raturn (tingkat keuntungan internal),
i1 = tingkat diskonto untuk menghasilkan NPV1 mendekati nol,
NPV1 = nilai NPV mendekati nol positif,
i2
= tingkat diskonto untuk menghasilkan NVP2 negatif mendekati
nol,
NPV2 = nilai NPV negatif mendekati nol.
Suatu bisnis dinyatakan layak secara finansial bilai nilai IRR
lebih besar dari tingkat suku pinjaman di bank yang berlaku saat
ini.
Selanjutnya, nilai B/C dirumuskan sebagai beikut:
n
Bt

t =0 (1 + i)t
B/C =
n
Ct

t =0 (1 + i)t

................................................................................... (3)

dimana:
B/C =
Benefit Cost Ratio ( Rasio penerimaan-biaya),
Bt = benefit atau penerimaan pada tahun t,
Ct = biaya pada tahun t,
i
= tingkat diskonto,
n
= umur ekonomis proyek.
Kegiatan usaha dikatakan layak apabila B/C > 1.

PROSPEK PENGUSAHAAN GAHARU


A. Prospek Pasar Gaharu
Indonesia adalah produsen gaharu terbesar di dunia dan menjadi
tempat tumbuh endemik beberapa spesies gaharu komersial dari

162

Prospek Pengusahaan Gaharu .....(Sri Suharti)

marga Aquilaria seperti A. malaccensis, A. microcarpa, A. hirta, A.


beccariana, A. filarial, dan lain-lain. Pada tahun 1985, jumlah ekspor
gaharu Indonesia mencapai sekitar 1.487 ton, namun eksploitasi
hutan alam tropis dan perburuan gaharu yang tidak terkendali telah
mengakibatkan spesies-spesies gaharu menjadi langka. Tingginya
harga jual gaharu mendorong masyarakat untuk memburu gaharu,
tidak hanya dengan cara memungut dari pohon gaharu yang mati
alami melainkan juga dengan menebang pohon hidup. Oleh karena
itu pada tahun 1995 CITES memasukkan A. malaccensis, penghasil
gaharu terbaik ke dalam daftar Ap-pendix II dan sejak saat itu ekspor
gaharu dibatasi oleh kuota yaitu hanya 250 ton/tahun (Anonim,
2005).
Perkembangan yang terjadi selanjutnya ternyata kurang begitu
bagus. Bahkan sejak tahun 2000, total ekspor gaharu dari Indonesia
terus menurun hingga jauh di bawah ambang kuota CITES. Semakin
sulitnya mendapatkan gaharu di hutan alam telah mengakibatkan
semua pohon gaharu (Aquilaria spp. dan Gyrinops spp.) dimasukkan
dalam Apendix II pada konvensi CITES tanggal 2-14 Oktober 2004 di
Bangkok (Gun et al., 2004). Selanjutnya, karena adanya kekhawatiran
akan punahnya spesies gaharu di Indonesia, maka sejak tahun
2005 Departemen Kehutanan kembali menurunkan kuota ekspor
menjadi hanya 125 ton/tahun (Anonim, 2005).
Permintaan terhadap gaharu terus meningkat karena banyaknya
manfaat gaharu. Seiring dengan kemajuan ilmu pengetahuan dan
teknologi industri, gaharu tidak hanya digunakan sebagai bahan
wangi-wangian (industri parfum), tetapi juga digunakan sebagai
bahan baku obat-obatan, kosmetika, dupa, dan pengawet berbagai
jenis asesoris. Selain itu, beberapa agama di dunia mensyaratkan
wangi gaharu yang dibakar sebagai sarana peribadatan (untuk
keperluan kegiatan religi).
Namun dari sisi negara pengekspor, tingginya permintaan
gaharu belum dapat dipenuhi karena kekurangan bahan baku
bermutu tinggi untuk ekspor. Hal ini banyak dikeluhkan oleh
beberapa eksportir gaharu Indonesia. Ekspor untuk pasar Timur
Tengah sebagai contoh menurun dari 67.245 kg pada tahun 2005
menjadi 39.400 kg tahun 2006, karena sulitnya memperoleh bahan

163

Aspek SOSIAL EKONOMI DAN KONSERVASI

baku gubal super yang diminta. Keluhan kekurangan bahan baku


gaharu untuk ekspor juga dialami oleh pemasok pasar Singapura.
Sebagai contoh, CV Ama Ina Rua, eksportir di Jakarta yang pada
tahun 2005 bisa mengekspor 5-6 ton/bulan, pada tahun 2006 hanya
mampu mengekspor 2-3 ton/bulan (Adijaya, 2009). Penurunan
kemampuan ekspor Indonesia tersebut sudah diprediksi oleh
berbagai pihak karena eksploitasi hutan dan perburuan gaharu
yang tidak terkendali.
Sebagai gambaran, pada Tabel 1 disajikan data hasil kajian
tentang perdagangan gaharu di Indonesia yang diterbitkan CITES
pada tahun 2003.
Penurunan kemampuan ekspor Indonesia tersebut sangat
berpengaruh terhadap perkembangan harga gaharu, baik di pasar
dunia maupun di tingkat pengumpul. Pada tahun 1980, harga
gaharu di tingkat pengumpul berkisar antara Rp 30.000-50.000/
kg untuk kualitas rendah dan Rp 80.000/kg untuk kualitas super.
Pada awalnya kenaikan harga gaharu relatif lambat, yaitu hanya
naik menjadi Rp100.000/kg pada tahun 1993. Kenaikan pesat
terjadi pada saat krisis ekonomi melanda Indonesia tahun 1997,
Tabel 1. Hasil pemanenan dan ekspor gaharu jenis Aquilqria spp. dari
Indonesia tahun 1995 - 2003

Tahun

Kuota
hasil
panen
resmi*)

Kuota
hasil
aktual*)

Aktual ekspor berdasar


CITES Indonesia*)

Net ekspor
laporan
CITES **)

n/a))

Total ekspor
gaharu
(semua
spesies)*)

1995

n/a

n/a

323,577

n/a

1996

300,000

160,000

299,523 (termasuk A.
filarial dan jenis lain

293,593

299,593

1997

300,000

120,000

287,002 (termasuk
A.filarial 180,000 kg)

305,483

287,002

1998

150,000

150,000

148,238

147,212

n/a )

1999

300,000

180,000

81,079

76,401

313,649

2000

225,000

225,000

81,377

81,377

245,150

2001

75,000

70,000

74,826

74,826

219,772

2002

75,000

68,000

70,546

n/a

175,245

2003

50,000

50,000

n/a

n/a

n/a

*): CITES Management Authority of Indonesia; **): CITES Annual Report Data Compiled by UNEP-WCMC;
): the reason for the unavailability of data for 1995 1nd 1998 is not known

164

Prospek Pengusahaan Gaharu .....(Sri Suharti)

di mana harga gaharu mencapai Rp 3-5 juta/kg. Kenaikan harga


gaharu terus berlanjut dan makin tajam hingga mencapai Rp10 juta/
kg pada tahun 2000 dan meningkat lagi hingga mencapai Rp 15 juta/
kg pada tahun 2009 (Adijaya, 2009; Wiguna, 2006).
Kondisi tersebut menggambarkan bahwa gaharu sangat
prospektif untuk dikembangkan, khususnya bagi Indonesia yang
memiliki potensi biologis yaitu tersedianya beragam spesies
tumbuhan penghasil gaharu dan masih luasnya lahan-lahan
kawasan hutan yang potensial serta tersedianya teknologi inokulasi
yang menunjang untuk pembudidayaan gaharu.

B. Potensi dan Peluang Usaha


Sebagaimana diuraikan sebelumnya, Indonesia memiliki potensi
yang sangat besar untuk menghasilkan gaharu, namun potensi
yang tersedia tersebut sampai saat ini belum dimanfaatkan secara
optimal dan produksi gaharu lebih banyak berasal dari proses
alami, sehingga produksi gaharu Indonesia terus menurun.
Pada saat ini luas kawasan hutan dan perairan Indonesia
berdasarkan Keputusan Menteri Kehutanan tentang Penunjukkan
Kawasan Hutan dan Perairan serta Tata Guna Hutan Kesepakatan
(TGHK) tercatat seluas 137,09 juta ha, terdiri dari Kawasan Suaka
Alam dan Pelestarian Alam 23,31 juta ha, Hutan Lindung 31,6 juta
ha, Hutan Produksi Terbatas 22,5 juta ha, Hutan Produksi Tetap
36,65 juta ha, Hutan Produksi yang Dapat Dikonversi 22,8 juta ha,
dan Taman Buru 0,23 juta ha (Departemen Kehutanan, 2007). Dari
kawasan hutan tersebut khususnya dari kawasan hutan produksi
alam, dihasilkan gaharu sebagai salah satu hasil hutan bukan kayu
yang bernilai ekonomi tinggi.
Gaharu dihasilkan oleh pohon-pohon terinfeksi yang tumbuh
di daerah tropika dan memiliki marga Aquilaria, Gyrinops,
dan Gonystilus yang keseluruhannya termasuk dalam famili
Thymelaeaceae. Marga Aquilaria terdiri dari 15 spesies, tersebar
di daerah tropis Asia mulai dari India, Pakistan, Myanmar, Lao
PDR, Thailand, Kamboja, China Selatan, Malaysia, Philipina,
dan Indonesia. Enam di antaranya ditemukan di Indonesia (A.
malaccensis, A. microcarpa, A. hirta, A. beccariana, A. cumingiana,

165

Aspek SOSIAL EKONOMI DAN KONSERVASI

dan A. filarial). Keenam jenis tersebut terdapat hampir di seluruh


kepulauan Indonesia, kecuali Jawa, Bali, dan Nusa Tenggara. Marga
Gonystilus memiliki 20 spesies, tersebar di Asia Tenggara mulai
dari Malaysia, Peninsula, Serawak, Sabah, Indonesia, Papua New
Guinea, Philipina, dan kepulauan Solomon serta kepulauan Nicobar.
Sembilan spesies di antaranya terdapat di Indonesia yaitu di
Sumatera, Kalimantan, Bali, Maluku, dan Irian Jaya. Marga Gyrinops
memiliki tujuh spesies. Enam di antaranya tersebar di Indonesia
bagian timur serta satu spesies terdapat di Srilanka (Anonim, 2002).
Berbagai hasil penelitian tentang tanaman gaharu memberikan
hasil yang sangat menggembirakan karena berbagai jenis tanaman
gaharu dari hutan alam ternyata dapat dibudidayakan dan produksi
gaharu dapat direkayasa. Pembudidayaan tanaman penghasil
gaharu dapat dilakukan secara monokultur maupun tumpangsari
dengan tanaman lainnya. Persyaratan tumbuh serta pemeliharaan
tanaman penghasil gaharu relatif tidak terlalu rumit. Karena
sifat permudaan gaharu yang toleran terhadap cahaya (butuh
naungan), penanaman pohon gaharu sebaiknya dilakukan secara
tumpangsari atau berada di bawah naungan tegakan lain seperti
karet, sawit, durian (Rizlani dan Aswandi, 2009) atau di bawah
tegakan pohon hutan seperti meranti, mahoni, pulai seperti yang
dikembangkan di KHDTK Carita. Jika ditanam secara monokultur
dan tanpa naungan resiko kegagalan penanaman (tanaman muda)
lebih tinggi. Beberapa alternatif pengembangan budidaya pohon
penghasil gaharu selain pada hutan produksi (LOA), HTI, Hutan
Rakyat juga dapat ditanam pada areal tanaman perkebunan (karet,
kelapa, sawit, dan lain-lain).
Setelah tanaman penghasil gaharu berumur 5 tahun dengan
diameter 15 cm, rekayasa produksi untuk menghasilkan gaharu
sudah dapat mulai dilakukan dengan cara teknik induksi/inokulasi
penyakit pembentuk gaharu yang sesuai dengan jenis pohon. Hasil
rekayasa tersebut dapat dipanen satu atau dua tahun kemudian.
Pemanenan dapat dilakukan pada kondisi pohon belum mati,
tetapi idealnya dipanen setelah pohon mati dengan variasi mutu
produksi akan terdiri dari kelas gubal, kemedangan, dan abu/
bubuk (Sumarna, 2007). Keberhasilan berbagai hasil penelitian

166

Prospek Pengusahaan Gaharu .....(Sri Suharti)

tersebut makin mendorong dan menggugah pemburu gaharu untuk


melakukan budidaya tanaman gaharu.
Upaya pembudidayaan gaharu sudah mulai dirintis sejak
tahun 1994/1995 oleh sebuah perusahaan pengekspor gaharu, PT
Budidaya Perkasa di Riau dengan menanam A. malaccensis seluas
lebih dari 10 hektar. Selain itu Dinas Kehutanan Riau juga menanam
jenis yang sama seluas 10 hektar di Taman Hutan Raya Syarif
Hasyim. Selanjutnya pada tahun 2001-2002 beberapa individu atau
kelompok tani juga mulai tertarik untuk membudidayakan jenis
pohon penghasil gaharu. Sebagai contoh usaha yang dilakukan oleh
para petani di Desa Pulau Aro, Kecamatan Tabir Ulu, Kabupaten
Merangin, Jambi, yang menanam gaharu dari jenis A. malacensis
dan A. microcarpa. Di desa tersebut, sampai akhir tahun 2002
terdapat sekitar 116 petani yang tergabung dalam Kelompok
Tani Penghijauan Indah Jaya yang telah mengembangkan lebih
dari seratus ribu bibit gaharu (Anonim, 2008). Selain itu, BP DAS
Batanghari bekerjasama dengan Badan Litbang Kehutanan pada
2004/2005 membuat demplot budidaya gaharu di antara tegakan
tanaman karet rakyat seluas 50 ha (Sumarna, 2007).

C. Kelayakan Pengusahaan Gaharu


Untuk memperoleh gambaran bagaimana kelayakan
pengusahaan gaharu melalui budidaya dan rekayasa produksi
gaharu, berikut ini dilakukan contoh analisis finansial budidaya
gaharu dengan asumsi tingkat keberhasilan mencapai 60%. Analisis
finansial tersebut menggunakan beberapa batasan dan asumsi
sebagai berikut:
1. Pengusahaan gaharu dilakukan pada luasan satu ha dengan
jarak tanam 5 m x 5 m, sehingga kerapatan 400 pohon per hektar.
2. Tanaman yang bertahan hidup dan menghasilkan gaharu
diasumsikan 60% dengan tingkat produksi 2 kg per pohon,
sehingga total produksi 480 kg/ha dengan 3 kualitas masingmasing kelas kemedangan I sebesar 10%, kelas kemedangan II
sebesar 40%, dan kelas kemedangan III sebesar 50%.

167

Aspek SOSIAL EKONOMI DAN KONSERVASI

3. Harga jual produksi gaharu hasil inokulasi untuk kelas


kemedangan I = Rp 5 juta/kg, kelas kemedangan II = Rp 2 juta/
kg, dan kelas kemedangan III = Rp 500 ribu/kg.
4. Upah tenaga kerja, baik tenaga kerja keluarga maupun luar
keluarga diasumsikan sebesar Rp 50.000/HK, sedangkan upah
tenaga kerja untuk inokulasi Rp 30.000/pohon.
5. Harga inokulan diasumsikan Rp 50.000/pohon, sehingga total
biaya inokulan Rp 20 juta/ha.
6. Analisis finansial menggunakan tingkat diskonto sebesar 15%.
Berdasarkan asumsi dan batasan tersebut ternyata untuk
pengusahaan satu hektar gaharu dibutuhkan biaya sebesar Rp
141,350 juta. Biaya tersebut meliputi biaya pra-investasi dan
persiapan lahan serta penanaman sebesar Rp 26,50 juta, biaya
bahan dan peralatan Rp 40,350 juta, dan biaya tenaga kerja Rp 74,50
juta. Kalau diperhatikan lebih seksama, beban biaya yang relatif
besar adalah untuk pembelian bahan inokulan, tenaga kerja untuk
inokulasi, dan tenaga kerja untuk pemungutan hasil (panen) yang
besarnya mencapai Rp 77 juta atau sekitar 54,47% dari total biaya.
Hasil analisis finansial menunjukkan bahwa pengusahaan gaharu
tersebut layak untuk dilaksanakan karena dapat menghasilkan
keuntungan bersih nilai kini (NPV) sebesar Rp 147,74 juta/ ha, IRR
sebesar 48,53%, dan B/C = 3,32 (Lampiran 1).

PROSPEK PENGUSAHAAN GAHARU DENGAN POLA


PHBM
A. Peluang Pengembangan Gaharu dengan Pola PHBM
Pembudidayaan tanaman penghasil gaharu akhir-akhir
ini makin marak karena sebagian masyarakat sudah dapat
menikmati hasilnya. Namun di sisi lain juga dijumpai beberapa
kasus ketidakberhasilan pengusahaan gaharu yang disebabkan
antara lain oleh kegagalan dalam pemeliharaan, kegagalan dalam
melakukan inokulasi, dan adanya pencurian pohon di kebun gaharu
(Duryatmo, 2009).

168

Prospek Pengusahaan Gaharu .....(Sri Suharti)

Untuk lebih membudayakan penanaman gaharu secara


luas, meningkatkan peluang keberhasilan serta mengurangi
resiko kerugian yang diderita, perlu dikembangkan suatu pola
kemitraan dalam budidaya tanaman penghasil gaharu. Salah satu
bentuk kemitraan yang dapat dikembangkan adalah melalui pola
pengelolaan hutan berbasis masyarakat (PHBM), baik di lahan
milik di luar kawasan hutan maupun di kawasan hutan. PHBM
merupakan salah satu jawaban dari pergeseran paradigma dalam
pengelolaan sumberdaya hutan dari yang berbasis negara (state
based) ke arah yang berbasis komunitas/masyarakat (community
based) (Indradi, 2009).
Perubahan paradigma ke arah PHBM menjadi momentum
penting bagi masyarakat desa hutan. Di satu sisi masyarakat dapat
mendayagunakan potensi-potensi kehutanan untuk kesejahteraan
mereka, dan di sisi lain, masyarakat di dalam dan di sekitar
kawasan hutan dapat menjadi aset bagi usaha-usaha penjagaan,
pemeliharan, dan pengelolaan hutan (Hayat, 2007).
Melalui pola PHBM, parapihak yang tertarik (pemerintah,
pengusaha/investor, kelompok usaha bersama/koperasi, masyarakat)
dapat berbagi peran dan tanggung jawab untuk mengembangkan
tanaman gaharu. Masyarakat dengan keterbatasan sumberdaya yang
dimiliki (lahan, input produksi, sarana prasarana, keterampilan,
akses pasar, dan lain-lain) dapat ikut berperan dalam pengusahaan
tanaman gaharu.
Karena bentuk kerjasamanya adalah kemitraan, maka parapihak yang terlibat dalam kegiatan ini dapat memperoleh bagian/
sharing manfaat sesuai kontribusi masing-masing. Pengembangan
gaharu melalui pola PHBM merupakan salah satu alternatif
peningkatan produksi gaharu melalui pelibatan masyarakat dalam
budidaya gaharu. Dengan pola ini diharapkan areal tanam dan juga
kualitas dan kuantitas produksi gaharu akan dapat ditingkatkan.
Pengembangan gaharu dengan pola PHBM dapat dilakukan,
baik dalam areal hutan milik (hutan rakyat) maupun dalam
kawasan hutan Negara. Pada areal hutan milik, masyarakat
diharapkan melakukan penanaman gaharu pada lahannya sendiri
terutama pada lahan kosong (tidak produktif ) secara swadaya.

