Anda di halaman 1dari 66

aprendizaje activo de la

biologa

Laura Natal Afanador Barajas


ngela Patricia Navas Berdugo
Ada Vanessa Wilches Morales
Consejo Superior
Fernando Snchez Torres (presidente) Gustavo Francisco Petro Urrego
Rafael Santos Caldern Alcalde
Jaime Arias Ramrez
Jaime Posada Daz scar Gustavo Snchez Jaramillo
Pedro Luis Gonzlez (representante de los docentes) Secretario de educacin del Distrito
Germn Ardila Surez (representante de los estudiantes)
Nohora Patricia Buritic
Subsecretaria de calidad y pertinencia
Rector
Rafael Santos Caldern Pablo Fernando Cruz Layton
Director de educacin media y superior
Vicerrector acadmico
Fernando Chaparro Osorio

Vicerrector administrativo y financiero


Nelson Gnecco Iglesias

PUBLICACIN RESULTADO DEL CONVENIO 3351 SUSCRITO ENTRE LA SECRETARA


DE EDUCACIN DISTRITAL Y LA UNIVERSIDAD CENTRAL

Aprendizaje activo de la biologa


ISBN: 978-958-26-0220-8
Primera edicin: diciembre de 2014
Laura Natal Afanador Barajas
ngela Patricia Navas Berdugo
Ada Vanessa Wilches Morales
Universidad Central
Carrera 5 No. 21-38, Bogot, D. C. Colombia
Tels.: (57-1) 323 98 68, ext.: 1556
editorial@ucentral.edu.co

Preparacin editorial
Direccin: Hctor Sanabria Rivera
Diseo y diagramacin: Arturo Corts y Patricia Salinas G.
Correccin de estilo: Pablo H. Clavijo Lpez
Impresin: Xpress Estudio Grfico y Digital

Impreso en Colombia-Printed in Colombia

Este libro se podr reproducir o traducir siempre que se indique la fuente


y no se utilice con fines lucrativos, previa autorizacin escrita de los editores.
CONTENIDO
5 Introduccin

Diversidad del loro


orejiamarillo: 7
conocer y cuidar nuestra riqueza

Enfermedad de chagas
y las relaciones entre
15 organismos

Fotosntesis
27

"Ese beb es mo: tiene que


haber una forma de demostarlo"
37 Estudio de caso

Intercambio de nutrientes
y energa en un lago de
iunundacin de la Amazona
colombina
Estudio de caso 45

Sinapsis neuronal, una visin


desde la biologa, la fsica y la
qumica.
55 Actividades integradoras

Identificando nuestra
biodiversidad
61
Proyecto de aula
INTRODUCCIN

E
l Proyecto 891 de la Secretara de Educacin del Distrito busca articular la
educacin media con la educacin superior, de manera tal que los estudian-
tes inicien sus actividades en el colegio y transiten hacia la universidad, en
un recorrido de lo concreto a lo abstracto, del pensamiento comn al pensa-
miento cientfico. De esta manera, el camino que el estudiante inicia en su educacin
media tendr mayor probabilidad de culminar en un ttulo profesional.
Con esta cartilla pretendemos que los docentes tengan herramientas y metodologas,
adicionales a las ya empleadas, para guiar a los estudiantes en el proceso de trans-
formacin del pensamiento y de las actitudes que los capaciten para llevar una vida
universitaria exitosa. Para este fin, hemos incluido actividades enmarcadas en cuatro
metodologas: PODS (predecir, observar, discutir y sintetizar); estudios de caso; acti-
vidades integradoras; y proyectos de aula. Todas ellas son herramientas comnmente
utilizadas durante el desarrollo de las asignaturas que tiene a cargo el Departamento
de Ciencias Naturales de la Universidad Central.
La metodologa PODS le permite al estudiante llegar al concepto transitando por la
va de la intuicin, la experimentacin y la elaboracin de conclusiones a partir de
la experiencia. De esta manera, cuando se utiliza el trmino prediccin no se habla
estrictamente de la prediccin cientfica; ms bien nos inclinamos por darles cabida
a la intuicin y a las preconcepciones que tienen los estudiantes. Despus de tener
claras estas predicciones, se podr invitar al estudiante a que realice experimentos
o actividades que le permitan confirmar o replantear los conceptos preconcebidos.
Posteriormente hay una seccin de Discusin, en la que concretan los conceptos
aprendidos mediante la discusin entre pares y la consulta de referencias bibliogr-
ficas. Por ltimo, se realiza la sntesis del ejercicio, en la que se tienen en cuenta las
experiencias y conocimientos adquiridos durante la actividad.
Mediante la metodologa estudios de caso se pretende que el estudiante refuerce y
aplique los conceptos, contextualizndolos en un escenario o problemtica real que
le permita aplicar a su entorno los conceptos, comprender cmo pueden aplicarse, y
analizar las implicaciones que las tcnicas y conocimientos pueden tener en el desa-
rrollo social, cultural y econmico del pas.
La metodologa actividad integradora est encaminada a que las ciencias naturales
no se conciban como disciplinas aisladas (biologa, fsica y qumica), sino que se
comiencen a ver como un todo que puede ser aplicado en distintos escenarios y

5
situaciones. Esa visin integradora permite que los asuntos aqu tratados puedan
comprenderse mejor y de manera ms global.

Por ltimo, se hace necesario que los estudiantes incorporen sus conocimientos y
generen respuestas a preguntas o problemticas por medio del proyecto de aula,
metodologa basada en la pedagoga propuesta por John Dewey. Gracias a ella y
por medio de la experiencia que va a investigar, el estudiante podr aprender a
plantear una problemtica, a generar una metodologa de trabajo, con el fin de
encontrar alternativas y soluciones. El desarrollo de proyectos le ayudar al estu-
diante a trabajar en equipo, con lo cual lograr apropiarse de diversas temticas
no solo en el mbito acadmico, sino tambin en el social, permitiendo as que se
d una conexin de su proceso de aprendizaje con la realidad.

6
Diversidad del
loro
orejiamarillo:
conocer y cuidar nuestra riqueza
Qu conceptos debe conocer el estudiante
antes de realizar esta actividad?

Evolucin
Ecosistema
ADN (secuencia de nucletidos)

Qu conceptos aprender/afianzar
el estudiante despus de realizar
esta actividad?

Biodiversidad (gentica, especfica y ecosistmica)

Las especies son como ladrillos en la construccin


de un edificio. Podemos perder una o dos docenas

Predecir de ladrillos sin que la casa se tambalee. Pero si


desaparece el 20% de las especies, la estructura
entera se desestabiliza y se derrumba.
As funciona un ecosistema
Donald Falk

Biodiversidad
5-30 millones de especies en el mundo
Ecosistema
Colombia
Especie
TOP 5 de pases
ms diversos

Individuos TOP 1 en aves 40 mil especies


de plantas
1 especie se
extingue por da
30 mil plantas
comestibles
0,1% de diferencia genmica
entre humanos 30 cultivos 1/4 de las planta se enfrentan
nos alimentan a la extincin

70% del mundo usa plantas


como medicina

Figura 1. Imagen reelaborada apartir de la original: http://blogs.eltiempo.com/biogenic-colombia/wp-content/uploads/sites/525/2014/04/Biodiversidad.png

8
De los conceptos que conoce, y despus de observar la figura 1, responda las siguien-
tes preguntas:
Cules son las diferencias entre biodiversidad, a nivel de individuo, especie y ecosis-
1. tema?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Cmo se originaron tantas y tan diferentes especies? Piense en las diferentes formas
2. en que se pueden generar nuevas especies.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Qu papel(es) desempea(n) la(s) especie(s) en el ambiente? Luego analice: Qu
3. pasara si esta(s) especie(s) desapareciera(n)? Imagine varios escenarios posibles y des-
crbalos a continuacin.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Describa cmo se relaciona la diversidad con el material gentico (ADN).
4. __________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Ahora, imagine cmo seran las secuencias de ADN (secuencias de nucletidos) de
5. dos individuos hermanos, de dos gemelos, de dos no familiares y de dos especies
diferentes. Mencione en cada uno de los casos si pueden diferenciarse fcilmente,
ligeramente, difcilmente o no pueden diferenciarse.

Relacin entre Diferenciacin en el ADN


Gemelos

Hermanos
No familiares
Especies diferentes

9
Observar
Biodiversidad del
loro orejiamarillo
El loro orejiamarillo (Ognorhynchus icterotis) se encuentra actualmente amenazado
debido a la deforestacin de los bosques de palma de cera, para su uso en las cele-
braciones del Domingo de Ramos. Otra amenaza, en muchos casos no documenta-
da, proviene de la caza y trfico de las especies. La poblacin de individuos de este
loro se ubicaba antiguamente en Colombia y Ecuador, pero hoy se encuentra tan
solo en algunos lugares de Colombia y se teme que pronto desaparezca.

