Anda di halaman 1dari 12

4.

MOLECULAR BASIS OF INHERITANCE


Nucleic acids (DNA & RNA) are the building blocks of genetic material.
DNA is the genetic material in most of the organisms.
RNA is the genetic material in some viruses. RNA mostly functions as messengers.
STRUCTURE OF POLYNUCLEOTIDE
CHAIN
Polynucleotides are the polymer of nucleotides. DNA & Nucleosides in RNA Nucleosides in DNA
RNA are polynucleotides. A nucleotide has 3 components: Adenosine Deoxyadenosine
1. A nitrogenous base Guanosine Deoxyguanosine
2. A pentose sugar (ribose in RNA & deoxyribose in DNA) Cytidine Deoxycytidine
3. A phosphate group Uridine Deoxythymidine
Nitrogen base + sugar + phosphate group = Nucleotide
Nitrogen bases are 2 types

Purines: It includes Adenine (A) and Guanine (G). (deoxyribonucleotide).

Pyrimidines: It includes Cytosine (C), Thymine (T) & In RNA, every nucleotide residue has an additional OH
Uracil (U). Thymine (5-methyl Uracil) present only in group present at 2'-position in the ribose.
DNA) and Uracil only in RNA. 2 nucleotides are linked through 3-5 phosphodiester
A nitrogenous base is linked to the pentose sugar through an bond to form dinucleotide.
N-glycosidic linkage to form nucleoside. When more nucleotides are linked it forms polynucleotide.
STRUCTURE OF
DNA

Friedrich Meischer (1869): Identified DNA and named it DNA is made of 2 polynucleotide chains coiled in a right
as Nuclein. handed fashion. Its backbone is formed of sugar &

James Watson & Francis Crick proposed double helix phosphates. The bases project inside.
model of DNA. It was based on the X-ray diffraction data
The 2 chains have anti-parallel polarity, i.e. one chain
produced by Maurice Wilkins & Rosalind Franklin. has the polarity 53 and the other has 35.

The bases in 2 stands are paired through H-bonds
forming base pairs (bp).
A=T (2 hydrogen bonds) CG (3 hydrogen bonds)

Purine comes opposite to a pyrimidine. This generates
uniform distance between the 2 strands.

Erwin Chargaffs rule: In DNA, the proportion of A is
equal to T and the proportion of G is equal to C.
i.e, [A] + [G] = [T] + [C] or [A] + [G] / [T] + [C] =1

Length of DNA = number of base pairs X distance
between two adjacent base pairs.
174 (a bacteriophage) has 5386 nucleotides.
Bacteriophage lambda has 48502 base pairs (bp).
6
E. coli has 4.6x10 bp.
9
Haploid content of human DNA is 3.3x10 bp.
Number of base pairs in human = 9
6.6 x 10
Hence, the length of DNA =
6.6 x10 x 0.34x 10
9 -9
=
2.2 m
In E. coli, length of DNA -3
=1.36 mm (1.36 x 10 m)
The number of base pairs 1.36x10
3
= 9
0.34 x 10

6
=
4 x 10 bp

PACKAGING OF DNA
HELIX

In prokaryotes (E.g. E. coli), the DNA is not scattered Histones are rich in positively charged basic amino
throughout the cell. DNA, being negatively charged, is held acid residues lysines and arginines.
with some positively charged proteins and form nucleoid.
8 histones form histone octamer.

In eukaryotes, there is a set of positively charged, Negatively charged DNA is wrapped around histone
basic proteins called histones. octamer to give nucleosome.

1

Nucleosomes in chromatin = beads-on-string.

Chromatin is packaged chromatin fibres coiled and
condensed at metaphase stage chromosomes.

Higher level packaging of chromatin requires non-histone
chromosomal (NHC) proteins.

Chromatins include
Euchromatin: Loosely packed and

A typical nucleosome contains 200 bp. transcriptionally active chromatin and stains light.
Therefore, the total number of nucleosomes in human =
6.6x109 bp
Heterochromatin: Densely packed and inactive
= 3.3x107

region of chromatin and stains dark.


