Clinical Nutrition xxx (2015) 1e7

Contents lists available at ScienceDirect

Clinical Nutrition
journal homepage: http://www.elsevier.com/locate/clnu

Original article

Enterally delivered dipeptides improve small intestinal inammatory

status in a piglet model of intestinal resection*
Matthew G. Nosworthy, M. Elaine Dodge, Robert F. Bertolo, Janet A. Brunton*
Department of Biochemistry, Memorial University of Newfoundland, St. John's, NL, Canada A1B 3X9

a r t i c l e i n f o s u m m a r y

Article history: PepT1, a di/tripeptide transporter, is preferentially preserved over free amino acid transporters in situ-
Received 8 September 2014 ations of gut stress. Therefore, our objective was to determine the impact of enterally delivered
Accepted 24 May 2015 dipeptide-containing diets on indices of intestinal adaptation in neonatal piglets after intestinal
resection.
Keywords: Methods: Piglets (n 25, 10 1 d old) underwent an 80% jejuno-ileal resection and were provided 50% of
PepT1
nutritional support as TPN, and 50% as one of ve, enteral test diets: 1) a control diet containing free
Piglet
amino acids, or the same diet but with equimolar amounts of free amino acids replaced by 2) alanyl-
Intestinal resection
Dipeptide
alanine, 3) alanyl-glutamine, 4) cysteinyl-glycine, or 5) both alanyl-alanine and cysteinyl-glycine. After
Inammation 4 d of enteral feeding, indices of intestinal adaptation were assessed. Outcome measures included plasma
Enteral nutrition and mucosal amino acid concentrations, morphological and histological parameters, protein synthesis,
PepT1 mRNA and protein expression, and mucosal cytokine concentrations.
Results: Intestinal length, organ weight and protein synthesis rates were not different amongst groups.
All of the dipeptide-containing diets reduced pro-inammatory cytokine concentrations in the mucosa
(TNF-a, IFN-g). The cysteinyl-glycine diet supported greater villus height compared to all other di-
peptides and greater crypt depth compared to alanyl-glutamine; however, none of the dipeptide diets
altered intestinal morphology compared to the free amino acid control diet.
Conclusions: This study showed that while there was no explicit morphological benet of enteral di-
peptides over their constituent free amino acids, there was the potential for the amelioration of intestinal
inammation by reducing pro-inammatory cytokines. Enteral provision of dipeptides impacted intes-
tinal adaptation, but the response was dipeptide-specic.
2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

1. Introduction is maintained or increased, in contrast to other nutrient trans-

Peptide transporter 1 (PepT1) is responsible for absorption of
small peptides, two or three residues, from the lumen of the small
intestine. Evidence suggests that PepT1 population and/or activity
can be altered by manipulating the nutritional status or health of
the animal [1]. In situations of gut stress such as malnutrition,
fasting, intestinal failure or surgical intervention, PepT1 expression
Abbreviations: PepT1, peptide transporter 1 (SLC15A1); CysGly, cysteinyl-
glycine; AlaGln, alanyl-glutamine; AlaAla, alanyl-alanine.
*
Conference Presentation: Presented at Experimental Biology 2011,
Washington DC, USA.
* Corresponding author. Tel.: 1 709 864 8533; fax: 1 709 864 2422.
E-mail addresses: mnosworthy@mun.ca (M.G. Nosworthy), edodge@mun.ca
(M.E. Dodge), rbertolo@mun.ca (R.F. Bertolo), jbrunton@mun.ca (J.A. Brunton).
porters which typically decline in number [2e4]. In addition to
being preserved during gut stress, PepT1 expression is also sub-
strate driven [5e7]. When the uptake of dietary protein is
compromised due to intestinal injury, such as inammation or
surgery, it may be advantageous to provide small peptides, rather
than free amino acids, in the diet to stimulate PepT1 at the brush
border and exploit its capacity for nitrogen transport.
Short bowel syndrome (SBS) is a clinical condition induced
through the surgical removal of intestinal tissue. Causes for intes-
tinal resection are varied, and include vascular emergencies such as
bowel ischemia, inammatory disorders such as Crohn's disease
and ulcerative colitis, tumors, physical trauma and infection such as
necrotizing enterocolitis (NEC) [8,9]. NEC is an aggressive, anaer-
obic infection that develops rapidly in the gastrointestinal tract in
approximately 10% of all very low birth weight infants, with up to a