Materiales
Tarjetas con informacin de ADN de hembras y machos de loro orejiamarillo
1. (Ognorhynchus icterotis)
Metodologa
Llegaron cinco individuos de loro orejiamarillo, que fueron incautados por la Polica
2. en el Quindo y Tolima; estos loros fueron sacados de su hbitat natural para co-
mercializarlos. Se hizo un estudio del ADN de estos individuos pensando en poder
caracterizarlos y luego someterlos a un plan de conservacin de la especie.
Observe las secuencias de ADN de cada uno de los individuos y evidencie las dife-
rencias entre hembras y machos de cada una de las regiones.
1. ADN de loro orejiamarillo hembra del Quindo

ATGCGACTGGATTCCAATCGGCCTATCAGACTACATAGA

2. ADN de loro orejiamarillo hembra del Tolima

ATGAGACTCCATTCCGGCCTATCAGAGTACATAGA

3. ADN de loro orejiamarillo macho del Tolima

ATGCGACTGGTAACCAATCAACCTATCAGACTACATACT

4. ADN de loro orejiamarillo macho del Quindo

ATGCGACTGGATTCCAATCGGCCTATCAGACTACATAGA

5. ADN de loro orejiamarillo macho del Quindo

ATGAGACTCCATTCCTATCGGCCTATCAGAGTACATAGA
Discutir
Qu hembras y/o machos tienen secuencias de ADN similares? Explique por qu podran
1. darse las similitudes.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Qu individuos hembras y/o machos tienen secuencias de ADN diferentes? Explique por
2. qu podran darse las diferencias entre individuos y regiones.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Si se pensara en el cuidado de la especie, y posiblemente en cruzar a estos individuos para
3. promover su biodiversidad (tenga en cuenta que las diferencias entre individuos generan
la diversidad), cmo los cruzara? Discuta su respuesta.

Hembra del Quindo Hembra del Tolima

__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

12
Sintetizar

L
os individuos muestran diferencias entre La biodiversidad se genera por el apareamien-
s, que se ven reflejadas por lo general to al azar de los individuos. Sin embargo,
en su morfologa. Aun cuando las di- cuando una poblacin ha reducido su nme-
ferencias morfolgicas no sean tan claras, si ro de individuos, las posibilidades de que este
analizamos las secuencias de ADN podemos proceso se lleve a cabo son bastante bajas. Es
evidenciar las diferencias entre organismos re- importante pensar que todos estos procesos
lacionados o hermanos de una misma especie. pueden llevar a que las poblaciones de una
Es importante conocer cmo una secuencia especie se diferencien y puedan generar una
de ADN nos puede ayudar a conocer la va- nueva especie, o a que las poblaciones sean
riacin y a relacionarla con la biodiversidad, tan pequeas y tan poco diferenciadas que
como es el caso que se ha planteado con el puedan extinguirse a causa de algn proceso
loro orejiamarillo. que las afecte.
Cmo se puede relacionar esto con la evo-
Actualmente vemos cmo el ser humano pue-
lucin?
de afectar o intervenir de forma negativa los
procesos de la naturaleza, lo que lleva a la Qu consecuencias tiene una baja varia-
destruccin de ambientes y a la extincin de bilidad o diversidad, y cmo afectara a las
especies. poblaciones e individuos de una especie?

Sugiera cmo podramos intervenir de for-


ma positiva para disminuir el dao provoca-
do a la naturaleza o a las especies.

13
Actividades
complementarias
Para conocer ms acerca de la diversidad de especies en el mundo y el lugar que en ella
1. ocupa Colombia, vea el siguiente video, en el que se pueden conocer los 10 pases ms
megadiversos del mundo:

http://www.youtube.com/watch?v=df224hAx130

Consulte qu es el trfico de especies y qu entidades de Colombia se encargan de controlarlo.


2.
Investigue qu tipos de conservacin existen y piense en cul sera el adecuado para aplicar
3. en el caso del loro orejiamarillo.

Bibliografa
Andrade, C. (2011). Estado de conocimiento de la biodiversidad en Colombia y
sus amenazas. Consideraciones para fortalecer la interaccin ciencia-poltica".
Rev. Acad. Colomb. Cienc., 35(137), 491-507.
Biello, D. (2012). How biodiversity keeps earth alive". Scientific American. May 3.
Estrella, J., Manosalvas, R., Mariaca, J. y Ribadeneira, M. (2005). Biodiversidad
y recursos genticos: una gua para su uso y acceso en el Ecuador. Quito: Eco-
Ciencia, INIAP, MAE y Abya Yala.

14
Enfermedad de CHAGAS
y relaciones entre
organismos

Actividad modificada y adaptada de: Crean, 2010


Qu debe saber el estudiante
antes de realizar esta actividad?
Protozoo
Ciclo de vida
Poblacin
Comunidad

Qu aprender el estudiante despus


de realizar esta actividad?
Mutualismo
Parasitismo
Vector
Hospedero
Reservorio natural

Introduccin
En las comunidades, los individuos de distintas especies interactan entre
s de distintas maneras. Pueden competir por un recurso, en el proceso que
denominamos competencia; pueden intercambiar un recurso o servicio, en
el llamado mutualismo; puede beneficiarse uno sin afectar al otro, proceso
conocido como comensalismo; o puede beneficiarse uno y afectar de mane-
ra negativa al otro, en el denominado parasitismo.
Dentro de las relaciones de parasitismo encontramos las de microparasitis-
mo, en las que un virus, bacteria, hongo o protozoo tiene como hospedero
a un organismo ms grande y se aprovecha de este para obtener alimento o
completar su ciclo de vida, con lo cual reduce su gasto de energa. Los ciclos
de vida de los microparsitos suelen ser muy complejos, ya que involucran
vectores, reservorios y hospederos. Los vectores son organismos que trans-
portan al parsito de hospedero a hospedero y no se ven afectados por este.
Los reservorios son los hospederos del parsito a largo plazo; generalmente
no se ven afectados por este o son asintomticos. Por ltimo, hay algunos
hospederos que s se van a ver afectados por los parsitos y estos ponen en
riesgo su vida (Smith y Smith, 2007).
Una de las enfermedades tropicales ms comn en las zonas bajas latinoa-
mericanas, incluida Colombia, es la enfermedad de Chagas, tambin co-
nocida como tripanosomiasis. Se calcula que en todo el mundo hay entre
16 y 18 millones de personas infectadas por el parsito, de las cuales cada
ao mueren 50000. Hay transmisin local de la enfermedad de Chagas en
Argentina, Belice, Bolivia, Brasil, Colombia, Costa Rica, Ecuador, El Salvador,
Guatemala, Guyana, Guyana Francesa, Honduras, Mxico, Nicaragua, Pa-
nam, Paraguay, Per, Venezuela y Suriname. La prevalencia de la tripano-
somiasis en Colombia se ha estimado entre 700000 y 1200000 habitantes
infectados, y hay 8 millones en riesgo de adquirir la infeccin, segn se

16
deduce de la distribucin geogrfi- Boyac 215
ca y las especies rectoras descritas Bogot 179
en la fase exploratoria del Programa Santander 111
Norte Sant. 96
Nacional de Prevencin y Control Casanare 65
de la Enfermedad de Chagas, que Cesar 63
comenz oficialmente en 1996 por Arauca 55

iniciativa del Ministerio de Salud de Cundinamarca 32


Meta 26
Colombia y en el que participan cen- Tolima 25
tros de investigacin nacionales con Guaviare 20
experiencia en la patologa. Los en- Huila 14
Antioquia
tes territoriales con el mayor nmero 12
Caqueta 10
de casos notificados fueron Boyac Valle 9
(215), Bogot (179), Santander (111), Crdoba 7

Norte de Santander (96), Casanare Sucre 5


Guaina
(65), Cesar (63), Arauca (55) y Cun- Caldas 3
4

dinamarca (32), los cuales aportan el Santa Marta 3


84% (817) del total de casos noti- Barranquilla 3

ficados, como se ve en el siguiente Cauca 2


Putumayo 2
mapa (INS, 2012). Bolvar 1
Quindo 1
Nario 1
0 20 40 60 80 100 120 140 160 180 200 220

Figura 2: Entes territoriales con mayor prevalencia de la enfermedad de Chagas en Colombia.


Fuente: SIVIGILA INS

La enfermedad de Chagas es causada


por un protozoo denominado Trypa-
nosoma cruzi, cuyo vector es un in-
secto comnmente conocido como
chinche, muy comn en los lugares
de asentamiento humano. El parsito
puede permanecer en reservorios natu-
rales, como animales silvestres (arma-
dillos, marsupiales, murcilagos) y do-
msticos (perros, gatos). Cuando entra
al torrente sanguneo de los humanos,
T. cruzi se hospeda en las clulas del
Figura 3: Ciclo de vida de Trypanosoma cruzi, parsito que produce la enfermedad de Chagas. Se presentan corazn, donde al cabo de unos aos
los distintos vectores, reservorios y hospederos relacionados con esta. El contagio de la enfermedad
puede presentarse debido a la picadura de la chinche o al consumo de alimentos contaminados
puede debilitar este rgano y causar la
con las heces de esta. (Imagen tomada de: http://www.educhagas.com.ar/imagenes/galeria/ muerte al hospedero.
originales/ciclo_t_cruzi_oms.gif)

17
Predecir
Responda las siguientes preguntas teniendo en cuenta lo mencionado en la Introduc-
cin y lo mostrado en la figura 2:
Qu tipo de relaciones entre organismos encuentra usted en este ciclo de vida? Re-
1. cuerde incluir al parsito, los vectores, reservorios y hospederos.
_____________________________________________________________________
En qu casos las relaciones son obligadas (una especie no puede sobrevivir sin la otra),
2. y en qu casos son facultativas (las especies pueden vivir sin las otras)?
_____________________________________________________________________
Cmo cambiar la frecuencia de contagio de la enfermedad dependiendo del nmero
3. de chinches (sanas o enfermas) presentes en una comunidad? Qu pasar si se modifi-
ca la cantidad de animales domsticos que viven en relacin estrecha con las personas?
_____________________________________________________________________
Si una persona es picada por una chinche queda infectada. Si otra chinche la vuelve a
4. picar, esta persona se enfermer ms en comparacin con su estado de salud cuando
solo le haba picado una chinche?
_____________________________________________________________________
Cmo cambiar la dinmica de contagio (nmero de personas contagiadas) si cambia el
5. nmero de vectores (chinches) y el de humanos se mantiene constante?
_____________________________________________________________________

Observar
Juego de la enfermedad de Chagas:
Materiales:
1. Tarjetas del juego Marcadores rojos y azules
Jugadores:
2. Vectores: chinches Rhodnius prolixus Reservorios: armadillos, zarigeyas, pe-
(infectados y no infectados) rros y murcilagos
Hospederos: humanos

18
Jugando:
3. Distribuya sus estudiantes en los distintos marcador azul y a cada vector infectado
roles, como se indica a continuacin: un marcador rojo.
Vectores: 20% del total de estudian- Reservorios: perros, 30 %; zarigeyas,
tes, de los cuales la mitad ser de no 10%; armadillos, 10%; murcielagos, 10%
infectados, y la otra mitad de infecta- Hospederos: 20% de humanos.
dos. Dele a cada vector no infectado un
Cada estudiante recibir una tarjeta de juego en donde se le le indica el rol que debe
desempear durante la actividad.