200

Nucleosomes constitute the repeating unit to form


chromatin. Chromatin is the thread-like stained bodies.

THE SEARCH FOR GENETIC


MATERIAL

1. Griffiths experiment (Transforming Digestion of protein and RNA (using Proteases and
principle) RNases) did not affect transformation. So the
transforming substance was not a protein or RNA.

Griffith used mice & Streptococcus pneumoniae. Digestion of DNA with DNase inhibited transformation. It
Streptococcus pneumoniae has 2 strains- means that DNA caused transformation of R cells to S
cells, i.e. DNA was the transforming substance.
Smooth (S) strain (Virulent): Has polysaccharide 3.Hershey-Chase Experiment (Blender
mucus coat. Cause pneumonia. Experiment)
Rough (R) strain (Non-virulent): No mucous coat.
- Hershey & Chase made 2 preparations of bacteriophage -
Does not cause Pneumonia. 35
In one, proteins were labeled with S by putting in
Experiment:
medium containing radioactive sulphur (S-35). In the
S-strain Inject into mice Mice die 32
second, DNA was labeled with P by putting in a
R-strain Inject into mice Mice live
medium containing radioactive Phosphorous (P-32).
S-strain (Heat killed) Inject into mice Mice - These preparations were used separately to infect E. coli.
live
- After infection, the E. coli cells were gently agitated in a
S-strain (Hk) + R-strain (live) Inject into mice
blender to separate the phage particles from the bacteria.
Mice die
He concluded that some transforming principle, - Then the culture was centrifuged. Heavier bacterial cells are
transferred from heat-killed S-strain to R-strain. It enabled R- formed as a pellet at the bottom. Lighter viral components
strain to synthesize smooth polysaccharide coat and become outside the bacterial cells remained in the supernatant.
virulent. This must be due to the transfer of genetic material. - They found that:
35
2. Biochemical Supernatant contains viral protein labeled with S , i.e.
characterization of the viral protein had not entered the bacterial cells.
transforming principle The bacterial pellet contains radioactive P. This shows
32
- Oswald Avery, Colin MacLeod & Maclyn McCarty that viral DNA labeled with P had entered the bacterial
worked to determine the biochemical nature of cells. This proves that DNA is the genetic material.
transforming principle in Griffiths experiment.
- They purified biochemicals (proteins, DNA, RNA etc.)
from heat killed S cells using suitable enzymes.
- They discovered that
PROPERTIES OF GENETIC
MATERIAL
A genetic material must Reasons for stability Reasons for mutability
Be able to generate its replica (Replication). (less reactivity) of DNA (high reactivity) of RNA
Chemically and structurally be stable. Double stranded Single stranded
Provide the mutations that are required for Presence of thymine Presence of Uracil
evolution. Absence of 2-OH Presence of 2-OH
Be able to express itself as Mendelian Characters.
The 2 DNA strands are complementary. On heating,
DNA is a better genetic material they separate. When appropriate conditions are provided they
- Due to unstable nature of RNA, RNA viruses (E.g. Q.B come together. (In Griffiths experiment, when the bacteria
bacteriophage, Tobacco Mosaic Virus etc.) mutate and were heat killed, some properties of DNA did not destroy).
evolve faster.
RNA WORLD
- For the storage of genetic information DNA is better due
RNA was the first genetic material.
to its stability. But for the transmission of genetic
It acts as genetic material and catalyst.

information, RNA is better. Essential life processes (metabolism, translation, splicing

etc) evolved around RNA.
- RNA can directly code for the protein synthesis, hence DNA evolved from RNA for stability.
can easily express the characters. DNA is dependent on
2
RNA for protein synthesis.
CENTRAL DOGMA OF MOLECULAR
BIOLOGY

Messelson & Stahls Experiment


A unit of replication with one origin is called a
It is proposed by Francis Crick. It states that the genetic
replicon.
information flows from DNA RNA Protein.