http://dx.doi.org/10.1016/j.clnu.2015.05.013
0261-5614/ 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
2 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7
34% mortality rate in the lowest birth weight category [10]. Intes-
tinal resection results in a dramatic loss of absorptive capacity [11]
leading to a requirement for long term parenteral nutrition (PN).
A recent study from our laboratory in a piglet model of SBS
demonstrated that enteral feeding of an elemental diet (EN), in
combination with PN, induced intestinal adaptation including
greater cell mass and intestinal length compared to PN alone [12].
Due to the substrate driven expression of PepT1, we hypothesized
that providing enteral amino acids as peptides may stimulate the
up-regulation of PepT1, leading to greater amino acid transport
potential.
Certain amino acids such as glutamine and cysteine are involved
in intestinal barrier function and the regulation of oxidative stress.
Glutamine may be necessary for the localization of tight junction
proteins, thereby linking glutamine directly to intestinal integrity
[13]. Decline in the B0 transporter after surgical resection [2] may
prevent adequate absorption of glutamine, which could interfere
with the maintenance of the intestinal barrier. With PepT1 poten-
tially up-regulated following surgery, and single amino acid
transporters possibly depressed, the provision of enteral glutamine
as a dipeptide may be particularly advantageous to the remaining
intestine.
Cysteine is a conditionally essential amino acid and has been
linked to increased cellular proliferation of intestinal cells [14,15].
Cysteine is also one of the amino acid residues in glutathione (g-
Glu-Cys-Gly, GSH) and contributes to controlling cellular redox
states in the gut [16,17]. Humans with inammatory bowel disor-
ders requiring surgical resection have compromised redox status
[18]. Inclusion of cysteine-containing peptides in enteral diets may
enhance cysteine availability and increase the generation of GSH,
leading to improved recovery and intestinal adaptation.
In this study, we utilized a Yucatan miniature piglet model of
intestinal adaptation [12] to investigate the potential benets of
alanyl-glutamine and cysteinyl-glycine when provided enterally to
piglets with an 80% proximal resection of the small intestine.
2. Materials and methods
2.1. Surgical procedures
Twenty-ve (25) Yucatan miniature piglets, 10e12 days of age
(Animal Care Services, Memorial University of Newfoundland,
Newfoundland and Labrador, Canada) were randomized to one of
ve experimental groups. The study was approved by the Institu-
tional Animal Care Committee and followed the guidelines of the
Canadian Council of Animal Care. An intramuscular injection of
ketamine hydrochloride (22 mg/kg; Bimeda Canada, Ontario, Can-
ada) and acepromazine (0.5 mg/kg; Vetoquinol Canada Inc.,
Quebec, Canada) was used to induce anesthesia. After atropine
sulfate injection (0.05 mg/kg; Rafter Dex, Canada), the piglets were
intubated. Anesthesia was maintained with 1.0e1.5% isourane
(Abbott Laboratories Ltd., Quebec, Canada) and oxygen at a ow
rate of 1.5 L/min. Two venous catheters were implanted; one
catheter was introduced into the left femoral vein and advanced to
the inferior vena cava just caudal to the heart. A second catheter
was placed into the left external jugular vein and advanced to the
superior vena cava just cranial to the heart. The femoral catheter
was used for blood sampling and drug delivery, while the jugular
was used to deliver parenteral nutrition. Subsequently, a laparot-
omy was conducted and approximately 80% of the proximal small
intestine (SI) was resected. 100 cm of the distal ileum proximal to
the ileocecal valve was left in situ. The length of intestine left intact
was identied by locating the ileocecal valve and following the
ileum proximally for 100 cm using a pre-measured string. The in-
testine proximal to the 100 cm mark was removed via
Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
electrocautery. Continuity of the small intestine was restored by
end-to-end anastomosis. Finally, a gastric catheter was implanted
to facilitate infusion of the enteral diets. A purse string suture was
placed in the body of the stomach and an incision was made in the
center of the area delineated by the suture. The gastric catheter was
then inserted into the stomach through this incision and secured by
the tightening of the purse string suture; subsequently, a second
purse string suture was added that encompassed both the initial
suture and the catheter.
Post-surgery, piglets were given intravenous antibiotics (20 mg
trimethoprim and 100 mg sulfadoxine; Borgal, Intervet Canada Ltd.,
Ontario, Canada) and analgesic (0.03 mg/kg buprenorphine hy-
drochloride; Temgesic, Ontario, Canada). The intravenous and
gastric catheters were secured by placing the piglets in jackets that
attached to a tether-swivel system with dual-infusion ports (Lomir
Biomedical, Quebec, Canada). This facilitated continuous infusion of
both I.V. and enteral diets. Piglets were individually housed in
metabolic cages (circular, 1 m diameter), and each had aural and
visual contact with other piglets, and toys were provided for
enrichment. The room temperature was between 23  C and 28  C,
but piglets were also provided with heat lamps. Borgal was given
daily and analgesic every 12 h for the rst 3 days postoperatively.
Blood was sampled daily, the plasma collected and stored at 80  C.
Piglet weights were measured daily beginning 48 h after surgery.
2.2. Parenteral/enteral diets
Following surgery, parenteral nutrition was infused into the
jugular vein at half the rate of the targeted intake. The rate of
infusion was advanced to 75% on the rst morning after surgery,
and then to full rate by the end of day 1 (13.5 mL kg1 d1). The
complete parenteral solution provided 1.1 MJ of metabolizable
energy$kg1 d1. Glucose (24.5 g kg1 d1) and lipid (20% Intralipid,
Pharmacia, Stockholm, Sweden) each supplied half of the non-
protein energy. Protein, supplied as free amino acids, were pro-
vided at 15 g kg1 d1. The amino acid composition was (per gram
of L-amino acids): ala, 107 mg; arg, 67 mg; asp, 61 mg; cys, 14 mg;
glu, 105 mg; gly, 27 mg; his, 31 mg; iso, 46 mg; leu, 104 mg; lys-HCl,
102 mg; met, 19 mg; phe, 55 mg; pro, 83 mg; ser, 56 mg; tau, 5 mg;
thr, 41 mg; trp, 21 mg; tyr, 8 mg; and val, 53 mg. Vitamins (Multi-
12K1 Pediatric, Quebec, Canada), trace minerals (at 200% of NRC
recommendations [19]), lipid, and iron dextran (Fe, 3.0 mg/kg;
Vetoquinol Canada Inc., Quebec, Canada) were added to the diets
immediate before use. On day 2, the resolution of ileus was tested
for by introducing a 10-mL bolus of the parenteral diet via the
gastric catheter. The volume of the stomach contents was measured
after 2 h. Gastric emptying was conrmed by the inability to
retrieve the dietary bolus from the stomach. Once gastric emptying
was evident, then enteral feeding was initiated on the following
day, increased over the subsequent 24 h to achieve 50% of total
nutritional intake, and maintained for an additional 3 days. The
balance of nutrients was provided as parenteral nutrition; all pig-
lets received the same parenteral formulation as described above.
Nutritional support (I.V. and enteral) was provided continuously
(24 h/d) via peristaltic pumps.
The piglets were randomized to one of 5 experimental enteral
diets (n 5 per group). The experimental diets were based on the
elemental diet used for parenteral nutrition, with nitrogen pro-
vided as free L-amino acids, except for dipeptide treatments
(described below). Also, the parenteral formula contained gluta-
mate, whereas in the enteral diet, glutamate was replaced with free
glutamine or glutamine-dipeptide. Specically, the enteral test
formulations were: 1) free amino acids as a control diet (Control),
or the equimolar replacement of free amino acids with the
following dipeptides (Bachem, California, USA); 2) alanyl-alanine
 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7 3