169

Aspek SOSIAL EKONOMI DAN KONSERVASI

Agar masyarakat bersedia menanam gaharu, maka perlu diberikan


berbagai bentuk insentif, baik berupa pengadaan bibit, biaya tanam,
biaya inokulasi tanaman maupun informasi tentang peluang dan
teknik pengembangan gaharu.
Pengadaan bibit dan inokulasi dapat difasilitasi oleh mitra
kerjasama yang disalurkan kepada petani, baik dalam bentuk
bantuan/hibah maupun melalui sistim kredit yang akan dibayar
jika tanaman gaharu telah menghasilkan nantinya. Oleh karena
lahan milik rakyat umumnya tidak begitu luas dan sudah ditumbuhi
berbagai jenis tanaman, proporsi tanaman gaharu yang ditanam
disesuaikan dengan luasan dan kondisi areal hutan milik yang ada.
Dalam prakteknya pengembangan hutan rakyat gaharu umumnya
dikombinasikan dengan tanaman semusim atau tahunan lainnya
yang sudah ada (tanaman sisipan).
Pengembangan tanaman gaharu dalam kawasan hutan dapat
dilakukan melalui pelibatan masyarakat sekitar hutan dalam
pengelolaan hutan. Hal ini sesuai dengan paradigma pembangunan
kehutanan yang lebih menitikberatkan pada peningkatan partisipasi
masyarakat dalam pengelolaan hutan dan menempatkan masyarakat
desa hutan sebagai patner/mitra menuju pengelolaan hutan lestari.
Oleh karena kawasan hutan umumnya sudah ditumbuhi dengan
berbagai jenis tumbuhan, maka pola tanam yang dikembangkan
adalah pola tumpangsari (sisipan atau tanaman sela di antara
tegakan yang sudah ada).
Berbagai hasil penelitian menunjukkan bahwa pola kerjasama
kemitraan pengelolaan hutan dengan masyarakat desa hutan
memberikan dampak positif, baik secara ekonomi, sosial maupun
ekologi. Keterlibatan masyarakat dalam pengelolaan hutan
meningkatkan posisi tawar serta rasa memiliki masyarakat terhadap
sumberdaya hutan yang ada. Dampak positif yang terjadi selanjutnya
adalah sumberdaya hutan akan lebih terjaga dan terpelihara,
produktivitas meningkat serta kesejahteraan masyarakat akan
meningkat pula. Adanya peningkatan kesejahteraan dari budidaya
gaharu selanjutnya akan mengurangi tekanan masyarakat terhadap
sumberdaya hutan dalam bentuk illegal logging dan perambahan
lahan bahkan masyarakat secara sadar akan mempertahankan

170

Prospek Pengusahaan Gaharu .....(Sri Suharti)

setiap jengkal hutan dari kerusakan, apapun penyebabnya


(Aswandi, 2009).
Menempatkan masyarakat sebagai mitra dalam pengelolaan
hutan secara tidak langsung juga telah memposisikan masyarakat
sebagai garda terdepan dalam pengamanan sumberdaya hutan.
Dari sisi masyarakat, pengembangan gaharu dengan pola PHBM
memberikan peluang kepada masyarakat untuk memperoleh
manfaat ganda yaitu dari hasil tanaman gaharu jika telah
menghasilkan nantinya serta kesempatan untuk memanfaatkan
lahan di antara tanaman untuk usahatani tanaman semusim.

B. Sistim Bagi Hasil dalam PHBM


Pengembangan gaharu dengan pola PHBM merupakan salah
satu alternatif usaha yang dapat mengakomodasikan kepentingan
ekologi di satu sisi dan pertimbangan ekonomi di sisi lain. Tanaman
gaharu dipilih karena tanaman ini dapat tumbuh di dalam areal
hutan yang sudah banyak ditumbuhi tegakan pohon dengan
intensitas cahaya < 70%, pemeliharaannya relatif mudah dan
bernilai ekonomi tinggi. Beberapa prinsip utama yang dipegang
dalam pengembangan gaharu dengan pola PHBM adalah:
1. Pengembangan kerjasama memang layak secara ekonomi
dalam jangka panjang (sesuai jangka waktu kontrak perjanjian
kerjasama),
2. Adanya tujuan bersama yang ingin dicapai,
3. Adanya pengaturan kerjasama yang saling menguntungkan dan
adil sesuai dengan kontribusi yang diberikan masing-masing
pihak untuk mencapai tujuan bersama,
4. Adanya kesepahaman tentang resiko dan konsekuensi dari
adanya perjanjian kerjasama tersebut.
Beberapa skenario sebagai alternatif bentuk kemitraan yang
dapat dikembangkan antara lain sebagaimana disajikan dalam
Tabel 2.

171

Aspek SOSIAL EKONOMI DAN KONSERVASI

Tabel 2. Alternatif bentuk kemitraan yang dapat dikembangkan


Jenis input

Skenario I
1

Lahan

Saprodi
Tenaga kerja

Skenario II

Skenario III

Skenario IV

Bahan inokulan

Biaya inokulasi

Pengolahan hasil

Pemasaran

Keterangan: 1. Petani; 2. Investor/Pengusaha; 3. Pemda/Pihak lain

Sebagaimana diuraikan sebelumnya, pengembangan gaharu


dengan pola PHBM dapat dilakukan di areal hutan milik maupun di
dalam kawasan hutan sepanjang persyaratan tumbuhnya terpenuhi.
Berbeda dengan pengusahaan gaharu skala besar yang dilakukan
oleh para investor, budidaya gaharu oleh masyarakat umumnya
dilakukan dalam skala kecil dengan pola campuran. Sebagaimana
sifat usahatani skala kecil oleh masyarakat yang ketergantungannya
terhadap lahan usahatani yang dimiliki/digarap sangat tinggi,
maka gaharu bukan merupakan komoditi utama yang diusahakan.
Gaharu diusahakan sebagai investasi jangka panjang, sepanjang
modal yang dimiliki mencukupi untuk biaya budidaya tanaman
berikut biaya inokulasinya yang cukup besar. Konsekuensinya,
populasi tanaman gaharu dalam setiap garapan petani berjumlah
relatif sedikit serta tidak seragam, tergantung luas lahan garapan
dan kepadatan tanaman yang ada.
Dengan pola PHBM, diharapkan masyarakat yang memiliki
banyak keterbatasan, baik dari segi permodalan, teknologi serta
akses terhadap pasar dapat ikut berpartisipasi dalam budidaya
tanaman gaharu. Besarnya bagi hasil yang diperoleh oleh masingmasing pihak yang terlibat dalam PHBM disesuaikan dengan
kontribusi masing-masing pihak dan merupakan hasil kesepakatan
bersama. Dengan demikian meskipun investor/penyandang dana

172

Prospek Pengusahaan Gaharu .....(Sri Suharti)

memberikan kontribusi input dengan porsi terbesar, belum tentu


bagian hasil/sharing yang diperolehnya akan paling besar pula.
Apalagi jika pengembangan kemitraan dengan pola PHBM bertujuan
untuk meningkatkan kelestarian sumberdaya hutan (dalam
hal ini tanaman gaharu yang sudah langka) dan meningkatkan
kesejahteraan masyarakat desa hutan dan bukan semata-mata
untuk tujuan komersial (mendapat profit terbesar).

C. Uji Coba Pengembangan Gaharu dengan Pola PHBM


di KHDTK Carita
Di areal KHDTK Carita, Banten pada tahun 2008 telah
dikembangkan uji coba skema kemitraan budidaya tanaman
penghasil gaharu dengan pola PHBM. Uji coba ini merupakan
kerjasama antara Pusat Penelitian dan Pengembangan Hutan dan
Konservasi Alam dengan masyarakat sekitar areal KHDTK Carita,
Banten. Kegiatan dilaksanakan pada sebagian Petak 21 di areal
KHDTK Carita dengan luas 40 hektar.
Kegiatan dilaksanakan dengan melibatkan masyarakat yang
telah berusahatani di areal tersebut untuk ikut mengembangkan
tanaman penghasil gaharu di lahan garapan mereka. Kelompok
masyarakat yang terlibat dalam kegiatan penelitian ini berasal
dari Desa Sindang Laut dan Desa Suka Jadi tepatnya dari Kampung
Longok, Cangkara, dan Cilaban sebanyak 49 orang (anggota
Kelompok Tani Hutan Giri Wisata Lestari yang dipimpin Ustad
Jafar sebanyak 40 orang dan Kelompok Tani Hutan Carita Lestari
pimpinan Pak Rembang sebanyak 19 orang).
Selama ini masyarakat ikut menggarap lahan di Petak 21 dengan
budidaya berbagai tanaman jenis pohon serbaguna (JPSG) dan
buah-buahan seperti melinjo, durian, cengkeh, jengkol, petai, dan
nangka. Selain tanaman JPSG milik masyarakat, di areal tersebut
juga terdapat berbagi pohon hutan seperti meranti, mahoni, pulai,
khaya, dan hawuan. Oleh karena areal kerjasama sudah ditumbuhi
berbagi jenis tumbuhan, maka pola tanam yang diterapkan adalah
pola tumpangsari (sisipan di antara tanaman yang ada). Gaharu
ditanam dengan jarak 5 m x 5 m. Dengan demikian jumlah

173

Aspek SOSIAL EKONOMI DAN KONSERVASI

tanaman gaharu yang ditanam di areal kerjasama sebanyak 15.000


pohon ( 400 pohon/ha).
Sebelum penanaman, kegiatan pembangunan demplot uji
coba tanaman penghasil gaharu di KHDTK Carita diawali dengan
pendekatan yang lebih intensif kepada berbagai pihak yang
terkait pengembangan gaharu di areal tersebut seperti Perhutani,
Pemda, dan masyarakat calon peserta untuk mempelajari prospek
partisipasi masyarakat dalam kegiatan dan pemeliharaan tanaman.
Setelah diperoleh gambaran prospek partisipasi masyarakat dalam
pembangunan demplot uji coba ini dilanjutkan dengan penyusunan
rancangan teknis kerjasama penelitian dan penyusunan draft
perjanjian kerjasama. Dengan pendekatan yang lebih intensif ini
diharapkan masyarakat akan lebih memahami tujuan kerjasama
penelitian serta dapat lebih aktif berpartisipasi dalam budidaya
tanaman plot uji coba.
Beberapa prinsip utama yang disepakati antara pihak pertama
(Puslitbang Hutan dan Konservasi Alam) dengan pihak kedua
(kelompok masyarakat peserta uji coba) dalam pola kemitraan di
areal KHDTK carita adalah:
1. Pihak pertama menyediakan biaya bagi pihak kedua untuk
melakukan kegiatan budidaya penanaman pohon gaharu yang
meliputi biaya upah dan bibit tanaman.
2. Pihak pertama memberikan pembinaan teknis budidaya
tanaman gaharu secara rutin kepada pihak kedua.
3. Pihak pertama menyediakan jamur pembentuk gaharu untuk
kegiatan inokulasi sebanyak 25% dari jumlah tanaman gaharu
pada masing-masing penggarap setelah tanaman gaharu
berumur 5 tahun.
4. Pihak pertama akan membantu mencarikan investor untuk
bekerjasama menyediakan produksi jamur pembentuk gaharu
untuk kegiatan inokulasi untuk 75% tanaman gaharu lainnya.
5. Pihak pertama akan memberikan pelatihan budidaya gaharu
serta pemanenan gaharu (paket training gaharu) kepada pihak
kedua.

174

Prospek Pengusahaan Gaharu .....(Sri Suharti)

6. Pihak kedua berkewajiban memelihara dan menjaga keamanan


tanaman gaharu dan tanaman hutan lainnya.
7. Pihak kedua berkewajiban mengikuti aturan teknis dan kaidah
konservasi yang berlaku di dalam areal KHDTK Carita.
8. Pihak kedua berkewajiban melaporkan setiap kejadian seperti
serangan hama/penyakit tanaman, kebakaran atau bencana lain
yang mengakibatkan kerusakan sumberdaya hutan, baik pada
tanaman gaharu atau tanaman lainnya di areal kerjasama.
9. Jika sudah menghasilkan, pihak pertama dan pihak kedua
memperoleh hasil tanaman gaharu yang ditanam dan dipelihara
di lokasi kerjasama dengan proporsi masing-masing 35% untuk
pihak pertama dan 60% untuk pihak kedua. Selain pihak
pertama dan pihak kedua, sebagian hasil tanaman gaharu akan
diberikan pada Desa Sindang Laut sebesar 2,5% dan LMDH
(kelompok) 2,5%.
10. Jika pada saat pemanenan tanaman gaharu ternyata ada
tanaman yang mati/hilang/tidak/belum menghasilkan, maka
resiko akan ditanggung bersama sehingga perhitungan bagi
hasil pada saat panen ditentukan dengan rumus sebagai berikut:
=
P
akhir

tan total tan mati x P


awal
tan total

Keterangan:
Pakhir = Proporsi bagi hasil tanaman gaharu yang diterima masingmasing pihak jika ada tanaman yang mati/hilang/tidak/
belum menghasilkan
Pawal = Proporsi bagi hasil tanaman gaharu sesuai kesepakatan yang
tertuang dalam perjanjian kerjasama ini
Butir-butir kesepakatan tersebut tertuang dalam naskah
perjanjian kerjasama yang disusun berdasarkan hasil kesepakatan/
negosiasi antara pihak pertama dan pihak kedua.

175

Aspek SOSIAL EKONOMI DAN KONSERVASI

KESIMPULAN DAN SARAN


1. Gaharu sangat prospektif untuk dikembangkan, khususnya
bagi Indonesia yang memiliki potensi biologi yaitu tersedianya
beragam spesies tumbuhan penghasil gaharu dan masih luasnya
lahan-lahan kawasan hutan yang potensial serta tersedianya
teknologi inokulasi yang menunjang untuk pembudidayaan
gaharu.
2. Budidaya gaharu layak untuk dilaksanakan karena secara
finansial akan memberikan keuntungan bersih nilai kini (NPV)
sebesar Rp 147,74 juta/ha, IRR sebesar 48,53%, dan B/C = 3,32.
3. Kerjasama kemitraan pengembangan tanaman penghasil gaharu
dengan pola PHBM merupakan salah satu alternatif solusi untuk
menjaga kelestarian hutan, meningkatkan produktivitas lahan
serta meningkatkan pendapatan masyarakat sekitar hutan.
4. Prinsip utama yang dipegang dalam pengembangan kerjasama
kemitraan dengan pola PHBM adalah prinsip kelestarian dan
kelayakan secara ekonomi dalam jangka panjang sesuai jangka
waktu kontrak serta saling menguntungkan berdasarkan nilai
kontribusi yang diberikan masing-masing pihak untuk mencapai
tujuan sosial, ekonomi, dan ekologi.
5. Skema kemitraan dengan pola PHBM memberikan kesempatan
kepada para-pihak yang berminat mengembangkan tanaman
gaharu untuk bekerjasama sesuai dengan input/sumberdaya
yang dimiliki dan memperoleh bagian hasil/sharing sesuai
dengan kontribusi serta kesepakatan parapihak yang terlibat.

DAFTAR PUSTAKA
Adijaya, D. 2009. Gaharu: Harta di Kebun. Trubus online. http://
www.trubus- online.co.id/mod.php?mod=publisher&op
=viewarticle&cid=8 &artid=290. Diakses 16 Februari 2009.
Anonim. 2002. GAHARU: HHBK yang Menjadi Primadona. Info Pusat
Standardisasi dan Lingkungan Departemen Kehutanan. http://
www.dephut.go.id/ Halaman/STANDARDISASI_& _LINGUNGAN_
KEHUTANAN/INFO_V02/VI_V02.htm. Diakses 20 Januari 2009.

176

Prospek Pengusahaan Gaharu .....(Sri Suharti)

Anonim. 2003. Review of Significant Trade Aquilaria malaccensis.


Convention on International Trade in Endangered Species of Wild
Fauna and Flora (CITES). http://www.cites.org/eng /com/PC/14/EPC14-09-02-02-A2.pdf. Diakses 16 Februari 2009.
Anonim. 2005. Pelatihan Nasional: BUDIDAYA DAN PENGOLAHAN
GAHARU. BIOTROP Training and Information Centre. http://
www.bticnet. com/gaharu. htm. Diakses 16 Februari 2009.
Anonim. 2008. Perkembangan Gaharu dan Prospeknya di Indonesia.
http:// forestry-senu57.blogspot.com/2008/01 /perkembangangaharu-dan-prospeknya-di.html. Diakses 16 Februari 2009.
Aswandi. 2009. BUDIDAYA GAHARU : Alternatif Pemberdayaan
Masyarakat Desa Hutan. http://bpk-aeknauli.org/index.php
?option=com_content&task= view&id= 74&Itemid=1. Diakses,
12 Februari, 2009.
Blanchette, R. A. 2006. Sustainable Agarwood Production in
Aquilaria Trees. http://forestpathology.cfans.umn.edu/
agarwood.htm. Access November, 3 2008.
Departemen Kehutanan. 2007. Statistik Kehutanan Indonesia 2006.
Depatemen Kehutanan. Jakarta.
Duryatmo, S. 2009. Tersandung Wangi Gaharu. Trubus online.
http:// www.trubus-online.co.id/mod.php?mod=publisher
&op=viewarticle&cid=1& artid=1618. Diakses 16 Februari 2009.
Gun, B., P. Steven., M. Sungadan., L. Sumari and P. Chatteron. (2004).
Eaglewood in Papua New Guinea. Tropical Rain Fo rest Project.
Working paper No. 51. Vietnam.
Hayat, Z. 2007. Mencari Solusi PHBM di Geumpang. http://www.ffi.
or.id/id/news /1/tahun/2007/bulan/11/tanggal/17/id/ 60/. Diakses
4 Maret 2009.
Indradi, Y. 2009. Perjalanan Panjang Pengelolaan Hutan Berbasis
Masyarakat di Indonesia. http://fwi.or.id. Di akses 4 Maret 2009.
Rizlani, C. dan Aswandi. 2009. Prospek Budidaya Gaharu Secara
Ringkas. http://laksmananursery.blogspot.com/2009/01/
prospek-budidaya-gaharu-secara ringkas.html. Diakses 13
Januari, 2009.

