Anda di halaman 1dari 2

I wish to have a promoter reporter assay with detection via luciferase

method.

Promotor region of CXCR4 (1100BP)

-1 GATCGCTTTAAACGTCTGACCCCCACCCCCACTCCGCCCCGCCCAGTTCTTCAACCTAAT

TTCTGATTCGTGCCAAAGCTTGTCCTCTGCTCAAAATCGTGGAAGACGCCGAGTATGGGG

ACCGAAGACCTGGGTTCAAGCCCGGCTTGGAATCCCTGCCCATCCCTGGCATTTCATCTC

TCCGGGCTTATTTGCTGGTTTCTCCGAATGCGGGCCTTGTCTGGTTCACGCTGGATCCCC

AACGCCTAGAACAGTGCGTGGCACGCAGTTCGTCCTTCTATAAATATCGGACTAAATGCA

TCTCTGTGATGGTAATACCCACACGGTGTTGTGAGAATGAATGAGTGATTCTGTGCAAGT

TCCTAGTGATCTGTTACAAAAAGTACTGGTCGCTAAATTACTCTTATAATAAAGCATACT

TTTAGGATAATAAAGCACTATTCGCGAATTGGTTACCGCTATTATGAAATTACTGAGCAA

TACATATCTACATCTGATCAGTCTCCAGAATTATGCCAAATCCTACCTTCTTCTGAAAGT

ATCTCCTAATTATCTGCACCTGACCCTAGTGATGCTGTGAATGTGCAAGTATAGCTACAT

CCTCCGAAGGAAGGATCTTTACTCCTTTTACCTCCTGAATGGGCTGCGTCTGCTGAAAGC

GCGGGGAATGGCGTTGGAAGCTTGGCCCTACTTCCAGCATTGCCGCCTACTGGTTGGGTT

ACTCCAGCAAGTCACTCCCCTTCCCTGGGCCTCAGTGTCTCTACTGTAGCATTCCCAGGT

CTGGAATTCCATCCACTTTAGCAAGGATGGACGCGCCACAGAGAGACGCGTTCCTAGCCC

GCGCTTCCCACCTGTCTTCAGGCGCATCCCGCTTCCCTCAAACTTAGGAAATGCCTCTGG

GAGGTCCTGTCCGGCTCCGGACTCACTACCGACCACCCGCAAACAGCAGGGTCCCCTGGG

CTTCCCAAGCCGCGCACCTCTCCGCCCCGCCCCTGCGCCCTCCTTCCTCGCGTCTGCCCC

TCTCCCCCACCCCGCCTTCTCCCTCCCCGCCCCAGCGGCGCATGCGCCGCGCTCGGAGCG

TGTTTTTATAAAAGTCCGGC
Highlight part is the binding site for STAT-3, I need a Point mutation at
this sequence to prevent stat-3 from binding to the promotor

-1 GATCGCTTTAAACGTCTGACCCCCACCCCCACTCCGCCCCGCCCAGTTCTTCAACCTAAT

TTCTGATTCGTGCCAAAGCTTGTCCTCTGCTCAAAATCGTGGAAGACGCCGAGTATGGGG

ACCGAAGACCTGGGTTCAAGCCCGGCTTGGAATCCCTGCCCATCCCTGGCATTTCATCTC

TCCGGGCTTATTTGCTGGTTTCTCCGAATGCGGGCCTTGTCTGGTTCACGCTGGATCCCC

AACGCCTAGAACAGTGCGTGGCACGCAGTTCGTCCTTCTATAAATATCGGACTAAATGCA

TCTCTGTGATGGTAATACCCACACGGTGTTGTGAGAATGAATGAGTGATTCTGTGCAAGT

TCCTAGTGATCTGTTACAAAAAGTACTGGTCGCTAAATTACTCTTATAATAAAGCATACT

TTTAGGATAATAAAGCACTATTCGCGAATTGGTTACCGCTATTATGAAATTACTGAGCAA

TACATATCTACATCTGATCAGTCTCCAGAATTATGCCAAATCCTACCTTCTTCTGAAAGT

ATCTCCTAATTATCTGCACCTGACCCTAGTGATGCTGTGAATGTGCAAGTATAGCTACAT

CCTCCGAAGGAAGGATCTTTACTCCTTTTACCTCCTGAATGGGCTGCGTCTGCTGAAAGC

GCGGGGAATGGCGTTGGAAGCTTGGCCCTACTTCCAGCATTGCCGCCTACTGGTTGGGTT

ACTCCAGCAAGTCACTCCCCTTCCCTGGGCCTCAGTGTCTCTACTGTAGCATTCCCAGGT

CTGGAATTCCATCCACTTTAGCAAGGATGGACGCGCCACAGAGAGACGCGTTCCTAGCCC

GCGCTTCCCACCTGTCTTCAGGCGCATCCCGCTTCCCTCAAACTTAGGAAATGCCTCTGG

GAGGTCCTGTCCGGCTCCGGACTCACTACCGACCACCCGCAAACAGCAGGGTCCCCTGGG

CTTCCCAAGCCGCGCACCTCTCCGCCCCGCCCCTGCGCCCTCCTTCCTCGCGTCTGCCCC

TCTCCCCCACCCCGCCTTCTCCCTCCCCGCCCCAGCGGCGCATGCGCCGCGCTCGGAGCG

TGTTTTTATAAAAGTCCGGC