DNA REPLICATION
Replication is the copying of DNA from parental
DNA.
Watson & Crick proposed Semi-conservative
model of replication. It suggests that the parental DNA
strands act as template for the synthesis of new
complementary strands. After the completion of
replication, each DNA molecule would have one parental
and one new strand.
Matthew Messelson & Franklin Stahl (1958)
experimentally proved Semi-conservative model.
15
They cultured E. coli in a medium containing NH4Cl
15 15
( N: heavy isotope of N). N was incorporated into both
strands of bacterial DNA and the DNA became heavier.
14
Another preparation containing N salts labeled with N is
14
also made. N was also incorporated in both strands of
DNA and became lighter.
These 2 types of DNA can be separated by centrifugation
in a CsCl density gradient.
15
They took E. coli cells from N medium and transferred
14
to N medium. After one generation (i.e. after 20
minutes), they isolated and centrifuged the DNA. Its
15
density was intermediate (hybrid) between N DNA
14
and N DNA. This shows that the newly formed DNA
15 14
one strand is old ( N type) and one strand is new ( N
type). This confirms semi-conservative replication.
After II generation (i.e. after 40 minutes), there was equal
amounts of hybrid DNA and light DNA.
Taylor & colleagues (1958) performed similar experiments
on Vicia faba (faba beans) using radioactive thymidine to
detect distribution of newly synthesized DNA in the
chromosomes. It proved that the DNA in chromosomes also
replicate semiconservatively.
The Machinery and Enzymes for
Replication
DNA replication starts at a point called origin (ori).
During replication, the 2 strands unwind and
separate by breaking H-bonds in presence of an enzyme,
Helicase.
In the presence of an enzyme, DNA dependent DNA
Unwinding of the DNA molecule at a point forms a
Y-shaped structure called replication fork. polymerase, many nucleotides join with one another to
The separated strands act as templates for the primer strand and form a polynucleotide chain (new strand).
synthesis of new strands. The DNA polymerase forms one new strand (leading
DNA replicates in the 53 direction. strand) in a continuous stretch in the 53 direction
Deoxyribonucleoside triphosphates (dATP, dGTP, (Continuous synthesis).
The other new strand is formed in small stretches (Okazaki
dCTP & TTP) act as substrate and also provide energy for
polymerization. fragments) in 53 direction (Discontinuous synthesis).
The Okazaki fragments are then joined together to form a
Firstly, a small RNA primer is synthesized in
presence of an enzyme, primase. new strand by an enzyme, DNA ligase. This new strand is
called lagging strand.
If a wrong base is introduced in the new strand, DNA
polymerase can do proof reading.
E. coli completes replication within 38 minutes. i.e. 2000
bp per second.
In eukaryotes, the replication of DNA takes place at S-
phase of the cell cycle. Failure in cell division after DNA
replication results in polyploidy.

TRANSCRIPTI
ON
- It is the process of copying genetic information from one Transcription Unit
strand of the DNA into RNA. - It is the segment of DNA between the sites of initiation
- Here, adenine pairs with uracil instead of thymine. and termination of transcription. It consists of 3 regions:
- Both strands are not copied during transcription, because A promoter (Transcription start site): Binding site
The code for proteins is different in both strands. This for RNA polymerase.
complicates the translation. Structural gene: The region between promoter and
If 2 RNA molecules are produced simultaneously this terminator where transcription takes place.
would be complimentary to each other, hence form a A terminator: The site where transcription stops.
double stranded RNA. This prevents translation. - The DNA- dependent RNA polymerase catalyzes the
polymerization only in 53direction.