Aclaracin: el porcentaje de chinches puede ser modificado para investigar los efec-
tos de un incremento en el nmero total de vectores. Tambin puede cambiarse la
proporcin de infectados y no infectados.
Habr tres rondas de picaduras de las chinches. Para cada ronda, el docente predeterminar
el perodo de su realizacin. Se recomienda que sea de 1 minuto o menos, dependiendo del
nmero de estudiantes de cada grupo.

Ronda 1
Las chinches picarn aleatoriamente che no infectada pica a un armadillo, el
tantos reservorios y hospederos como armadillo recibir una marca azul en la
les sea posible. Sin embargo, cada hos- caja 1 de la tarjeta.
pedero podr ser picado una sola vez Despus de que la chinche marque la
por ronda. Para evitar la confusin, el tarjeta de un reservorio u hospedero,
docente puede elegir que todos los re- ella puede moverse a otro.
servorios y hospederos estn organiza- El resultado para el reservorio u hospe-
dos en fila y que los vectores se muevan. dero diferir dependiendo del tipo de
Al picar a un reservorio u hospedero, chinche que lo pique (Revise ms ade-
una chinche marca la tarjeta del hospe- lante la seccin Resultados para cada
dero en la caja sealada con el nmero jugador).
1. Las chinches infectadas marcarn la Al final de la ronda 1, cuente el nmero
tarjeta con rojo, las no infectadas lo ha- de chinches, reservorios y hospederos
rn con azul. Por ejemplo, si una chin- infectados y no infectados.

Ronda 2
Los jugadores seguirn los mismos pasos les sea posible, marcando sus tarjetas
que en la ronda 1, con las siguientes re- en la caja identificada con el nmero
glas adicionales: 2. De nuevo, cada hospedero puede ser
picado solo una vez por ronda.
Las chinches picarn a la mayor can-
Si una chinche no infectada pica un
tidad de reservorios u hospederos que
reservorio u hospedero infectado (con

19
la caja 1 marcada con rojo), la chinche Si el hospedero muere al final de la ron-
se infecta y debe cambiar su marcador da 2, el jugador se sentar y no puede
azul por uno rojo. ser picado de nuevo.
Cuando la chinche queda infectada, Al final de la ronda 2, cuente el nmero
inmediatamente comienza a marcar las de vectores, reservorios y hospederos
tarjetas con el marcador rojo. infectados y no infectados.

Ronda 3
Los jugadores seguirn los mismos pasos Si una chinche no infectada pica a un
que en la ronda 2 con las siguientes re- reservorio u hospedero que recibi una
glas adicionales: marca roja en la ronda 1 o 2, el vector
quedar infectado y deber cambiar el
Las chinches picarn tantos reservo- marcador azul por uno rojo.
rios y hospederos como les sea posible
Al final de la ronda 3, cuente el nmero
y marcarn sus tarjetas en la caja 3.
de chinches, reservorios y hospederos
Las chinches no podrn picar a los hos- infectados, no infectados y muertos.
pederos muertos.

Resultados para cada jugador


a. Si una chinche no infectada pica a Si un perro es picado por una chin-
un reservorio u hospedero, no pasa che infectada, pueden obtener-
nada con estos individuos. se dos resultados: la mitad de los
perros infectados ir a la siguiente
b. Reservorios ronda y luego morir, mientras la
Si un armadillo es picado por una otra mitad continuar en el juego
chinche infectada, queda infectado hasta el final. Si una chinche no in-
pero no se enferma ni muere. Con- fectada pica a un perro infectado,
tinuar en el juego durante las tres la chinche quedar infectada.
rondas. Si una chinche no infectada c. Hospederos (humanos)
pica a un armadillo infectado, dicha
Si un humano es picado por una
chinche quedar infectada.
chinche infectada, quedar infec-
Si una zarigeya o murcilago es tado, caer enfermo y morir al
picado por una chinche infectada, final de la siguiente ronda. Si una
queda infectado y se enferma, pasa chinche no infectada pica a un hu-
a la segunda ronda y muere al final mano infectado, la chinche quedar
de esta. Si una chinche no infecta- infectada.
da pica a una zarigeya o murci-
lago infectado, esa chinche quedar
infectada.

20
Tarjetas de juego

21
T eres un armadillo T eres una zarigeya
Una vez infectado, no te pasar nada, Una vez infectada, te enfermars y morirs
podrs seguir jugando hasta el final al final de la siguiente ronda

T eres un perro T eres un murcilago


Una vez infectado, te enfermars y morirs Una vez infectado, te enfermars y morirs
al final de la siguiente ronda al final de la siguiente ronda

T eres un perro T eres un humano


Una vez infectado, no te pasar nada, Una vez infectado, te enfermars y morirs
podrs seguir jugando hasta el final al final de la siguiente ronda

22
Discutir
El conocimiento de todos los actores involucrados en el contagio de la enfermedad
1. puede relacionarse con el ambiente donde la enfermedad tiene mayores probabilida-
des de ser adquirida. Existen factores medioambientales comunes en los departa-
mentos colombianos donde hay mayor cantidad de casos de Chagas?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Cul cree que sera el mejor mecanismo para limitar la expansin de esta grave en-
2. fermedad?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Averige en qu rangos de edad se encuentra la poblacin ms vulnerable Qu ra-
3. zones hay para ello?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
De acuerdo con las predicciones que se hicieron antes de realizar el juego, proponga
4. una actividad de discusin en clase, en la que se argumenten las diferencias basn-
dose en fuentes bibliogrficas.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Prediccin 1

_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

23
Prediccin 2
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Prediccin 3
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Prediccin 4
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Prediccin 5
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Qu diferencias hay entre las reglas del juego y la manera en la que el T. cruzi es
5. transmitido entre reservorios y hospederos? Son iguales? cambian? Se recomienda
una actividad de discusin alrededor de la pregunta propuesta.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

24
Sintetizar
Los protozoarios presentan algunas caractersticas que los hacen particulares frente a
otros grupos de organismos vivos; de ah que sea importante conocer dichas caracte-
rsticas y relacionarlas con el caso que aqu se ha planteado.
A lo largo de la historia de las civilizaciones humanas han existido otros casos de con-
tagio de enfermedades por vectores, que han puesto en riesgo incluso la supervivencia
de la especie humana.
Plantee comparaciones con casos como la peste negra, el bola, la fiebre tifoidea, el
dengue y el paludismo. Qu tienen en comn?, qu las diferencia?

Estos tipos de enfermedades surgen por la interaccin de las especies: cada una ensa-
ya una forma de ganar su pelea evolutiva, en la cual unos animales mueren y otros no.
Cmo se puede relacionar este tema con el de seleccin natural? Qu caracterstica
sera deseable en casos como estos?

Actividades
complementarias
Para mejorar su conocimiento sobre esta enfermedad, realice las siguientes consultas
y actividades para ser sometidas a discusin:
Realice un diagrama de barras que muestre cuntas personas han muerto por esta
1. enfermedad en los ltimos 10 aos en Colombia.

Averige cules son los sntomas de esta enfermedad crnica y si hay tratamientos
2. para curarla o aliviarla.

Realice una consulta sobre los lugares del pas donde se hacen pruebas diagnsticas.
3. Pdales a sus estudiantes que describan con sus palabras el mtodo que se utiliza.

Establezca una relacin entre el cambio climtico y el efecto que puede tener sobre la
4. distribucin de las plagas y enfermedades en Bogot. Qu pasara si la capital ahora
tuviera una temperatura promedio de 12 grados? Qu pasara en el mundo con otras
enfermedades transmitidas por vectores del tipo insectos?

25
Bibliografa
Crean, J. (2010). West Nile Virus: Vectors and Hosts Game. Howard Hughes
Medical Institute, Holiday Lectures on Science. Consultado en: http://www.
hhmi.org/biointeractive
Instituto Nacional de Salud (2012). Informe del evento Enfermedad de Cha-
gas. Consultado el 2 de nov. De 2014 en: http://www.ins.gov.co/lineas-de-ac-
cion/Subdireccion-Vigilancia/Informe%20de%20Evento%20Epidemiolgico/
CHAGAS%202012.pdf
Smith, T. y Smith, R. (2007). Ecologa. 6 ed. Madrid: Pearson Education.

