THE JOURNAL OF BIOLOGICAL CHEMISTRY

1999 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 274, No. 11, Issue of March 12, pp. 70827088, 1999
Printed in U.S.A.

Cloning and Expression of a Wheat (Triticum aestivum L.)

Phosphatidylserine Synthase cDNA
OVEREXPRESSION IN PLANTS ALTERS THE COMPOSITION OF PHOSPHOLIPIDS*
(Received for publication, November 24, 1998, and in revised form, January 7, 1999)

Emmanuel Delhaize, Diane M. Hebb, Keith D. Richards, Jian-Ming Lin, Peter R. Ryan, and
Richard C. Gardner
From the Plant Industry, Commonwealth Scientific Industrial and Research Organisation, GPO Box 1600,
Canberra Australian Capital Territory 2601, Australia and Centre for Gene Technology, School of Biological Sciences,
University of Auckland, Private Bag 92019, Auckland, New Zealand

Although phosphatidylserine (PS)1 is a minor phospholipid

component of plant membranes (1), it is likely to have roles in
* The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBankTM/EBI Data Bank with accession number(s) U91983.
to whom correspondence should be addressed: Plant Industry, Commonwealth Scientific Industrial and Research Organisation, GPO Box
1600, Canberra Australian Capital Territory 2601, Australia. Tel.: 61 2
6246 5047; Fax: 61 2 6246 5000; E-mail: e.delhaize@pi.csiro.au.
1
The abbreviations used are: PS, phosphatidylserine; PSS, phosphatidylserine synthase; PE, phosphatidylethanolamine; PC, phosphatidylcholine; PI, phosphatidylinositol; PG, phosphatidylglycerol;
PCR, polymerase chain reaction.

addition to contributing to the structure of lipid bilayers. In

mammalian and yeast cells, PS is normally distributed asymmetrically across the plasma membrane with the inner surface
containing most of the PS (2, 3). Externalization of PS on the
plasma membrane is an early indicator of apoptosis in mammalian cells (4, 5). Phosphatidylserine is required for activation
of protein kinase C (6), is implicated as a key element in the
coagulation of blood (3), and also allows phagocytes to recognize
apoptotic cells (7). By comparison, there is little information
available describing the roles of PS in plants although a recent
report describes the migration of PS to the outer surface of the
plasma membrane being associated with apoptosis in plant
cells (8).
In Saccharomyces cerevisiae, PS is synthesized by the action
of phosphatidylserine synthase (PSS; CDP-diacylglycerol:L-serine o-phosphatidyltransferase, EC 2.7.8.8) that catalyzes the
condensation of L-serine with CDP-diacylglycerol (9). The synthesis of PS in yeast is the first committed step in the major
pathway for the de novo synthesis of phosphatidylethanolamine (PE) and phosphatidylcholine (PC; Fig. 1A), the two
most abundant phospholipids of yeast membranes. In mammalian cells, by contrast, PS is synthesized by exchange of the
polar head group of an existing phospholipid with L-serine (10)
in a so-called base-exchange reaction (PSS-BE; Fig. 1B)
whereas PC and PE are synthesized by pathways that do not
involve PS (11). Although the enzymes involved in the synthesis of PS by both types of reactions share the same trivial name,
phosphatidylserine synthase, the biochemistry of the reactions
is different, and there is minimal amino acid sequence similarity between the two types of enzymes.
In plant cells the major pathway for the synthesis of PS is
uncertain and may differ according to the type of tissue and
species in question (12). A PSS-base exchange enzyme activity
has been demonstrated in castor bean endosperm (13), whereas
another report described a PSS activity in extracts of spinach
leaves (14), but there are no subsequent reports to verify the
presence of PSS in other plant species or tissues. Feeding of
radiolabeled precursors to plant cells has produced equivocal
results in identifying the major pathways for phospholipid
biosynthesis. Some results have suggested that PC is synthesized primarily by pathways that do not require PS, but it has
not been possible to completely rule out that PS contributes to
PC biosynthesis (15, 16), Despite the paucity of direct experimental evidence in plants, a dogma has developed that PS
synthesis in higher eukaryotic cells, including plant cells, proceeds exclusively by the base-exchange pathway (11, 17).
As a result of screening a wheat cDNA library for clones that
conferred enhanced aluminum resistance to yeast, we isolated
a cDNA encoding a PSS that catalyzes the formation of PS by

7082

This paper is available on line at http://www.jbc.org

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

We describe the cloning of a wheat cDNA (TaPSS1)