3
triphosphates (ATP, GTP, UTP & CTP) are added. This is
complementary to the base sequence in the DNA template.
Termination: A termination factor ( factor) binds
to the RNA polymerase and terminates the transcription.
In bacteria (Prokaryotes) transcription and translation can
be coupled (Translation can begin before mRNA is fully
- 35 acts as template strand. 53 acts as coding strand. transcribed) because
3-ATGCATGCATGCATGCATGCATGC-5 template strand. 5- mRNA requires no processing to become active.
TACGTACGTACGTACGTACGTACG-3 coding strand.
Transcription and translation take place in the same
Transcription unit and gene compartment (no separation of cytosol and nucleus).
- Gene: Functional unit of inheritance. It is the DNA In eukaryotes, there are 2 additional complexities:
sequence coding for RNA molecule. 1. There are 3 RNA polymerases:
- Cistron: A segment of DNA coding for a polypeptide. RNA polymerase I: Transcribes rRNAs (28S, 18S &
- Structural gene in a transcription unit is 2 types: 5.8S).

Monocistronic structural genes (split genes): It is RNA polymerase II: Transcribes the
seen in eukaryotes. Here, the coding sequences
(expressed sequences or exons) are interrupted by heterogeneous nuclear RNA (hnRNA). It is the
introns (intervening sequences). precursor of mRNA.

Polycistronic structural genes: It is seen in RNA polymerase III: Transcribes tRNA, 5S rRNA
prokaryotes. Here, there are no split genes.
and snRNAs (small nuclear RNAs).
Steps of transcription in prokaryotes
2. The primary transcripts (hnRNA) contain both the exons

Initiation: Here, the enzyme RNA polymerase binds and introns and are non-functional. Hence introns have to be
at the promoter site of DNA. This causes the local unwinding removed. For this, it undergoes the following processes:
of the DNA double helix. An initiation factor ( factor)
present in RNA polymerase initiates the RNA synthesis. Splicing: From hnRNA introns are removed (by
the spliceosome) and exons are spliced (joined)

Elongation: The RNA chain is synthesized in the 5- together.


3 direction. In this process, activated ribonucleoside
Capping: Here, a nucleotide methyl guanosine
triphosphate (cap) is added to the 5 end of hnRNA.
Tailing (Polyadenylation): Here, adenylate
residues
(200-300) are added at 3-end. It is the fully processed
hnRNA, now called mRNA.

GENETIC
CODE

It is the sequence of nucleotides (nitrogen bases) in mRNA George Gamow: Suggested that for coding 20 amino
acids, the code should be made up of 3 nucleotides.
that contains information for protein synthesis (translation).
Har Gobind Khorana: Developed the chemical method
20 AMINO ACIDS INVOLVED IN in synthesizing RNA molecules with defined
TRANSLATION combinations of bases (homopolymers & copolymers).

Marshall Nirenberg: Developed cell-free system for
1. Alanine (Ala) 11. Leucine (Leu) protein synthesis.

2. Arginine (Arg) 12. Lysine (Lys) Severo Ochoa (polynucleotide phosphorylase) enzyme
is used to polymerize RNA with defined sequences in a
3. Asparagine (Asn) 13. Methionine (Met) template independent manner.
4. Aspartic acid (Asp) 14. Phenyl alanine (Phe) Salient features of genetic code
5. Cystein (Cys) 15. Proline (Pro) Triplet code (three-letter code).
6. Glutamine (Gln) 16. Serine (Ser) 61 codons code for amino acids. 3 codons (UAA,
7. Glutamic acid (Glu) 17. Threonine (Thr) UAG & UGA) do not code for any amino acids. They
8. Glycine (Gly) 18. Tryptophan (Trp) function as stop codons (Termination codons or non-sense
9. Histidine (His) 19. Tyrosine (Tyr)
codons).
10. Isoleucine (Ile) 20. Valine (Val)
Genetic code is universal. E.g. From bacteria to
The codons for the various amino human UUU codes for Phenylalanine. Some exceptions
acids are found in mitochondrial codons, and in some
protozoans.
No punctuations b/w adjacent codons (comma less
code). The codon is read in mRNA in a contiguous
fashion.
Genetic code is Non-overlapping.
A single amino acid is represented by many codons
(except AUG for methionine & UGG for tryptophan).
Such codons are called degenerate codons.
Genetic code is unambiguous and specific. i.e.
one codon specifies only one amino acid.