26
Fotosntesis

27
Qu debe saber el estudiante
antes de realizar esta actividad?
Organelos celulares
Molculas orgnicas e inorgnicas

Qu aprender el estudiante despus


de realizar esta actividad?
Productividad primaria
y nociones de productividad secundaria

No podemos engaar al ADN. No podemos


Introduccin esquivar la fotosntesis. No podemos decir
que no vayamos a estar condenados al
fitoplancton. Todos estos pequeos
En estos tiempos de la revolucin ge- mecanismos proporcionan las condiciones
ntica, la posibilidad de hacer mejora- de nuestra vida planetaria
miento de plantas y animales es una
Barbara Ward
realidad y va a ritmos acelerados. El
rumbo que han tomado las investiga-
ciones cientficas en la agricultura se
debe a la urgente necesidad de conse-
guir suficiente alimento para todos los habitantes del planeta. El nmero de individuos de
nuestra especie aumenta cada da en 8,6 millones, lo que genera preocupacin en todos
los gobiernos del mundo, que se preguntan da tras da cmo mejorar la productividad de
sus suelos y mares para poder abastecer a una humanidad creciente y necesitada.
Desde aquel tiempo en que el hombre se convirti en agricultor, comenz a escoger aque-
llas plantas y animales que le provean ms energa al consumirlos, al tiempo que le brin-
daban otros beneficios, como servirle como materia prima para elaborar su ropa, techar sus
casas, ayudarle en su trabajo, movilizarse, o cuidar sus propiedades. Las mujeres eran las
encargadas de escoger y guardar aquellas semillas que daban los mejores frutos y, poco a
poco, aparecieron las primeras variedades mejoradas, que, con luz, agua y cuidados, produ-
can alimentos ricos y abundantes; esto permiti a las primeras familias mejorar su calidad
de vida y garantizar su supervivencia. Sin darse cuenta, el ser humano haba comenzado
una carrera, que an no termina, para aumentar la productividad de sus alimentos. Con la
revolucin industrial aparecieron las mquinas que iran a mejorar las tcnicas de cultivo, de
pesca, de explotacin de todos los recursos que usa nuestra especie.
De esta manera, lo que en un principio tuvo el fin exclusivo de sobrevivir nos ha llevado
a un punto en el que hay que repensar a dnde nos ha conducido esta carrera.
Las plantas, que son la base del sustento de todo ecosistema terrestre, y las algas, que
son su equivalente en los ecosistemas acuticos (agua dulce y salada), garantizan la
supervivencia de todos los dems organismos vivos del planeta. Adicionalmente, las
plantas realizan de forma natural dos funciones que tambin mejoran y garantizan
nuestra supervivencia: capturan el dixido de carbono (CO2) y liberan oxgeno. El

28
mecanismo de la fotosntesis consiste entonces en un maravilloso proceso en el cual
los organismos productores logran formar frutas y verduras a partir de agua y dixi-
do de carbono. Las algas microscpicas son su equivalente en el mundo acutico, lo
que garantiza la supervivencia de peces, que les dan de comer a 2/3 de la poblacin
mundial. De ah que sea vital revisar en qu consiste este mecanismo, base de la vida
en la Tierra.

Figura 4: Imagen reelaborada apartir de la original:


http://www.hydroenv.com.mx/catalogo/index.php?main_page=page&id=221

29
Actividad sugerida previa a la prctica
(Consulte el video del profesor Bozeman en youtube)
http://www.youtube.com/watch?v=ZnY9_wMZZWI

Predecir
Las hojas de todas las plantas verdes son capaces de realizar la fotosntesis, siempre y
1. cuando las condiciones estn a su favor.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Si se comprueba que las hojas de las plantas producen oxgeno, se podra afirmar
2. que la fotosntesis efectivamente ocurri?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Al aadir al medio del ensayo una fuente de carbono, la fotosntesis ser mucho ms
3. efectiva que sin ella?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Si se cambia la cantidad de luz, la fotosntesis podr hacerse ms rpida o ms lenta?
4. _____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

30
Observar
Materiales y reactivos para 1 soporte, donde se pueda fijar el bom-
1. todo el grupo billo a 40 cm de la mesa.
Un bombillo de luz LED o uno de los 1 frasco de vidrio o 1 vaso de precipita-
tradicionales (incandescentes) de 100 dos de 400 ml de capacidad.
watts. 2 hojas de espinaca fresca, verde bri-
llante y sana.
Reactivos e implementos (para 1 perforadora.
el laboratorio) 1 reloj con cronmetro.
10 gramos de bicarbonato de sodio o Pliegos de papel celofn de colores
de calcio. azul, verde y rojo, uno de cada color.
1 litro de agua destilada o embotellada. Hielo picado.
1 jeringa de 5 ml, sin la aguja.

Montaje del ensayo (Bozeman, 2014)


2. Instrucciones para todos los estudiantes
1. Tomen la perforadora y corten con ella una hoja de espinaca hasta obtener 20
crculos.
2. Tomen el bicarbonato y disulvanlo en 1 litro de agua destilada o embotellada.
3. Introduzcan los crculos en una jeringa de 5 ml. Qu pasa con los crculos? Por
qu se ubican en ese lugar?

4. Pongan su dedo en la punta de la jeringa y jalen hacia atrs el mbolo. Qu


observan alrededor de los crculos de hojas? Qu gas aparece?

31
5. Repitan este procedimiento las veces que sea necesario hasta que los crculos des-
ciendan.
6. Tpenlos ahora con sus manos, retiren el mbolo y pnganlos en 200 ml de la
solucin de bicarbonato vertida en un frasco o vaso de precipitados.
7. Asegrense de poner una hoja blanca debajo, o de que la superficie donde estn
los circulitos sea blanca.
8. Rpidamente prendan el bombillo y activen el conmetro del reloj.

Variaciones propuestas en los grupos


Establecer un grupo control, que realizar el procedimiento tal como se describi
arriba.

Tratamientos propuestos

Grupo 1. Este grupo de estudiantes pondr el bombillo a 50 cm de la mesa. Qu


factor est modificando respecto al grupo de control?
Grupo 2. Este grupo prepara una solucin de bicarbonato ms concentrada (200
g/100 ml). Deben observar el frasco del bicarbonato y revisar la frmula qumica.
(Este grupo debe estructurar una hiptesis acerca del elemento qumico que est
modificando).
Grupo 3. Este grupo pone un papel celofn sobre el vaso de precipitados. Utiliza
papeles azul, rojo o verde, y el resto del procedimiento tiene que mantenerlo igual.
Grupo 4. El grupo 4 pone el vaso de precipitados con los crculos de espinaca sumer-
gidos en una cubeta con hielo, es decir, modifica la temperatura del ensayo; el resto
del procedimiento permanece igual al del grupo de control.

32
Para todos los grupos

Los estudiantes deben observar los crculos de espinaca y comenzar a anotar el tiempo en el
que van ascendiendo a la superficie. El docente les dice que detengan su cronmetro cuando
suban todos los crculos y verifiquen que se registren todos los tiempos en una tabla. Al final,
se deben comparar los datos de todos los grupos con los datos del grupo control.

Tiempo Grupo 1 Grupo 2 Grupo 3 Grupo 4


Grupo
de ascenso (intensidad (cantidad de (calidad de la (temperatura
control
de cada crculo lumnica) CO2) luz) ambiental)

Resultados para cada grupo

Cada grupo debe registrar el tiempo en el cual suben los 20 crculos y alguno de los integrantes
debe ir revisando cmo van progresando los dems ensayos, para poder recoger las inquietudes de
cada grupo. Esto es muy importante para poder establecer las consecuencias de ir modificando
cada uno de los factores vinculados. Si se cuenta con computadores, se pueden registrar todos los
datos y se pueden graficar curvas correspondientes a cada ensayo, para compararlas al final.

Discutir
Las plantas verdes fabrican molculas muy complejas, como azcares y almidones, a partir de
molculas relativamente sencillas, como CO2 y H2O, utilizando como energa la luz del sol. El tipo
de luz fotosintticamente activa es la luz blanca. Sin embargo, hay muchos factores que pueden
alterar este proceso.

Qu cambios se pueden observar en la velocidad de ascenso de los crculos de espi-


1. naca en cada tratamiento propuesto?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

33
La calidad de la espinaca es tambin importante? Qu puede pasar si la espinaca est
2. muy vieja o amarillenta?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Ocurren variaciones en la fotosntesis a lo largo del da? Qu pasa en un da soleado y
3. en un da nublado?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Sintetizar
Todos los ecosistemas terrestres y acuticos se soportan en la actividad de los orga-
nismos fotosintetizadores. Esto significa que estos organismos estn en la base de
las pirmides alimenticias y que, sin su trabajo, la vida de los consumidores no es
sustentable.
Lo mismo ocurre en los mares y lagos, aunque las plantas terrestres sean ms fciles
de medir y contar. En la mayora de los ecosistemas acuticos, los fotosintetizado-
res son las bacterias y los protistas. Estos organismos unicelulares, aunque no pesan
mucho, se reproducen de forma rpida y son el alimento de los peces herbvoros que
estn en los primeros eslabones de la cadena trfica (Purves, 2003).
Si se consideran los cambios que estn ocurriendo en nuestro planeta en cuanto a
aumento de las concentraciones de CO2, de la temperatura en el aire y en el mar, y la
mayor demanda de alimento en el mundo, qu predicciones se pueden hacer?

34
Actividades
complementarias
Para ampliar sus conocimientos sobre la fotosntesis:
Dibuje un cloroplasto y ubique los lugares y estructuras en donde se llevan a cabo
1. los dos procesos principales: la produccin de oxgeno y la fijacin del carbono para
producir azcar (glucosa).