that encodes a phosphatidylserine synthase (PSS) and
provides the first strong evidence for the existence of
this enzyme in a higher eukaryotic cell. The cDNA was
isolated on its ability to confer increased resistance to
aluminum toxicity when expressed in yeast. The sequence of the predicted protein encoded by TaPSS1
shows homology to PSS from both yeast and bacteria
but is distinct from the animal PSS enzymes that catalyze base-exchange reactions. In wheat, Southern blot
analysis identified the presence of a small family of
genes that cross-hybridized to TaPSS1, and Northern
blots showed that aluminum induced TaPSS1 expression in root apices. Expression of TaPSS1 complemented the yeast cho1 mutant that lacks PSS activity
and altered the phospholipid composition of wild type
yeast, with the most marked effect being increased
abundance of phosphatidylserine (PS). Arabidopsis
thaliana leaves overexpressing TaPSS1 showed a
marked enhancement in PSS activity, which was associated with increased biosynthesis of PS at the expense
of both phosphatidylinositol and phosphatidylglycerol.
Unlike mammalian cells where PS accumulation is
tightly regulated even when the capacity for PS biosynthesis is increased, plant cells accumulated large
amounts of PS when TaPSS1 was overexpressed. High
levels of TaPSS1 expression in Arabidopsis and tobacco
(Nicotiana tabacum) led to the appearance of necrotic
lesions on leaves, which may have resulted from the
excessive accumulation of PS. The cloning of TaPSS1
now provides evidence that the yeast pathway for PS
synthesis exists in some plant tissues and provides a tool
for understanding the pathways of phospholipid biosynthesis and their regulation in plants.

Phosphatidylserine Synthase cDNA from Wheat

the condensation of CDP-diacylglycerol with L-serine. The

cDNA complements a yeast mutant defective in PSS activity,
and the putative translation product shows homology to PSS
proteins from yeast and bacteria. Heterologous expression in
plants leads to increased synthesis of PS, and high levels of
expression are associated with lesions on the leaves.
EXPERIMENTAL PROCEDURES

Yeast Strains and Growth MediaA wheat cDNA library was prepared from an aluminum-resistant wheat line and expressed in the
yeast (S. cerevisiae) strain InVSc2 (Invitrogen, MATa his3-D1 ura3-52).
Other yeast strains (FY833: MATa his3-D200 ura3-52 leu2-D1 lys2D202, trp1-D63; FY73 MATa his3-D200 ura3-52; DBY747-a1: MATa
ade2 his3-D1 leu2-3, 112 ura3-52 trp-289a can1 GAL1 CUPr) were also
used to assess whether selected wheat cDNAs conferred aluminum
resistance in different genetic backgrounds. Yeast strains were propagated on YPD medium or on minimal SC medium supplemented with
amino acids (18). Yeast colonies were assessed on plates for resistance
to aluminum as described below, and in some cases aluminum resistance was also tested in liquid medium (19).
DNA Manipulations, Sequence Analysis, and Preparation of cDNA
LibraryNucleic acids were manipulated using standard methods (20)
and sequenced by the dideoxy chain termination method (21).
The aluminum-resistant wheat line, ET3 (22), was grown in solution
culture, and root apices (0 5 mm) were collected from 5-day-old seedlings exposed to 10 mM aluminum for times ranging from 1 to 48 h. Total
RNA was extracted from the combined root apices using a method
described by Chandler et al. (23). Poly(A)1 mRNA was purified by
passage through oligo(dT)-cellulose columns (Amersham Pharmacia
Biotech), and cDNA was synthesized from this RNA template using a
commercial kit (Stratagene). The resulting cDNA was ligated into the
pYES2 yeast expression vector (Invitrogen), and the plasmids were
used to transform Escherichia coli (strain XL1-Blue; Stratagene).
Plasmid DNA was purified from the cDNA library grown in E. coli
and used to transform the InVSc2 strain of S. cerevisiae using a lithium
acetate procedure (24). Transformants were selected on SC minus/
uracil medium, eluted from the plates into sterile water, and screened
for aluminum resistance. About 100,000 ura1 yeast cells were spread
onto modified LPM plates that contained 2% galactose and either 100 or
150 mM aluminum added as Al2(SO4)3. LPM plates have low pH (pH 3.8;
required to maintain the toxic Al31 species), low magnesium concentration, and low phosphorus concentration (19); in this case agar (BBL
granulated agar; Becton Dickinson) was used instead of agarose, and
complete amino acids were provided as described by Rose et al. (18), and