177

Sumarna, Y. 2007. Budidaya dan Rekayasa Produksi Gaharu. Temu


Pakar Pengembangan Gaharu. Direktorat Jenderal RLPS.
Jakarta.
Squidoo. 2008. Production and marketing of cultivated agarwood.
http://www. squidoo.com/agarwood Copyright 2008, Squidoo,
LLC and respective copyright owners. Access November,3 2008.
Wiguna, I. 2006. Tinggi Permintaan Terganjal Pasokan. Trubus
online. http://www.trubus- online.co.id/mod.php?mod
=publisher&op=viewarticle& cid=8 &artid=290. Diakses 16
Februari 2009.

179

Cash inflow (Rp 1000)


a. Output (kg)
b. Nilai output
Gaharu kemedangan I (10%)
Gaharu kemedangan II (40%)
Gaharu kemedangan III (50%)
Cash outflow (Rp 1000)
a. Pra investasi
1. Pra-investasi
2. Persiapan lahan & tanam
3. Sewa lahan
4. Lain-lain
Biaya pra investasi
b. Biaya bahan & peralatan
1. Bibit tanaman gaharu
2. Pupuk Urea
3. Pupuk TSP/SP-36
4. Pupuk KCl
5. Pupuk kandang
6. Peralatan pertanian
7. Bahan inokulan
Biaya bahan & peralatan
c. Biaya tenaga kerja
1. Tenaga kerja keluarga
2. Tenaga kerja upahan
3. Tenaga kerja inokulasi
Biaya tenaga kerja
Total biaya
Cash flow
Cash flow komulatif
a. NPV (DF 15%)
b. IRR (%)
c. B/C

I.

II.

III.

IV.

0
0
0
0
5250
-5250
-5250
147.742
48,53%
3,3176

0
0
0
0
0
250
0
250

500
3000
1250
250
5000

2500
1000
0
3500
16425
-16425
-21675

6750
125
350
300
150
0
0
7675

0
2500
2500
250
5250

2500
1000
0
3500
7075
-7075
-28750

0
125
350
300
300
0
0
1075

0
0
2500
0
2500

Catatan:
Produksi gaharu 480 kg/ha dengan harga rata-rata Rp 1.550.000/kg
Harga gaharu K1= Rp 5 juta/kg, K2= Rp 2 juta/kg dan K3=Rp 500.000/kg.
Harga bibit Rp 15.000/phn, jumlah tanaman 400 phn/ha dibutuhkan 450 phn dg sulaman.
Harga pupuk urea Rp 2500/kg, TSP Rp 7000/kg, KCl Rp 6000/kg, dan pupuk kandang Rp 150/kg
Harga inokulan Rp 50.000/tanaman

Keterangan

No.

2000
500
0
2500
6850
-6850
-35600

0
250
700
600
300
0
0
1850

0
0
2500
0
2500

0
250
700
600
300
250
0
2100

0
0
2500
0
2500

1500
500
0
2000
6600
-6600
-42200

Lampiran 1. Lampiran 1. Analisis NPV, IRR, dan B/C dari Pengusahaan


tanaman gaharu per hektar

1500
500
12000
14000
39125
-39125
-81325

0
375
1050
900
300
0
20000
22625

0
375
1050
900
300
0
0
2625

0
0
2500
0
2500

1500
500
0
2000
7125
-7125
-88450

Tahun ke-

0
0
2500
0
2500

1500
500
0
2000
6650
-6650
-95100

0
250
700
600
300
300
0
2150

0
0
2500
0
2500

20000
25000
0
45000
46250
697750
602650

0
0
0
0
0
0
0
0

0
0
1250
0
1250

480
744000
240000
384000
120000

33000
29500
12000
74500
141350
602650

6750
1750
4900
4200
1950
800
20000
40350

500
5500
20000
500
26500

744000

Total

Aspek SOSIAL EKONOMI DAN KONSERVASI

180

10
THE ENVIRONMENTAL CHARACTERISTICS OF
SOUTH KALIMANTAN SITE FOR EAGLEWOOD
PLANTATION PROJECT
Erry Purnomo
Lambung Mangkurat University, South Kalimantan

INTRODUCTION
Eaglewood (gaharu) may play an important role in gaining
foreign exchange and as a source of income for people living in
out- and in-side the forest in Indonesia. This is because, the gaharu
export market remains open. Therefore there is a big opportunity
for the Indonesian farmers to establish eaglewood plantation.
In South Kalimantan, the gaharu production may be considered
low. Most of the gaharu formation usually relays on natural infection.
Only small group of farmers using introduced inoculants.
There is a lack of information on factors influencing the success
of gaharu formation. The success of gaharu formation may not be
only due to inoculants but may also be influenced by environmental
characteristics (climate, soil properties and plant species).
The present work focused on characterizing the environment,
namely, climate, soil properties and plant diversity surrounding
the newly grown and existing gaharu stands in South Kalimantan
Province.

181

Aspek SOSIAL EKONOMI DAN KONSERVASI

METHODS
A. Site
Distribution of selected sites for the project can be seen in
Figure 1. The selected site were used for growing eagle wood and
inoculation. The sites located in Banjar, Hulu Sungai Selatan (HSS)
and Hulu Sungai Tengah (HST). Location-wise, 14 sites would be
used for newly planted eaglewood trees and 9 sites for inoculation
trial.
115.7
22.8 km

Wawai (HST)

115.6

Layuh (2, HST)

115.5

Aluan (3) (HST)


Bawan (HST)
Gading (HST)
Batung (HST) Layuh (HKK) (HST)

115.4
oE

Rasau (HST)
Kambat (2, HST)
Kalaka (HST)

115.3

Kandangan (HSS)

North

Madang (HSS)

115.2
Belanti (3) (HSS)

115.1

115.0

Rejo (Banjar)

2.4

2.6

2.8

3.0

3.2

3.4

3.6

oS

Figure 1. The selected study sites

B. Climatic Characters
The climate parameters collected were rainfall, air temperature
and relative humidity. The climatic data for all sites were
represented by Kandangan weather station. The data were supplied
by the Weather Bureau in Banjarbaru, South Kalimantan. The data
obtained were for the last 9 years observation.

182

The Environmental Characteristics .....(Erry Purnomo)

C. Soil Properties
Soil properties measured were particle fraction analysis, the
content of total carbon (C), total nitrogen (N), total potassium (K)
and total phosphorus (P), soil pH, electric conductivity (EC), cation
exchange capacity (CEC), and CO2 evolution. Method used for particle
fraction analysis was described in Klute (1986) and the methods for
other soil properties were described in Page et al. (1982).

D. Plant Diversity
The diversity of plant species was determined to show its
association with the success of inoculation. In each site, plant species
grown under gaharu tree were collected plant within area of 6x6 m2.

RESULTS
A. Climatic Characters
The average rainfall, air temperature and relative humidity
for the last 9 years are shown in Figure 2. The average annual
rainfall in the study area was 2361.72 mm. The rainfall distribution
can be observed in Figure 2a. The rainy season commenced in
October and ended in July each year. A significant low rainfall
occurred in the period of July-September. The pattern of air
temperature and relative humidity are shown in Figure 2b and
2c, respectively.

183

Aspek SOSIAL EKONOMI DAN KONSERVASI

30

500

[b]

[a]

29

Air temperature (oC)

Rainfall (mm)

400
300
200

28
27
26

100

25
0

l
t
ary ary rch Apri May June July gus mbertobermbermber
nu ru Ma
Au pte Oc ove ece
Ja Feb
N
D
Se
Month

l
t
ary ary rch Apri May June July gus mbertobermbermber
nu ru Ma
Au pte Oc ove ece
Ja Feb
N
D
Se
Month

30
[b]

Air temperature (oC)

29
28
27
26
25
0

l
t
r
r
r
r
ary ary rch pri May June July gus mbe tobe mbe mbe
nu ru Ma A
Au pte Oc ove ece
Ja Feb
N D
Se
Month

Figure 2. The rainfall [a], air temperature


[b] and relative humidity [c] for
the last 9 years. Bars indicate
the standard error mean 9 years
observation

B. Soil Properties
The soil properties of each site are presented in Figures 3-11.
Soil properties measures were particle fraction analysis, the content
of total carbon (C), Total nitrogen (N), total potassium (K) and total
phosphorus (P), soil pH, electric conductivity (EC), cation exchange
capacity (CEC), and CO2 evolution. The particle fraction analysis
(Figure 3) shows that all soil samples dominated by slit fraction,
followed by clay and sand fractions. If applicable, level of status
of each soil property will be made available as categorized by
Djaenuddin et al. (1994).

184

The Environmental Characteristics .....(Erry Purnomo)

The category range of total C total content was very low to low
(Figure 4). Most of the selected sites contained very low C, only 5
sites had low C. The N content of the soils (Figure 5) was generally
low. It was found that Wawai and Belanti 13 sites had very low and
moderate levels of N content, respectively. The low level of C and N
content confirms the low level of organic matter content of the soil.
The K and P contents of the soils from all sites are demonstrated
in Figures 6. Most of the soil classified as very low to low level of K
concentration. Two sites, namely, Mandala and Madang Low had K
content of moderate level.
100
Sand
Silt
Clay

80

60
40
20
0

n
Bela

5
ti 1

t
)
)
i
s
3
g
h
3
w
- 16 angsa andala awai dingin awa au (10 Kate g Hig adin (2 & 3 lanti 1 ng Lo gkinkin
W as
M
W Man
uh
an aur G bat
da Han
Be
TL
R
Lay Mad
H
Ma
Kam
Site

Figure 3. Particle fraction analysis of each soil

2.5
Moderate

2.0
Low
1.5
Total C content (%)

1.0

Very low

0.5
0.0

Be

ti
lan

t
la ai 3 ngin wai (10) ates igh ding & 3) ti 13 Low nkin
- 16 gsa da
i
H
i
15 T Lan Man Waw and Waasauyuh Kdang ur Gaat (2Belandang angk
M
R La Ma Ha mb
H
Ma
Ka
Site

Figure 4. The total C of soil for each site

185

Aspek SOSIAL EKONOMI DAN KONSERVASI

0.25
Moderate

Total N content (%)

0.20
Low
0.15
0.10

Very low

0.05
0.00

la n
Be

16 ngsatndalawai 3 inginawai (10) ates Highading & 3)nti 13 Low inkin


d W sau h K ng r G t (2 ela ang ngk
5a
ti 1 T La Ma W Man
B ad Ha
Ra LayuMada Hau mba
M
Ka
Site

Figure 5. The total N of soil for each site

One site (Rasau 10) had a very high K level. Most of total P content
of the soils was categorized as very low to low. Only one site (Rasau
10) was categorized as very high (Figure 7).
Almost all the soil pH of the selected soils was categorized into
very acidic to acidic category. Only one site (Belanti 13) had a slightly
acidic value (Figure 8). For EC reading, except for Hangkinkin site,
all soils had EC below 1 mS cm-1 (Figure 9). The low EC readings
may be associated with the far distance from the shore. The low EC
readings indicate the absence of salinity problem.
The CEC of the soils were commonly low (Figure 10). There were
3 sites and 2 sites had CEC of moderate and high, respectively. The
low CEC indicates a low storage cation capacity and results in prone
to cation leaching.
The CO2 evolution as an indication microbial activity was similar
site-wise (Figure 11). Except, at Madang Low, it was observed that
the microbial was lower than the other sites.

C. Number of Plant Species


It was observed that the number of plant species was varied
from site to site (Figure 12). At 5 sites, there were 3-5 plant species.

186

The Environmental Characteristics .....(Erry Purnomo)

The other 8 sites had 5-14 plant species and one site had 22 plant
species.
1200

Total K content (%)

1000
800
600
400
200
0

nt
Bela

Very high

High
Moderate
Low
Very low

)
)
t
s
i
in
- 16 gsa dalawai 3inginawa (10 ate High ding & 3nti 1n3g Logw
kin k
i 15 T Lan Man WaMand WRasaauyuhaKdangaur Gbaat (2Belaa
d a Han
L M
H Kam
M
Site

Figure 6. Total K content of soil for each site

2600

Total P content (%)

2400
2200
2000
600
400
200
0

nt
Bela

Very high
High
Moderate
Low
Very low

t
0) ates High ding & 3) ti 13 Low inkin
- 16 gsa dalawai 3 inginawai (1h
g
k
i 15 T Lan Man WaMand WRasau
u K ang r Ga t (2Belan
danHang
Lay Mad Hauamba
Ma
K
Site

Figure 7. Total P content of soil for each site

187

Aspek SOSIAL EKONOMI DAN KONSERVASI

Soil pH H2O

Neutral

Slightly acidic

Acidic

Very acidic

6 sat dala ai 3 ingin wai (10) ates High ding & 3) ti 13 Low inkin
5 - 1 angM
an Wawand Waasauyuh K ang ur Gaat (2 elandang angk
B Ma
R L a Ma d H a m b
n ti 1 T L
M
H
Bela
Ka
Site

Figure 8. Soil pH for each site

Electric conductivity (mScm-1)

130
120
110
100
2

nt
Bela

t
i
n
0) ates High ding & 3) ti 13 Low inkin
- 16 gsa dalawain3
ingi awa (1h
g
k
i 15 T Lan Man WaM
u K ng r Ga t (2Belan
a d WRasau
danHang
Lay Mada Hauamba
Ma
K
Site

Cation exchnage capacity (cmol[+]kg-1)

Figure 9. Electrical conductivity readings for soil each site

40

30

High

20

Moderate

10

Low
Very low

)
)
t
s
i
g
a
3
3
h
n
n
- 16 ngsa ndal wai ingi awa (10 Kate Hig adin & 3 nti 1 g Lowkinki
ng
i 15 T La Ma WaMand WRasauayuh adangaur Gbat (2Bela adanH
t
a
n
a
L M
H am
M
Bel
K
Site

Gambar 10. Cation exchange capacity of soil for each site


188

The Environmental Characteristics .....(Erry Purnomo)

2000
1600
1200
CO2 evolution (mg C kg-1)
800
400
0

an t
Bel

)
)
t
s
i
g
a
3
- 16 gsa dal wai 3 inginawa (10 ate High din & 3nti 1ng Logwkinkin
i 15 T Lan Man WaMand WRasaauyuhaKdangaur Gbaat (2Belaa
d a Han
L M
H am
M
K
Site

Gambar 11. CO2 evolution from soil from each site

DISCUSSION
The rainfall pattern was typical the study area. The highest
rainfall occurred in the period of November-April ranging 215-358
mm. In May, June and October the rainfall ranged 132-151 mm.
The lowest rainfall was observed in the period of July-September
ranging 54-84 mm. The schedule of inoculation may have to consider
the climatic condition throughout the year.

Number of plant species each site

25

20

15

10

t
)
)
i
s
g
h
3
3
w
in
la
in
- 16 ngsa nda wai ding awaau (10 Kate g HigGadin (2 & 3lanti 1ng Lo gkink
W as yuh
n
i 15 T La Ma W a Man
Be ada Han
R La Mada Haur mbat
ant
l
M
e
B
Ka

Sites

Gambar 12. The number of plant species found in each site

189

Aspek SOSIAL EKONOMI DAN KONSERVASI

The low fertility status according to Djaenuddin et al. (1994)


leads the need to amend to improve the soil fertility status. However,
improving the fertility status may results in healthier eaglewood
trees. The healthy trees may immune to the infection. This may
result in the failure of gaharu formation.
Plants grown under the gaharu was quite divers from site to site.
From field observation, it was found that there was gaharu trees
growth variation under different plan species grown surrounding
the gaharu trees. It seems that there was a shading affect on the
gaharu trees growth.

CONCLUSION
The selected sites were distributed in regencies, namely, Banjar,
Hulu Sungai Selatan and Hulu Sungai Tengah. The annual total
rainfall in the area under study was 2361 mm. The rainy season
began in October and ease in June. In general, the soil in each site
was considered very poor. The number plant species were varied
from site to site.
It is too early to gain any conclusion on the effect of environmental
characters on gaharu production. Therefore, further study is still
needed to investigate the relationship between soil properties or
plant diversity on eaglewood growth or the success of inoculants
application.

ACKNOWLEDGEMENT
I would like to thank ITTO for funding the work. Dr. Maman
Turjaman for the invitation to be involved in the project. Mrs.
M Yani, Presto Janu Saputra and Storus for supporting the field
work. I also acknowledge the anonymous reviewer who critically
commented on the manuscript.

190

REFERENCE
Djaenuddin, D., Basuni, Hardjowigeno, S., Subagjo, H., Sukardi, M.,
Ismangun, Marsudi, Ds., Suharta, N., Hakim, L., Widagdo, Dai,
J., Suwandi, V., Bachri, S., and Jordens, E.R. Land Suitability for
Agricultural and Silviculture Plants. Laporan Teknis No. 7. Versi
1.0. April 1994. Center for Soil and Agroclimate Research, Bogor.
(In Indonesian).
Klute, A. (1986) Methods of soil Analysis. Part 1 Physical and
mineralogy methods. 2nd Edition. ASA, SSSA. Madison. Pp.1188

Page, A.L., Miller, R.H. and Keeney, D.R. (1982) Methods of


soil Analysis. Chemical and microbiological properties.
2nd Edition. ASA, SSSA. Madison. Pp 1159.