Consulte los cambios que estn ocurriendo en los mares donde la temperatura haya
2. aumentado en los ltimos aos. Qu especies han desaparecido? Hay algunas espe-
cies que se hayan beneficiado con este cambio?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

35
Existen otros pigmentos en las plantas, que les dan los colores rojo, naranja, amarillo,
3. azul y morado. Qu funcin tienen estos pigmentos? Por qu la clorofila es la ms
importante?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

En Estados Unidos hay grupos de preppers, que aseguran que sern los nicos sobre-
4. vivientes en caso de que se estrelle un meteorito contra la Tierra o de que haya una
guerra mundial que tape la luz del sol. Cunto tiempo cree que ellos sobreviviran?
Qu otros escenarios ha habido en la historia de nuestro planeta, en los que hubo
oscuridad y polvo que cubri la atmosfera? Genere una discusin alrededor de las
consecuencias de esta situacin real vs. la hipottica.

Bibliografa
Bozeman (2014). Photosynthesis Lab Walkthrough. Disponible en:
http://www.youtube.com/watch?v=ZnY9_wMZZWI
Purves (2003). Vida: la ciencia de la biologa. Bogot: Panamericana.

36
Ese beb es mo:
tiene que haber
una forma
de demostrarlo
Estudio de caso
Qu debe saber el estudiante
antes de realizar esta actividad?
Estructura y funciones del ADN
Concepto de mutacin: neutra, ventajosa, desventajosa

Qu aprender el estudiante despus


de realizar esta actividad?
Diferencias estructurales entre ADN
nuclear y mitocondrial
Aplicaciones del anlises de ambos tipos de ADN

"Porque al besar la madre a un hijo amado,


Primera parte besa a un tiempo el amor del que ha nacido"
Ramn de Campoamor

Camila estaba muy feliz cuando se cas tras un corto


noviazgo. Julio, su novio, era un hombre mayor, muy ca-
llado y aparentemente reservado y serio. Haba estado casado anteriormente, pero nadie saba
muy bien por qu ya no viva con su esposa y sus hijos. Camila tena 18 aos cuando Julio la con-
quist muy rpidamente; l comenz a cortejarla y a acompaarla a todos lados, la esperaba a la
salida del colegio y pronto le regal un celular para poder encontrarla fcilmente. Al comienzo
todo pareca muy normal, aunque Camila en el fondo senta que Julio era muy posesivo con ella.
Su familia tambin senta que ese no era el orden normal de las cosas y su mam supo algo que
la dej muy preocupada: Julio no viva con su esposa porque tena una demanda por violencia
domstica y, si se acercaba a ella, ira preso por abuso. La mam de Camila habl con su hija y
le pidi que reconsiderara su noviazgo, porque la violencia y el control eran dos conductas que
iban a anular su vida, pero Camila no consider que esto fuera una buena razn para dejarlo y,
como en todo ciclo de violencia, ella senta que tena la culpa cuando Julio la gritaba o la ame-
nazaba. En efecto, muy pronto comenz a golpearla. Camila le dijo que estaba embarazada pero
a l no le import y los golpes siguieron de forma rutinaria. A los cinco meses de embarazo la
golpe tan fuerte que ella qued inconsciente y cuando se despert, se fue al hospital porque
senta que algo no andaba bien con su beb.
Sus sospechas se hicieron realidad cuando le dijeron que su beb estaba muerto y que tenan
que hacerle una cesrea para evitar una infeccin. Camila estaba en shock; todo haba pasado
muy rpido y, en lugar de preocuparse por su salud, pensaba en la reaccin de Julio cuando
supiera que su hijo ya no exista. El pnico la invadi y dej de dormir por muchos das, tratan-
do de encontrar una salida a lo que ella senta como su problema. Como nadie saba lo que le
haba pasado, Camila ide un plan desesperado: seguira con un embarazo ficticio; eso se poda
simular con algunos trapos en su abdomen y, mientras tanto, pensara en algo para recuperar a
ese beb perdido.
Efectivamente dise un abdomen de embarazo con espuma y tela, que le qued muy bien, y
enga a todos sus allegados con su embarazo ficticio. Pero los meses pasaron y se acercaba la
fecha del parto, as que Camila le dijo a todos que se iba a ver a una prima muy querida en Cali,

38
y que estara all 15 das y regresara antes de la fecha del parto. Julio se opuso pero Camila fue
tan insistente que l le dio permiso para el viaje.
Camila lleg a Cali y esper un par de das mientras ideaba algn plan que resultara relativamen-
te sencillo de ejecutar. Frente a su hotel haba un hospital muy grande y ella comenz a ver que
a todas horas mucha gente entraba y sala. Esto era una ventaja y entonces pens que all estaba
su solucin. Al tercer da ya tena bien controlado el horario de vigilancia de la entrada y supo
que, a cierta hora, el guarda iba a tomar caf y dejaba la puerta descuidada por dos minutos.
Camila compr un uniforme de enfermera y entr al hospital un jueves a las 8 de la maana,
salud y sigui en bsqueda de las salas de maternidad y de recin nacidos. Esper un buen rato
hasta que vio que una enfermera tomaba un nio que haba nacido la noche anterior y lo llevaba
al cuarto de su mam. La mam de este beb se llamaba Fabiola; era una madre joven y soltera
que no haba recibido muchas visitas, as que Camila decidi que iba a tomar ese beb. La enfer-
mera sali del cuarto de Fabiola, dej al beb en su cunita y Fabiola lo recibi llena de felicidad.
Estuvo con l algunos minutos y Camila entr a la habitacin, fingiendo su papel de enfermera,
y le dijo que deba llevarse al nio unos instantes para pesarlo y alimentarlo. Aunque Fabiola le
dijo que le pareca raro, finalmente accedi y entreg a su beb. Nunca hubiera imaginado la
desgracia y la angustia que estaban por comenzar. Camila tom al beb y, como era tan pequeo,
lo meti en su bolso y sali del hospital rpidamente.
Camila haba cometido un delito muy grave y nada poda justificar su manera de ac-
tuar. Tom el beb, se fue al hotel, llam a su prima y le dijo que ya haba tenido al
nio y que la ayudara a regresar a su ciudad cuanto antes. Camila lleg a su casa
y le ense su beb a toda la familia.
Todos estaban muy felices, pero las noticias comenzaron a ser cada vez ms
insistentes acerca del robo infame de un recin nacido en Cali; las cmaras
haban captado parte de la figura de la ladrona y mucha gente vio la noticia.
Sin embargo, alcanzaron a pasar 15 das en los que las cosas pare-
can haber salido bien. No obstante, un da lleg un agente de la
Polica a la casa de los padres de Camila. Desde ah, todo fue
una espiral de caos: una cmara haba captado el rostro de
Camila, los vecinos llamaron a decir que crean conocer
a la ladrona de bebs. En la clnica donde Camila fue
atendida por la agresin y la cesrea, hubo ms de una
persona que sospech de ella En fin, todo se le vino
abajo a Camila. La verdadera mam del beb robado,
Fabiola, interpuso una demanda inmediatamente y los
abogados de uno y otro lado comenzaron a buscar ar-
gumentos para defender a sus clientes. Pero el aboga-
do de Fabiola fue ms listo y consigui una autorizacin
del juez para pedir una prueba de ADN para el beb
cuestionado, y para Camila, Julio y Fabiola.

39
Preguntas de la primera parte

Conoce casos en Bogot similares al planteado? Qu caractersticas se le ocurren que


1. pueda usted utilizar de forma inmediata para identificar a un hijo en medio de varios bebs?
Cules respuestas dan ms informacin sobre el parentesco entre padres e hijos?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Compare los rangos de certeza de cada una de las respuestas de los estudiantes frente
2. al punto 1. Si hablan de ADN, indague un poco ms sobre el concepto que se maneja
en el grupo.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

Segunda parte

Las pruebas de ADN se haran el lunes en Cali, as que los implicados deban asistir al Instituto
de Paternidad y Pruebas Cientficas y presentarse muy temprano para la toma de muestras.
Sin embargo, algo inesperado sucedi: el avin donde venan Camila y Julio (los acusados) tuvo
un terrible accidente y no quedaron rastros de ellos. Se perdi su ADN y ahora su abogado
argument que, mientras no se demostrara lo contrario, el beb segua siendo de Camila y
deba pasar a la familia de ella. Fabiola estaba devastada: podran pasar meses y aos antes de
poder rescatar los restos de las vctimas e identificarlas; aun as, el ADN podra encontrarse
muy alterado, lo cual generara ms dudas que certezas.

40
Preguntas de la segunda parte

En el caso planteado, a qu factores se refiere cuando habla de alteracin del ADN?