4
AUG has dual functions. It codes for Methionine tRNA- the adapter molecule
(met), and also acts as initiator codon. In eukaryotes, tRNA has
methionine is the first amino acid and formyl methionine An Anticodon (NODOC) loop that has bases
in prokaryotes. complementary to the code.
TYPES OF RNA An amino acid acceptor end to which amino acid
binds.
- mRNA (messenger RNA): Provide template for
translation (protein synthesis). - For initiation, there is another tRNA called initiator tRNA.
- rRNA (ribosomal RNA): Structural & catalytic role during - There are no tRNAs for stop codons.
translation. E.g. 23S rRNA in bacteria acts as ribozyme. - Secondary (2-D) structure of tRNA looks like a clover-
leaf. 3-D structure looks like inverted L.
- tRNA (transfer RNA or sRNA or soluble RNA): Brings
amino acids for protein synthesis and reads the genetic code.
TRANSLATION (PROTEIN
SYNTHESIS)
It takes place in ribosomes. Includes 4 steps anticodon binds to the second codon on the mRNA and a
1. Charging of tRNA (aminoacylation of peptide bond is formed between first and second amino
tRNA) acids in presence of an enzyme, peptidyl transferase.
Formation of peptide bond requires energy obtained from ATP. First amino acid and its tRNA are broken. This tRNA is
For this, amino acids are activated (amino acid + ATP) and removed from P site and second tRNA at the A site is pulled
linked to their cognate tRNA in the presence of aminoacyl to P site along with mRNA. This is called translocation.
tRNA synthetase. So the tRNA becomes charged. Then 3
rd
codon comes into A site and a suitable tRNA with
rd
2.Initiation 3 amino acid binds at the A site. This process is repeated.
It begins at the 5-end of mRNA in the presence of A group of ribosomes associated with a single mRNA for
an initiation factor. translation is called a polyribosome (polysomes).
The mRNA binds to the small subunit of ribosome. 4.Termination
Now the large subunit binds to the small subunit to When aminoacyl tRNA reaches the termination codon like
complete the initiation complex. UAA, UAG & UGA, the termination of translation occurs.
Large subunit has 2 binding sites for tRNA- The polypeptide and tRNA are released from the ribosomes.
aminoacyl tRNA binding site (A site) and peptidyl site The ribosome dissociates into large and small subunits at
(P site). the end of protein synthesis.
Initiation codon for methionine is AUG. So An mRNA has additional sequences that are not translated
methionyl tRNA complex would have UAC at the (untranslated regions or UTR). UTRs are present at both
Anticodon site. 5-end (before start codon) and 3-end (after stop codon).
3.Elongation They are required for efficient translation process.
At the P site the first codon of mRNA binds with
anticodon of methionyl tRNA complex.
Another aminoacyl tRNA complex with an
appropriate amino acid enters the ribosome and attaches
to A site. Its

REGULATION OF GENE
EXPRESSION

Gene expression results in the formation of a polypeptide. When a substrate is added to growth medium of bacteria,
In eukaryotes, the regulation includes the following levels: a set of genes is switched on to metabolize it. This is
called induction.
1. Transcriptional level (formation of primary transcript)
When a metabolite (product) is added, the genes to produce
it are turned off. This is called repression.
2. Processing level (regulation of splicing)
Lac operon in E. coli: The operon controlling lactose
3. Transport of mRNA from nucleus to the cytoplasm metabolism. It consists of
4. Translational level. a) A regulatory or inhibitor (i) gene: Codes for the repressor.
The metabolic, physiological and environmental conditions b) 3 structural genes:
regulate expression of genes. E.g.

i. z gene: Codes for galactosidase (hydrolyze lactose


In E. coli the enzyme, beta-galactosidase hydrolyses
lactose into galactose and glucose. In the absence of to galactose and glucose).
lactose, the synthesis of beta-galactosidase stops. ii. y gene: Codes for permease (increase permeability of

The development and differentiation of embryo into adult


are a result of the expression of several set of genes. the cell to lactose).
OPERON CONCEPT iii. a gene: Codes for a transacetylase.

