Anda di halaman 1dari 5

SNTESIS DE PROTENAS EN EUCARIOTAS

Caractersticas generales
Cdigo gentico
Biomoleculas que participan en las diferentes etapas del proceso
(inclinacin, elongacin y terminacin)

Presentacin del tema: "SNTESIS DE PROTENAS Las


protenas son los productos finales de la informacin gentica.
Una clula necesita miles de protenas diferentes que deben
sintetizarse." Transcripcin de la presentacin:

1. 1 SNTESIS DE PROTENAS Las protenas son los productos finales de la


informacin gentica. Una clula necesita miles de protenas diferentes que deben
sintetizarse en respuesta a las necesidades celulares, ser transportadas a la
localizacin celular adecuada y degradarse cuando no se necesita su presencia

2. 2 SNTESIS DE PROTENAS Y CDIGO GENTICO En qu lugar se sintetizan


las protenas? Experiencias con aminocidos radioactivos determinaron que se
realizaba en los ribosomas Cmo se unen los aminocidos? Los aminocidos son
activados (ATP) antes de incorporarse al polipptido, unindose a un ARNt
especfico (complejo aminoacil-ARN) mediante aminoacil-ARNt-sintetasas
especficas

3. 3 SNTESIS DE PROTENAS Y CDIGO GENTICO Cmo se traduce el cdigo


de 4 letras (A, U, C, G) en aminocidos? Mediante el Cgigo Gentico, que es
prcticamente universal

4. 4 SNTESIS DE PROTENAS Y CDIGO GENTICO Cada triplete de bases o


codn representa a un aminocido o indica el final de la cadena. Los codones no
estn separados, sino contiguos, por lo que la secuencia de una protena est
definida por una secuencia lineal de codones contiguos.

5. 5 CDIGO GENTICO: Marcos de Lectura El primer codn de la secuencia


establece el marco de lectura, en el que empieza un nuevo codn cada tres
residuos nucleotdicos. En este esquema existen tres marcos de lectura posibles
AAUCCGGACUUACGUUAACGGUACAGUAC (1er. marco)
AAUCCGGACUUACGUUAACGGUACAGUAC (2do. marco)
AAUCCGGACUUACGUUAACGGUACAGUAC (3er. marco) Asparagina-Prolina-
Asprtico Isoleucina-Arginina-Treonina Serina-Glicina-Leucina Una vez establecido
el marco de lectura, los codones se traducen ordenadamente sin solapamiento ni
puntuacin hasta que se encuentra un codn de terminacin. Los otros dos marcos
de lectura posibles dentro de un gen normalmente no contienen informacin
gentica til, pero hay excepciones. En algunos virus la misma secuencia produce
dos protenas distintas al utilizar diferentes marcos de lectura.

6. 6 SNTESIS DE PROTENAS: Ribosomas y ARNt Los ribosomas bacterianos


estn formados por dos subunidades: una mayor (50S) y una menor (30S). Los
ribosomas de clulas eucariotas tienen tambin dos subunidades pero con
tamaos ligeramente mayores (60S y 40S)

7. 7 SNTESIS DE PROTENAS: Ribosomas y ARNt Los ARNt tienen entre 73 y 93


residuos nucleotdicos. Como mnimo cada ARNt tiene ocho bases modificadas,
muchas de las cuales son derivados metilados de las bases principales Hay al
menos un ARNt para cada aminocido, pero para algunos aminocidos se requiere
ms de un ARNt El bucle (o brazo) de la izquierda reconoce su lugar en el
ribosoma. El de la derecha opera en el reconocimiento de la aminoacil- ARNt
sintetasa correspondiente. El anticodn reconoce la ubicacin del ARNt en el ARN
m.

8. 8 SNTESIS DE PROTENAS: Fases de la Traduccin La sntesis de polipptidos


empieza siempre en el extremo amino (NH2) y progresa en el sentido de la sntesis
hacia el extremo carboxilo (CO.OH). Este patrn se ha confirmado en numerosos
experimentos y es vlido para todas las sntesis en todas las clulas

9. 9 Etapas de la Sntesis de Protenas: Inicio La fijacin de un factor de inicio a la


subunidad meno impide que las dos subunidades se unan prematuramente. Luego
se fija el ARNm a la subunidad menor, de modo que el codn de inicio (AUG, que
codifica para formil metionina) se une en un lugar preciso, porque del lado 5 del
ARNm, a pares de bases hay una secuencia que se unir con la secuencia
complementaria del ARNr de la subunidad ribosmica menor. Luego de unido el
ARNt que transporta a la fMet se fija la subunidad ribosmica mayor.

10. 10 Etapas de la Sntesis de Protenas: Elongacin El aminoacil-ARNt que


transporta el segundo aminocido (Val) se ubica en el sitio A y luego se forma el
primer enlace peptdico entre la fMet (unida al sitio P) y la Val del sitio A. Esta
reaccin produce un dipeptidil-ARNt en el sitio A y un ARNt descargado en el sitio
P. El siguiente paso es la translocacin: el ribosoma se desplaza un codn hacia el
extremo 3, que provoca el traslado del dipeptidil-ARNt al sitio P, dejando el A libre
para la ubicacin del siguiente aminocido (Phe). Simultneamente el ARNt
desacilado (el que estaba unido a la fMet) se desprende del sitio P, volviendo al
citosol.