(AlaAla), 3) alanyl-glutamine (AlaGln), 4) cysteinyl-glycine (CysGly) 2.5. Real-time RT-PCR

or 5) the combination of alanyl-glutamine and cysteinyl-glycine
(AlaGln CysGly). All enteral diets were isonitrogenous. The
amino acid composition of the enteral diets is given in Table 1.
Necropsy of all piglets occurred four days after the initiation of
enteral feeding. Four hours prior to the initiation of necropsy, BrdU
was provided intravenously to investigate crypt cell proliferation. A
ooding dose of 3H-phenylalanine was also provided via the
femoral catheter, 30 min after which the piglets were anesthetized,
and samples of liver and mucosa from the remnant intestine were
taken for analysis of rates of protein synthesis [20].
2.3. Histological analyses
Sections of intestine were xed in 10% buffered formalin (Fisher
Scientic, Pennsylvania, USA), processed and stained with hema-
toxylin and eosin (Fisher Scientic, Pennsylvania, USA) as previ-
ously described [12]. Ten measurements of villus height and crypt
depth were measured in a blinded manner by a single investigator
(MGN) using a Zeiss Axiostar microscope (Carl Zeiss Toronto,
Ontario, Canada). Images were captured with an Innity 1 camera
and Innity Analyze software (Lumenera Corporation, Ontario,
Canada). Immunohistologic analyses were conducted to determine
the incorporation of BrdU into proliferating cells within the intes-
tinal crypts with visualization based on DAB substrate (Vector
Laboratories, Ontario, Canada).
Proliferation was expressed as the percentage of total crypt cells
that were labeled with BrdU (10 crypts per animal).
PepT1 mRNA was measured in mucosa sampled from the
remnant intestine. RNA was extracted using the Qiagen RNEasy
Mini kit (Qiagen Inc., Quebec, Canada) according to the manufac-
turer's protocol. Concentration, purity and integrity were deter-
mined using the Agilent 2100 Bioanalyzer and the Agilent
Eukaryotic Total RNA Nano Kit (Agilent Technologies, Ontario,
Canada). cDNA was created according to the protocol outlined in
the QuantiTect (Qiagen Inc., Quebec, Canada) reverse transcriptase
manual. 800 ng of total RNA was used in the reverse transcription
reaction. Roche Faststart DNA master Sybr Green I kit (Roche,
Quebec, Canada) was used for the qPCR reaction. The sequences of
the primers were as follows: PepT1 forward primer 50
d CTGGAGTTCTCCTATTCTCA 30 , reverse primer 50 d AACAGC-
CACGGTCAACAG 3; b-actin was used as an internal control with
the following sequences: forward primer 50 d CCCAGCACGAT-
GAAGA 30 , reverse primer 50 d CGATCCACACGGAGTC 3. The
accession numbers for the template sequences were AY180903.1
for PepT1 [23] and AY550069 for b-actin. The qPCR instrument
(Mastercycler, Eppendorf, Ontario, Canada) was set to the following
conditions: 10 min at 95  C, 40 cycles of 15 s at 95  C and 15 at
58  C, and 63  C incubation for 15 s. Reaction efciency for PepT1
was 0.87 0.04 and b-actin reaction efciency was 0.89 0.04.
Samples were repeated in duplicate and analyzed using the 2ddCt
method [24].
2.6. PepT1 protein analysis