1. Explore la estructura del ADN con sus estudiantes y mencione qu elementos estn
sujetos a alteraciones. Enumeren y discutan sobre los efectos de algunos factores sobre
la integridad de esta molcula.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Invite a que los estudiantes compartan casos en los que haya existido desaparicin
2. de muchos integrantes de una misma familia y se encuentren restos no identificados.
Qu otras alternativas existen para casos en los que el nico ADN con que se cuenta
es el del nio (o los sobrevivientes) y de los familiares?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
En los laboratorios donde se hacen las pruebas, los encargados de estos exmenes
3. usan mscaras, guantes y ropa de bioseguridad Por qu son tan cuidadosos en el
trabajo de laboratorio?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

41
Tercera parte
Esa maana, Fabiola comenz a buscar informacin y llam a su abogado emocionada cuando
ley que un caso muy parecido al de ella haba sido resuelto con el anlisis del ADN mitocon-
drial. Fabiola pidi una cita con el director de Medicina Legal y le solicit que le explicara de
qu se trataba esta prueba, de la que ella nunca haba escuchado. Despus de escuchar su caso,
el director, un hombre joven y con una gran sonrisa, le dijo:
Aqu la mejor opcin es hacer una prueba de ADN mitocondrial pues ante la ausencia de
los supuestos padres y de su pareja, lo mejor es establecer una relacin gentica por lnea
materna.
Doctor, ya llam a mi abogado, viene para ac. Mientras l llega, explqueme qu es eso del
ADN.
Se trata de una marca gentica que se transmite solo de la mujer a todos los hijos que ella
tenga, sin importar que sean hombres o mujeres, y seguir siendo transmitida a los hijos de
sus hijas.
Fabiola se puso feliz al escuchar esta opcin, pero sigui preguntando:
Qu diferencias hay entre el ADN nuclear y el mitocondrial?
El ADN es el mismo para todas las clulas, por lo que si se encuentra aunque sea una sola
clula, se puede extraer su ADN y compararlo con las muestras problema. Esto ocurre por-
que cada persona tiene una nica combinacin de ADN. Pero para este anlisis es deseable
tener a todos los miembros vinculados al caso: el pap, la mam y el supuesto hijo. As, la
confianza aumenta mucho ms en un juicio. Las mitocondrias en cambio tienen su propio
ADN, es mucho ms corto que el ADN nuclear y, por lo tanto, es ms fcil estudiarlo.
Pero por qu solo las mujeres pueden pasarlo a sus hijos? Acaso en la fecundacin no
ocurre un intercambio a todo nivel?
No, Fabiola, no ocurre as. La razn es que el espermatozoide es una clula mucho ms
pequea que el vulo, porque casi en su totalidad est hecha de un ncleo con su ADN
nuclear; de ah que lo nico que transmite es lo que tiene. El vulo, por su lado, es una clula
ms grande que tiene sus mitocondrias con su ADN, por lo cual el cigoto que se comienza
a desarrollar mantiene el ADN nuclear de ambos, pero el ADN mitocondrial es el de la
mam. Comprende mejor ahora, Fabiola?
S, ahora ya comprendo mejor y creo que esto es lo nico que puede devolverme a mi hijito.
Cuando el abogado entr, les explic un poco ms sobre el anlisis y se ofreci a colaborar
con el caso. El anlisis consiste en analizar alrededor de 700 letras (nucletidos), que
deben coincidir perfectamente entre el hijo y su lnea materna.

42
Preguntas de la tercera parte
Vea el video disponible en: http://www.youtube.com/watch?v=Lf9wnPCKSsY (Viaje
1. desde frica: el ADN mitocondrial) y conteste: Para qu propsitos de estudio se ha
utilizado este ADN? Las tcnicas usadas en ADN nuclear y mitocondrial son similares?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Qu quiere decir que haya mutaciones aleatorias e inocuas? Describa la importan-
2. cia de que ellas surjan entre las mujeres y sus hijos.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Basados en el documental Origen del hombre y su evolucin (Eva Mitocondrial), pida
3. a sus estudiantes que elaboren un mapamundi donde se sealen los distintos grupos
humanos, las migraciones y el establecimiento de poblaciones humanas. Relacione
este ejercicio con la variabilidad de los seres humanos.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________

43
Parte final
Se hizo el anlisis gentico y los resultados fueron satisfactorios para Fabiola, que, en medio de
una gran felicidad, recuper a su beb. En esta oportunidad la ciencia ayud a resolver un caso que
hace 50 aos hubiera quedado inconcluso. Fabiola tena dos hermanos, una hermana; y su mam y
su abuela estaban vivas, por lo que fue sencillo establecer el parentesco del beb con esta familia.
El cotejo realizado por los peritos de Medicina Legal comprob, con una probabilidad superior
al 99,999998%, la idea de que Fabiola era la madre biolgica del beb raptado y rescatado por la
Polica, que estuvo bajo proteccin de la entidad encargada del cuidado de los nios en estado
de indefensin.
Nota: Esta historia es totalmente ficticia, as como los nombres
y todas las situaciones que se plantean.

Actividad integradora
En el Instituto de Medicina Legal, qu tan asequible es esta prueba?
En los laboratorios privados, a cunto asciende el costo, en pesos colombianos, de
las dos pruebas? Una visita o consulta podra ser muy interesante.

Bibliografa
Colprensa (2011). Rescatan beb robada, tras hacerle cesrea casera a su ma-
dre. Santa Marta, Colombia. Publicado el 2 de septiembre de 2011. Consultado
el 8 de nov. de 2014.
El Colombiano (2014). Disponible en : http://www.elcolombiano.com/BancoCo-
nocimiento/R/rescatan_bebe_robada_tras_hacerle_cesarea_casera_a_su_madre.
Consultado el 8 de nov. de 2014.
Instituto de Medicina Legal y Ciencias Forenses (2014). Disponible en : http://
www.medicinalegal.gov.co/medicina-legal-identifica-a-bebe-extraida-del-vien-
tre-de-su-mama;jsessionid=083963C951C7C47266881F6FCD8646E3. Consul-
tado el 8 de nov. de 2014.
Ribbens, E. y Lydeard, A. (2013) Thomas and Sally: The Interplay of Scientific and
Historical Evidence. Disponible en: National Center for Case Study Teaching in
Science. Department of Biological Sciences. Western Illinois University, Macomb, IL

44
Intercambio de nutrientes
y energa en un lago
de inundacin de la Amazonia
colombiana
Estudio de caso
Qu debe saber el estudiante
antes de realizar esta actividad?
Ecosistemas
Fotosntesis
Comunidad econlgica
Qu aprender el estudiante despus
de realizar esta actividad?
Redes y cadenas trficas
Relaciones interespecficas
Productividad

Primera parte Si toda la humanidad desapareciera, el mundo


podra regenerarse y regresar al estado de []
hace 10.000 aos. Si los insectos desaparecieran,
El planeta Tierra recibe una gran cantidad de ener- el ambiente colapsara en el caos.
ga lumnica del Sol. Parte de ella se refleja en la E. O. Wilson
atmsfera, en los espejos de agua, ayuda a calentar
la superficie del planeta, participa en la evapora-
cin del agua, en el movimiento de las mareas, y
una mnima cantidad queda disponible para los organismos que pueden capturarla y transformarla.
Estos organismos son en su mayora las plantas y las microalgas, las cuales toman esta energa
lumnica y la transforman en energa qumica empacada en azcares simples que pueden ser trans-
formados en carbohidratos ms complejos mediante un proceso conocido como fotosntesis.
Como en cualquier sistema, la transferencia de energa en los ecosistemas est gobernada por
los principios termodinmicos. Estos plantean, primero, que la energa no se crea ni se des-
truye, sino que se transforma; segundo, que de la energa contenida en un sistema, solo una
parte quedar disponible para realizar trabajo, pues el resto de la energa se pierde en procesos
de entropa (tendencia al desorden) y se mide en forma de calor.
Un ecosistema est definido por las condiciones ambientales y por la comunidad ecolgica
que lo compone, es decir, por los grupos de distintas especies que se encuentran en l. Los
organismos que forman estas comunidades presentan interacciones alimentarias o trficas. En
estas, cada organismo se alimenta del otro y as obtiene la energa necesaria para realizar sus
funciones vitales. Existen dos maneras de representar estas relaciones: mediante las cadenas
trficas, que son una representacin grfica de la transferencia de energa en estos organismos;
y mediante las redes trficas, las cuales ilustran el mapa de las relaciones alimentarias entre
los organismos (Andramunio-Acero y Caraballo, 2012). Las relaciones trficas son aquellas que
permiten que haya una transferencia de energa y nutrientes a travs de los organismos.
De acuerdo con la funcin que cada uno de los organismos lleva a cabo en las cadenas trficas,
se pueden clasificar en productores, herbvoros, carnvoros primarios, carnvoros secundarios y
descomponedores. Los productores son todos aquellos organismos fotosintticos capaces de
transformar la energa lumnica en energa qumica. Los herbvoros son animales que consu-
men nicamente organismos productores. En el caso de los carnvoros, estos se van a alimentar
especficamente de animales.
46
Preguntas
Qu son los ciclos biogeoqumicos?, los ciclos biogeoqumicos se enfocan en la
1. transferencia de energa o en los nutrientes?
_____________________________________________________________________
_____________________________________________________________________
Qu son las pirmides energticas? Cmo se les aplican los dos principios de la ter-
2. modinmica? Cmo se relacionan con las cadenas y redes trficas?
_____________________________________________________________________
_____________________________________________________________________
Una comunidad hipottica est formada por los organismos que se muestran a con-
3. tinuacin. Utilizando los dibujos represente cmo seran la cadena y la red trficas.
_____________________________________________________________________
_____________________________________________________________________

Imagen Organismo Fuente de energa

Pastos Sol

Coates Animales y Plantas

47
Imagen Organismo Fuente de energa

Tapires Hojas

Jaguares Animales

Mono araa Frutas

48
Imagen Organismo Fuente de energa

Pava
Hojas
hedionda

rboles Sol

guila
Animales
arpa

49
Segunda parte
La regin amaznica se caracteriza por presentar altas precipitaciones (lluvias), en
mayor proporcin durante los meses de marzo y abril (figura 5). Esto hace que algu-
nos ecosistemas amaznicos cambien a lo largo del ao. Este es el caso de los lagos
inundables (vrzeas), que son ms evidentes durante las pocas de mayores precipita-
ciones. Es interesante entonces estudiar y comprender cmo funcionan las cadenas y
redes trficas de estos ecosistemas.