uracil was omitted to provide selection for the pYES2 vector. The plates
were incubated at 30 C and aluminum-resistant colonies were selected
over 3 weeks. Putative aluminum-resistant colonies were retested by
streaking onto aluminum-containing plates in the presence and absence of galactose (cDNA inserts were expressed behind the GAL1
promoter in pYES2) and by introducing the DNA into E. coli and then
back into the yeast strain InVSc2 to confirm their ability to confer
aluminum resistance.
Northern and Southern HybridizationsRNA from root tips of aluminum-sensitive wheat (cv. Warigal) was isolated for Northern blot
analysis using procedures described by Snowden and Gardner (25).
Northern blots were quantitated using a Fuji film BAS 2500 PhosphorImager (Fuji) with MACBAS (version 2.5E) software to normalize expression levels relative to rRNA expression as determined with the
wheat rRNA probe pTA250.2 (26). Genes homologous to the predicted
proteins encoded by the cDNAs were identified using the BLASTX
algorithm (27).
Wheat DNA was purified by the method of Doyle and Doyle (28), and
Southern hybridization at high stringency was performed as described
by Sambrook et al. (20).
Manipulation of the Yeast CHO1 GenePCR-mediated disruption of
the CHO1 gene was carried out using oligonucleotides with 41 nucleotides homologous to the CHO1 gene and 19 nucleotides homologous to
the HIS1 gene. The sequence of the forward primer was CGCACCTCA
AGAATTCCCACACACGGACACAGACGTTATCGGGCCTCCTCTAGTACACTC and the reverse primer was CCCAACACCAAAGCTAGAGTGGTTGGCATAGGCAATCCCTCGGAAAGCGCGCCTCGTTCA. The
PCR product (990 base pairs) was transformed into the yeast strain
FY833, and transformants able to grow in the absence of histidine were
screened for an inability to grow without choline. One line (CH5) was
confirmed as a CHO1 disruption by PCR and Southern hybridization.
Aluminum resistance of CH5 yeast strains was determined by growth
in liquid LPM medium (pH 3.5) that contained histidine, choline, and
galactose (2% w/v).
The yeast CHO1 gene was amplified using the primers GCAAGCTTGGATCCAAAATGGTTGAATCAGATGAAGATTTC and CGTCTAGAGCGGCCGCCCAGGCATGAACAAAAACTACT and cloned behind
the GAL1 promoter in the vector pYES3, a modified version of pYES2
described by Smith et al. (29).
Transgenic PlantsThe TaPSS1 cDNA was ligated to plant expression vectors under the control of the cauliflower mosaic virus promoter.
The Arabidopsis transformation used the pART7/pART27 vector system (30) in Agrobacterium, and transgenic plants were generated by
vacuum infiltration (31). For tobacco (Nicotiana tabacum), TaPSS1 was
cloned into the BamHI/XbaI site of pDH51 (32), and the resulting EcoRI
fragment that contained TaPSS1 with the cauliflower mosaic virus
promoter and terminator was cloned into the EcoRI site of the binary
vector pPLEX201-3 (33). Tobacco was then transformed with this vector
using Agrobacterium and co-cultivation of leaf explants (34). Control
plants were transformed with the vectors alone. For tobacco, seed (T1)
was collected from the primary transgenics (T0) and grown for analysis
of phospholipids and PSS activity. For Arabidopsis, kanamycin-resistant T1 plants were selected and segregating T2 lines were analyzed. In
both cases, TaPSS1 overexpressing lines could be easily identified in
the segregating lines on the basis of their phenotype.
Phospholipid and PSS AssaysYeast cultures (5 ml of LPM-galactose medium) at a starting A600 nm of 1.0 were labeled with KH232PO4
(0.74 MBq; Amersham Pharmacia Biotech) for 1 or 24 h. Phospholipids
were extracted from yeast cells using procedures described by Homann
et al. (35) and were separated by thin layer chromatography using
either a single dimension with chloroform:methanol:acetic acid:water
(32:4:5:1 by volume) as the solvent system or with a two-dimensional
procedure where chloroform:methanol:concentrated NH4OH:water (66:
27:3:0.9 by volume) was used for the first dimension and chloroform:
methanol:acetic acid:water (32:4:5:1 by volume) was used for the second
dimension. The identity of the various phospholipids was determined by
comparison to standard phospholipids (Sigma), and the thin layer chromatography plates were analyzed with a PhosphorImager system (Molecular Dynamics) to quantitate the 32P incorporated into the various
phospholipids. Yeast extracts were prepared and assayed for PSS activity according to Homann et al. (35).
Similar methods were used for the assay of phospholipids and PSS
activity in Arabidopsis seedlings. Seedlings (25-day-old) grown in hydroponic culture using previously described methods (36) were transferred to nutrient solution that contained 10 mM phosphate and 32P
(0.74 MBq; Amersham Pharmacia Biotech). Tissues (approximately 100
mg) were ground in CH3Cl:isopropyl alcohol (6:1) with a hand-held
homogenizer. Subsequent steps for phospholipid extraction were the

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

FIG. 1. The major biosynthetic pathways for PS in yeast (A)

and mammalian cells (B). The yeast enzymes that compete for the
common substrate CDP-diacylglycerol are also shown. The enzymes
catalyzing the various yeast reactions are as follows: arrow 1, CDPdiacylglycerol synthase; arrow 2, phosphatidylserine synthase (PSS);
arrow 3, phosphatidylinositol synthase; arrow 4, phosphatidylglycerophosphate synthase; arrow 5, phosphatidylglycerophosphate phosphatase. In mammalian cells two phosphatidylserine synthase enzymes,
with different substrate specificities, catalyze base-exchange reactions
(PSS-BE) from pre-existing phospholipids to synthesize PS.

7083

7084

Phosphatidylserine Synthase cDNA from Wheat

same as used for the yeast. Extracts for PSS assay were prepared by
grinding approximately 50 mg of tissue in 100 ml of extraction buffer,
centrifuged, and assayed according to Homann et al. (35).
Statistical analysis of the phospholipid composition in yeast and
Arabidopsis was complicated by the high variability between replicates
for the total 32P incorporated. Therefore the statistical analyses were
performed on the proportion of 32P appearing in each phospholipid
fraction. The data were transformed with the arcsine function to normalize the distribution and to minimize the variance between the
means. For each phospholipid a t test was used to compare the means
of the different genotypes.
RESULTS