2.6.1. Brush border membrane vesicle (BBMV) preparation

2.4. Protein synthesis and tissue/plasma amino acid determination
Brush border membrane vesicles were isolated from mucosal
scrapings. Briey, tissues were homogenized in 100 mM mannitol,
Amino acid concentrations in plasma and tissue samples were
2 mM HEPES/Tris pH 7.1 and 0.1 mM PMSF. 2 mL of homogenate
analyzed using PITC derivatization [21] with norleucine as the in-
was used for protein and marker enzyme analysis; the remaining
ternal standard. Specic radioactivity of the tissue free phenylala-
sample was centrifuged at 500  g for 12 min. Then, 1 M MgCl2 was
nine and the protein-bound phenylalanine was determined as
added to the supernatant to a nal concentration of 10 mM; this
described previously [22]. In brief, phenylalanine fractions were
solution was incubated on ice for 20 min prior to centrifugation at
isolated using reverse-phase HPLC combined with fraction collec-
3000  g for 15 min. The supernatant was collected and centri-
tion. The radioactivity associated with these fractions was deter-
fuged at 30,000  g for 30 min. The pellet was then resuspended in
mined by scintillation counting.
20 mL of 100 mM mannitol, 2 mM HEPES/Tris pH 7.4 and 1 mM
MgSO4 and centrifuged at 30,000  g for 30 min to isolate BBMVs.
The nal pellet was resuspended in 300 mM mannitol, 20 mM
Table 1
HEPES/Tris pH 7.4 and 0.1 mM MgSO4 (400 mL/g wet tissue) and
Amino acid composition of the enteral diets (g/L).
stored at 80  C. BBMVs were analyzed for sucrase activity as
Amino acid Control AlaAla AlaGln CysGly AlaGln CysGly previously described [25].
Alanine 4.40 0 1.03 4.40 1.03
Arginine 3.59 3.59 3.59 3.59 3.59
Aspartate 3.27 3.27 3.27 3.27 3.27 2.6.2. Western Blot
Cysteine 1.10 1.10 1.10 0 0 BBMVs were analyzed for protein content using the BCA
Glutamate 0 0 0 0 0 protein assay (Pierce Chemicals, Illinois, USA). Equivalent
Glutamine 5.50 5.50 0 5.50 0
amounts of protein (50 mg) were electrophoresed on 8% SDS-
Glycine 1.47 1.47 1.47 0.80 0.80
Histidine 1.67 1.67 1.67 1.67 1.67 polyacrylamide gels. After transfer to nitrocellulose membrane,
Isoleucine 2.48 2.48 2.48 2.48 2.48 blots were stained with Ponceau Red (SigmaeAldrich, Ontario,
Leucine 5.61 5.61 5.61 5.61 5.61 Canada) to assess the equivalency of protein loading. Blots were
Lysine 5.58 5.58 5.58 5.58 5.58 blocked in 3% milk-TBST (Tris-buffered saline and Tween 20 at
Methionine 1.04 1.04 1.04 1.04 1.04
Phenylalanine 2.95 2.95 2.95 2.95 2.95
0.2% v/v) for 45 min at room temperature and incubated with
Proline 4.46 4.46 4.46 4.46 4.46 primary antibodies overnight at 4  C. Primary antibodies used
Serine 5.19 5.19 5.19 5.19 5.19 were PepT1 (1:600, gift provided by E.A. Wong, Virginia Tech),
Taurine 0.24 0.24 0.24 0.24 0.24 and b-actin (1:600 SigmaeAldrich, Ontario, Canada). Blots were
Threonine 2.18 2.18 2.18 2.18 2.18
visualized using the Immun-Star Western C Kit (Bio Rad,
Tryptophan 1.14 1.14 1.14 1.14 1.14
Tyrosine 0.42 0.42 0.42 0.42 0.42 Quebec, Canada) and images obtained using a Gel Documenta-
Valine 2.86 2.86 2.86 2.86 2.86 tion System (Alpha Innotech, California, USA). Band intensity
Alanyl-alanine 0 4.40 0 0 0 was analyzed using AlphaVIEW SA (ProteinSimple, Ontario,
Alanyl-glutamine 0 0 8.87 0 8.87 Canada) and PepT1 expression was assessed relative to b-actin
Cysteinyl-glycine 0 0 0 1.77 1.77
for each sample.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
4 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7

2.7. Tissue and plasma glutathione 3.2. Histology

Plasma and mucosal concentrations of reduced and total
glutathione were measured using the Biovision Glutathione assay
kit (Biovision, California, USA) according to their protocol.
2.8. TNF-a/IFN-g
Mucosal TNF-a and IFN-g concentrations were determined us-
ing porcine ELISA kits (Pierce, Illinois, USA). Tissue supernatants
were prepared by homogenizing tissue in PBS containing Protease
Inhibitor Cocktail III (Calbiochem, California, USA) and 1 mM PMSF
(Sigma, Ontario, Canada). Homogenates were centrifuged at
>10,000  g to allow for analysis of tissue supernatants according
to the protocol provided by the supplier. Linear regression was used
to calculate the nal concentration of cytokine in the supernatant
which was reported as concentration per gram of mucosa.
2.9. Statistics
The results were expressed as mean standard deviation for
each group. Data were analyzed by one-way ANOVA with Bonfer-
roni's protected means separation test; variances were shown to be
equal through the application of Bartlett's test for equal variances.
Sample size was n 5 piglets per dietary treatment and differences
were noted as signicant if P < 0.05 (GraphPad Prism 4.0, California,
USA).
Although villus height for the CysGly group was similar to
control treatments, it was signicantly greater than all other
dipeptide groups (P < 0.05) (Fig. 1). Enteral CysGly also resulted in
signicantly greater crypt depth when compared to AlaGln
(P < 0.05) (Fig. 1). Provision of enteral dipeptides did not alter
cellular proliferation, as determined by BrdU incorporation (data
not shown).
3.3. GSH, TNF-a and IFN-g
Total and reduced glutathione was quantied in both plasma
and mucosal tissue with no signicant differences among treat-
ments (data not shown). The inclusion of AlaGln or CysGly in the
enteral diets signicantly reduced the concentration of IFN-g to less
than 40% of control (P < 0.05) (Fig. 2a). The inclusion of any of the
dipeptides in the diets resulted in a dramatic reduction in TNF-a, to
less than 27% of control (P < 0.01) (Fig. 2b).
3.4. PepT1 mRNA/protein
Samples of mucosa taken from the remnant intestine were used
to determine PepT1 mRNA and protein concentration. No signi-
cant difference was found in PepT1 protein or mRNA among dietary
treatments (data not shown).
4. Discussion