191

Aspek SOSIAL EKONOMI DAN KONSERVASI

192

Karakteristik Lahan Habitat .....(Pratiwi)

11
KARAKTERISTIK LAHAN HABITAT
POHON PENGHASIL GAHARU DI
BEBERAPA HUTAN TANAMAN DI
JAWA BARAT
Pratiwi
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu merupakan salah satu hasil hutan non kayu yang
mempunyai nilai penting, karena secara ekonomis jenis ini
dapat meningkatkan devisa negara dan sumber penghasilan bagi
masyarakat yang hidup di dalam maupun sekitar hutan. Gaharu
merupakan salah satu kayu aromatik penting, sehingga hasil
hutan non kayu ini menjadi subjek pemanenan yang cukup tinggi.
Ada beberapa jenis tumbuhan yang dapat menghasilkan gaharu.
Awalnya gaharu berasal dari pohon tropika yang terinfeksi jamur,
seperti Aquilaria spp., Gonystylus spp., Wikstromeae spp., Enkleia
spp., Aetoxylon spp., dan Gyrinops spp. (Chakrabarty et al., 1994,
Sidiyasa et al., 1986). Dalam kegiatan penelitian ini difokuskan pada
jenis-jenis pohon dari genus Aquilaria, yaitu A. malaccensis dan
A. microcarpa. Genus ini termasuk dalam famili Thymelaeaceae.
Karena jenis pohon ini mempunyai nilai ekonomi tinggi, maka
keberadaan jenis ini perlu dipertahankan. Salah satu upaya yang
dapat dilakukan adalah dengan mengembangkan tanaman gaharu
dalam hutan tanaman di beberapa area. Oleh karena itu beberapa

193

Aspek SOSIAL EKONOMI DAN KONSERVASI

informasi sehubungan dengan habitat pohon penghasil gaharu


perlu diinventarisasi, termasuk sifat-sifat tanahnya dan komposisi
vegetasi tumbuhan bawah yang ada di sekitarnya, agar kemampuan
lahannya dapat diketahui.
Tanah sebagai bagian dari suatu ekosistem merupakan salah
satu komponen penyangga kehidupan, di samping air, udara,
dan energi matahari. Pratiwi dan Mulyanto (2000) serta Jenny
(1941) menyebutkan bahwa tanah merupakan hasil proses
pelapukan batuan yang dipengaruhi oleh faktor-faktor iklim,
topografi, organisme, dan waktu. Sifat-sifat tanah yang spesifik
mempengaruhi komposisi vegetasi yang ada di atasnya (Pratiwi,
1991). Selanjutnya Pratiwi dan Mulyanto (2000) menyatakan bahwa
penyebaran tumbuhan, jenis tanah, dan iklim (termasuk iklim
mikro) harus dipertimbangkan sebagai bagian dari ekosistem yang
terintegrasi. Sepanjang komponen tanah bervariasi, maka tanah
dan karakteristiknya akan berbeda-beda dari satu tempat ke tempat
lain. Tanah yang berbeda dengan sistem lingkungan yang bervariasi
akan menentukan vegetasi yang ada di atasnya.
Sehubungan dengan hal tersebut di atas, maka penelitian ini
bertujuan untuk mendapatkan informasi tentang sifat-sifat habitat
pohon penghasil gaharu di hutan tanaman gaharu di daerah Carita,
Dramaga, dan Sukabumi. Penelitian dilakukan dengan membuat
plot-plot penelitian untuk pengamatan sifat-sifat tanah dan
topografi serta vegetasi. Diharapkan informasi ini dapat mendukung
pengembangan hutan tanaman pohon penghasil gaharu, sehingga
keberadaan jenis ini dapat dilestarikan, sebagaimana juga
diharapkan dapat meningkatkan pendapatan dan kesejahteraan
masyarakat.

METODOLOGI
A. Lokasi dan Waktu Penelitian
Penelitian dilakukan pada bulan September 2008 di Carita,
Dramaga, dan Sukabumi. Secara administrasi pemerintahan, Carita
terletak di Kabupaten Pandeglang, Provinsi Banten sedangkan

194

Karakteristik Lahan Habitat .....(Pratiwi)

Dramaga terletak di Kabupaten Bogor, Jawa Barat serta Sukabumi


di Provinsi Jawa Barat.
Carita memiliki topografi bergelombang sampai bergunung
dengan tipe curah hujan A (Schmidt dan Ferguson, 1951) dan curah
hujan tahunan sekitar 3.959 mm. Temperatur minimum sekitar
26C dan temperatur maksimum 32C. Kelembaban udara ratarata berkisar antara 77% sampai 85% (Pusat Litbang Hutan dan
Konservasi Alam, 2005). Sedangkan Dramaga mempunyai topografi
datar sampai bergelombang dengan tipe curah hujan A (Schmidt
dan Ferguson, 1951) dan curah hujan sekitar 3.600 mm per tahun.
Temperatur udara bervariasi antara 24C sampai 30C. Kelembaban
udara rata-rata berkisar antara 80% sampai 90%. Sedangkan
Sukabumi mempunyai topografi bergelombang sampai berbukit
dengan tipe curah hujan A (Schmidt dan Ferguson, 1951) dan curah
hujan sekitar 3.000 mm per tahun. Temperatur udara bervariasi
antara 20C sampai dengan 25C.

B. Bahan dan Alat Penelitian


Sebagai bahan penelitian adalah contoh tanah yang diambil
dalam plot penelitian di Carita, Dramaga, dan Sukabumi. Jumlah
contoh tanah yang diambil di masing-masing lokasi adalah sebanyak
6 buah. Bahan lain adalah berupa data hasil analisis vegetasi untuk
tingkat semai (termasuk tumbuhan bawah). Sedangkan alat yang
dipakai dalam penelitian lapangan adalah alat-alat tulis, alat-alat
survei lapangan seperti bor tanah, Munsell Color Chart, cangkul,
dan meteran.

C. Metode Penelitian
Penelitian dilakukan dengan membuat plot-plot penelitian untuk
pengamatan sifat-sifat tanah, topografi, dan vegetasi. Pengamatan
terhadap sifat-sifat tanah dan topografi dilakukan di dalam plot
yang sama dengan pengamatan vegetasi.

1. Pengambilan Contoh Tanah


Plot dibuat di area yang telah dipilih berdasarkan peta tanah
Jawa dan Madura pada skala 1:500.000 (Lembaga Penelitian

195

Aspek SOSIAL EKONOMI DAN KONSERVASI

Tanah, 1962). Contoh tanah diambil dari setiap horizon yang telah
diidentifikasi untuk dianalisis di laboratorium. Dua macam contoh
tanah yang diambil adalah contoh tanah terganggu untuk analisis
sifat-sifat fisik dan kimia tanah serta contoh tanah tidak terganggu
untuk pengamatan sifat fisik tanah (porositas dan berat jenis tanah).
Sifat-sifat tanah yang dianalisis, meliputi: a) sifat fisik yaitu tekstur,
berat jenis, porositas, permeabilitas, dan sifat kimia yaitu pH H2O,
Corg, Ntotal, ketersediaan P, K, Na, Ca, Mg, KB, KTK, Al, dan H+ (sifat
kimia) (Blackmore et al., 1981).
Contoh tanah komposit diambil pada kedalaman 0-30 cm,
30-60 cm, dan > 60 cm di setiap lokasi penelitian. Pada setiap
kedalaman tanah, contoh tanah diambil pada 20 titik yang tersebar
di masing-masing horizon. Kemudian contoh tanah dicampur
sesuai kedalamannya. Total tanah komposit yang dikumpulkan
dari masing-masing lokasi adalah enam contoh (tiga untuk analisis
sifat fisik tanah dan tiga untuk analisis sifat kimia tanah). Dengan
demikian ada 18 contoh tanah yang dikumpulkan.

2. Pengamatan Vegetasi
Pengamatan vegetasi dilakukan terhadap seluruh vegetasi
yang ada dalam plot, yaitu pada tingkat pohon, belta, dan semai.
Kriteria pohon adalah tumbuhan dengan diameter setinggi dada
(1,3 m)>10 cm. Sedangkan belta merupakan tumbuhan dengan
diameter setinggi dada (1,3 m) antara 2 cm sampai < 10 cm dan
semai merupakan permudaan dari kecambah sampai tinggi < 1,5 m
(Kartawinata et al., 1976). Plot-plot contoh berukuran 20 m x 20 m
dibuat untuk pengamatan pohon dengan interval 20 m pada jalur
sepanjang satu km. Sedangkan untuk pengamatan belta dilakukan
dengan membuat petak berukuran 10 m x 10 m di sepanjang jalur
tersebut dengan interval 10 m. Seluruh jenis pohon dan belta
dihitung dan diukur diameternya. Sedangkan tingkat semai dan
tumbuhan bawah diamati dengan cara membuat petak 1 m x 1 m
di dalam jalur pengamatan pohon dan belta. Seluruh semai dan
tumbuhan bawah yang ada dicatat dan dihitung jumlahnya.
Pengamatan vegetasi dilakukan terhadap semai dan tumbuhan
bawah yang ada di bawah tegakan/pohon penghasil gaharu. Kriteria

196

Karakteristik Lahan Habitat .....(Pratiwi)

semai adalah permudaan jenis tumbuhan berkayu dari kecambah


sampai tinggi < 1,5 m (Kartawinata et al., 1976).
Plot-plot berukuran 1 m x 1 m diletakkan di jalur pengamatan
vegetasi di dalam tegakan/pohon penghasil gaharu. Pada masingmasing lokasi, jalur dibuat sebanyak tiga buah masing-masing
sepanjang 100 m. Seluruh semai dan tumbuhan bawah yang ada
dalam plot dicatat nama daerahnya, dan dihitung jumlahnya serta
diukur luas penutupan tajuknya. Jenis yang diperoleh kemudian
dibuat spesimen herbariumnya untuk diidentifikasi di laboratorium
Botani dan Ekologi Hutan, P3HKA, Bogor.

D. Analisis Data
Sifat-sifat fisik dan kimia tanah dihitung sesuai dengan formula
pada standar prosedur dari setiap karakteristik tanah kemudian
ditabulasi untuk setiap horizon.
Untuk vegetasi, data yang diperoleh ditentukan spesies
dominannya dengan menghitung nilai penting sesuai dengan rumus
yang dikemukakan oleh Kartawinata et al. (1976). Spesies dominan
merupakan spesies yang mempunyai nilai penting tertinggi di
dalam tipe vegetasi yang bersangkutan. Indeks kesamaan jenis
dihitung dengan menggunakan rumus Sorensen (Mueller-Dum-bois
and Ellenberg, 1974), yaitu:

SI =

2w
a+b

Dimana :
SI = Similarity Index
w = Jumlah dari nilai penting terkecil untuk jenis yang sama yang
ditemukan pada dua komunitas yang dibandingkan (A dan B)
a = Jumlah nilai penting dari semua jenis yang ada di komunitas A
b = Jumlah nilai penting dari semua jenis yang ada di komunitas B

197

Aspek SOSIAL EKONOMI DAN KONSERVASI

HASIL DAN PEMBAHASAN


A. Karakteristik Tanah di Daerah Penelitian
Karakteristik tanah sangat dipengaruhi oleh faktor-faktor
pembentukan tanah dan sifat-sifat tanah.

1. Faktor-Faktor yang Mempengaruhi Pembentukan Tanah di


Lokasi Penelitian
Penelitian dilakukan di tiga lokasi, yaitu Carita, Dramaga, dan
Sukabumi.
Topograpfi di daerah Carita bergelombang sampai bergunung
sedangkan di Dramaga datar sampai bergelombang dan di Sukabumi
bergelombang sampai berbukit.
Bahan induk tanah Carita adalah dari Gunung Danau sedangkan
Dramaga dan Sukabumi masing-masing dari Gunung Salak dan
Gede Pangrango. Vulkanik material dari lokasi-lokasi ini memiliki
sifat andesitik. Ini berarti bahan induk daerah ini kaya akan
mineral-mineral ferro-magnesium dan beberapa mineral sebagai
sumber elemen basa. Tipe mineral-mineral ini sangat dipengaruhi
oleh sifat-sifat tanah, khususnya sifat fisik dan kimia.
Lokasi penelitian Carita memiliki topografi bergelombang sampai
bergunung dengan tipe curah hujan A (Schmidt dan Ferguson, 1951)
dan curah hujan tahunan sekitar 3.959 mm. Temperatur minimum
sekitar 26C dan temperatur maksimum 32C. Kelembaban udara
rata-rata berkisar antara 77% sampai 85% (Pusat Litbang Hutan
dan Konservasi Alam, 2005). Sedangkan Dramaga mempunyai
topografi datar sampai bergelombang dengan tipe curah hujan A
(Schmidt dan Ferguson, 1951) dan curah hujan sekitar 3.600 mm
per tahun. Temperatur udara bervariasi antara 24C sampai 30C.
Kelembaban udara rata-rata berkisar antara 80% sampai 90%.
Sedangkan Sukabumi mempunyai topografi bergelombang sampai
berbukit dengan tipe curah hujan A (Schmidt dan Ferguson, 1951)
dan curah hujan sekitar 3.000 mm per tahun. Temperatur udara
bervariasi antara 20C sampai dengan 25C.

198

Karakteristik Lahan Habitat .....(Pratiwi)

Penggunaan lahan di ketiga lokasi penelitian adalah hutan


tanaman pohon penghasil gaharu. Di Carita, jenis yang ditanam
adalah Aquilaria microcarpa, dengan areal sekitar 5 ha dan dibangun
pada tahun 1998 dengan total 346 pohon. Pohon penghasil gaharu
ditanam bersama dengan tanaman lain, umumnya pohon serbaguna
seperti pete (Parkia speciosa), melinjo (Gnetum gnemon), nangka
(Artocarpus integra), durian (Durio zibethinus) dan sebagainya.
Ketinggian daerah ini sekitar 100 meter di atas permukaan laut.
Sedangkan di Dramaga dan Sukabumi, gaharu ditanam secara
monokultur dan ditanam masing-masing tahun 1993 dan 1999.
Spesies yang ditanam adalah Aquilaria crassna dan A. microcarpa
di Darmaga dan A. microcarpa di Sukabumi.

2. Sifat-Sifat Tanah
a. Sifat Fisik Tanah

Sifat fisik tanah, antara lain berkaitan dengan tekstur, berat jenis,
porositas, dan permeabilitas. Hasil penelitian sifat-sifat fisik tanah
disajikan pada Tabel 1, Tabel 2, dan Tabel 3. Pada tabel tersebut
terlihat bahwa ketiga lokasi penelitian memiliki sifat-sifat fisik tanah
yang relatif sama. Data analisis tekstur tanah menunjukkan bahwa
tanah di semua lokasi penelitian memiliki kelas tekstur liat. Hal ini
mengindikasikan bahwa partikel tanah yang dominan adalah fraksi
liat. Implikasi dari kelas tekstur ini adalah retensi air dan hara pada
tanah ini relatif bagus. Dari data tekstur tanah dapat dilihat juga
bahwa tanah di dalam profil menunjukkan adanya akumulasi liat.
Ini berarti seluruh tanah di lokasi penelitian memiliki sub horizon
argilik.
Berat jenis (BD) tanah di semua lokasi penelitian kurang dari 1
tetapi lebih dari 0,8. Hal ini menunjukkan bahwa tanah di lokasi
penelitian berkembang dari material vulkanik tuff.
Tanah yang memiliki horizon argilik dapat diklasifikasikan
sebagai alfisol atau ultisol tergantung kejenuhan basanya (KB).
Tanah di Carita dan Dramaga memiliki KB kurang dari 50% (Tabel
4, Tabel 5, dan Tabel 6). Oleh karena itu tanah ini diklasifikasikan
sebagai ultisol. Sedangkan tanah di lokasi penelitian Sukabumi
memiliki KB lebih dari 50% sehingga diklasifikan sebagai alfisol.

199

Aspek SOSIAL EKONOMI DAN KONSERVASI

Data porositas tanah menunjukkan bahwa di semua lokasi


penelitian, porositas tanah di horizon permukaan lebih rendah
daripada di bagian bawahnya. Informasi ini menunjukkan bahwa
terjadi fenomena pemadatan tanah (soil compaction) karena adanya
injakan (trampling) dan mungkin adanya jatuhan butir-butir hujan
dari batang pohon (stem fall).
Sedangkan berat jenis tanah di tiga kedalaman kurang dari
satu. Hal ini menunjukkan bahwa tanah ini mempunyai sifat andik,
sehingga tanah di lokasi penelitian termasuk dalam ordo andisol
dalam sistem taksonomi tanah (Soil Survey Staff, 1994).
Tabel 1. Sifat-sifat fisik tanah di lokasi penelitian Dramaga
Sifat fisik
Kedalaman
(cm)

Tekstur

Berat
Jenis

Porositas
(%)

0,90

65,86

30

0,87

66,99

60

0,96

63,85

Berat
Jenis

Porositas
(%)

0,93

64,99

30

0,84

68,45

60

0,90

66,21

Pasir (%)

Debu
(%)

Liat (%)

Kelas
tekstur

0-30

8,33

25,10

66,57

Liat

30-60

8,55

22,10

69,35

Liat

> 60

6,01

36,51

57,48

Liat

Tabel 2. Sifat-sifat fisik tanah di lokasi penelitian Carita


Sifat fisik
Kedalaman
(cm)

200

Tekstur
Pasir
(%)

Debu
(%)

Liat (%)

Kelas
tekstur

0-30

8,33

12,59

79,08

Liat

30-60

6,33

11,98

81,69

Liat

> 60

5,13

9,09

85,78

Liat

Karakteristik Lahan Habitat .....(Pratiwi)

Tabel 3. Sifat-sifat fisik tanah di lokasi penelitian Sukabumi


Sifat fisik
Kedalaman
(cm)

Tekstur
Pasir
(%)

Debu
(%)

Liat (%)

Kelas
tekstur

0-30

12,78

18,73

68,49

Liat

30-60

9,95

5,90

84,15

Liat

> 60

11,54

26,37

62,09

Liat

Berat
Jenis

Porositas
(%)