11. 11 Etapas de la Sntesis de Protenas: Terminacin La cuarta fase de la sntesis


peptdica est determinada por la presencia de uno de los tres codones de
terminacin del ARNm (UAA, UAG o UGA), que desencadenan los siguientes
procesos sucesivos: (1) la hidrlisis del enlace peptidil-ARN terminal, (2) la
liberacin del polipptido terminado y (3) la disociacin de las dos subunidades
ribosmicas, preparando la iniciacin de un nuevo ciclo de sntesis polipeptdica.

12. 12 SNTESIS DE PROTENAS: Esquema de la Traduccin Los ARNt reconocen


codones mediante apareamiento de bases entre el codn del ARNm y una
secuencia de tres bases de ARNt denominada anticodn. Los dos ARN se aparean
de forma antiparalela, aparendose la primera base del codn (siempre leda en
direccin 5 3) con la tercera base del anticodn.

13. 13 SNTESIS DE PROTENAS: Esquema de la Traduccin

14. 14 SNTESIS DE PROTENAS: Eficiencia de la Traduccin Tanto a partir de


clulas procariticas como eucariticas se pueden aislar grandes agrupamientos
de 10 a 100 ribosomas unidos a la misma molcula de ARNm, denominados
polisomas o polirribosomas, que representan diferentes estadios de la traduccin
de la seal contenida en el ARNm, que es traducida simultneamente por muchos
ribosomas prximos unos a otros, lo que permite una utilizacin muy eficiente del
ARNm.

15. 15 Modificaciones Postraduccionales Prdida de secuencias seal. Pptidos


cortos (15 a 30 aminocidos) que dirigen a la protena hacia su destino final. Son
eliminados por proteasas durante la sntesis en el RER Modificaciones N- y C-
terminales. Todos los polipptidos empiezan con f Met (procariotas) o Met
(eucariotas), pero en la mayora de los casos son eliminados. Un 50% de las
protenas eucariticas tienen el extremo N-terminal acetilado. Los residuos C-
terminales son modificados con menor frecuencia. Modificacin de amino- cidos.
Los grupos -OH de Ser, Tre y Tyr pueden ser fosforilados. El carboxilo de Asp y Glu
pueden formar amidas (Asn y Gln). Lys es frecuentemente metilada o hidroxilada,
como Pro, en la formacin del colgeno.

16. 16 Modificaciones Postraduccionales Modificacin proteoltica. La insulina, las


proteasas pepsina, tripsina y quimotripsina y el colgeno se sintetizan como
precursores inactivos (proinsulina, pepsingeno, tripsingeno, quimotripsingeno y
protocolgeno, respectivamente) que luego deben ser hidrolizados parcialmente
para convertirse en productos biolgicamente activos. Formacin de puentes
disulfuro. Pueden ser intra- o intercatenarias y se supone que ayudan a las
protenas que deben ser exportadas a mantener su estructura nativa. Proinsulina
Insulina

17. 17 Retculo Endoplsmico liso (REL) Es el principal sitio de metabolismo de los


lpidos. Realiza tambin una funcin importante al localizar enzimas
desintoxicantes que degradan sustancias qumicas txicas o carcinognicas y las
conviertan en molculas solubles fcilmente excretables por el organismo. Algunas
lneas celulares, como las clulas del hgado, contienen grandes cantidades de
REL. En otras clulas del cuerpo el REL llega a ser un componente menor. El REL
de los hepatocitos est tambin involucrado en la hidrlisis enzimtica de
glucgeno, que se almacena en grnulos asociados al REL

18. 18 Retculo Endoplsmico Rugoso (RER) El RER juega un papel central en la


sntesis de las protenas de sus propias membranas y en la sntesis de protenas
de otras membranas. Muchas de las protenas que la clula exporta (como las
enzimas digestivas o las hormonas proteicas) o aquellas destinadas a otros
organelos o a la propia membrana plasmtica se forman en los ribosomas unidos a
la membrana del RER

19. 19 Aparato de Golgi Muchas de las protenas secretadas por las clulas, as como
las que se integran a la membrana plasmtica y las que son dirigidas a otros
organelos del sistema endomembranoso, pasan a travs del aparato de Golgi.
Despus que estas protenas son sintetizadas por ribosomas unidos al RER se
transportan al aparato de Golgi mediante vesculas de transporte formadas en la
membrana del RER
20. 20 Lisosomas Pequeos sacos que contienen enzimas digestivas que degradan
lpidos, protenas, carbohidratos y cidos nucleicos, originados dentro y fuera de la
clula. Contienen cerca de 40 enzimas diferentes, todas hidrolasas activas a pH 5
(proteasas, lipasas, fosfolipasas, glicosidasas, fosfatasas, sulfatasas, nucleasas).
Se sintetizan en el RER y son luego modificadas en el aparato de Golgi.

21. 21 Aspecto de un proteasoma caracterstico. Consiste en un ncleo de forma


tubular, con dos partculas ubicadas en cada extremo, como formando un gorro.
Proteasomas La mayora de las protenas que se degradan en el citosol de las
clulas eucariticas lo hacen a travs de grandes complejos de enzimas
proteolticas denominados proteasomas.