Isolation of a Wheat cDNA That Encodes PSSA wheat

cDNA encoding PSS was isolated from a yeast expression library that was screened for cDNAs whose expression enhanced
aluminum resistance. After screening over 2 million yeast
transformants, eight cDNAs encoding six different genes were
found to confer aluminum resistance to the yeast strain InVSc2. Sequencing of these cDNAs identified one (TaPSS1)
whose predicted translation product showed sequence similarity to PSS from other organisms. Fig. 2 shows that the predicted protein encoded by the TaPSS1 open reading frame is
similar to PSS from S. cerevisiae (54% identity; GenBankTM
accession number D00171), Bacillus subtilis (23% identity;

GenBankTM accession number P39823), and Helicobacter pylori (22% identity; GenBankTM accession number AE000614).
TaPSS1 also showed 20 23% amino acid identity to putative
PSS proteins predicted from sequences present in the genomes
of Methanococcus jannaschii (GenBankTM accession number
U67562), Mycobacterium tuberculosis (GenBankTM accession
number Z84724), and Chlamydia trachomatis (GenBankTM accession number AE001355). The predicted wheat protein has
eight hydrophobic regions suggesting that it is a membranespanning protein. Unlike yeast PSS, the predicted TaPSS1
protein lacks an acidic N terminus sequence (Fig. 2). The presence of a stop codon 27 bases upstream and in frame with the
predicted translation start site of the TaPSS1 cDNA indicates
that there is not an alternative translation start site that could
account for the absence of the acidic N-terminal sequence and
also suggests that the cDNA is full length.
Northern blot analysis showed that TaPSS1 mRNA was
present at a low level in both wheat roots and shoots and that
its expression in roots increased in response to aluminum toxicity stress (Fig. 3A). Control plants where roots were not
exposed to aluminum for equivalent times did not show any
change in TaPSS1 expression. Southern blot analysis indicated
the presence of a small family of genes (310 bands per lane,

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

FIG. 2. Alignment of the predicted amino acid sequence encoded by the TaPSS1 open reading frame with the predicted
polypeptides encoded by PSS genes from yeast and bacteria. Sequences of PSS from yeast (S. cerevisiae; GenBankTM accession number
D00171) B. subtilis (GenBankTM accession number P39823) and H. pylori (GenBankTM accession number AE000614) were aligned with the
deduced amino acid sequence of TaPSS1. Identical amino acids are shown with dark shading, and similar amino acids are shown with light
shading.

Phosphatidylserine Synthase cDNA from Wheat

7085

FIG. 4. The wheat cDNA TaPSS1 complements the choline requirement of a yeast cho1 mutant. The cho1 mutant (cho1) was
derived from strain FY833 (wild type, WT) by PCR-generated disruption of the CHO1 gene. The growth of the cho1 mutant transformed
with either TaPSS1 in the vector (pTaPSS1) or the vector without
insert (pYES3) was assessed in the presence or absence of choline.

depending on the enzyme used) in the genome of hexaploid

wheat (Fig. 3B).
TaPSS1 Complements the Yeast cho1 MutantThe similarity of the protein encoded by the TaPSS1 open reading frame to
PSS from yeast and bacteria suggested that it encodes a plant
PSS. Yeast cho1 mutants are defective in PSS activity and
require exogenously supplied choline or ethanolamine for
growth (37, 38). A cho1 mutant was constructed by PCR-mediated disruption in the yeast strain FY833. Fig. 4 shows that
expression of the wheat TaPSS1 gene complemented the choline requirement of the cho1 mutant, demonstrating that
TaPSS1 encodes a functional plant PSS enzyme.
Overexpression of this cDNA conferred aluminum resistance
to another yeast strain (DBY747-a1) but did not confer aluminum resistance to strain FY833. Since overexpression of a
plant PSS conferred aluminum resistance to yeast, we also
determined whether altering the expression of the endogenous
yeast CHO1 gene, which encodes PSS, also altered aluminum
resistance. The cho1 disruption mutant in the FY833 genetic
background was indeed more sensitive to aluminum than the
corresponding wild type strain (data not shown). Conversely,
overexpression of yeast CHO1 conferred aluminum resistance
to the INVSc2 strain but not to the FY833 strain, as observed
for expression of TaPSS1 (data not shown).
Expression of TaPSS1 in Yeast Alters the Composition of
Phospholipids and Confers PSS Activity to a Yeast cho1 Mu-

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

FIG. 3. Northern and Southern blot analysis of wheat using

TaPSS1. A, Northern hybridization; each lane contains 10 mg of total
RNA from the tissues indicated. Probes were TaPSS1 (PSS) or the 26 S
rRNA gene (rRNA). Roots were treated with 10 mM aluminum for the
times indicated (in hours, see Snowden and Gardner (25)). The aluminum induction experiments were performed twice, and quantitation of
the transcript levels showed a 3.5-fold (experiment shown) and 5-fold
increase after 8 h exposure in two independent experiments. B, Southern hybridization; each lane contains 20 mg of wheat genomic DNA
cleaved with DraI (lane 1), SstI (lane 2), XbaI (lane 3), and AvaII (lane
4). The blot was probed with TaPSS1, and the final wash stringency
was 0.23 SSC at 65 C. kb, kilobase pairs; bp, base pairs.