0,97

63,43

30

0,86

67,59

60

0,83

68,75

Sedangkan porositas di lokasi penelitian menunjukkan


bahwa semakin ke bawah porositasnya semakin kecil. Hal ini
menunjukkan semakin ke dalam jumlah pori-pori semakin kecil
yang diakibatkan antara lain oleh adanya pemadatan tanah. Pratiwi
dan Garsetiasih (2003) menyatakan bahwa pemadatan tanah dapat
diakibatkan oleh karena injakan manusia. Hal ini terjadi juga
di ketiga lokasi penelitian, di mana lokasi-lokasi ini merupakan
hutan tanaman. Adanya pori-pori yang menurun jumlahnya, maka
akan mengakibatkan kapasitas tanah menampung air dan udara
menurun.
Nilai permeabilitas tanah menunjukkan laju pergerakan air.
Peningkatan berat jenis tanah, umumnya diikuti dengan penurunan
persentase ruang pori atau porositas dan juga penurunan nilai
permeabilitas tanah. Hal ini terlihat pada lokasi penelitian. Namun
demikian Bullock et al. (1985) menyatakan bahwa nilai ini tergantung
bukan saja oleh jumlah pori tetapi juga tingkat kontinuitas pori.
b. Sifat Kimia Tanah

Sifat-sifat kimia tanah, meliputi pH H2O, C, N, P tersedia, Ca, Mg,


K, Na, kapasitas tukar kation (KTK), kejenuhan basa (KB), Al, Fe, Cu,
Zn, dan Mn. Keterangan yang lebih lengkap dapat dilihat pada Tabel
4, Tabel 5, dan Tabel 6.
pH H 2O di semua lokasi penelitian umumnya kurang dari
lima, kecuali Sukabumi. Namun demikian tanah-tanah di lokasi

201

Aspek SOSIAL EKONOMI DAN KONSERVASI

penelitian masih dikategorikan asam. Walaupun tanah-tanah di


lokasi penelitian berkembang dari bahan vulkanik andesitik yang
kaya akan material-material basa, namun karena adanya proses
pelapukan yang intensif dan juga adanya pencucian (leaching),
maka reaksinya asam dan kejenuhan basanya kurang dari 100%.
Reaksi ini mempengaruhi ketersediaan unsur hara esensial.
Unsur hara esensial merupakan unsur yang diperlukan oleh
tanaman dan fungsinya tidak dapat digantikan oleh unsur lain
(Pratiwi, 2004 dan 2005). Unsur-unsur ini dikategorikan sebagai
unsur hara makro (C, H, O, N, P, K, Ca, Mg, dan S) dan unsur hara
mikro (Fe, Mn, B, Mo, Cu, Zn, Cl, dan Co). Di samping pH, ketersediaan
dari unsur-unsur esensial ditentukan oleh bahan organik dan
proses-proses dinamis yang ada di dalam profil tanah.
Carbon organik dan nitrogen total di lokasi penelitian menurun
semakin ke bawah. Jumlah carbon organik relatif rendah di semua
horizon, tetapi di Carita, carbon organik lebih tinggi daripada
Sukabumi dan Dramaga. Rendahnya carbon organik dan nitrogen
total berhubungan dengan rendahnya bahan organik. Hal ini dapat
dimengerti karena di lokasi penelitian Carita, dijumpai banyak
tumbuhan bawah jika dibandingkan dengan lokasi penelitian
Sukabumi dan Dramaga. Tumbuhan bawah merupakan sumber
bahan organik.
Menurut Sutanto (1988), bahan organik juga menyebabkan
meningkatnya KTK dengan meningkatnya muatan negatif.
Perbandingan C/N di semua horizon tergolong tinggi, khususnya
di horizon bagian atas. Hal ini menunjukkan bahwa dekomposisi
bahan organik tidak terlalu kuat.
Kandungan P di semua lokasi penelitian tergolong sangat
rendah (< 2). Pratiwi (2004 dan 2005) menyatakan bahwa unsur ini
khususnya di lapisan atas mempunyai fungsi yang sangat penting
dalam perkecambahan biji. Elemen penting lainnya adalah K, Al+3,
dan H+. Di areal penelitian Dramaga, K tergolong medium sedangkan
di Carita dan Sukabumi masing-masing tergolong rendah dan tinggi
dan Al+3 dan H+ rendah sampai sangat rendah di semua lokasi. Tanah
dengan kandungan Al yang tinggi memiliki sifat toksik. Oleh karena
itu di ketiga lokasi penelitian tidak ada bahaya keracunan Al.

202

Karakteristik Lahan Habitat .....(Pratiwi)

Unsur hara mikro juga mempengaruhi pertumbuhan tanaman,


tetapi diperlukan dalam jumlah sangat sedikit. Unsur-unsur tersebut
adalah Fe, Cu, Zn, dan Mn. Unsur-unsur Fe, Cu, dan Zn relatif rendah
sementara kandungan Mn sedang sampai relatif cukup. Kondisi ini
relatif sesuai untuk pertumbuhan tanaman.
Kapasitas tukar kation (KTK) menunjukkan tingkat kesuburan
tanah. Tanah dengan KTK tinggi dapat menyerap unsur hara,
sehingga ketersediaan hara akan lebih bagus pada areal dengan KTK
rendah. KTK tanah dianalisis dengan larutan buffer NH4Oact pH 7
dan KTK sum of cation. Tabel 4, Tabel 5, dan Tabel 6 menunjukkan
secara jelas bahwa KTK NH4Oact pH 7 dari seluruh profil sangat
tinggi daripada KTK sum of cation. KTK tinggi berarti areal tersebut
cukup subur.
Dari Tabel 4, Tabel 5, dan Tabel 6 mengindikasikan bahwa tanah
di Sukabumi memiliki KB tinggi (39,35-41,07) sedangkan di Dramaga
medium (16,01-17,75) dan yang terendah adalah di Carita (13,0515,77). Tanah dengan pH lebih tinggi umumnya memiliki KTK yang
lebih tinggi. Kecenderungan ini terjadi di areal penelitian, di mana
pH daerah Sukabumi lebih tinggi daripada Carita dan Dramaga.
Kandungan kation basa di Sukabumi termasuk tinggi sedangkan
di Dramaga medium dan Carita termasuk rendah. Di semua horizon
dari tiga lokasi penelitian ini, kation basa didominasi oleh calcium
dan magnesium.
Jumlah kation tertinggi di areal penelitian terdapat di Sukabumi
dan yang terendah di Carita. Hal ini disebabkan karena Sukabumi
memiliki pH H 2O tertinggi. Ada kecenderungan bahwa daerah
dengan pH yang tinggi memiliki kejenuhan basa yang tinggi pula.
Tabel 4. Sifat-sifat kimia tanah di lokasi penelitian Dramaga
Sifat-sifat kimia

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

pH H2O 1:1

4,70 (Rendah)

4,60 (Rendah)

4,50 (Rendah)

C org (%)

1,43 (Rendah)

1,03 (Rendah)

1,03 (Rendah)

N-total (%)

0,15 (Rendah)

0,12 (Rendah)

0,11(Rendah)

203

Aspek SOSIAL EKONOMI DAN KONSERVASI

Sifat-sifat kimia

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

P Bray (ppm)

1,7 (Sangat rendah)

1,3 (Sangat rendah)

1,7 (Sangat rendah)

Ca

5,29 (Medium)

4,17 (Rendah)

5,32 ( Medium)

Mg

1,19 ( Medium)

1,09 (Medium)

1,70(Medium)

0,44 (Medium)

0,44 (Medium)

0,58 (Tinggi)

Na

0,30 (Rendah)

0,26 (Rendah)

0,26 (Rendah)

KTK

17,75 (Medium)

16,61 (Medium)

16,99 (Medium)

KB (%)

40,68 (Medium)

35,88 (Medium)

46,26 (Medium)

Al

3,72 (Sangat
rendah)

4,16 (Sangat
rendah)

4,90 (Sangat
rendah)

0,33

0,36

0,41

Fe

2,04

1,80

1,48

Cu

3,44

2,64

2,40

Zn

5,24

4,88

5,28

Mn

85,60

88,01

79,20

NH4OAc pH 7
(me/100 gr):

KCl (me/100 gr):

0,05 N HCl (ppm):

Tabel 5. Sifat-sifat kimia tanah di lokasi penelitian Carita


Sifat-sifat kimia

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

pH H2O 1:1

4,60 (Rendah)

4,50 (Rendah)

4,60 (Rendah)

C org (%)

2,31 (Medium)

1,51 (Rendah)

0,71 (Sangat
rendah)

N-total (%)

0,17 (Rendah)

0,14 (Rendah)

0,08 (Sangat
rendah)

P Bray (ppm)

1,70 (Sangat
rendah)

1,20 (Sangat
rendah)

1,20 (Sangat
rendah)

Ca

1,49 (Sangat
rendah)

1,01 (Sangat
rendah)

1,00 (Sangat
rendah)

Mg

0,75 (Rendah)

0,53 (Rendah)

0,52 (Rendah)

0,16 (Rendah)

0,14 (Rendah)

0,13 (Rendah)

NH4OAc pH 7
(me/100 gr):

204

Karakteristik Lahan Habitat .....(Pratiwi)

Sifat-sifat kimia

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

Na

0,20 (Rendah)

0,22 (Rendah)

0,21 (Rendah)

KTK

15,77 (Rendah)

13,11 (Rendah)

13,03 (Rendah)

KB (%)

16,49 (Sangat
rendah)

14,49 (Sangat
rendah)

14,27 (Sangat
rendah)

Al

5,84 (Rendah)

7,36 (Rendah)

6,40 (Rendah)

0,49

0,53

0,45

Fe

1,72

1,00

1,04

Cu

1,64

1,68

1,52

Zn

3,00

2,60

2,80

Mn

28,48

17,08

16,40

KCl
(me/100 gr):

0,05 N HCl (ppm):

Tabel 6. Sifat-sifat kimia tanah di lokasi penelitian Sukabumi


Sifat-sifat kimia

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

pH H2O 1:1

5,10 (Rendah)

5,10 (Rendah)

4,60 (Rendah)

C org (%)

1,60 (Rendah)

2,07 (Medium)

1,01 (Rendah)

N-total (%)

0,15 (Rendah)

0,18 (Rendah)

0,11 (Rendah)

P Bray (ppm)

3,90 (Sangat
rendah)

3,70 (Sangat
rendah)

3,40 (Sangat
rendah)

Ca

16,98 (Tinggi)

16,99 (Tinggi)

14,64 (Tinggi)

Mg

10,52 (Sangat
tinggi)

10,94 (Sangat
tinggi)

10,05 (Sangat
tinggi)

0,71 (Tinggi)

0,40 (Medium)

0,22 (Rendah)

NH4OAc pH 7
(me/100 gr):

Na

0,36 (Medium)

0,43 (Medium)

0,22 (Rendah)

KTK

41,07 (Sangat
tinggi)

36,48 (Tinggi)

39,35 (Tinggi)

KB (%)

69,56 (Tinggi)

78,84 (Sangat
tinggi)

63,86 (Tinggi)

KCl
(me/100 gr):

205

Aspek SOSIAL EKONOMI DAN KONSERVASI

Horizon 1
(0-30 cm)

Horizon 2
(30-60 cm)

Horizon 3
(>60 cm)

Al

2,32 (Sangat
rendah)

2,76 (Sangat
rendah)

6,40 (Rendah)

0,25

0,30

0,42

Sifat-sifat kimia

0,05 N HCl (ppm):


Fe

0,52

0,36

0,32

Cu

1,20

1,12

1,44

Zn

1,40

1,56

1,56

Mn

17,00

22,12

26,36

B. Komposisi Vegetasi dan Spesies Dominan


1. Umum
Analisis vegetasi dilakukan terhadap vegetasi/tumbuhan bawah
di Carita, Dramaga, dan Sukabumi. Areal ini merupakan hutan
tanaman pohon penghasil gaharu. Dengan demikian untuk tingkat
pohon, sapling serta tiang didominasi oleh gaharu. Oleh karena itu
analisis vegetasi ditekankan pada tumbuhan bawah.

2. Komposisi Tumbuhan Bawah


Hasil pengamatan menunjukkan
bahwa komposisi jenis tumbuhan bawah
di Carita lebih tinggi dibandingkan di
Sukabumi dan Dramaga (Tabel 7).

Tabel 7. Jumlah jenis


tumbuhan bawah
dan familinya di
lokasi penelitian
Lokasi
penelitian

Jumlah
jenis

Jumlah
famili

Ko n d i s i i n i a g a k nya k a r e n a
Carita
30
18
perbedaan sistem penanaman dalam
Dramaga
8
16
hutan tanaman tersebut. Di Carita pohon
Sukabumi
6
3
penghasil gaharu ditanam dengan
sistem campuran dengan jenis tanaman
serba guna sedangkan di Sukabumi dan Dramaga ditanam dengan
sistem monokultur. Sistem penanaman di Carita yang multikultur,
mendukung beberapa anakan muncul dari jenis-jenis lain selain
jenis tanaman penghasil gaharu.

206

Karakteristik Lahan Habitat .....(Pratiwi)

3. Jenis Tumbuhan Bawah Dominan


Secara ekologis, nilai vegetasi ditentukan oleh peran dari jenis
dominan. Jenis dominan merupakan jenis yang mempunyai nilai
penting tertinggi di dalam komunitas yang bersangkutan. Nilai ini
merupakan hasil dari interaksi di antara jenis dengan kondisikondisi
lingkungan.
Hasil pengamatan menunjukkan bahwa jenis dominan dan
kodominan masing-masing areal penelitian berbeda. Di Carita
jenis dominan dan kodominan dari tumbuhan bawah yang ditemui
adalah jampang (Panicum disachyum) dan selaginela (Selaginella
plana) sedangkan di Dramaga adalah pakis (Dictyopteris iregularis)
dan seuseureuhan (Piper aduncum) serta di Sukabumi adalah
jampang (Panicum disachyum) dan rumput pait (Panicum barbatum)
(Lampiran 1, Lampiran 2, dan Lampiran 3). Data ini mengindikasikan
bahwa habitat dari masing-masing lokasi penelitian secara ekologis
memiliki karakteristik yang berbeda-beda.

4. Indeks Kesamaan Jenis Tumbuhan Bawah


Berdasarkan indeks kesamaan jenis menurut Sorensen (MuellerDumbois and Ellenberg, 1974) komposisi jenis tumbuhan bawah di tiap
lokasi penelitian berbeda satu Tabel 8. Indeks similaritas (%) dari
dengan lainnya. Hal ini diindikomuni-tas tumbuhan di lokasi
penelitian
kasikan dengan nilai indeks
similaritas yang rendah (<50%)
Lokasi
Carita Dramaga
Sukabumi
(Tabel 8).

Perbedaan komposisi
jenis ini dikarenakan adanya
perbedaan faktor lingkungan
seperti iklim, topografi, dan
karakteristik tanah.

Carita

35

Darmaga

Sukabumi

KESIMPULAN
1. Tanah di tiga lokasi penelitian memiliki bahan induk yang relatif
sama, yaitu material volkanik yang bersifat andesitik.

207

Aspek SOSIAL EKONOMI DAN KONSERVASI

2. Perbedaan sifat-sifat fisik dan kimia tanah di lokasi penelitian


disebabkan perbedaan tingkat proses pelapukan yang
berhubungan dengan kondisi lingkungan dari proses pelapukan
tersebut.
3. Sehubungan dengan tingkat pelapukan, tanah Carita kurang
subur dibandingkan dengan Dramaga dan Sukabumi. Tingkat
kesuburan ini berhubungan dengan tingkat dari proses
pelapukan.
4. Sifat-sifat fisik dan kimia tanah di areal penelitian mendukung
pertumbuhan pohon penghasil gaharu.
5. Jenis dominan dan kodominan di masing-masing areal
penelitian berbeda. Di Carita tumbuhan bawah yang dominan
adalah jampang (Panicum disachyum) dan jenis kodominan
adalah selaginela (Selaginella plana). Sedangkan di Dramaga
jenis dominan dan kodominan masing-masing adalah pakis
(Dictyopteris irregularis) dan seuseureuhan (Piper aduncum),
serta di Sukabumi masing-masing jampang (Panicum disachyum)
dan rumput pait (Panicum barbatum).
6. Komposisi jenis tumbuhan bawah juga berbeda di tiap lokasi
penelitian sebagaimana diindikasikan dengan nilai SI < 50%.
Perbedaan komposisi jenis ini dikarenakan adanya perbedaan
faktor-faktor lingkungan seperti iklim, topografi, dan sifat-sifat
tanah.

DAFTAR PUSTAKA
Allison, L.E. 1965. Organic Matter by Walkey and Black methods. In
C.A. Black (ed.). Soil Analyses. Part II.
Chakrabarty, K., A. Kumar and V. Menon. 1994. Trade in Agarwood.
WWF-Traffic India.
Jenny, H. 1941. Factors of Soil Formation. McGrawhill. New York.
280 p.
Lembaga Penelitian Tanah. 1962. Peta Tanah Tinjau Jawa dan
Madura. LPT. Bogor.

208

Karakteristik Lahan Habitat .....(Pratiwi)

Mueller-Dumbois, D. and H. Ellenberg. 1974. Aims and Methods of


Vegetation Ecology. John Willey and Son. New York.
Pratiwi. 1991. Soil Characteristics and Vegetation Composition Along
a Topotransect in The Gunung Gede Pangrango National Park,
West Java, Indonesia. MSc. Thesis. International Training Center
For Post Graduate Soil Scientists, Universiteit Gent, Belgium.
Pratiwi and B. Mulyanto. 2000. The Relationship Between Soil
Characteristics with Vegetation Diversity in Tanjung Redep,
East Kalimantan. Forestry and Estate Crops Research Journal
1(1): 27-33.
Pratiwi. 2004. Hubungan Antara Sifat-Sifat Tanah dan Komposisi
Vegetasi di Daerah Tabalar, Kabupaten Berau, Kalimantan
Timur. Buletin Penelitian Hutan 644: 63-76.
Pratiwi. 2005. Ciri dan Sifat Lahan Habitat Mahoni (Swietenia
macrophylla King.) di Beberapa Hutan Tanaman di Pulau Jawa.
Gakuryoku XI(2):127-131.
Pusat Litbang Hutan dan Konservasi Alam. 2005. Hutan Penelitian
Carita. Pusat Litbang Hutan dan Konservasi Alam. Bogor. 21 p.
Schmidt, F.H. and J.H.A. Ferguson. 1951. Rainfall Based on Wet and
Dry Period Ratios for Indonesia with Western New Guinea.
Verhand. 42. Kementrian Perhubungan. Djawatan Meteorologi
dan Geofisika. Jakarta.
Sidiyasa, K., S. Sutomo, dan R. S. A. Prawira. 1986. Eksplorasi dan
Studi Permudaan Jenis-Jenis Penghasil Gaharu di Wilayah
Hutan Kintap, Kalimantan Selatan. Buletin Penelitian Hutan
474: 59-66.
Sutanto, R. 1988. Minerlogy, Charge Properties and Classification
of Soils on Volcanic Materials and Limestone in Central Java.
Indonesia. PhD Thesis. ITC-RUG. Gent. 233 p.
Soil Survey Staff. 1994. Key to Soil Taxonomy. United Stated
Department of Agriculture. Soil Conservation Service. Six
Edition. 306 p.
Soil Conservation Service. 1984. Procedure for Collecting Samples
and Methods of Analyses for Soil Survey. Report No. I. Revised
ed.,U.S. Dept.Agric. 68 p.