In a previous study, we demonstrated that early provision of an

3. Results
3.1. Morphologic measurements
Final body weights were not different amongst treatment
groups (Table 2). Also, there were no differences in weight gain per
kg per day (determined for the period after initiation of EN), or in
the percentage increase in body weight (Table 2). Total liver and
kidney weights were also not different among treatment groups
(Table 2). No signicant differences were observed in plasma amino
acid concentrations among treatment groups (data not shown).
Protein synthesis rates in the liver and intestinal mucosa were also
similar among dietary treatments (Table 2). The length of the
remnant intestine increased by more than 70% in all groups after
one week of enteral feeding, from the remnant 100 cm left after
surgery; however, there was no effect of treatment on length or
total weight in the remnant small intestine (Table 2). The AlaGln
treatment resulted in lower mucosa weight in the proximal 50 cm
of the remnant intestine when compared to the control diet
(Table 2).
elemental enteral diet in tandem with parenteral nutrition resulted
in massive adaptive responses in a piglet model of short bowel
syndrome [12]. In the current study, we utilized this model to
assess whether metabolically important amino acids (cysteine and
glutamine) delivered as dipeptides would further enhance adap-
tation of the remnant intestine. Unfortunately, no structural or
functional benets of either dipeptide were found when compared
to the free amino acid treatment. Even more surprising were the
results that suggested the substitution of alanine and glutamine
with alanyl-glutamine may actually be detrimental to mucosal re-
covery. Despite these results, the provision of enteral dipeptides did
lead to a signicant reduction in pro-inammatory cytokines in
mucosal tissue, suggesting that the form of the dietary amino acids
can alter the inammatory state of the small intestine.
The trigger for the mucosal inammatory response in our study
is uncertain, but could be related to bacterial overgrowth in the
remnant small intestine. Bacterial overgrowth is a common and
potentially serious complication of short bowel syndrome in infants
[26]. Some pro-inammatory bacterial peptides are known sub-
strates for PepT1; tri-DAP l-Ala-g-d-Glu-meso-DAP [27] and

Table 2
Comparison of morphological and metabolic changes in piglets receiving different enteral diets.

Control AlaAla AlaGln CysGly AlaGln CysGly

Final body weight (kg) 3.3 0.5 3.3 0.3 3.2 0.5 2.9 0.3 3.4 0.4
Weight gain (g kg1 d1) 59 18 53 24 47 15 53 10 52 18
Weight gain (%) 21 3 23 6 15 8 23 4 20 8
Remnant intestine length (cm) 185 21 196 15 170 36 174 31 180 25
Weight of the proximal 50 cm of remnant intestinal mucosa (g) 14.03 4.74a 9.86 1.41ab 8.51 1.66b 9.86 2.36ab 8.27 1.33b
Remnant intestine relative weight (g/cm) 0.31 0.07 0.23 0.04 0.26 0.10 0.31 0.10 0.28 0.09
Individual kidney weight (g/kg) 3.67 0.41 3.54 0.72 4.40 0.89 4.37 0.75 3.70 0.38
Liver weight (g/kg) 37.4 3.9 38.9 3.7 40.1 7.0 41.8 7.9 38.3 2.5
Mucosal protein synthesis (%/day) 78 27 90 13 85 23 98 14 83 14
Liver protein synthesis (%/day) 114 38 71 19 75 30 88 35 80 14

Values are mean SD, one-way ANOVA with Bonferroni's protected means separation test. Values across a row not sharing a superscript are signicantly different (P < 0.05).