Each metabolic reaction is controlled by a set of genes - The genes present in the operon function together in the

All the genes regulating a metabolic reaction constitute an


same or related metabolic pathway. There is an operator
Operon. E.g. lac operon, trp operon, ara operon, his
region for each operon.
operon, val operon etc.
- If there is no lactose (inducer), Lac operon remains
switched off. The regulator gene synthesizes mRNA to

5
produce the repressor protein; this protein binds to the So repressor protein cannot bind to operator gene. The
operator genes and blocks RNA polymerase movement. operator gene becomes free and induces the RNA
So the structural genes are not expressed. polymerase to bind with promoter gene. Then
- If lactose is provided in the growth medium, the lactose is transcription starts. Regulation of lac operon by repressor
transported into the E. coli cells by the action of is called negative regulation.
permease. Lactose (inducer) binds with repressor protein.
In the absence of inducer: In the presence of inducer:

HUMAN GENOME PROJECT


(HGP)
The entire DNA in the haploid set of chromosome amplification Fragments are sequenced using Automated
of an organism is called a Genome. DNA sequencers (using Frederick Sanger method)
In Human genome, DNA is packed in 23 Sequences are arranged based on overlapping regions
chromosomes. Alignment of sequences using computer programs
Human Genome Project (1990-2003) is the first
Genetic and physical maps on the genome were generated
effort in identifying the sequence of nucleotides and
using information on polymorphism of restriction
mapping of all the genes in human genome.
9
endonuclease recognition sites and some repetitive DNA
Human genome contains about 3x10 bp. sequences (microsatellites).
Goals of HGP
Salient features of Human Genome
a. Identify all the estimated genes in human DNA
a. Human genome contains 3164.7 million nucleotide bases.
b. Determine the sequences of the 3 billion chemical base
b. Total number of genes= about 30,000.
pairs that make up human DNA.
c. Average gene consists of 3000 bases, but sizes vary.
c. Store this information in databases.
Largest known human gene (dystrophin on X-
d. Improve tools for data analysis.
chromosome) contains 2.4 million bases.
e. Transfer related technologies to other sectors.
d. 99.9% nucleotide bases are identical in all people. 0.1%
f. Address the ethical, legal and social issues (ELSI) that
is what makes each of us unique.
may arise from the project.
e. Functions of over 50% of discovered genes are unknown.
HGP was closely associated with Bioinformatics. f. Chromosome I has most genes (2968) and Y has the
Bioinformatics: Application of computer science and fewest (231).
information technology to the field of biology & medicine. g. Less than 2% of the genome codes for proteins.
Usually applies in analyzing DNA sequence data. h. Repeated sequences make up very large portion of
Methodologies of HGP: 2 major approaches. human genome. Repetitive sequences are stretches of
DNA sequences that are repeated many times. They have
Expressed Sequence Tags (ESTs): Focused on
identifying all the genes that are expressed as RNA. no direct coding functions, but they shed light on
chromosome structure, dynamics and evolution.
Sequence annotation: Sequencing whole set of
genome containing all the coding & non-coding sequence i. About 1.4 million locations where single-base DNA
and later assigning different regions in the sequence with differences (SNPs- Single nucleotide polymorphism or
functions.
snips) occur in humans.
Procedure:
Isolate total DNA from a cell Convert into random
fragments Clone in suitable host (e.g. BAC & YAC) for