209

Aspek SOSIAL EKONOMI DAN KONSERVASI

Lampiran 1. Nilai penting jenis tumbuhan bawah di Carita


No.

Nama daerah

Nama botani

Famili

Kr (%) Fr (%) Dr (%) NP (%)

Jampang

Panicum disachyum Linn. Gramnea

47,00

8,58

25,70

81,28

Selaginella

Selaginella plana Hiern.

Selaginellaceae

14,52

10,00

32,76

57,28

Harendong
merah

Melastoma
malabathricum L.

Melastomataceae

5,17

9,99

7,09

22,25

Cingcau

Cyclea barbata Miers.

Meraispermaceae

7,88

10,00

3,82

21,70

Rumput pait

Panicum barbatum Lamk. Graminae

7,39

5,71

3,71

16,81

Ilat

Cyperus difformis Linn.

3,69

5,71

0,99

10,39

Parasi

Curculigo latifolia Dryand. Amaryllidiaceae

2,45

4,29

3,09

9,83

Terongan

Solanum jamaicence Mill.

Solanaceae

0,98

5,71

2,97

9,66

Hatta

Coniograma intermedia
Hieron.

Polypodiaceae

0,75

1,43

6,18

8,36

10

Peletok

Cecropia peltata L.

Moraceae

1,23

2,85

2,10

6,18

11

Paku anam

Lygodium circinatum Sw.

Schizophyllaceae

0,98

4,29

0,73

6,00

12

Pakis

Dictyopteris irregularis
Presl.

Polypodiaceae

0,50

1,43

3,09

5,02

13

Sasahan

Tetracera indica L.

Dilleniaceae

0,75

2,86

1,11

4,72

14

Harendong

Clidenia hirta Don.

Melastomaceae

0,49

1,43

0,62

4,57

15

Kokopian

Ixora sp.

Rubiaceae

1,23

2,85

0,48

4,57

16

Mahoni

Swietenia macrophylla
King

Meliaceae

0,50

2,85

0,62

4,47

17

Cacabean

Morinda bracteosa Hort.

Rubiaceae

0,25

1,43

1,23

2,91

18

Alang-alang

Imperata cylindrica Linn.

Graminae

0,75

1,43

0,25

2,43

19

Hawuan

Elaeocarpus glaber Blume Elaeocarpaceae

0,25

1,43

0,62

2,30

20

Kakacangan

Stachystarpheta
jamaisensis Vahl.

Verbenaceae

0,25

1,43

0,62

2,30

21

Pacing

Tapeinochilus
teysmannianus K.Sch.

Zingiberaceae

0,49

1,43

0,25

2,17

22

Seuseureuhan Piper aduncum L.

Piperaceae

0,25

1,43

0,37

2,05

23

Gagajahan

Panicum montanum Roxb. Graminae

0,50

1,43

0,12

2,05

24

Ki koneng

Plectronia sp.

0,25

1,43

0,37

2,05

25

Babadotan

Ageratum conizoides Linn. Compositae

0,25

1,43

0,25

1,93

26

Pakis anjing

Dryopteris dentata C.Chr.

Polypodiaceae

0,25

1,43

0,25

1,93

27

Gaharu

Aquilaria malaccensis
Lamk.

Thymelaeaceae

0,25

1,43

0,25

1,93

28

Pete

Parkia speciosa Hassk.

Leguminosae

0,25

1,43

0,12

1,80

29

Kanyere

Bridelia monoica L.

Euphorbiaceae

0,25

1,43

0,12

1,80

30

Cingcanan

Morinda bracteosa Hort.

Rubiaceae

0,25

1,43

0,12

1,80

Total

Keterangan:
Kr
Fr
Dr
NP

210

: Kerapatan relatif
: Frekuensi relatif
: Dominansi relatif
: Nilai penting

Cyperaceae

Rubiaceae

100,00 100,00 100,00 300,00

Karakteristik Lahan Habitat .....(Pratiwi)

Lampiran 2. Nilai penting jenis tumbuhan bawah di Dramaga


No.

Nama
daerah

Nama botani

Famili

Kr (%)

Fr (%)

Dr (%)

NP (%)

29,41

16,72

28,08

74,21

11,76

11,03

34,25

57,04

Pakis

Dictyopteris irregularis
Presl.

Polypodaceae

Seuseureuhan

Piper aduncum Linn.

Piperaceae

Tales

Alocasia sp.

Araceae

5,89

16,72

20,55

43,16

Rumput pait Panicum barbatum Lamk.

Graminae

17,64

16,72

3,42

37,78

Rumput
padi

Oryza grandulata Nees.

Gramnea

11,76

16,72

1,71

30,19

Areu

Micania scandens Willd.

Compositae

5,89

11,03

5,14

22,06

Babadotan

Ageratum conizoides Linn. Compositae

11,76

5,52

1,71

19,00

Pacine

Tapeinochilus
teysmannianus K.Sch.

5,89

5,53

5,14

16,56

100,00

100,00

100,00

300,00

Total

Zingiberaceae

Keterangan:
Kr : Kerapatan relatif
Fr : Frekuensi relatif
Dr : Dominansi relatif
NP : Nilai penting

211

Lampiran 3. Nilai penting jenis tumbuhan bawah di Sukabumi


No.

Nama
daerah

Nama botani

Famili

Kr (%)

Fr (%)

Dr (%)

NP (%)

Jampang

Panicum distachyum Linn.

Gramnea

56.56

33.34

50,00

139,9

Rumput pait Panicum barbatum Lamk.

Graminae

24,24

16,67

17,87

58,94

Harendong

Clidenia hirta Don.

Melastomaceae

4,76

16,67

10,71

32,14

Babadotan

Ageratum conizoides Linn.

Compositae

7,74

8,33

14,28

30,35

Kirinyuh

Euphatorium pallascens DC. Compositae

2,38

16,67

3,57

22,62

Alang-alang Imperata cilndrica Linn.

4,16

8,33

100,00

100,00

Total

Keterangan:
Kr : Kerapatan relatif
Fr : Frekuensi relatif
Dr : Dominansi relatif
NP : Nilai penting

212

Graminae

3,57
100,00

16,06
300,00

12
POTENSI DAN KONDISI REGENERASI ALAM
GAHARU (Aquilaria malaccensis Lamk.)
DI PROVINSI LAMPUNG DAN BENGKULU,
SUMATERA
Titiek Setyawati
Pusat Penelitian dan Pengembangan Hutan dan Konservasi Alam

PENDAHULUAN
Gaharu, dengan nama perdagangan agarwood/aloe-wood/
eaglewood, selama ini banyak dikenal sebagai bahan untuk
membuat wangi-wangian, bahan obat serta juga kulitnya dapat
dibuat untuk bahan tali atau kain (Puri, 2001; Heyne, 1987; Zuhud
1994). Gaharu banyak diproduksi di Indonesia, negara penghasil
gaharu terbesar di dunia. Indonesia juga merupakan habitat
endemik beberapa jenis gaharu komersial dari marga Aquilaria,
seperti A. malaccensis Lamk., A. microcarpa, A. hirta, A. beccariana,
A. filaria, dan lain-lain. Gaharu merupakan komoditi hasil hutan
bukan kayu yang banyak diminati oleh pasar luar negeri (Soehartono
dan Newton, 2000). Bagi Suku Dayak Punan di Kalimantan Timur,
gaharu merupakan komoditi hasil hutan non-kayu penting, karena
merupakan sumber pendapatan terbesar yang memiliki nilai pasar
tinggi (Kaskija, 2002). Indonesia merupakan salah satu eksportir
terbesar produk gaharu dan sudah menyumbangkan sekitar 6,2
milyar rupiah ke kas negara pada tahun 1995.
Jenis pohon penghasil gaharu menghasilkan resin yang memiliki
aroma wangi dan jenis-jenis yang menghasilkan gaharu dengan

213

Aspek SOSIAL EKONOMI DAN KONSERVASI

kualitas tinggi banyak diperdagangkan ke luar negeri. Gaharu


dihasilkan dari proses pembusukan atau infeksi, baik batang
maupun akar pohon secara kimiawi oleh beberapa jenis jamur.
Resin yang dihasilkan memiliki aroma wangi yang merupakan ciri
khas dalam menentukan kualitas gaharu. Pada umumnya gaharu
diperdagangkan dalam tiga kelompok sortimen, yaitu gubal gaharu,
kemedangan, dan abu gaharu. Dalam proses selanjutnya, masingmasing sortimen akan dibedakan lagi berdasarkan kelas mutunya.
Berdasarkan hasil pengamatan di lapangan, gaharu ternyata
dihasilkan tidak dari satu jenis pohon saja melainkan dari berbagai
macam jenis. Menurut Sidiyasa (1986) dalam Mai dan Suripatty
(1996), kedelapan jenis tersebut masuk dalam marga Aetoxylon (1
jenis), Aquilaria (2 jenis), Enkleia (1 jenis), Gonystylus (2 jenis), dan
Wikstroemia (2 jenis). Dari beberapa pustaka yang ada, jenis pohon
penghasil gaharu dari marga Aquilaria dan Wiekstroemia memiliki
lebih dari 2 jenis (Sellato, 2001) yang tumbuh tersebar di Indonesia.
Hampir sebagian besar jenis dapat ditemukan di Kalimantan,
Sumatera, Nusa Tenggara Timur, Nusa Tenggara Barat, serta Irian
Jaya. Potensi yang diperkirakan ada saat ini yaitu 1,87 pohon/ha
(Sumatera), 3,37 pohon/ha (Kalimantan), dan 4,33 pohon/ha (Irian
Jaya) (Anonim, 2007). Satu pohon biasanya dapat menghasilkan 0,5
sampai 4 kg gaharu dengan harga di tingkat pencari Rp 700.000,untuk kualitas super. Jenis yang saat ini banyak dipanen di Irian
Jaya sudah sangat terancam keberadaannya, karena eksploitasi
yang berlebihan (Zich dan Compton, 2001).
Meskipun jumlah ekspor gaharu saat ini mengalami penurunan
pesat dibandingkan dengan tahun-tahun sebelumnya, informasi
mengenai jenis, keberadaan serta potensi pohon penghasil gaharu
yang ada di Indonesia sampai saat ini masih belum terkoleksi
dengan baik. Bahkan beberapa jenis sudah menjadi langka akibat
perburuan jenis-jenis tertentu yang tidak terkendali. Usaha budidaya
jenis pohon penghasil gaharu juga belum banyak mengalami
perkembangan yang nyata dan produk gaharu masih lebih banyak
dipanen dari hutan alam. Karena eksploitasi yang intensif sehingga
mengancam keberadaanya di alam, sejak tahun 1994 gaharu masuk
dalam Appendix II daftar CITES (Soehartono dan Newton, 2001) dan
bahkan semua jenis penghasil gaharu (Aquilaria spp. dan Gyrinops

214

Potensi dan Kondisi .....(Titiek Setyawati)

spp.) masuk dalam Appendix II CITES sejak tahun 2004. Mengingat


keberadaan jenis-jenis pohon penghasil gaharu yang mulai langka
dan terancam punah, diperlukan upaya eksplorasi dan konservasi,
baik ek-situ maupun in-situ.
Mengingat semakin terancamnya keberdaan jenis pohon
penghasil gaharu yang ada di habitat alaminya, maka diperlukan
upaya serius dari berbagai macam pihak yang berkepentingan
agar keberadaan jenis-jenis tersebut di Indonesia dapat dipantau,
baik dari sisi potensi dan persebarannya. Dengan tersedianya
informasi yang memadai, maka diharapkan tersedia bukti yang kuat
menyangkut status jenis-jenis pohon penghasil gaharu di Indonesia,
diharapkan jenis ini dapat keluar dari daftar CITES sebagai jenis
yang harus dilindungi, karena berbagai macam alasan yang
menyangkut status konservasinya. Makalah ini bertujuan untuk
memberikan informasi menyangkut aspek potensi dan persebaran
gaharu (A. malaccencis Lamk.) di Provinsi Lampung dan Bengkulu,
Sumatera.
Selama beberapa dekade ini, Indonesia dikenal sebagai negara
penghasil gaharu terbesar (Direktorat Jenderal PHPA, 1997 dalam
Soehartono dan Newton, 2000) dan sudah memberikan sumbangan
kepada pemasukan negara sejumlah 6,2 milyar rupiah di tahun
1995. Harga gaharu saat ini sangat bervariasi tergantung dari
kualitasnya. Dengan usia tanam dari 6 hingga 8 tahun gaharu
mampu menghasilkan getah sekitar dua kilogram. Harga gaharu
saat ini bervariasi mulai dari 5 juta hingga 20 juta rupiah per
kilogramnya. Untuk jenis gaharu yang terbaik di kelasnya harganya
bisa melebihi 20 juta rupiah per kilogram tergantung kualitasnya
(Anonim, 2009). Mengingat harga gaharu yang demikian tinggi,
maka tidaklah heran jika gaharu sangat dicari oleh para pedagang
sedangkan pemanenan masih mengandalkan gaharu yang tumbuh
di alam dan pencarian dilakukan oleh masyarakat lokal yang
memiliki akses masuk ke dalam hutan.
Masyarakat di lokasi hutan di Sumatera pada umumnya
mengumpulkan gaharu dalam kelompok yang masing-masing
terdiri dari 3 sampai 5 orang. Kelompok tersebut biasanya akan
tinggal di hutan selama lebih kurang seminggu untuk mencari

215

Aspek SOSIAL EKONOMI DAN KONSERVASI

gaharu di pedalaman hutan. Pada saat ini, pencarian gaharu makin


sulit akibat potensinya yang mulai menurun, sehingga orang harus
tinggal lebih dari 2 minggu atau bahkan sebulan hanya untuk
mendapatkan gaharu. Jika gaharu ditemukan, maka mereka
akan menebang pohonnya secara manual menggunakan kampak.
Seringkali terjadi bahwa kualitas gaharu tidak seperti yang mereka
inginkan dan pada akhirnya pohon yang sudah terlanjur ditebang
ditinggalkan begitu saja di hutan.

METODE PENELITIAN
A. Lokasi Penelitian
1. Lampung
Survei jenis-jenis pohon penghasil gaharu di Provinsi Lampung
dilakukan di satu lokasi yang ada di dalam kawasan Taman Nasional
Bukit Barisan Selatan (Hutan Biha) dan dua lokasi di luar kawasan
TNBBS, yaitu di Hutan Bukit Rupi dan Hutan Gunung Sugih, tepatnya
di Kabupaten Lampung Tengah.
Kawasan Hutan Bukit Rupi berada di Desa Segala Midar,
Kecamatan Pubian, Kabupaten Lampung Tengah. Kondisi topografi
di hutan alam ini sedikit berbukit dengan beberapa lokasi memiliki
kelerengan hingga 35 derajat. Kawasan Hutan Bukit Rupi berada di
luar kawasan TNBBS namun demikian merupakan kawasan hutan
lindung yang dikelola oleh Dinas Kehutanan Provinsi Lampung
Tengah. Kondisi hutan sebagian sudah dialihfungsikan menjadi
lahan perkebunan dan ladang masyarakat. Namun demikian masih
ada beberapa lokasi hutan alam, dimana ditemukan tegakan gaharu
yang masih utuh.
Kawasan Hutan Biha masuk dalam Blok Hutan Podomoro, Resort
Biha, Seksi Krui. Lokasi survei berada di Desa Sumur Jaya, Kecamatan
Pesisir Selatan, Kabupaten Lampung Barat. Areal penelitian masuk
dalam Seksi Konservasi Wilayah II Krui dengan luas kawasan
96,884 ha dengan cakupan wilayah meliputi Resort Merpas, Pugung

216

Potensi dan Kondisi .....(Titiek Setyawati)

Tampak, Krui, dan Biha. Lokasi penelitian secara detil tertera pada
Gambar 1.
Kawasan
hutan
TNBBS ini terletak
di ujung selatan dari
rangkaian pegunungan
Bukit Barisan dan
secara
geografis
berada pada 40315057 LS dan 1030241 0 4 0 BT s e d a n g k a n
secara administratif
p e n ge l o l a a n te r b a g i
d a l a m t i g a w i l aya h
pengelolaan, yaitu Seksi
Konservasi Wilayah I
Liwa.
Gambar 1. Peta lokasi survei dan pengamatan

S e k s i Ko n s e r va s i
jenis-jenis pohon penghasil gaharu
Wilayah Krui, dan Seksi
di Provinsi Lampung
Konservasi Wilayah III
Sukaraja. Topografi kawasan ini bergelombang dan berbukit-bukit
dengan ketinggian berkisar antara 0-1.964 m dpl. Curah hujan ratarata di bagian barat adalah 3.000-3.500 mm/th sedangkan di bagian
timur 2.500-3.000 mm/ th.

2. Bengkulu
Lokasi kedua kawasan hutan sangat berdekatan dengan Tahura
Rojolelo yang terletak di antara 03 42-03 44LS sampai 102 21BT
dan berada di ketinggian 10-30 m dpl. Waktu tempuh dari pusat
kota Bengkulu sekitar 30 menit dengan jarak sekitar 20 km (Gambar
2).

217

Aspek SOSIAL EKONOMI DAN KONSERVASI

Gambar 2.
Lokasi penelitian di
Kawasan Hutan Binjai
Temula (Kec. Talang
Empat) dan Pungguk
Gambo (Kec. Pondok
Kelapa), Bengkulu
Utara

Kawasan hutan dekat Desa Tanjung Terdana sebagian besar


sudah dikonversi menjadi areal persawahan dan perkebunan
masyarakat. Tanaman yang umum ditanam antara lain padi, kelapa
sawit, karet, pisang, jeruk, jati, dan tanaman palawija lainnya.