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7
Fig. 1. Villus height and crypt depth distal to the site of anastomosis in piglets fed diets
containing either all free amino acids (Control), or one of alanyl-alanine (AlaAla),
alanyl-glutamine (AlaGln), cysteinyl-glycine (CysGly) or both AlaGln and CysGln
(AlaGln CysGly). N 5 piglets per group, values are mean SD. Data were analyzed
by 1-way ANOVA with Bonferroni's protected means separation test. Bars with
differing letters are signicantly different P < 0.05.
formyl-methionyl-leucyl-phenylalanine [28,29] are examples of
bacterially derived pro-inammatory substrates for PepT1. In the
healthy small intestine, bacterial peptides are found in very low
concentrations in the proximity of PepT1. If bacterial overgrowth
occurs, as is common in recovery from resection [26], the PepT1-
mediated transport of bacterial products could induce a pro-
inammatory cytokine response through NFkb signaling from
Fig. 2. Concentration of A) IFN-g and B) TNF-a in intestinal mucosa of piglets fed diets containing either all free amino acids (Control), or one of alanyl-alanine (AlaAla), alanyl-
glutamine (AlaGln), cysteinyl-glycine(CysGly), or both AlaGln and CysGly (AlaGln CysGly). N 5 per group. Values are mean SD. Data were analyzed by 1-way ANOVA.
Bars with differing letters are signicantly different P < 0.05.
Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
5
within the enterocytes as well as from macrophages and mono-
cytes recruited into the submucosal space by chemoattractants
released from the enterocytes [30,31]. In this circumstance, the
presence of any dietary peptides in the intestinal lumen could serve
to lower bacterial peptide uptake through competitive inhibition.
Indeed, we found that the provision of any of the test dipeptides
resulted in a reduction of TNF-a compared to the free amino acid
treatment, suggesting this effect is related to PepT1 activity rather
than provision of constituent amino acids.
In addition to protecting the intestine through competitive in-
hibition, there are other potential anti-inammatory mechanisms
that are dipeptide-specic. All test dipeptides lowered the TNF-a
concentration, but the mucosal IFN-g concentration was lower only
in groups exposed to CysGly and/or AlaGln. Others have found that
supplementation of an enteral diet with free cysteine attenuated
the inammatory response in a piglet model of DSS-induced colitis
through the suppression of chemotactic gene expression and pro-
inammatory gene expression [32]. Thus, CysGly may have resul-
ted in more intracellular cysteine which modulated intracellular
signaling to suppress immune cell recruitment and mucosal IFN-g
concentrations. However, this did not translate into better struc-
tural or functional outcomes compared to the free amino acid
treatment. We found no difference in protein synthesis rate or
mucosal weight compared to free amino acids. While not different
than free amino acids, piglets receiving the cysteine-dipeptide did
have greater villus height compared to the groups provided the
glutamine dipeptide (AlaGln or AlaGln CysGly), with no differ-
ence in cellular proliferation at necropsy. This discrepancy between
the morphological outcomes and cellular growth data could be due
to the time at which the samples were taken for analysis. Samples
were removed approximately one week after surgery. Previous
work in our lab using an identical surgical model demonstrated
that within 24 h of initiating enteral feeding, there was a period of
rapid cellular proliferation that was not detectable one week later
[12]. It is possible that this period of rapid growth was missed in our
study protocol.
The detrimental effect of alanyl-glutamine on intestinal
morphology is perhaps the most puzzling result from this study.
Not only did alanyl-glutamine limit growth of the remnant intes-
tine, but it also offset the benets conferred by cysteinyl-glycine.
The small intestine is a major consumer of glutamine and gluta-
mate, and both are important to the energy economy of the mucosa
[33]. Under normal conditions, the splanchnic tissues extract
greater than 60% of the glutamine provided in the diet, and most of
that is oxidized for energy [33]. Dietary glutamate is extracted to an
6 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7
even greater extent in young pigs, with only 6% entering the portal
blood; however, extraction of glutamate from the arterial blood is
negligible [34]. Our parenteral diet contained glutamate, but the
enteral diets were void of glutamate, in essence depriving the gut of
a source of glutamate. The AlaGln treatment contained no free
glutamine. We speculate that the delivery of glutamine in the form
of a dipeptide actually reduced glutamine availability to the intes-
tinal epithelial cells, such that it was transported out of the cell as
an intact dipeptide. In healthy adult men fed equal amounts of
glutamine as L-glutamine or alanyl-glutamine, plasma glutamine
concentration peaked at the same time, but the alanyl-glutamine
treatment resulted in a signicantly higher peak, and took 2 h
longer to return to baseline [35]. This suggests that greater amounts
of glutamine bypassed the small intestine. In our model this would
be a distinct disadvantage to intestinal regeneration and recovery,
especially in the absence of enteral glutamate, the other key energy
substrate for enterocytes [33].
Alanyl-glutamine appeared to be detrimental to mucosal
growth, but it was effective at suppressing the inammatory
response, likely through competitive inhibition, and perhaps via