tantFig. 5 shows that expression of the wheat TaPSS1 gene

changed the phospholipid profile of yeast strain InVSc2. Short
term 32P-labeling experiments (Fig. 5A) showed a large increase in abundance of label into PS primarily at the expense of
phosphatidylinositol (PI). Longer term 32P-labeling experiments (Fig. 5B) also showed increased PS biosynthesis at the
expense of PI, but the effects were less dramatic than in the
short term experiments. This difference was expected, since
short term experiments label phospholipid intermediates in the
various pathways, and the 32P in each phospholipid pool gives
an indication of the rate of biosynthesis. By contrast, longer
term 32P experiments more accurately reflect the steady state
phospholipid composition in yeast cells (38). In long term experiments expression of TaPSS1 increased the amount of PS
and PE and decreased the amount of PI, whereas the amount of
PC was unchanged (Fig. 5B). Similar results were obtained for
yeast strain FY833 (data not shown), which did not show enhanced aluminum resistance with expression of TaPSS1.
Overexpression of TaPSS1 in the yeast cho1 disruptant resulted in measurable PSS activity, to levels greater than those
obtained by overexpression of the yeast CHO1 gene (Table I).
PSS activity was undetectable in the disruption mutant transformed with the plasmid vector alone.
Overexpression of TaPSS1 in Plants Results in Increased
Accumulation of PS and Is Associated with Necrotic Lesions on
LeavesWhen TaPSS1 cDNA was overexpressed in Arabidopsis and tobacco under the control of the cauliflower mosaic
virus promoter, a number of transgenic plants showed changes
in morphology and necrotic lesions. Arabidopsis plants showing
the most severe phenotypes were stunted (Fig. 6D), and the
necrotic lesions on tobacco typically appeared as spots with
leaves being distorted and asymmetric (Fig. 6, B and C). Lesions and altered morphology were found in plants with the
highest level of TaPSS1 transcript (data not shown).
One of the Arabidopsis lines that showed a severe phenotype,
D244-24, was analyzed for its phospholipid composition by 32P
labeling. After 24 h labeling with 32P, the proportion of radiolabel into the various classes of major leaf phospholipids
showed a dramatic difference in D244-24 compared with wild
type Arabidopsis plants (Fig. 7A). The overexpression of
TaPSS1 resulted in an increase of 32P incorporation into PS
and a corresponding decrease of 32P incorporation into PI, as
found for yeast. In addition, there was a decrease in 32P found
in phosphatidylglycerol (PG) but an increase in labeled PC.
Phosphatidylglycerol, which is not a major phospholipid of
yeast cells, is a major phospholipid in leaves and is found in the
lamellae of chloroplasts (1). Similar results were found for PS
in roots (32P incorporated into PS as a percent of total phospholipids: control, 0.56 6 0.17; D244-24, 7.95 6 2.63, means 6

7086

Phosphatidylserine Synthase cDNA from Wheat

TABLE I
Phosphatidylserine synthase activity in yeast and plants transformed
with TaPSS1
Crude homogenates were prepared by disruption of cells with glass
beads (yeast) or by grinding leaf tissues with a hand-held homogenizer.
The homogenates were centrifuged at 500 3 g for 15 min, and the
supernatant solutions assayed for PSS activity.
Source of extract

PSS activity
nmol PS produced/mg protein/min

Yeasta cho1; pYES3

Yeast cho1; pTaPSS1
Yeast cho1; pCHO1
Yeast wild type
Arabidopsisb controlc
Arabidopsis D24424
Arabidopsis D2447
Arabidopsis D24415
Arabidopsis D24427
Tobacco control
Tobacco TaPSS1

Undetectable (n 5 3)
0.99 6 0.15 (n 5 4)
0.28 6 0.06 (n 5 4)
0.14 (n 5 1)
Undetectable (n 5 3)
0.43 6 0.11 (n 5 3)
0.01 6 0.0 (n 5 3)
0.43 6 0.04 (n 5 3)
0.32 6 0.07 (n 5 3)
0.01 6 0.00 (n 5 3)
1.23 6 0.50 (n 5 3)

FIG. 5. Composition of phospholipids labeled with 32P in INVSc2 yeast cells expressing TaPSS1 compared with vector
alone. Cells were labeled with 32P for 1 h (A) or 24 h (B) before they
were analyzed for phospholipid composition. The amount of 32P incorporated into the major phospholipids is expressed as a percent of the
total 32P incorporated into phospholipids. The means from four independent transformants for each plasmid are shown 6 S.E. and statistically significant differences in proportion of phospholipids between
plasmids are shown by * (p , 0.05) or **(p , 0.01). Analysis by
two-dimensional thin layer chromatography showed that phosphatidyldimethylethanolamine (PDE) comprised about 5% of the 32P incorporated into phosphatidyldimethylethanolamine (PDE) 1 PE.