DNA FINGERPRINTING (DNA


PROFILING)
It is the technique to identify the similarities of the DNA Number of repeats is specific from person to person.
fragments of 2 individuals. The size of VNTR varies from 0.1 to 20 kb.
Developed by Alec Jeffreys (1985). Repetitive DNA are separated from bulk genomic DNA
Basis of DNA fingerprinting as different peaks during density gradient centrifugation.
DNA carries some non-coding sequences called repetitive The bulk DNA forms a major peak and the other small
sequence [variable number tandem repeats (VNTR)]. peaks are called as satellite DNA.
6
Satellite DNA is classified into many categories, d. Separate DNA fragments by gel electrophoresis.
(micro-satellites, mini-satellites etc) based on base e. Treat with alkali solution (NaOH) to denature DNA
composition (A:T rich or G:C rich), length of segment bonds in the gel into single strands.
and number of repetitive units. f. Transfer (blotting) single stranded DNA fragments to
An inheritable mutation observed in a population at high synthetic membranes such as nitrocellulose or nylon,
o
frequency is called DNA polymorphism (variation at and then baked in a vacuum oven at 80 C for 3-5 hours
genetic level). (to fix the DNA fragment on the membrane).
Polymorphism is higher in non-coding DNA sequence. g. Nitrocellulose filter paper is placed in a solution
Because mutations in these sequences may not have any containing radioactive labeled single stranded DNA
immediate effect in an individuals reproductive ability. probe. The DNA probe binds with the complimentary
These mutations accumulate generation after generation sequences of the DNA fragment on the membrane to
and cause polymorphism. For evolution & speciation, form a hybridized DNA.
polymorphisms play important role. h. The filter paper is washed to remove unbound probe.
Steps of DNA i. The hybridized DNA is photographed on to an X-ray
fingerprinting (Southern film by autoradiography. The image (in the form of
Blotting Technique) dark & light bands) obtained is called DNA fingerprint.
a. Isolate DNA (from any cells like blood stains, semen Application of DNA fingerprinting
stains or hair roots). Forensic tool to solve paternity, rape, murder etc.
b. Make copies (amplification) of DNA by polymerase For the diagnosis of genetic diseases.
chain reaction (PCR). To determine phylogenetic status of animals.
c. Digest DNA by restriction endonucleases.

Model questions
1. Analogy type questions.
a. DNA: Thymine and cytosine RNA:
b. UGG: Tryptophan AUG:
2. The percentage of adenosine phosphate in DNA isolated from human liver is observed to be
30.7%. What is the
expected percentage of four
nitrogen bases? 3. Schematically
represent Griffiths experiment.
4. Analyze the following diagram

a. Identify and copy the diagram


b. Label A,B &C
c. Mention the advantage of this arrangement.

5. Analyse the below flowchart which represent the central dogma of molecular biology, and
answer the following
A B Protein
DNA RNA s
a. Mention the processes represented by the letters A and B
b. How the central dogma is modified with discovery of reverse transcriptase?
6. Find odd one and give reason: UAA, AUG, UAG, UGA
7. Protein synthesis will fail in the absence of tRNA molecule. Justify this statement.
8. If the coding region of a gene is estimated to consist of 450 nucleotide base pairs.
a. How many amino acids would the corresponding polypeptide chain contain?
b. Justify your answer.
9. Given below is the DNA sequence, representing a part of the gene. Analyse this and answer the
following questions.
5 ATGGGGGTGCTCAATATATGCCCC CGT AGTTAA 3
3 TACCCC CAC GAGTTATATACGGGGGCATCAATT 5
a. Construct the mRNA molecule which will be transcribed from this DNA sequence.
b. Make a processed mRNA (assuming that all the codons containing a C represent the
intron DNA).
c. How many amino acid residues will make up the polypeptide corresponding to this
processed mRNA?
d. In a sample of DNA 14% of the nucleotides contained cytosine. What will be the % of
adenine?
10. Observe the diagrammatic representation of the lac operon given below and
answer the questions. (see the second diagram of lac operon)
a. What is the inducer in lac operon? b. How does it ensure the switching-on of genes?
11. Draw a flowchart of steps involved in DNA fingerprinting.