the modulation of the immune response. Bacterial peptides can
trigger an inammatory response through two distinct routes.
Transport into intestinal cells via PepT1 will stimulate NFkb activity,
resulting in the production of proinammatory cytokines and
chemokines that are released from the cell [30]. In addition,
disruption of the mucosal barrier allows for transcellular move-
ment of bacterial peptides, which may interact with immune cells
in the lamina propria to augment the inammatory process. The
importance of glutamine to cells of the immune system, including
macrophages, neutrophils and lymphocytes, has been well
described [36]. Specically in pigs, glutamine was shown to down-
regulate the early immune response by lowering NFkb activity in
the jejunum [37]. Another study using an Escherichia coli challenge
in young pigs, found that enteral glutamine suppressed pro-
inammatory cytokine production [38]. We suspect that gluta-
mine availability within the cells was limited in the AlaGln groups
due to the dipeptide form; however, in the submucosal space,
adequate free glutamine may have been available to immune cells,
either from extracellular hydrolysis of the dipeptide or from the
arterial blood supply.
An important aspect to consider in this study is the bioavail-
ability of the dipeptides that we included in the diets. Stability and
clearance of plasma cysteinyl-glycine have not been as clearly
delineated as for alanyl-glutamine. However, cysteinyl-glycine is a
product of GSH degradation and numerous peptidases have been
shown to hydrolyze cysteinyl-glycine (leucyl amino peptidase,
alanyl peptidase) [39]. Certain characteristics of dipeptides may
predict their afnity for transport via PepT1. A study by Vig et al.
detailed the effect of peptide size, hydrophobicity, composition and
charge on dipeptide transport [40]. Although cysteine-containing
dipeptides were not studied, their results can be used to make in-
ferences regarding the bioavailability of cysteinyl-glycine. All X-gly
dipeptides were transported via PepT1 and neutral dipeptides
resulted in higher activation than charged peptides, suggesting that
cysteinyl-glycine is a viable substrate for PepT1.
In conclusion, we measured the impact of enterally-delivered
dipeptides on indices of intestinal adaptation, with the hypothe-
sis that there would be benets as a result of enhanced uptake of
metabolically important amino acids via peptide transport. On the
contrary, we found no morphological benets of dipeptides over
the constituent free amino acids in this short duration study.
Despite the lack of structural and functional differences in the
mucosa, dietary dipeptides did lower pro-inammatory cytokine
concentrations, suggesting an important therapeutic role for spe-
cic peptides in intestinal inammatory disease.
Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
Sources of funding
Supported by grants from the Ajinomoto Amino Acid Research
Program (3ARP 08-03) and the Canadian Institutes of Health
Research (MOP-86679).
Contributions of the authors
MGN, MED, RFB, and JAB were responsible for designing the
study and conducting the surgeries, MGN and MED carried out the
laboratory analysis, MGN performed the statistical analyses, MGN
and JAB drafted the manuscript. All authors contributed to and
approved the nal version of the manuscript.
Conict of interest
There is no conict of interest by any of the authors. The authors
alone are responsible for the content and writing of this paper.
References
[1] Daniel H. Molecular and integrative physiology of intestinal peptide transport.
Annu Rev Physiol 2004;66:361e84.
[2] Satoh J, Tsujikawa T, Fujiyama Y, Banba T. Enteral alanyl-glutamine supple-
ment promotes intestinal adaptation in rats. Int J Mol Med 2003;12(4):
615e20.
[3] Vazquez JA, Morse EL, Adibi SA. Effect of starvation on amino acid and peptide
transport and peptide hydrolysis in humans. Am J Physiol 1985;249(5 Pt 1):
G563e6.
[4] Ihara T, Tsujikawa T, Fujiyama Y, Bamba T. Regulation of PepT1 peptide
transporter expression in the rat small intestine under malnourished condi-
tions. Digestion 2000;61(1):59e67.
[5] Walker D, Thwaites DT, Simmons NL, Gilbert HJ, Hirst BH. Substrate upregu-
lation of the human small intestinal peptide transporter, hPepT1. J Physiol
1998;507(Pt 3):697e706.
[6] Erickson RH, Gum Jr JR, Lindstrom MM, McKean D, Kim YS. Regional
expression and dietary regulation of rat small intestinal peptide and amino
acid transporter mRNAs. Biochem Biophys Res Commun 1995;216(1):249e57.
[7] Shiraga T, Miyamoto K, Tanaka H, Yamamoto H, Taketani Y, Morita K, et al.
Cellular and molecular mechanisms of dietary regulation on rat intestinal H/
Peptide transporter PepT1. Gastroenterology 1999;116(2):354e62.
[8] Goulet OJ, Revillon Y, Jan D, De Potter S, Maurage C, Lortat-Jacob S, et al.
Neonatal short bowel syndrome. J Pediatr 1991;119(1 Pt 1):18e23.
[9] Sodhi C, Richardson W, Gribar S, Hackam DJ. The development of animal
models for the study of necrotizing enterocolitis. Dis Model Mech
2008;1(2e3):94e8.
[10] Fitzgibbons SC, Ching Y, Yu D, Carpenter J, Kenny M, Weldon C, et al. Mortality
of necrotizing enterocolitis expressed by birth weight categories. J Pediatr
Surg 2009;44(6):1072e5. discussion 5e6.
[11] Sukhotnik I, Siplovich L, Shiloni E, Mor-Vaknin N, Harmon CM, Coran AG.
Intestinal adaptation in short-bowel syndrome in infants and children: a
collective review. Pediatr Surg Int 2002;18(4):258e63.
[12] Dodge ME, Bertolo RF, Brunton JA. Enteral feeding induces early intestinal