S.E.).
We reasoned that, as in yeast cells, longer term labeling
would more accurately reflect the steady state composition of
plant phospholipids. Longer term 32P labeling (7 days) still
showed a much greater 32P incorporation into PS for the
TaPSS1 transgenic lines compared with control plants (Fig.
7B). As in the 24-h experiment, label incorporated into PI and
PG was reduced, although the effect was less pronounced than
in the short term experiment.
Phosphatidylserine synthase activity was readily detected in
crude homogenates prepared from leaves of Arabidopsis and
tobacco overexpressing TaPSS1 but was either undetectable or
very low for control plants that were transformed with the
vector alone (Table I). The levels of TaPSS1 expression activity
in different transgenic lines were related to the severity of the
phenotypes described above (data not shown).
DISCUSSION

Four lines of evidence support the conclusion that the wheat

TaPSS1 gene encodes a functional PSS enzyme as follows: (i)
there is homology between the protein encoded by TaPSS1 and
known PSS proteins from yeast and bacteria; (ii) TaPSS1 complements the yeast cho1 mutant; (iii) overexpression of TaPSS1

FIG. 6. Phenotypes of Arabidopsis and tobacco overexpressing

TaPSS1. A control tobacco seedling (A) and tobacco seedling overexpressing TaPSS1 (B) are shown on the upper panels. A mature tobacco
plant overexpressing TaPSS1 is shown in C. Arrows indicate necrotic
regions on the leaves. Transgenic Arabidopsis plants (D) expressing
TaPSS1 are shown with progressively more severe phenotypes from
right to left. The plant to the far right shows a similar phenotype to wild
type Arabidopsis.

in plants and in a disrupted cho1 mutant of yeast yields measurable PSS activity in both types of organisms; and (iv) overexpression of TaPSS1 in yeast and plants changes the phospholipid composition in both these organisms with an increase
in PS content being the most marked effect. Our cloning of a
functional plant PSS gene provides the first strong evidence for
the existence of PSS in higher eukaryotic cells. The role of PSS
in wheat could be primarily for PS biosynthesis; or alternatively, in some plant species or tissues, it may play a key role in
the biosynthesis of PC, as occurs in yeast.
Complementation of the yeast cho1 mutant provided strong
evidence for TaPSS1 gene function. The fact that there is a
single gene encoding PSS in the yeast genome (39) precludes
the possibility that TaPSS1 is enhancing endogenous PSS in
yeast by transactivation of another gene. A marked difference
between yeast PSS and wheat PSS is the absence of an acidic
N-terminal sequence in the wheat protein (Fig. 2). However,
overexpression of a truncated form of the yeast CHO1 gene that

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

a
Three to four independent transformants for each plasmid were
assayed.
b
Three plants from each line were assayed. The different numbers
following D244 represent independent transformation events. Seedlings (T1) that showed the same phenotype as the T0 generation were
assayed for PSS.
c
Control denotes plants transformed with vector alone.

Phosphatidylserine Synthase cDNA from Wheat

lacks sequence encoding the acidic N-terminal region of the

protein was also able to complement the cho1 mutant. The
truncated yeast gene produced less than one-tenth the amount
of active enzyme produced by the wild type gene, even though
comparable amounts of protein were produced by expression of
the genes (40). This lower activity was attributed to the truncated form not being correctly inserted into membranes. In our
case, the wheat TaPSS1 gene yielded even greater enzyme
activity than the wild type CHO1 gene when overexpressed in
yeast (Table I). The significance of the lack of an acidic domain
in the wheat enzyme is not known, but this does not appear to
limit its activity in yeast.
The plasma membrane is a primary barrier to the entry of
aluminum into cells. A change in its lipid composition could
conceivably alter the resistance of the cell by excluding aluminum, by altering the activity of specific membrane proteins
involved in confering aluminum resistance, or by altering the
response of the yeast cell to external stimuli. Aluminum ions
bind to phospholipids, and the binding affinity under acidic
conditions is greatest for anionic phospholipids such as PG and
PI (41). Several features of our results suggest further links
between phospholipids and aluminum resistance. The wheat
PSS transcript was induced in response to aluminum stress,
and overexpression of PSS activity increased aluminum resist-