BAHAN DAN ALAT


A. Bahan dan Alat
Bahan yang dijadikan sebagai obyek kegiatan ekologi, fenologi,
dan potensi sebaran jenis pohon penghasil gaharu ini adalah semua
jenis pohon yang diduga menghasilkan gaharu yang terdapat di
kawasan hutan lindung.
Alat yang digunakan untuk pengambilan data di lapangan, baik
primer dan sekunder, antara lain alkohol 96%, kamera digital,
GPS Garmin 12 satelit, kompas, larutan sub-limat, kertas koran,
kantung plastik, karung plastik, kertas gambar spesial, kertas plak
herbarium, alat plak herbarium, tinta gambar spesial, pena/alat
gambar, tambang nilon, dan tali rafia.

B. Prosedur Kerja
Kajian lapangan di Kabupaten Lampung Tengah dan Lampung
Barat dilakukan pada bulan Oktober dan Desember 2007 sedangan

218

Potensi dan Kondisi .....(Titiek Setyawati)

Kabupaten Bengkulu Utara, Provinsi Bengkulu dilaksanakan dua


kali, yaitu pada bulan Oktober dan Desember 2008. Pengamatan
pertama di Bengkulu dilaksanakan di Hutan Lindung Kelompok
Hutan Binjai Temula, Desa Dusun Baru, Kecamatan Talang Empat
dan yang kedua di Hutan Lindung Kelompok Hutan Pungguk
Gambo, Desa Tanjung Terdana, Kecamatan Pondok Kelapa. Waktu
pengamatan lapangan masing-masing selama 8 dan 10 hari. Kegiatan
pengamatan dan pengukuran di lapangan dikerjakan oleh seorang
peneliti, 3 orang teknisi, dan 5 orang tenaga teknis lapangan.
1. Pengamatan dan analisis gaharu meliputi beberapa macam
kegiatan, antara lain:
2. Pengumpulan data lapangan, baik secara langsung melalui
wawancara dengan masyarakat yang tinggal di dekat dan sekitar
hutan maupun tidak langsung dengan cara melakukan kajian
pustaka. Kuesioner dipersiapkan sebelum kegiatan lapangan
dilakukan.
3. Koleksi data primer di lapangan mencakup keanekaragaman
jenis pohon penghasil gaharu dan kondisi lingkungan tempat
tumbuhnya dengan menggunakan metode eksplorasi dalam
jalur-jalur yang sistematik. Panjang tiap jalur eksplorasi yaitu
1 km dengan jarak antar jalur 500 m. Eksplorasi dilakukan di
berbagai kondisi hutan, baik di lahan kering maupun lahan
basah. Ketinggian tempat di lahan kering ada 3 macam, yaitu
antara 0-200 m, 200-500 m, dan lebih dari 500 m dpl dengan
topografi yang berbeda, yakni topografi datar (kemiringan
lereng kurang dari 10%) dan bergelombang berat (kemiringan
25% atau lebih). Beberapa contoh pohon akan diambil untuk
keperluan identifikasi dan koleksi herbarium. Untuk itu
digunakan blanko isian mencakup data pohon, data kondisi
lingkungan tempat tumbuh, dan data penggunaan tradisional
penduduk setempat. Di samping itu dibuat juga blangko isian
tersendiri yang digunakan untuk bahan wawancara dengan
penduduk yang berisi pertanyaan-pertanyaan menyangkut
berbagai macam informasi tentang karakter jenis-jenis pohon
penghasil gaharu yang dikenal oleh penduduk setempat.

219

Aspek SOSIAL EKONOMI DAN KONSERVASI

4. Mengadakan pendugaan potensi dan sebarannya dengan


menggunakan metode titik pusat kuadran (quadrant center point
method) sepanjang jalur eksplorasi dengan jarak antara titik
pertama dan titik berikutnya 50 m. Pada tiap titik pusat kuadran
dilakukan perisalahan 4 individu pohon penghasil gaharu atau
pohon lainnya yang terdekat dengan titik pusat atau 1 individu
pohon pada tiap kuadran. Individu pohon tersebut yang
dirisalah dibatasi jarak terjauh 25 m dari titik pusat kuadran
dan diameter batangnya 20 cm atau lebih. Pendataan pohon
meliputi nama jenis, diameter batang, dan tinggi pohon.
5. Estimasi regenerasi jenis-jenis pohon penghasil gaharu yang
terdapat di kawasan hutan dengan cara menghitung permudaan
tingkat semai (tinggi kurang dari 150 cm), tingkat pancang
(tinggi lebih dari 150 cm dengan diameter kurang dari 10 cm)
dan tingkat tiang (diameter 10-20 cm) di sekitar titik pusat
kuadran. Jika anakan yang pertama ditemukan berada jauh
dari pohon induk, maka dibuat risalah anakan menggunakan
metoda jalur transek sepanjang 1 km dari titik anakan pertama
ditemukan. Jarak anakan pertama dengan pohon induk diukur.
Selanjutnya dibuat petak 10 m x 10 m di setiap selang 200 m dari
jalur transek.
6. Pengidentifikasian jenis-jenis pohon penghasil gaharu dan
proses koleksi herbarium dari kegiatan eksplorasi.
7. Penggambaran lukisan spesimen herbarium jenis pohon
penghasil gaharu.
8. Pengolahan data hasil wawancara dengan masyarakat lokal.
9. Pengolahan data potensi keberadaan jenis pohon penghasil
gaharu dan wilayah sebarannya yang terdapat di dalam kawasan
hutan alam.
10. Penulisan deskripsi jenis-jenis pohon penghasil gaharu yang
disertai gambar lukisan spesimen herbarium.
11. Pembuatan tally sheet untuk mengisi data tentang masa
berbunga dan berbuah jenis-jenis pohon penghasil gaharu.
Penduduk yang tinggal di dekat kawasan diminta untuk mengisi
blanko kosong yang harus diisi dengan informasi kapan masa

220

Potensi dan Kondisi .....(Titiek Setyawati)

berbunga, jumlah buah dan bunga (persentase), jumlah pohon


yang berbuah dan berbunga, kondisi iklim atau cuaca pada saat
berbunga atau berbuah (hujan, panas, kering, dan sebagainya)
dan mengisi data curah hujan.

C. Analisis Data
1. Beberapa definisi dan kalkulasi yang digunakan dalam analisis
vegetasi, antara lain:
2. Kepadatan: jumlah individu per plot (100 m2).
3. Frekuensi: jumlah unit contoh (10 m x 10 m), di mana jenis
ditemukan.
4. Luas Bidang Dasar (LBD): luasan bagian melintang dari batang
>20 cm sebatas dada (diameter of breast height (dbh)). Luas
bidang dasar untuk tiap plot dijumlah untuk memperoleh LBD
tiap pohon dengan menggunakan rumus: LBD (m2)= pi x d
(diameter dalam m)2/4 (Kent dan Coker, 1992).
5. Nilai Penting (NP): perkiraan secara keseluruhan pentingnya
suatu jenis pohon di dalam komunitas lokalnya. Nilai NP ini
diperoleh dengan cara menjumlahkan Dominansi Relatif (DoR),
Kelimpahan Relatif (KR), dan Frekuensi Relatif (FR) dari jenis
tertentu. DR merupakan rasio total luas bidang dasar dari suatu
jenis terhadap jumlah total luas bidang dasar dari seluruh jenis
yang ada, KR merupakan rasio jumlah individu dari suatu jenis
terhadap jumlah total jenis di dalam plot dan FR merupakan
rasio frekuensi dari suatu jenis terhadap total frekuensi seluruh
jenis di dalam plot (Kent dan Coker, 1992, Krebs, 1999, 1994).

HASIL DAN PEMBAHASAN


A. Hasil Pengamatan di Lampung
Hasil pengamatan yang diperoleh dalam rangka melakukan
kajian potensi sebaran jenis A. malaccensis Lamk. di Provinsi
Lampung ini menunjukkan bahwa di beberapa lokasi di dalam
kawasan Taman Nasional Bukit Barisan Selatan ini masih terdapat

221

Aspek SOSIAL EKONOMI DAN KONSERVASI

tegakan alam pohon gaharu meskipun jumlah dan potensi


regenerasi alamnya tampak mengalami penurunan seperti yang
ada di Kawasan Hutan Biha. Di beberapa tempat juga tampak tandatanda bekas perambahan hutan yang tentunya sebagian besar
untuk mengambil kayu gaharu. Khusus di Bukit Rupi, jumlah
tegakan pohon, sapling, dan anakan yang ditemukan pada enam
plot sampel tampak cukup banyak. Tampaknya tidak banyak
gangguan seperti pengambilan gubal gaharu di kawasan ini.
Kemungkinan hal ini disebabkan akses ke dalam kawasan hutan
yang relatif sulit dibandingkan dengan Kawasan Hutan Biha.
Tampak pada Gambar
3
kecambah
gaharu
yang tumbuh melimpah
menyerupai permadani di
bawah tegakan induknya
yang ditemukan di Kawasan
Hutan Bukit Rupi, Lampung
Tengah.
Di lokasi ini juga dijumpai
tegakan pohon penghasil
gaharu alami yang tumbuh Gambar 3. Anakan gaharu yang
ditemukan tumbuh secara
besar di wilayah perkebunan
alami di Kawasan Hutan Bukit
milik masyarakat (Gambar
Rupi, Lampung Tengah
4). Tegakan dapat dikatakan
alami, karena berdasarkan wawancara dengan pemilik kebun,
mereka tidak merasa menanam pohon penghasil gaharu dan
menemukan pohon tersebut tumbuh di halaman kebun mereka.
Kemungkinan besar biji gaharu terbang dan menemukan media
yang baik untuk tumbuh besar di kebun milik penduduk tersebut.
Namun demikian, belum ada laporan bahwa pohon tersebut pernah
menghasilkan gaharu atau terinfeksi oleh patogen. Nampak bahwa
kondisi batang tegakan pohon sangat halus dan tidak ditemukan
cacat pohon.
Jumlah pohon gaharu yang dapat ditemukan di Bukit Rupi,
Lampung Tengah tertera pada Tabel 1.
Hasil pengamatan regenerasi alam jenis gaharu di Kawasan
Hutan Way Waya, Gunung Sugih, Lampung Tengah menunjukkan
222

Potensi dan Kondisi .....(Titiek Setyawati)

perkembangan yang sedikit berbeda dengan yang ada di Bukit Rupi,


meskipun lokasinya sama-sama di satu kabupaten. Tampak bahwa
tidak satu pun jenis penghasil gaharu ditemukan di petak sampel
(Tabel 2) di antara 13 jenis pohon hutan yang berhasil diidentifikasi
di laboratorium Botani Hutan.
Sedangkan jumlah pohon gaharu dan potensi regenerasi alam
yang ada di beberapa cuplikan sampel plot di Kawasan Hutan
Biha tertera pada Tabel 3. Tampak bahwa potensi tegakan alam
dan regenerasi alam yang ada di Hutan Biha sangat sedikit,
namun bukan sama sekali tidak ditemukan seperti di Kawasan
Hutan Gunung Sugi, Lampung Tengah. Kurangnya jumlah pohon
ini dimungkinkan dengan semakin terbukanya akses ke dalam
kawasan hutan lindung, sehingga pemungut kayu gaharu setiap saat
dapat secara kebetulan maupun ada juga yang dengan niat keras,
menemukan jenis gaharu tersebut. Nampak pula bahwa sebagian
besar masyarakat sudah banyak mengetahui nilai ekonomis
dari gaharu, sehingga kemungkinan sejak dahulu sudah banyak
masyarakat yang memanfaatkan gaharu yang tumbuh alami namun
hal ini tidak dibarengi dengan upaya budidayanya.

Gambar 4. Tegakan pohon A. malaccensis Lamk. yang


ditemukan tumbuh secara alami di perkebunan
milik masyarakat yang lokasinya berbatasan
dengan Kawasan Hutan Bukit Rupi, Lampung
Tengah

223

Aspek SOSIAL EKONOMI DAN KONSERVASI

Gambar 5.
Penduduk setempat yang
sudah melakukan upaya
bu-didaya penanaman pohon gaharu (A. malaccensis Lamk.) di kebun miliknya di Kawasan Hutan
Gunung Sugih, Lampung
Tengah
Tabel 1. Jumlah pohon, pancang, dan anakan A. malaccensis Lamk. yang
ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Rupi,
Lampung Tengah
No.
plot

Jumlah pohon (> 10 cm)

Jumlah pancang

Jumlah anakan

1.

26

34

14

2.

15

21

3.

21

30

4.

14

16

14

5.

16

19

11

6.

17

Tabel 2. Jumlah pohon, pancang, anakan dan semai beberapa jenis pohon
alami yang ada dalam 50 plots penelitian di Kawasan Hutan Way
Waya, Gunung Sugih, Lampung Tengah
Pohon
No

Nama jenis

Tiang

Pancang

Semai

Plot

Batang

Plot

Batang

Plot

Batang

Plot

Batang

Artocarpus
elasticus

15

45

Ganophyllum
falcatum

10

15

Bombax valetonii

224

Potensi dan Kondisi .....(Titiek Setyawati)

Pohon
No

Nama jenis

Tiang

Pancang

Semai

Plot

Batang

Plot

Batang

Plot

Batang

Plot

Batang

Pterospermum
diversifolium

18

Laportea
stimulans

17

12

20

Vitex sp.

12

11

23

Ficus sp.

10

15

Artocarpus sp.

Alstonia
angustifolia

10

12

10

Pometia pinnata

12

23

11

Cananga odorata

12

12

Litsea sp.

13

20

13

Hibiscus
macrophyllus

Tabel 3. Jumlah pohon, pancang, dan anakan A. malaccensis Lamk. yang


ditemukan di tiap-tiap plot sampel di Kawasan Hutan Bukit Biha,
Lampung Barat
No. plot

Jumlah pohon
(> 10 cm)

Jumlah pancang

Jumlah anakan

1.

2.

3.

4.

12

Berdasarkan informasi penduduk yang tinggal di Kawasan


Hutan Lindung Bukit Sugih (Register 22 Way Waya) bahwa jenis
pohon gaharu sudah sulit dijumpai karena adanya pembalakan
hutan maupun adanya pencari gaharu di masa lampau. Namun
demikian masih terdapat beberapa pohon penghasil gaharu alami
yang tersisa di daerah hutan belukar, oleh karena itu pembuatan
plot dilakukan di hutan belukar tersebut.
Pohon gaharu yang masih ada di Kawasan Hutan Register 22 Way
Waya, Desa Sendang Baru, Kecamatan Sendang Agung, Kabupaten

225

Aspek SOSIAL EKONOMI DAN KONSERVASI

Gunung Sugih, Lampung Tengah, hanya tinggal sekitar 5 pohon, itu


pun terbagi tempatnya menjadi tiga titik dengan jarak tempuh yang
berbeda. Titik yang terdekat berjarak sekitar 5 km dengan jarak
tempuh sekitar 1 jam berjalan kaki. Adapun jenis pohon penghasil
gaharu yang ditemui hanya satu jenis yaitu A. malaccensis Lamk.
(Thymelaeaceae).
Dari 50 plot yang dibuat terdapat 5 plot yang dijumpai pohon
penghasil gaharu, masing-masing satu batang pohon yang
berdiameter 20 cm, 25 cm, 28 cm, 30 cm, dan 34 cm, sedangkan
tingkat tiang tidak dijumpai, tingkat pancang hanya satu batang,
dan tingkat anakan terdapat 3 plot dengan jumlah masing-masing
30, 85, dan 102 batang.

Gambar 6. Tegakan pohon A. malaccensis Lamk. (kiri) dan


anakan yang tumbuh di bawahnya (kanan) di
lokasi Kawasan Hutan Biha, Lampung Barat

226

Potensi dan Kondisi .....(Titiek Setyawati)

B. Hasil Pengamatan di Kawasan Hutan di Provinsi


Bengkulu
Hasil menunjukkan bahwa A. malaccensis Lamk. merupakan
jenis yang ditemukan di kedua lokasi penelitian di Bengkulu
Utara, yaitu di Kelompok Hutan Binjai Temula, Desa Dusun Baru,
Kecamatan Talang Empat dan Kelompok Hutan Pungguk Gambo,
Desa Tanjung Terdana, Kecamatan Pondok Kelapa. Kedua lokasi
berada di Provinsi Bengkulu dan kedua kawasan juga masuk dalam
kawasan hutan lindung. Sampai saat ini masih terdapat perburuan
gaharu di hutan alam dan bahkan masyarakat atau penduduk lokal
mengumpulkan anakan pohon gaharu (semai dan pancang) dari
hutan alam untuk diperdagangkan. Hal ini terjadi terutama di
Kawasan Lindung Kelompok Hutan Pungguk Gambo.
Jumlah pohon penghasil gaharu dan potensi regenerasi alam
yang ada di beberapa cuplikan sampel plot di Kawasan Hutan Binjai
Temula tertera pada Tabel 4. Tampak bahwa potensi tegakan alam
dan regenerasi alam yang ada di Kawasan Binjai Temula ini sangat
sedikit. Hal ini dimungkinkan dengan semakin terbukanya akses ke
dalam kawasan hutan lindung dan kemungkinan besar juga adalah
tingkat reproduksi tegakan yang mulai berkurang.
Sedangkan jumlah pohon gaharu dan potensi regenerasi alam
yang ada di beberapa cuplikan sampel plot di Kawasan Hutan
Pungguk Gambo tertera pada Tabel 5. Kondisi regenerasi di kawasan
ini hampir sama dengan kawasan yang sebelumnya, yaitu Binjai
Temula. Tampak bahwa jumlah pohon sangat sedikit dan menurut
informasi yang diperoleh dari masyarakat sekitar, sebagian besar
masyarakat sudah banyak mengetahui nilai ekonomis dari gaharu,
sehingga sejak dahulu sudah banyak memanfaatkan gaharu yang
tumbuh alami.
Berdasarkan hasil analisis vegetasi di Kelompok Hutan Binjai
Temula, A. malaccensis Lamk. memiliki indeks nilai penting yang
cukup tinggi pada tingkat pohon, yaitu 39,86% (urutan kedua setelah
Cinnamomum porectum (Roxb.) Kostm. (57,20%). Tegakan gaharu
pada tingkat tiang dan pancang tidak ditemukan pada plot sampel
namun mendominasi pada tiangkat seedling (38,72%). Berdasarkan
angka nilai pentingnya, pada Kawasan Lindung Kelompok Hutan

227

Aspek SOSIAL EKONOMI DAN KONSERVASI

Pungguk Gambo, pohon penghasil gaharu (>20 cm) menduduki


urutan keempat (43,20%) setelah Vitex pubescens Vahl. (90,55%),
C. porectum (Roxb.) Kostm. (67,30%), dan Garcinia diocia Blume
(56,82%). Tegakan tidak ditemukan di tingkat tiang dan hanya
memiliki nilai penting 3,59% pada tingkat pancang dan berada di
urutan keempat (19,48%) untuk tingkat seedling atau semai. Pada
plot sampel di lokasi Pungguk Gambo, banyak ditemukan kecambah
atau biji-biji yang mulai berkecambah di bawah pohon induknya
serta beberapa anakan dengan pertumbuhan yang cukup sehat
(Gambar 7).