adaptation in a parenterally fed neonatal piglet model of short bowel syn-
drome. J Parenter Enteral Nutr 2012;36(2):205e12.
[13] Li N, Lewis P, Samuelson D, Liboni K, Neu J. Glutamine regulates Caco-2 cell
tight junction proteins. Am J Physiol Gastrointest Liver Physiol 2004;287(3):
G726e33.
[14] Noda T, Iwakiri R, Fujimoto K, Rhoads CA, Aw TY. Exogenous cysteine and
cystine promote cell proliferation in CaCo-2 cells. Cell Prolif 2002;35(2):
117e29.
[15] Bauchart-Thevret C, Stoll B, Chacko S, Burrin DG. Sulfur amino acid deciency
upregulates intestinal methionine cycle activity and suppresses epithelial
growth in neonatal pigs. Am J Physiol Endocrinol Metab 2009;296(6):
E1239e50.
[16] Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione metabolism and its
implications for health. J Nutr 2004;134(3):489e92.
[17] Nkabyo YS, Gu LH, Jones DP, Ziegler TR. Thiol/disulde redox status is oxidized
in plasma and small intestinal and colonic mucosa of rats with inadequate
sulfur amino acid intake. J Nutr 2006;136(5):1242e8.
[18] Sido B, Hack V, Hochlehnert A, Lipps H, Herfarth C, Droge W. Impairment of
intestinal glutathione synthesis in patients with inammatory bowel disease.
Gut 1998;42(4):485e92.
[19] NRC. Nutrient requirements of swine. 10th ed. Washington, D.C.: National
Academy Press; 1998.
[20] Garlick PJ, McNurlan MA, Preedy VR. A rapid and convenient technique for
measuring the rate of protein synthesis in tissues by injection of [3H]
phenylalanine. Biochem J 1980;192(2):719e23.
 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7
[21] Bidlingmeyer BA, Cohen SA, Tarvin TL. Rapid analysis of amino acids using
pre-column derivatization. J Chromatogr 1984;336(1):93e104.
[22] Brunton JA, Baldwin MP, Hanna RA, Bertolo RF. Proline supplementation to
parenteral nutrition results in greater rates of protein synthesis in the muscle,
skin, and small intestine in neonatal Yucatan miniature piglets. J Nutr
2012;142(6):1004e8.
[23] Klang JE, Burnworth LA, Pan YX, Webb Jr KE, Wong EA. Functional charac-
terization of a cloned pig intestinal peptide transporter (pPepT1). J Anim Sci
2005;83(1):172e81.
[24] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
2001;25(4):402e8.
[25] Dahlqvist A. Assay of intestinal disaccharidases. Anal Biochem 1968;22(1):
99e107.
[26] Cole CR, Frem JC, Schmotzer B, Gewirtz AT, Meddings JB, Gold BD, et al. The
rate of bloodstream infection is high in infants with short bowel syndrome:
relationship with small bowel bacterial overgrowth, enteral feeding, and in-
ammatory and immune responses. J Pediatr 2010;156(6):941e7. 7 e1.
[27] Dalmasso G, Nguyen HT, Charrier-Hisamuddin L, Yan Y, Laroui H, Demoulin B,
et al. PepT1 mediates transport of the proinammatory bacterial tripeptide L-
Ala-{gamma}-D-Glu-meso-DAP in intestinal epithelial cells. Am J Physiol
Gastrointest Liver Physiol 2010;299(3):G687e96.
[28] Shi B, Song D, Xue H, Li J, Li N. Abnormal expression of the peptide transporter
PepT1 in the colon of massive bowel resection rat: a potential route for
colonic mucosa damage by transport of fMLP. Dig Dis Sci 2006;51(11):
2087e93.
[29] Carlson RM, Vavricka SR, Eloranta JJ, Musch MW, Arvans DL, Kles KA, et al.
fMLP induces Hsp27 expression, attenuates NF-kappaB activation, and confers
intestinal epithelial cell protection. Am J Physiol Gastrointest Liver Physiol
2007;292(4):G1070e8.
[30] Ingersoll SA, Ayyadurai S, Charania MA, Laroui H, Yan Y, Merlin D. The role and
pathophysiological relevance of membrane transporter PepT1 in intestinal
Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
7
inammation and inammatory bowel disease. Am J Physiol Gastrointest
Liver Physiol 2012;302(5):G484e92.
[31] Pan WW, Li JD, Huang S, Papadimos TJ, Pan ZK, Chen LY. Synergistic activa-
tion of NF-{kappa}B by bacterial chemoattractant and TNF{alpha} is mediated
by p38 MAPK-dependent RelA acetylation. J Biol Chem 2010;285(45):
34348e54.
[32] Kim CJ, Kovacs-Nolan J, Yang C, Archbold T, Fan MZ, Mine Y. L-Cysteine sup-
plementation attenuates local inammation and restores gut homeostasis in a
porcine model of colitis. Biochim Biophys Acta 2009;1790(10):1161e9.
[33] Bertolo RF, Burrin DG. Comparative aspects of tissue glutamine and proline
metabolism. J Nutr 2008;138(10):2032Se9S.
[34] Stoll B, Burrin DG, Henry J, Yu H, Jahoor F, Reeds PJ. Substrate oxidation by the
portal drained viscera of fed piglets. Am J Physiol 1999;277(1 Pt 1):E168e75.
[35] Harris RC, Hoffman JR, Allsopp A, Routledge NB. L-Glutamine absorption is
enhanced after ingestion of L-alanylglutamine compared with the free amino
acid or wheat protein. Nutr Res 2012;32(4):272e7.
[36] Newsholme P. Why is L-glutamine metabolism important to cells of the im-
mune system in health, postinjury, surgery or infection? J Nutr 2001;131(9
Suppl):2515Se22S. discussion 23Se24S.
[37] Zhong X, Li W, Huang X, Wang Y, Zhang L, Zhou Y, et al. Effects of glutamine
supplementation on the immune status in weaning piglets with intrauterine
growth retardation. Arch Anim Nutr 2012;66(5):347e56.
[38] Ewaschuk JB, Murdoch GK, Johnson IR, Madsen KL, Field CJ. Glutamine sup-
plementation improves intestinal barrier function in a weaned piglet model of
Escherichia coli infection. Br J Nutr 2011;106(6):870e7.
[39] Cappiello M, Lazzarotti A, Buono F, Scaloni A, D'Ambrosio C, Amodeo P, et al.
New role for leucyl aminopeptidase in glutathione turnover. Biochem J
2004;378(Pt 1):35e44.
[40] Vig BS, Stouch TR, Timoszyk JK, Quan Y, Wall DA, Smith RL, et al. Human
PEPT1 pharmacophore distinguishes between dipeptide transport and bind-
ing. J Med Chem 2006;49(12):3636e44.