ance in two strains of yeast, whereas deletion of the PSS gene

decreased aluminum resistance in a third strain. However, the
change in phospholipid composition in itself does not appear to
be sufficient to confer aluminum resistant to all yeast genotypes, since expression of TaPSS1 in strain FY833 did not
increase aluminum resistance despite similar changes in phospholipid composition as found for strain InVSc2. Preliminary
results also indicate that overexpression of TaPSS1 in tobacco
does not confer enhanced aluminum resistance.
In yeast, the major pathway for de novo PC biosynthesis is
through the conversion of CDP-diacylglycerol and L-serine to
PS (catalyzed by PSS) which is then converted sequentially to
PE and PC by the action of PS decarboxylase and methyltransferases (9). The increased PE synthesis seen in yeast cells
overexpressing PSS is consistent with this pathway since PS
decarboxylase should convert some of the excess PS to PE. The
observed increase in PS content at the expense of PI when
TaPSS1 is expressed (Fig. 5) is also consistent with PSS and PI
synthase competing for CDP-diacylglycerol as a common
substrate (Fig. 1A).
In plants the major pathway for PC biosynthesis is not well
defined, although much of the biochemical and physiological
evidence suggest that the CDP-choline pathway predominates
in some tissues (12, 15). The cloning of Brassica napus and
Arabidopsis cDNAs that encode CTP:phosphocholine cytidylyltransferase, the enzyme that catalyzes the rate-limiting step in
the conversion of choline to PC, provides support for the existence of this pathway (42, 43). Our cloning of a wheat cDNA that
encodes a functional PSS protein now provides evidence for the
existence of the yeast pathway for PS biosynthesis in wheat.
Overexpression of TaPSS1 in Arabidopsis increased PS biosynthesis at the expense of both PI and PG, consistent with PSS,
PI synthase, and PG-phosphate synthase competing for CDPdiacylglycerol as a common substrate (Fig. 1A). The rate of PC
synthesis was also increased in the TaPSS1-overexpressing
plants (Fig. 7, A and B), but PE synthesis did not increase. This
result contrasts with that found in yeast, where PE biosynthesis increased but PC was little affected in both short and long
term experiments. If the pathway to PC synthesis were the
same in the transgenic plants as in yeast, then one would
expect PE synthesis to be enhanced relative to PC because PE
is the direct precursor of PC in this pathway. One possible
explanation is that a base-exchange reaction of the type found
in mammalian cells (Fig. 1B; PSS-BEI) converts PS and free
choline directly to PC without proceeding through PE. The
increase in PC may be a consequence of the plant cells attempting to reduce the amount of PS accumulated in the TaPSS1
overexpressers or, alternatively, may represent an active pathway for PC biosynthesis in wild type plants that is further
enhanced in the transgenic plants.
As found in other organisms, PS is likely to be an essential
phospholipid for growth of plant cells. In contrast to yeast and
mammalian cells where PS can comprise up to 10% of the total
phospholipids, in plants PS is a minor component comprising
less than 2% of the total phospholipids found in leaves of many
species (1). Results from our long term 32P-labeling experiments (Figs. 5 and 7) are consistent with these values for
abundance of PS in yeast and plant cells. In mammalian cells
overexpressing a PSS-base exchange enzyme, PS biosynthesis
was greatly increased in vivo, but the steady state phospholipid
composition was unchanged (44). This lack of effect on phospholipid composition was attributed to compensatory changes
in activities of the pathways that synthesize and degrade PS to
maintain overall phospholipid homeostasis. Recently, Kuge et
al. (45) showed that PSS-base exchange I activity is regulated
by PS concentrations in the cell and that this can in itself

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

FIG. 7. Composition of phospholipids labeled with 32P in Arabidopsis D244-24 expressing TaPSS1 compared with control
plants. Plants were labeled with 32P for 24 h (A) or 7 days (B) before
they were analyzed for phospholipid composition. The amount of 32P
incorporated into the major phospholipids is expressed as a percent of
the total 32P incorporated into phospholipids. The means 6 S.E. of three
plants from line D244-24 and a line with vector alone are shown, and
statistically significant differences in proportion of phospholipids between lines are shown by * (p , 0.05) or **(p , 0.01).

7087

7088

Phosphatidylserine Synthase cDNA from Wheat

REFERENCES
1. Galliard, T. (1973) in Form and Function of Phospholipids (Ansell, G., Hawthorne, J., and Dawson, R., eds) pp. 253288, Elsevier Scientific Publisher
B.V., Amsterdam
2. Devaux, P. F. (1991) Biochemistry 30, 11631173
3. Schroit, A. J., and Zwaal, R. F. A. (1991) Biochim. Biophys. Acta 1071, 313329
4. Fadok, V. A., Voelker, D. R., Campbell, P. A., Cohen, J. J., Bratton, D. L., and
Henson, P. M. (1992) J. Immunol. 148, 22072216
5. Zhang, G., Gurtu, V., Kain, S. R., and Yan, G. (1997) BioTechniques 23,
525531
6. Nishizuka, Y. (1992) Science 258, 607 614
7. Fadok, V. A., Bratton, D. L., Frasch, S. C., Warner, M. L., and Henson, P. M.
(1998) Cell Death Differ. 5, 551562
8. OBrien, I. E. W., Baguley, B. C., Murray, B. G., Morris, B. A. M., and
Ferguson, I. B. (1998) Plant J. 13, 803 814
9. Carman, G. M., and Zeimetz, G. M. (1996) J. Biol. Chem. 271, 1329313296
10. Kuge, O., and Nishijima, M. (1997) Biochim. Biophys. Acta 1348, 151156
11. Dowhan, W. (1997) Annu. Rev. Biochem. 66, 199 232
12. Moore, T. S., Jr. (1982) Annu. Rev. Plant Physiol. 33, 235259
13. Moore Jr, T. S. (1975) Plant Physiol. (Bethesda) 56, 177180
14. Marshall, M. O., and Kates, M. (1974) Can. J. Biochem. 52, 469 482

15.
16.
17.
18.

19.
20.

21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.

34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.