F C Altitud: 78 m Temperatura promedio: 26 C Precipitacin anual: 2846 mm mm


320 160 320
302 150 300
284 140 280
266 130 260
248 120 240
230 110 220
212 100 200
194 90 180
176 80 160
158 70 140
140 60 120
122 50 100
104 40 80
86 30 60
68 20 40
50 10 20
32 0 0
Ene Feb Mar Abr May Jun Jul Ago Sep Oct Nov Dic

Figura 5. Climograma en Leticia, Amazonas para el ao 2013. Imagen reelaborada apartir de la original:
http://www.ingenioambiental.org/2013/10/climograma-de-leticia-amazonas_8.html

Teniendo en cuenta la figura 5, dgales a sus estudiantes que elaboren una red con
los organismos de la red trfica en abril y cmo ser el cambio de estas poblaciones
en julio. Pida a sus estudiantes que discutan sobre los cambios propuestos.
Algunos organismos tienen adaptaciones en su cuerpo que les dan ciertas ventajas
para vivir en estos ecosistemas. Pida a los estudiantes que indaguen acerca de estas
caractersticas.

50
Preguntas
En este ecosistema, qu tipo de organismos sera el de los productores?, cules los
1. herbvoros?, cules los carnvoros?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Haga un esquema de cules sern las relaciones trficas entre los organismos men-
2. cionados en la pregunta1.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Cmo cree que cambiar la comunidad durante las pocas de menor precipitacin?
3. Cmo se vern afectadas las cadenas trficas?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Es un hecho bien conocido que los organismos productores son aquellos que man-
4. tienen toda la biodiversidad del planeta, y que posiblemente podran desaparecer. Sin
embargo, los productores han desarrollado defensas qumicas y mecnicas que los
protegen. Cules son esas defensas?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
Teniendo en cuenta la interaccin entre productores y consumidores, investigue y
5. explique la hiptesis de la Reina Roja.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

51
Tercera parte
En 2012, Andramunio-Acero y Caraballo lo- Los bosques inundables de vrzea se en-
graron determinar cules eran las relaciones cuentran seriamente amenazados debido a
alimentarias entre los organismos que habitan dos causas principales: la deforestacin y la
los lagos inundables de Yahuarcaca, en la Ama- pesca extensiva. En el primer caso son objeto
zonia colombiana (figura 6). Como se puede de deforestacin especies como la lupuna y
apreciar en esa figura, las relaciones en esta la virola, por ser plantas maderables de alto
comunidad son bastante complejas, debido a valor comercial. En el caso de la pesca, esta
que un solo depredador, como las aves piscvo- se encuentra enfocada en la extraccin de pe-
ras, puede alimentarse de distintos organismos, ces depredadores y omnvoros. En los ltimos
(carnvoros y herbvoros). Adicionalmente, esta aos, estas dos actividades han aumentado de
comunidad depende exclusivamente de las al- forma considerable, amenazando seriamente
gas y de la vegetacin de vrzea, de tal manera la conservacin de estos ecosistemas y de las
que si algunos de estos organismos desapare- comunidades que all se estructuran.
cen, se pondrn en peligro todas las especies
que se alimentan de ellos.
Aves (piscvora)
Figura 6. Representacin de la red trfica que se presenta en los lagos
inundables de Yahuarcaca (Adaptado de: Andramunio-Acero
y Caraballo, 2012)

redadores)
dep s)
s(
ra
e
Pec

Aves (insectvo

s (filtradores) cton (carniv gr


Aves ( anvoras ectos (carnvoro es (omnvoro
Pec
e plan or Ins Pe c s)
oo ) s
os)
Z

)
)
oros
Ma

roi
verteb dos (car
nv

n
c

ra res) c tos (herbv


oro
s) rado Inse oro
filt
v

s(

s)
lancton (herb

nvertebrado
croi
p
Zoo

Ma

A lg a s tacin de varzea
ege
V

52
Preguntas
Cmo se podran afectar las cadenas trficas mostradas en la figura 6 con la desa-
1. paricin de la vegetacin de vrzea?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

2. Qu efecto tendra la extincin local de los peces depredadores en este ecosistema?


Recuerde mencionar qu sucedera con los tamaos poblacionales de los organismos
que tienen relaciones trficas con estos peces.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

3. Discuta con sus compaeros algunas alternativas para las comunidades que obtienen
su sustento de la explotacin comercial de estas especies amaznicas. Incluya en la
discusin las fallas que el Estado puede tener tanto en el control de estas actividades
como en el apoyo efectivo a las comunidades que habitan en una de las zonas ms
ricas en diversidad biolgica que hay en el planeta.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________

53
Bibliografa
Andramunio-Acero, C. y P. Caraballo (2012). Anlisis de las relaciones trficas
en un lago de inundacin de la Amazonia colombiana". Revista Colombiana
de Ciencia Animal 4(1): 102-120.
Smith, T. y Smith, R. (2007). Ecologa. 6 ed. Madrid: Pearson Education S.A.

54
Sinapsis neuronal:
una visin desde la biologa,
la fsica y la qumica
Actividades integradoras

55
Qu debe saber el estudiante
antes de realizar esta actividad?
Sistema nervioso central
Neurona
Tipos de neuronas
Qu aprender el estudiante despus
de realizar esta actividad?
Impulso nervioso
Sinapsis

La actividad espontnea de conjuntos especializados


de neuronas impulsa al organismo a explorar y
poner a prueba continuamente el medio ambiente
fsico, social y cultural, a obtener respuestas y
confrontarlas con lo que ya posee en la memoria.
Jean-Pierre Changeux

Figura 7. Imagen tomada de: http://mscfabiancuesta.


blogspot.com/2011/02/wetware.html
Fuente: Neuromarketing (Fabin Cuesta A.)

56
Primera parte

Biologa. La clula neuronal


La neurona es la unidad funcional del sistema nervioso y es en su membrana plas-
1. mtica donde se generan las seales elctricas que conocemos como impulsos ner-
viosos o potenciales de accin. Estos potenciales conducen las seales desde una
localizacin sobre la neurona hasta lugares ms distantes. La mayora de neuronas
est compuesta por cuatro regiones: un cuerpo celular, que contiene el ncleo y los
organelos; las dendritas, que reciben la informacin de otras neuronas; el axn, que
lleva la informacin a travs del impulso desde el cuerpo celular; y los terminales
del axn, donde ocurre la sinapsis con otras clulas, como se muestra en la figura 7
(Purves et l., 2003).

Actividad 1. Biologa de las neuronas


Dibuje los diferentes tipos de neuronas y analice sus diferencias morfolgicas, descri-
biendo cmo se relaciona la morfologa con la funcin.

Neurona unipolar Neurona bipolar Neurona multipolar


(Sensitiva) (Asociacin) (Motora)

Anlisis Anlisis Anlisis

57
Segunda parte
Fsica. Sinapsis elctrica e impulso nervioso
Las clulas neuronales son elctricamente negativas en su interior en comparacin
2. con el exterior. La diferencia de potencial elctrico, voltaje, a travs de la membrana
plasmtica de una clula es conocida como potencial de membrana. Una neurona que
no ha sido estimulada muestra una diferencia de voltaje llamado potencial de reposo
(Purves et l., 2003).
Segn el modelo fsico, el impulso nervioso es una onda que se propaga a travs del axn
y este es una prolongacin de las neuronas. A ambos lados (exterior e interior) de la mem-
brana coexisten cationes sodio y potasio, pero en el exterior es significativamente mayor
el nmero de los de sodio, mientras no se produce la excitacin nerviosa (Gonzlez, 2010).

Actividad 2. Biofsica del impulso nervioso


Con base en el artculo sobre la biofsica del impulso nervioso que est disponible en:
http://www.neurologia.com/pdf/Web/4109/t090538.pdf:
a. Describa para qu se aplican la ecuacin de Nernst y la ecuacin de
Goldman-Hodkin-Katz.
_______________________________________________________________
b. Piense ahora en cmo realizar un experimento para medir el impulso elctrico en
los msculos. Cmo lo hara? Qu materiales necesita? Qu datos tomara?
Organice siempre su informacin en un formato que le permita retroalimentar su
diseo experimental. Una propuesta es comenzar con los materiales y reactivos,
luego la metodologa en forma de pasos numerados o en un diagrama de flujo, y
por ltimo los resultados.
_______________________________________________________________

Tercera parte
Qumica. La sinapsis qumica
La sinapsis qumica ocurre en el axn terminal de la neurona, gracias a los neuro-
3. transmisores, que se encargan de llevar el mensaje qumico liberado por la clula

58
presinptica, que se une al receptor proteico de la membrana postsinptica e induce
cambios en esta clula. Eso significa que la comunicacin de nuestras neuronas es
neuroqumica, lo que explicara que haya personas que producen mayor o menor
cantidad de ciertos transmisores qumicos y, por lo tanto, ante un mismo estmulo,
las reacciones pueden ser muy similares o muy distintas en varias personas. Piense
por ejemplo en el trmino adiccin. Le dice algo? Al parecer las tendencias a las
adicciones pueden tener una relacin mayor o menor con las condiciones genticas
de las personas. Esto quiere decir que as como los genes codifican las caractersticas
fsicas, tambin lo hacen en la produccin de sustancias qumicas, lo que podra ex-
plicar que en ciertas familias haya ms tendencia que en otras a depender del alcohol,
los antidepresivos o las drogas (Prez Rubio et l., 2011).
Actividad 3. Neurotransmisores
Investigue la funcin de los siguientes neurotransmisores

Neurotransmisor Funcin
Dopamina
Acetilcolina
Norepinefrina
GABA
Serotonina
Glutamato
Noradrenalina

Cmo afecta al proceso de sinapsis el uso de sustancias estimulantes, como las dro-
gas (cocana, nicotina)? Se dara la sinapsis de forma normal?, qu pasara?
_______________________________________________________________
Investigue el efecto de las siguientes sustancias sobre la sinapsis.
Sustancia Neurotransmisor involucrado Efectos
Alcohol (Etanol)
Nicotina
Cafena
Cannabis
Anfetaminas
Extasis
Cocana
Herona
Tranquilizante (Valium)
Antidepresivos (Prozac)

59
Pida a sus estudiantes que consulten los efectos de consumir dos o ms de
estas sustancias de manera simultnea.
Algunas personas han muerto por sobredosis. A qu se refiere este trmi-
no? Por qu una sobredosis puede llevar a la muerte? Cuntos jvenes
mueren al ao en Colombia por abuso de sustancias psicoactivas?