Gambar 7. Kecambah atau biji yang mulai tumbuh (kiri) dan


beberapa anakan mulai tinggi (kanan) di areal
Kelompok Hutan Pungguk Gambo

Tabel 4. Jumlah pohon, pancang, dan anakan A. malaccensis Lamk. yang


ditemukan di tiap-tiap plot sampel di Kawasan Hutan Binjai Temula,
Bengkulu Utara
No. plot

Jumlah pohon
(> 10 cm)

Jumlah pancang

Jumlah anakan

1.

2.

3.

4.

5.

6.

228

Potensi dan Kondisi .....(Titiek Setyawati)

No. plot

Jumlah pohon
(> 10 cm)

Jumlah pancang

Jumlah anakan

10

Tabel 5. Jumlah pohon, pancang dan anakan A. malaccensis Lamk. yang


ditemukan di tiap-tiap plot sampel di Kawasan Hutan Pungguk
Gambo
No. plot

Jumlah pohon (>


10 cm)

Jumlah pancang

Jumlah anakan

1.

2.

3.

4.

10

Biji yang mulai berkecambah tersebut tumbuh sangat rapat dan


pada umumnya hanya bertahan beberapa hari saja, karena akan
dipungut oleh penduduk untuk diperdagangkan. Namun demikian
semai/seedling berukuran tinggi di atas 10 cm saja dihitung dalam
petak pengamatan (2 m x 2 m) untuk memperoleh angka nilai
penting. Tegakan pada tingkat pohon terlihat sangat rapat (Gambar
8) dan pada sebagian petak sampel terdapat pohon dengan ukuran
diameter yang cukup besar namun belum menampakkan tandatanda terjadinya pembusukan yang mengakibatkan terbentuknya
gaharu (Gambar 9).
Pada umumnya pohon mulai berbunga dan berbuah pada
umur 5 sampai 6 tahun bahkan pohon berukuran sedang bisa
menghasilkan biji kurang lebih 1,5 kg pada musim yang baik. Masa

229

Aspek SOSIAL EKONOMI DAN KONSERVASI

berbunga dan berbuah biasanya terjadi pada bulan-bulan kering.


Di Sumatera, masa berbunga dan berbuah 2 kali dalam setahun.

Gambar 8. Tegakan gaharu yang


rapat

Gambar 9. Pohon gaharu dengan


diameter 50 cm

Pohon berbunga pada bulan Juli dan Agustus dan menghasilkan


buah matang pada bulan November-Desember. Pembungaan pada
bulan Maret-April akan menghasilkan buah di bulan Juli-Agustus
(Adelina, 2004). Buah yang matang berwarna coklat kehitamhitaman. Buah ini harus langsung dipanen dari pohonnya.
Masalah utama di lapangan adalah penyakit pada anakan
yang disebabkan oleh serangga kecil yang hinggap di ujung daun
anakan, menghisap cairan daun dan menyebabkan helai pucuk
daun bergulung dan mengakibatkan anakan menjadi kerdil. Petani
menggunakan pestisida jika perlu untuk membasmi serangga ini.
Perkecambahan biji dan anakan yang muda sangat rentan terhadap
penyakit damping off yang disebabkan oleh jamur (Kundu dan
Ka-chari, 2000, Sumarna et al.. 2001). Penyakit seperti ini tidak
ditemukan di lokasi penelitian di Bengkulu Utara. Meskipun ada,

230

Potensi dan Kondisi .....(Titiek Setyawati)

dilaporkan hanya sedikit di beberapa tempat saja. Bisanya petani


akan membuang anakan yang sakit.
Estimasi potensi stock kayu gaharu di Indonesia yaitu 1,87
pohon/ha di Sumatera, 3,37 pohon/ha di Kalimantan, dan 4,33
pohon/ha di Papua. Tampak bahwa stock di kawasan hutan di
Sumatera lebih rendah dibandingkan dengan kawasan hutan
yang ada di Kalimantan dan Papua. Meskipun tampak bahwa di
kawasan Bengkulu Utara di sebagian tempat tampak rapat namun
keberadaan pohon penghasil gaharu sendiri tidak menjamin adanya
resin gaharu. Beberapa peneliti menduga bahwa hanya 10% dari
pohon Aquilaria yang mengandung gaharu. Indonesia merupakan
eksportir utama produk gaharu dan dengan tingginya permintaan
pasar akhir-akhir ini serta tingginya harga yang ditawarkan di
pasar dunia, maka banyak kolektor yang tidak berpengalaman
pada akhirnya ikut mengeksploitasi gaharu di alam. Sebagai
akibatnya populasinya di alam makin lama makin berkurang. Saat
ini gaharu sudah masuk dalam Appendix II CITES. Namun hal ini
tidak mengurangi kerusakan dan berkurangnya populasi gaharu di
alam (Anonim, 2007, Soehartono dan Newton, 2001).

KESIMPULAN DAN SARAN


A. Kesimpulan
1. Berdasarkan hasil pengamatan lapangan dan estimasi potensi
regenerasi alam jenis-jenis pohon penghasil gaharu yang tumbuh
di hutan alam di beberapa lokasi contoh di Kabupaten Lampung
Tengah dan Lampung Barat, tampak bahwa potensi tegakan
alam A. malaccensis Lamk. sudah mengalami penurunan
populasi. Demikian pula dengan potensi regenerasinya yang
ditunjukkan dengan sedikitnya jumlah semai maupun anakan
yang ada di bawah tegakan alam.
2. Hasil pengamatan di dua lokasi contoh di Kabupaten Bengkulu
Utara, tampak bahwa potensi tegakan alam A. malaccensis Lamk.
masih banyak namun demikian kondisinya saat ini menghadapi
ancaman penurunan populasi di berbagai tingkatan umur

231

Aspek SOSIAL EKONOMI DAN KONSERVASI

tegakan, terutama di tingkat seedling dan sapling. Akibatnya bagi


proses regenerasi alaminya terjadi kekosongan tegakan pada
tingkat tiang, sehingga potensi regenerasi alami akan mengalami
hambatan karena ketidakseimbangan pertumbuhan di setiap
tingkatan terutama tidak terjadinya pertumbuhan mencapai
tingkat tiang. Berlainan dengan temuan yang ada di Provinsi
Lampung, di Bengkulu ditemukan adanya laporan serangan
serangga yang menyebabkan pertumbuhan tegakan gaharu
menjadi kerdil. Untuk data masa pembungaan dan berbuah
sampai saat penelitian belum dapat diperoleh mengingat masa
pengamatan tidak bertepatan dengan masa berbunga dan
berbuah.
3. Kawasan hutan di Provinsi Lampung dan Bengkulu memiliki
potensi yang cukup baik untuk dijadikan areal sumberdaya
genetik untuk jenis A. malaccensis Lamk, mengingat potensi
jenis gaharu yang masih tampak baik. Meskipun ada beberapa
lokasi sampel dengan kondisi tegakan pohon dewasa yang sangat
kurang, akibat pemanenan gaharu yang kurang memperhatikan
aspek kelestarian.

B. Saran
Provinsi Lampung, khususnya Kabupaten Lampung Tengah
dan Lampung Barat memiliki potensi tegakan alam gaharu yang
cukup merata meskipun di beberapa lokasi jumlah sampelnya tidak
memadai. Tampak pula terjadi pemanfaatan kayu gaharu di alam
yang kurang mengindahkan aspek kelestarian, sehingga diperlukan
penyuluhan bagi masyarakat setempat terutama penduduk yang
tinggal berdekatan dengan kawasan Taman Nasional Bukit Barisan
Selatan dan kawasan hutan lindung.
Sedikit lebih baik dari kondisi gaharu di Provinsi Lampung,
kawasan hutan di Provinsi Bengkulu, khususnya Kabupaten
Bengkulu Utara memiliki potensi tegakan alam gaharu yang juga
cukup baik dilihat dari sisi populasi tegakan alaminya. Meskipun
demikian jenis pohon ini mengalami ancaman serius akibat
perburuan, tidak hanya pohonnya namun juga anakan alaminya.
Sebagian besar penduduk memperjualbelikan anakan alami untuk

232

Potensi dan Kondisi .....(Titiek Setyawati)

dikembangkan lebih lanjut atau ditanam di kebun masyarakat


ataupun dijual ke luar daerah Bengkulu.
Mengingat masih terjadi pemanfaatan kayu gaharu di alam
yang kurang mengindahkan aspek kelestarian, terutama gangguan
terhadap proses regenerasi alaminya, maka diperlukan penyuluhan
atau pendidikan konservasi bagi masyarakat setempat terutama
penduduk yang tinggal berdekatan dengan kawasan hutan lindung
yang merupakan habitat alami jenis pohon penghasil gaharu ini.

DAFTAR PUSTAKA
Adelina, N. 2004. Aquilaria malaccensis Lamk. Seed Leaflet No. 103.
Forest & Landscape Denmark. December 2004.
Anonim, 2009. Siapkan Masa Depan, Ayo Tanam Gaharu.
Ko m p a s o n l i n e : h t t p : / / r e g i o n a l . k o m p a s .c o m / r e a d /
xml/2009/07/24/1300220/siapkan.masa.depan.ayo.tanam.
gaharu
Anonim. 2007. Gaharu (Aquilaria). Media on line : http// www.
wwf.or.id/index.php?fuseactian=whatwedo.species_gaharu.
Downloaded: 24 Januari 2007.
Heyne, K. 1987. Tumbuhan Berguna Indonesia. Vol. I, II, III, dan
IV. Badan Penelitian dan Pengembangan Kehutanan. Yayasan
Sarana Wana Jaya. Jakarta.
Kaskija, L. 2002. Claiming the Forest. Punan Local Histories and
Recent Developments in Bulungan, East Kalimantan. CIFOR.
Indonesia.
Kent, M. dan P. Coker. 1992. Vegetation Description and Analysis : A
Practical Approach. CRC Press, Behalven Press.
Krebs, C. J. 1994. Ecology : The Experimental Analysis of Distribution
and Abundance. Harper Collins College Publishers.
Krebs, C. J. 1999. Ecological Methodology. Jim Green.
Kundu, M. dan J. Kachari. 2000. Desiccation Sensitivity and
Recalcitrant Behaviour of Seeds of Aquilaria agallocha Roxb.
Seed Science and Technology.

233

Aspek SOSIAL EKONOMI DAN KONSERVASI

Mai, R.R. dan B.A. Suripatty. 1996. Pengaruh Wadah Penyimpanan


dan Kelas Diameter Terhadap Pertumbuhan Stump Wikstroemia
polyantha. Buletin Penelitian Kehutanan 1(1). Balai Penelitian
Kehutanan Manokwari, Irian Jaya.
Puri, R.K. 2001. Bulungan Ethnobiology Handbook. East West
Center-Prosea- CIFOR. CIFOR, Bogor, Indonesia.
Sellato, B. 2001. Forest, Resources and People in Bulungan. Elements
for a History of Settlement. Trade and Social Dynamics in
Borneo, 1880-2000. CIFOR. Indonesia.
Soehartono, T. dan A.C. Newton. 2000. Conservation and Sustainable
Use of Tropical Trees in the GenusAquilaria I. Status and Use
in Indonesia. Biological ConservationNo. 96.
Soehartono, T. dan A.C. Newton. 2001. Conservation and Sustainable
Use of Tropical Trees in the Genus Aquilaria II. The Impact of
Gaharu Harvesting in Indonesia. Biological Conservation No 97.
Sumarna, Y., A. Syaffari, dan N. Mindawati. 2001. Pembibitan Jenis
Pohon Penghasil Gaharu (Aquilaria malaccensis Lamk).
Zich, F. dan J. Compton. 2001. Agarwood (Gaharu) Harvest and
Trade in Papua New Guinea : A Preliminary Assessment. An
information Document Prepared by TRAFFIC Oceania for the
Eleventh Meeting of the CITES Plants Committee, with reference
to CITES Decisions 11.112 and 11.113 Regarding Aquilaria spp.
Canberra, Australia, Centre for Plant Biodiversity Research,
CSIRO Plant Industry.
Zuhud, E.A.M. 1994. Pelestarian dan Pemanfaatan Keanekaragaman
Tumbuhan Obat Hutan Tropika Indonesia, Latin, Bogor.

234

Potensi dan Kondisi .....(Titiek Setyawati)

Lampiran 1. Daftar jenis pohon yang di survei dalam plot pengamatan


gaharu di Bukit Rupi, Lampung Tengah
No

Nama lokal

Nama botanis

Famili

Kayu alim

Aqualaria malaccensis Lamk.

Thymelaeaceae

Leban

Vitex pubescens Vahl.

Verbenaceae

Kelat

Eugenia grandis Wight

Myrtaceae

Kelepu

Neonauclea calycina Merr

Rubiacea

Putat

Barringtonia sp.

Lecythidiaceae

Lahu

Ficus variegata Bl.

Moraceae

Ketaran

Artocarpus anisophyllus
Reinw.

Moraceae

Kilada

Cinnanmomum porectum
(Roxb.) Kosterm.

Lauraceae

Simpur

Dillenia excelsa Gieg.

Dilleniaceae

10

Terap

Artocarpus elasticus Reinw.

Moraceae

11

Sepat

Carallia brachiata Merr

Rhizophoraceae

12

Rempelas

Tetracera indica L.

Dilleniaceae

13

Lingkem

Selaginella plana Hiern.

Selaginelaceae

14

Ranggung

Dillenia sumatrana Miq.

Dilleniaceae

15

Ancau

Clausena excavata Burm.

Rutaceae

16

Cempaka

Evodia aromatica Blume

Rutaceae

17

Pulai

Alstonia angustiloba Miq.

Apocynaceae

18

Lupang

Comersonia bartamia Merr

Sterculiaceae

19

Medang

Dehaasia caesia Blume

Lauraceae

20

Kedukduk

Clidenia hirta don

Melastomataceae

21

Gio

Kibessia azurea DC.

Melastomataceae

22

Kemutul

Cratoxylum formosum Dyer.

Hypericaceae

23

Seru

Schima wallichii Korth.

Theaceae

24

Asam Kandis

Garcinia dioica Bl.

Guttiferae

25

Nerung

Parasponia parvifolia Miq.

Ulmaceae

26

Petai

Parkia speciosa Hassk.

Mimosaceae

27

Sebasah

Strombosia javanica Blume

Olacaceae

28

Beruas

Garcinia celebica L.

Guttiferae

29

Tepa

Cinnamomum iners Blume

Lauraceae

30

Sago

Peltophorum grande prain

Celasteraceae

31

Sidi

Eurya acuminata APDC.

Theaceae

32

Nyari

Antidesma tetandrum Blume

Euphorbiaceae

33

Sungkai

Peronema canescens Jack

Verbenaceae

235

Aspek SOSIAL EKONOMI DAN KONSERVASI

Lampiran 2. Daftar jenis pohon yang ada di dalam Kelompok Hutan Binjai
Temula, Desa Dusun Baru, Kecamatan Talang Empat, Bengkulu
Utara
No

Nama lokal

Nama botanis

Famili

Karas

Aquilaria malaccensis Lamk

Thymelaceae

Gadis

Cinnamomum porectum (Roxb.) Kostrm

Lauraceae

Leban

Vitex pubescens Vahl

Verbenaceae

Marapuyan

Rhodamnia cinerea Jack

Myrtaceae

Petai

Parkia speciosa Hassk

Leguminosae

Berawas

Litsea odorifera T et B

Lauraceae

Sipo

Dillenia exelsa Gilg

Dilleniaceae

Terap

Artocarpus elasticus Reinw

Moraceae

Jering

Archidendron jiringa (Jack) Nielsen

Leguminosae

10

Tetak Tunjuk

Canarium dichotonum Miq

Burseraceae

11

Semipis

Baccaurea racemosa Muell Arg

Euphorbiaceae

12

Kademe

Croton argyratus Blume

Euphorbiaceae

13

Semuting

Neonauclea calycina Merr

Rubiaceae

14

Seubo-ubo

Glochidion zeylanicum Juss

Euphorbiaceae

15

Kemutun

Cratoxylum formosum (jack) Dyer

Hyperiaceae

16

K.Gambir

Styrax benzoind Dryand

Styraxaceae

17

Ketepung

Vernonia arborea Ham.

Compositae

18

K.Angit

Clausena exavata

Rutaceae

19

Jungjung bukit

Actinodaphne glabra Blume

Lauraceae

20

Sugi

Orophea sp

Annonaceae

21

Sipunan

Pleomele elliptica H.Br

Liliaceae

22

Kenidai

Bridelia monoica Merr

Euphorbiaceae

23

Kendung

Symplocos cochinchinense Lour

Symplocaceae

24

Naran

Horsfieldia glabularis Warb

Myristicaceae

25

Kandis

Garcinia dioica Blume

Guttiferae

26

Kbg Saka/
Seketut

Aporusa sp.

Euphorbiaceae

27

Pelangas

Aporusa aurita Miq

Euphorbiaceae

28

Lulus

Cratoxylum sumatranum (Jack) Blume

Hyperiaceae

29

Gamat

Elaeocarpus stipularis Blume

Elaeocarpaceae

30

Marabikang

Ixonanthes petiolaris Blume

Linnaceae

31

Kemalau

Litsea firma Hook.f

Lauraceae

32

Gelam Abang

Eugenia glomerata K et V

Myrtaceae

33

K.Beras

Timonius sericanthus Boerl

Rubiaceae

34

Salung Gajah

Tarenna sp.

Rubiaceae

35

Salung

Tarenna confusa K et V.

Rubiaceae

36

Urat Use

Ganophyllum falcatum Blume

Sapotaceae

37

Nyaran

Lucuma maingayi Dub

Sapotaceae

38

Ingitdare

Carallia brachiata Merr

Rhizophoraceae

236