Datko, A. H., and Mudd, S. H. (1988) Plant Physiol. (Bethesda) 88, 1338 1348
Kinney, A. J., and Moore, T. S., Jr. (1987) Plant Physiol. (Bethesda) 84, 78 81
Yamashita, S., and Nikawa, J. (1997) Biochim. Biophys. Acta 1348, 228 235
Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in Yeast Genetics: A
Laboratory Course Manual, pp. 177180, Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY
MacDiarmid, C. W., and Gardner, R. C. (1996) Plant Physiol. (Bethesda)112,
11011109
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual,2nd Ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY
Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A.
74, 54635467
Delhaize, E., Ryan, P. R., and Randall, P. J. (1993) Plant Physiol. (Bethesda)
103, 695702
Chandler, P. M., Higgins, T. J. V., Randall, P. J., and Spencer, D. (1983) Plant
Physiol. (Bethesda) 71, 4754
Gietz, R. D., Schiestl, R. H., Willems, A. R., and Woods, R. A. (1995) Yeast 11,
355360
Snowden, K. C., and Gardner, R. C. (1993) Plant Physiol. (Bethesda) 103,
855 861
Appels, R., and Dvorak, J. (1982) Theor. Appl. Genet. 63, 361365
Gish, W., and States, D. J. (1993) Nat. Genet. 3, 266 272
Doyle, J. J., and Doyle, J. L. (1990) Focus 12, 1315
Smith, F. W., Ealing, P. M., Hawkesford, M. J., and Clarkson, D. T. (1995)
Proc. Natl. Acad. Sci. U. S. A. 92, 93739377
Gleave, A. P. (1992) Plant Mol. Biol. 20, 12031207
Richardson, K., Fowler, S., Pullen, C., Skelton, C., Morris, B., and Putterill, J.
(1998) Aust. J. Plant Physiol. 25, 125130
Pietrzak, M., Shillito, R. D., Hohn, T., and Potrykus, I. (1986) Nucleic Acids
Res. 14, 58575868
Surin, B., Boevink, P., Keese, P., Chu, P., Larkin, P., Llewellyn, D., Kahn, R.,
Ellacott, G., and Waterhouse, P. (1998) Proceedings of the 4th Asia-Pacific
Conference on Agricultural Bio/Technology (Larkin, P. J., ed) pp. 121122,
Canberra UTC Publishing, Darwin
Horsch, R. B., Fry, J. E., Hoffman, N. L., Eichholtz, D., Rogers, S. G., and
Fraley, R. T. (1985) Science 227, 1229 1231
Homann, M. J., Poole, M. A., Gaynor, P. M., Ho, C.-T., and Carman, G. M.
(1987) J. Bacteriol. 169, 533539
Delhaize, E., and Randall, P. J. (1995) Plant Physiol. (Bethesda) 107, 207213
Atkinson, K. D., Jensen, B., Kolat, A. I., Storm, E. M., Henry, S. A., and Fogel,
S. (1980) J. Bacteriol. 141, 558 564
Atkinson, K., Fogel, S., and Henry, S. A. (1980) J. Biol. Chem. 255, 6653 6661
Letts, V. A., Klig, L. S., Bae-Lee, M., Carman, G. M., and Henry, S. A. (1983)
Proc. Natl. Acad. Sci. U. S. A. 80, 7279 7283
Sperka-Gottlieb, C., Fasch, E.-V., Kuchler, K., Bailis, A. M., Henry, S. A.,
Paltauf, F., and Kohlwein, S. D. (1990) Yeast 6, 331343
Jones, D. L., and Kochian, L. V. (1997) FEBS Lett. 400, 5157
Choi, S. B., Lee, K. W., and Cho, S. H. (1997) Mol. Cell.7, 58 63
Nishida, I., Swinhoe, R., Slabas, A. R., and Murata, N. (1996) Plant Mol. Biol.
31, 205211
Stone, S. J., Cui, Z., and Vance, J. E. (1998) J. Biol. Chem. 273, 72937302
Kuge, O., Hasegawa, K., Saito, K., and Nishijima, M. (1998) Proc. Natl. Acad.
Sci. U. S. A. 95, 4199 4203
Aussel, C., Pelasy, C., and Breittmayer, J. P. (1998) FEBS Lett. 431, 195199
Uchida, K., Emoto, K., Daleke, D. L., Inoue, K., and Umeda, M. (1998)
J. Biochem. (Tokyo) 123, 10731078

Downloaded from www.jbc.org at UAB/FAC. MEDICINA on October 13, 2007

account for a large part of the PS homeostasis. By contrast, our

results indicate that plant cells are unable to maintain phospholipid homeostasis when PSS activity is in excess since large
changes in overall phospholipid composition were seen. We
speculate that the necrotic lesions arise on plants expressing
TaPSS1 at high levels because of a large increase in abundance
of PS in membranes. This may have resulted in PS appearing
on the outer surface of the plasma membrane by saturating the
mechanisms that normally maintain phospholipid asymmetry
across the membrane. The appearance of PS on the outer
surface of cells is an early step in the apoptotic pathway, and in
mammalian cells increased biosynthesis of PS precedes the
appearance of PS on the outer surface of the plasma membrane
(46). Furthermore, external application of PS to Chinese hamster ovary cells can in itself trigger apoptosis, whereas other
phospholipids are not able to elicit this response (47).
In conclusion, we have isolated a wheat gene that encodes a
functional PSS enzyme. Overexpression of TaPSS1 in yeast
and plants alters the phospholipid composition of these organisms. Altering the expression of this gene in plants provides a
new tool for defining the pathways of phospholipid biosynthesis
and for understanding how these pathways are regulated. Altering the abundance of PS will also provide clues to the biological functions in plants of this minor, but potentially important, phospholipid.