Actividades
complementarias
Observe los siguientes vdeos en Youtube:
Neuronas y neurotransmisores:
https://www.youtube.com/watch?v=MK8fxmgrwp4
Sinapsis:
https://www.youtube.com/watch?v=vwk5OutMq80

Discuta con sus compaeros la efectividad de las campaas contra el uso y abuso
1. de las drogas psicoactivas, incluidos el alcohol y el cigarrillo. Cree que es efectivo
el uso de fotografas y mensajes directos en las cajas de cigarrillos, donde hablan de
los efectos de su uso? En Europa, Estados Unidos y otros pases donde se estn le-
galizando muchas drogas, hay argumentos que sustentan estas decisiones, y, adems,
los fabricantes pagan impuestos muy altos. Discutan acerca de esa posibilidad y sus
consecuencias sobre la salud pblica, la seguridad y el gasto.

Bibliografa
Gonzlez, J. (2010). La biofsica del impulso nervioso.
Disponible en: http://casanchi.com/fis/biofisica01.pdf
Purves, W., Sadava, D., Orians, G. y Heller, H. (2003). Vida: la ciencia
de la biologa. 6. ed. Madrid: Mdica Panamericana.
Prez-Rubio, G., Urdapilleta, E., Camarena, ., Resndiz-Hernndez, J. Mn-
dez, M., Ramrez, A., Sansores, R, Falfn-Valencia, R. (2011). Visin general
de la neurobiologa y gentica en la adiccin a la nicotina. Neumol. Cir.
Torax. 70(3): 179-187. Mxico: UNAM.

60
Identificando
nuestra biodiversidad
Proyecto de aula
Introduccin
Una de las sorpresas ms agradables [...]
al comprometernos totalmente con algn
proyecto especfico es que surgen fuerzas
y oportunidades que no hubiramos imaginado
hasta entonces.
Cleri Estrada Domnico

El proyecto de aula es otra forma de aprendizaje activo que surge con base en la
pedagoga por proyectos. Al trabajar en esta modalidad, los estudiantes tienen la
posibilidad de trabajar en equipo, pueden involucrar a sus padres, y el docente actua-
r como gua del proceso de aprendizaje. Sin embargo, son los estudiantes quienes
deciden qu proyecto realizar, para qu hacer ese proyecto, cmo realizarlo, cundo
hacerlo y dnde llevarlo a cabo.
Para empezar, es importante que los estudiantes formen un equipo de trabajo y
despus, entre todos, concreten la temtica sobre la cual les gustara desarrollar su
proyecto. El proyecto de aula que aqu presentamos tiene como eje central el conoci-
miento de la biodiversidad, ya sea local (Bogot) o nacional (Colombia). El desarrollo
de este proyecto har que los estudiantes logren identificar la biodiversidad fun-
damentndose en los siguientes objetivos, que les ayudarn a aprender sobre estas
temticas.

Objetivos
Explicar diferentes relaciones que se observen entre especies del ecosistema que est
trabajando en su proyecto.
Establecer relaciones entre individuo, poblacin, comunidad y ecosistema de estudio.
Comparar las adaptaciones de los seres vivos en el ecosistema de su proyecto.

Metodologa
Si los estudiantes deciden trabajar en el conocimiento de la biodiversidad local, podran
centrarse en los humedales de Bogot, y luego cada equipo decidir en qu humedal
trabajar y con cules especies u organismos. En el caso de que su inters sea la biodi-
versidad nacional, podran tener muchas opciones de trabajo; por ejemplo, en el Jardn
Botnico de Bogot podran empezar por analizar una muestra de los ecosistemas y la
flora de nuestro pas.

62
Identificar el problema, plantear los obje-
tivos y realizar una investigacin sobre el
ecosistema y las especies involucradas.

Cmo, cundo y dnde? realizar el pro-


yecto (recursos, herramientas analticas,
instrumentos.

Cumplir con los objetivos, presentacin


de resultados y hacer una propuesta de
socializacin.

Figura 8. Esquema de trabajo para el desarrollo del proyecto de aula.

Para empezar a trabajar es indispensable hacer segn lo que quieran trabajar, tras consultarle
recopilacin de informacin, por lo cual po- a su profesor; de esta forma pueden definir el
dran empezar a revisar los enlaces de inters tema y el ttulo del proyecto de aula que van
y los videos de Youtube sugeridos en este do- a desarrollar.
cumento. All pueden encontrar informacin La organizacin es una pieza clave para el
que les sera de gran utilidad para buscar ideas xito del proyecto. Es importante hacer un
de cmo encaminar su proyecto. Sin embargo, cronograma de actividades: bsqueda y reco-
pueden buscar en otros recursos de internet,

63
pilacin de informacin, visita de su lugar de jardn o el lugar en el que decidieron traba-
estudio, observacin y toma de datos. No olvi- jar. Cuando se encuentren en el lugar, pueden
den seguir su esquema de organizacin hasta observar el ecosistema, los organismos que all
el final del proyecto, y no dejen de concluir se encuentran, identificar las relaciones entre
con el anlisis de datos, la discusin de resul- organismos, su cantidad o poblacin, etc. Es
tados y la redaccin del documento final del importante la investigacin previa para po-
proyecto de aula. der identificar las especies de su proyecto, as
Es indispensable que en el desarrollo del pro- como sus relaciones. Recuerde tomar fotogra-
yecto participen todos los compaeros com- fas o realizar dibujos de esas especies. Tam-
prometidos con el proyecto. Adicionalmente, bin es importante la toma de apuntes, para
los estudiantes pueden decirles a sus padres que luego puedan plantear adecuadamente
que los acompaen a visitar el humedal, el sus ideas en el desarrollo del proyecto.

Ttulo de proyecto de aula Metodologa


Debe ser atractivo, de modo que describa el conte- Suministra la base para que otros puedan repetir los
nido del artculo en forma especfica clara, exacta experimientos o metodologa usada. Debe definirse la
breve y concisa. descripcin de los mtodos de anlisis y tratamiento de
la informacin (anlisis estadstico).
Autores
Resultados
Nombre de los estudiantes que elaboraron
el proyecto. Deben describir en prrafos las observaciones realiza-
das, as mismo se pueden hacer tablas o grficas que
Resumen deben referenciarse en el texto.

Identifica de forma rpida y exacta el contenido b-


Discusin
sico del artculo. Debe estructurarse con un breve
contexto, el objetivo, diseo o metodologa, resulta- Examina e interpreta los resultados obtenidos teniendo
dos y conclusiones. El texto debe tener entre 150 y en cuenta la coherencia y las contradicciones. Observa
300 palabras. las implicaciones de los resultados con respecto a las
hiptesis originales y postulan nuevos conocimientos e
Palabras claves hiptesis. Confrontan y comparan con otros datos an-
teriores.
Son aquellas palabras relevantes de acuerdo al tema
y las que identfican el estudio.
Conclusiones
Introduccin Se debe tener en cuenta que se hayan cumplido los
objetivos del proyuecto.
Identifica ntidamente el problema, deben resaltar
trabajos y contribuciones de otros autores del tema
objeto de estudio. La introduccin va de lo que ms
Bibliografa
general a lo ms especfico, tambin deben incluir la Registrar las fuentes bibliogrficas utilizadas en la
justificacin del proyecto y los objetivos. Es impor- introduccin o en la discusin, de acuerdo con normas
tante citar la informacin suministrada de la fuente APA o Icontec.
bibliogrfica usando las normas APA o Icontec.

64
Evaluacin

El profesor es el encargado de realizar la evaluacin del proyecto de aula realizado.


Como este ejercicio es un primer acercamiento a la investigacin, se sugiere que el
producto final sea un artculo, que es un documento escrito que consta de ttulo,
autores, resumen, palabras clave, introduccin, metodologa, resultados, discusin,
conclusiones y bibliografa, como se muestra en la pgina anterior. Asimismo, es im-
portante que se socialice el proyecto con los dems compaeros por medio de una
presentacin; para ello se puede apoyar en diapositivas realizadas en Power Point o
en Prezi.

Actividades
complementarias

Flora colombiana COLOMBIVA: https://www.youtube.


com/watch?v=xAFZw02JhGk
Humedales COLOMBIVA: https://www.youtube.com/wat-
ch?v=YoPCJnAIvR8&list=PL2626F32C48DF15F6
Humedales de Bogot: https://www.youtube.com/wat-
ch?v=b7-JlHFgb1g

Enlaces de inters:
Sistema de Informacin sobre Biodiversidad de
Colombia: http://www.sibcolombia.net/
Humedales de Bogota: http://humedalesbogota.
com/
Jardn Botnico de Bogot: http://www.jbb.gov.co/
Artculo Biodiversidad Bogotana: http://avalon.
utadeo.edu.co/dependencias/publicaciones/ta-
deo_67/67089.pdf

65